RET proto-oncogene

Details

Name
RET proto-oncogene
Synonyms
  • Fragment
Gene Name
RET
Organism
Human
Amino acid sequence
>lcl|BSEQ0010772|RET proto-oncogene
GEGDVRCRGAASAVAAAAAAARQ
Number of residues
23
Molecular Weight
2129.3
Theoretical pI
8.55
GO Classification
Not Available
General Function
Not Available
Specific Function
Not Available
Pfam Domain Function
Not Available
Transmembrane Regions
Not Available
Cellular Location
Not Available
Gene sequence
>lcl|BSEQ0002196|73 bp
ATGGCGAAGGCGACGTCCGGTGCCGCGGGGCTGCGTCTGCTGTTGCTGCTGCTGCTGCCG
CTGCTAGGCAAAG
Chromosome Location
Not Available
Locus
10q11.2
External Identifiers
ResourceLink
UniProtKB IDO43519
UniProtKB Entry NameO43519_HUMAN
GenBank Protein ID2795880
GenBank Gene IDAF032124
GenAtlas IDRET
General References
Not Available

Drug Relations

Drug Relations
DrugBank IDNameDrug groupPharmacological action?ActionsDetails
DB00619ImatinibapprovedyesinhibitorDetails
DB05014XL999investigationalunknownDetails