Metallothionein-1A

Details

Name
Metallothionein-1A
Synonyms
  • Metallothionein-IA
  • MT-1A
  • MT-IA
  • MT1S
Gene Name
MT1A
Organism
Humans
Amino acid sequence
>lcl|BSEQ0013312|Metallothionein-1A
MDPNCSCATGGSCTCTGSCKCKECKCTSCKKSCCSCCPMSCAKCAQGCICKGASEKCSCC
A
Number of residues
61
Molecular Weight
6120.19
Theoretical pI
Not Available
GO Classification
Functions
zinc ion binding
Processes
cellular response to cadmium ion / cellular response to zinc ion / negative regulation of growth
Components
cytoplasm / nucleus / perinuclear region of cytoplasm
General Function
Zinc ion binding
Specific Function
Metallothioneins have a high content of cysteine residues that bind various heavy metals; these proteins are transcriptionally regulated by both heavy metals and glucocorticoids.
Pfam Domain Function
Transmembrane Regions
Not Available
Cellular Location
Not Available
Gene sequence
>lcl|BSEQ0013313|Metallothionein-1A (MT1A)
ATGGACCCCAACTGCTCCTGCGCCACTGGTGGCTCCTGCACCTGCACTGGCTCCTGCAAA
TGCAAAGAGTGCAAATGCACCTCCTGCAAGAAGAGCTGCTGCTCCTGCTGCCCCATGAGC
TGTGCCAAGTGTGCCCAGGGCTGCATCTGCAAAGGGGCATCAGAGAAGTGCAGCTGCTGT
GCCTGA
Chromosome Location
16
Locus
Not Available
External Identifiers
ResourceLink
UniProtKB IDP04731
UniProtKB Entry NameMT1A_HUMAN
HGNC IDHGNC:7393
General References
  1. Richards RI, Heguy A, Karin M: Structural and functional analysis of the human metallothionein-IA gene: differential induction by metal ions and glucocorticoids. Cell. 1984 May;37(1):263-72. [Article]
  2. Martin J, Han C, Gordon LA, Terry A, Prabhakar S, She X, Xie G, Hellsten U, Chan YM, Altherr M, Couronne O, Aerts A, Bajorek E, Black S, Blumer H, Branscomb E, Brown NC, Bruno WJ, Buckingham JM, Callen DF, Campbell CS, Campbell ML, Campbell EW, Caoile C, Challacombe JF, Chasteen LA, Chertkov O, Chi HC, Christensen M, Clark LM, Cohn JD, Denys M, Detter JC, Dickson M, Dimitrijevic-Bussod M, Escobar J, Fawcett JJ, Flowers D, Fotopulos D, Glavina T, Gomez M, Gonzales E, Goodstein D, Goodwin LA, Grady DL, Grigoriev I, Groza M, Hammon N, Hawkins T, Haydu L, Hildebrand CE, Huang W, Israni S, Jett J, Jewett PB, Kadner K, Kimball H, Kobayashi A, Krawczyk MC, Leyba T, Longmire JL, Lopez F, Lou Y, Lowry S, Ludeman T, Manohar CF, Mark GA, McMurray KL, Meincke LJ, Morgan J, Moyzis RK, Mundt MO, Munk AC, Nandkeshwar RD, Pitluck S, Pollard M, Predki P, Parson-Quintana B, Ramirez L, Rash S, Retterer J, Ricke DO, Robinson DL, Rodriguez A, Salamov A, Saunders EH, Scott D, Shough T, Stallings RL, Stalvey M, Sutherland RD, Tapia R, Tesmer JG, Thayer N, Thompson LS, Tice H, Torney DC, Tran-Gyamfi M, Tsai M, Ulanovsky LE, Ustaszewska A, Vo N, White PS, Williams AL, Wills PL, Wu JR, Wu K, Yang J, Dejong P, Bruce D, Doggett NA, Deaven L, Schmutz J, Grimwood J, Richardson P, Rokhsar DS, Eichler EE, Gilna P, Lucas SM, Myers RM, Rubin EM, Pennacchio LA: The sequence and analysis of duplication-rich human chromosome 16. Nature. 2004 Dec 23;432(7020):988-94. [Article]
  3. Gerhard DS, Wagner L, Feingold EA, Shenmen CM, Grouse LH, Schuler G, Klein SL, Old S, Rasooly R, Good P, Guyer M, Peck AM, Derge JG, Lipman D, Collins FS, Jang W, Sherry S, Feolo M, Misquitta L, Lee E, Rotmistrovsky K, Greenhut SF, Schaefer CF, Buetow K, Bonner TI, Haussler D, Kent J, Kiekhaus M, Furey T, Brent M, Prange C, Schreiber K, Shapiro N, Bhat NK, Hopkins RF, Hsie F, Driscoll T, Soares MB, Casavant TL, Scheetz TE, Brown-stein MJ, Usdin TB, Toshiyuki S, Carninci P, Piao Y, Dudekula DB, Ko MS, Kawakami K, Suzuki Y, Sugano S, Gruber CE, Smith MR, Simmons B, Moore T, Waterman R, Johnson SL, Ruan Y, Wei CL, Mathavan S, Gunaratne PH, Wu J, Garcia AM, Hulyk SW, Fuh E, Yuan Y, Sneed A, Kowis C, Hodgson A, Muzny DM, McPherson J, Gibbs RA, Fahey J, Helton E, Ketteman M, Madan A, Rodrigues S, Sanchez A, Whiting M, Madari A, Young AC, Wetherby KD, Granite SJ, Kwong PN, Brinkley CP, Pearson RL, Bouffard GG, Blakesly RW, Green ED, Dickson MC, Rodriguez AC, Grimwood J, Schmutz J, Myers RM, Butterfield YS, Griffith M, Griffith OL, Krzywinski MI, Liao N, Morin R, Palmquist D, Petrescu AS, Skalska U, Smailus DE, Stott JM, Schnerch A, Schein JE, Jones SJ, Holt RA, Baross A, Marra MA, Clifton S, Makowski KA, Bosak S, Malek J: The status, quality, and expansion of the NIH full-length cDNA project: the Mammalian Gene Collection (MGC). Genome Res. 2004 Oct;14(10B):2121-7. [Article]

Drug Relations

Drug Relations
DrugBank IDNameDrug groupPharmacological action?ActionsDetails
DB00515CisplatinapprovedunknownsubstrateDetails
DB00958CarboplatinapprovedunknownsubstrateDetails
DB00526Oxaliplatinapproved, investigationalnosubstrateDetails
DB00435Nitric OxideapprovedunknownDetails
DB01593Zincapproved, investigationalunknownDetails
DB14487Zinc acetateapproved, investigationalunknownDetails
DB14533Zinc chlorideapproved, investigationalunknownbinderDetails
DB14548Zinc sulfate, unspecified formapproved, experimentalunknownbinderDetails
DB09130Copperapproved, investigationalnobinderDetails
DB12965Silverapproved, investigationalunknownbinderDetails