You are using an unsupported browser. Please upgrade your browser to a newer version to get the best experience on DrugBank.
Accession NumberDB00049  (BTD00090, BIOD00090)
GroupsApproved, Investigational
DescriptionRasburicase is a recombinant urate-oxidase enzyme produced by a genetically modified Saccharomyces cerevisiae strain. The cDNA coding for rasburicase was cloned from a strain of Aspergillus flavus.
Protein structureDb00049
Related Articles
Protein chemical formulaC1521H2381N417O461S7
Protein average weight34109.5 Da
>DB00049 sequence
Download FASTA Format
Urate oxidase
External IDs Not Available
Product Ingredients Not Available
Approved Prescription Products
NameDosageStrengthRouteLabellerMarketing StartMarketing End
ElitekKitSanofi Aventis2002-07-12Not applicableUs
ElitekKitSanofi Aventis2006-06-01Not applicableUs
FasturtecInjection, powder, for solution1.5 mg/mlIntravenousSanofi Aventis Groupe  2001-02-23Not applicableEu
FasturtecPowder, for solution1.5 mgIntravenousSanofi Aventis2004-09-21Not applicableCanada
FasturtecPowder, for solution7.5 mgIntravenousSanofi AventisNot applicableNot applicableCanada
FasturtecInjection, powder, for solution1.5 mg/mlIntravenousSanofi Aventis Groupe  2001-02-23Not applicableEu
Approved Generic Prescription ProductsNot Available
Approved Over the Counter ProductsNot Available
Unapproved/Other Products Not Available
International BrandsNot Available
Brand mixturesNot Available
CAS number134774-45-1
IndicationFor treatment of hyperuricemia, reduces elevated plasma uric acid levels (from chemotherapy)
Structured Indications
PharmacodynamicsDrugs used to treat lympohoid leukemia, non-Hodgkin's lymphoma and acute myelogenous leukemia often lead to the accumulation of toxic plasma levels of purine metabolites (i.e. uric acid). The injection of rasburicase reduces levels of uric acid and mitigates the toxic effects of chemotherapy induced tumor lysis.
Mechanism of actionRasburicase catalyzes enzymatic oxidation of uric acid into an inactive and soluble metabolite (allantoin).
TargetKindPharmacological actionActionsOrganismUniProt ID
Uric acidSmall moleculeyes
Humannot applicabledetails
Related Articles
AbsorptionNot Available
Volume of distribution
  • 110 to 127 mL/kg [pediatric patients]
  • 75.8 to 138 mL/kg [adult patients]
Protein bindingNot Available
MetabolismNot Available
Route of eliminationNot Available
Half life18 hours
ClearanceNot Available
ToxicityNot Available
Affected organisms
  • Humans and other mammals
PathwaysNot Available
Pharmacogenomic Effects/ADRs
Interacting Gene/EnzymeSNP RS IDsAllele nameGenotypeDefining ChangeType(s)DescriptionDetails
Glucose-6-phosphate 1-dehydrogenaseNot AvailableVilleurbanne---1000_1002delACCADR InferredAcute hemolytic anemia. Details
Glucose-6-phosphate 1-dehydrogenaseNot AvailableTorun---1006A->GADR InferredAcute hemolytic anemia. Details
Glucose-6-phosphate 1-dehydrogenaseNot AvailableSunderland---105_107delCATADR InferredAcute hemolytic anemia. Details
Glucose-6-phosphate 1-dehydrogenaseNot AvailableIwatsuki---1081G->AADR InferredAcute hemolytic anemia. Details
Glucose-6-phosphate 1-dehydrogenaseNot AvailableSerres---1082C->TADR InferredAcute hemolytic anemia. Details
Glucose-6-phosphate 1-dehydrogenaseNot AvailableTondela---1084_1101delCTGAACGAGCGCAAGGCCADR InferredAcute hemolytic anemia. Details
Glucose-6-phosphate 1-dehydrogenaseNot AvailableLoma Linda---1089C->AADR InferredAcute hemolytic anemia. Details
Glucose-6-phosphate 1-dehydrogenaseNot AvailableAachen---1089C->GADR InferredAcute hemolytic anemia. Details
Glucose-6-phosphate 1-dehydrogenaseNot AvailableTenri---1096A->GADR InferredAcute hemolytic anemia. Details
Glucose-6-phosphate 1-dehydrogenaseNot AvailableMontpellier---1132G>AADR InferredAcute hemolytic anemia. Details
Glucose-6-phosphate 1-dehydrogenaseNot AvailableCalvo Mackenna---1138A->GADR InferredAcute hemolytic anemia. Details
Glucose-6-phosphate 1-dehydrogenaseNot AvailableRiley---1139T->CADR InferredAcute hemolytic anemia. Details
Glucose-6-phosphate 1-dehydrogenaseNot AvailableOlomouc---1141T->CADR InferredAcute hemolytic anemia. Details
Glucose-6-phosphate 1-dehydrogenaseNot AvailableTomah---1153T->CADR InferredAcute hemolytic anemia. Details
Glucose-6-phosphate 1-dehydrogenaseNot AvailableLynwood---1154G->TADR InferredAcute hemolytic anemia. Details
Glucose-6-phosphate 1-dehydrogenaseNot AvailableMadrid---1155C->GADR InferredAcute hemolytic anemia. Details
Glucose-6-phosphate 1-dehydrogenaseNot AvailableIowa, Walter Reed, Springfield---1156A->GADR InferredAcute hemolytic anemia. Details
Glucose-6-phosphate 1-dehydrogenaseNot AvailableBeverly Hills, Genova, Iwate, Niigata, Yamaguchi---1160G->AADR InferredAcute hemolytic anemia. Details
Glucose-6-phosphate 1-dehydrogenaseNot AvailableHartford---1162A->GADR InferredAcute hemolytic anemia. Details
Glucose-6-phosphate 1-dehydrogenaseNot AvailablePraha---1166A->GADR InferredAcute hemolytic anemia. Details
Glucose-6-phosphate 1-dehydrogenaseNot AvailableKrakow---1175T>CADR InferredAcute hemolytic anemia. Details
Glucose-6-phosphate 1-dehydrogenaseNot AvailableWisconsin---1177C->GADR InferredAcute hemolytic anemia. Details
Glucose-6-phosphate 1-dehydrogenaseNot AvailableNashville, Anaheim, Portici---1178G->AADR InferredAcute hemolytic anemia. Details
Glucose-6-phosphate 1-dehydrogenaseNot AvailableAlhambra---1180G->CADR InferredAcute hemolytic anemia. Details
Glucose-6-phosphate 1-dehydrogenaseNot AvailableBari---1187C->TADR InferredAcute hemolytic anemia. Details
Glucose-6-phosphate 1-dehydrogenaseNot AvailablePuerto Limon---1192G->AADR InferredAcute hemolytic anemia. Details
Glucose-6-phosphate 1-dehydrogenaseNot AvailableCovao do Lobo---1205C>AADR InferredAcute hemolytic anemia. Details
Glucose-6-phosphate 1-dehydrogenaseNot AvailableClinic---1215G->AADR InferredAcute hemolytic anemia. Details
Glucose-6-phosphate 1-dehydrogenaseNot AvailableUtrecht---1225C->TADR InferredAcute hemolytic anemia. Details
Glucose-6-phosphate 1-dehydrogenaseNot AvailableSuwalki---1226C->GADR InferredAcute hemolytic anemia. Details
Glucose-6-phosphate 1-dehydrogenaseNot AvailableRiverside---1228G->TADR InferredAcute hemolytic anemia. Details
Glucose-6-phosphate 1-dehydrogenaseNot AvailableJapan, Shinagawa---1229G->AADR InferredAcute hemolytic anemia. Details
Glucose-6-phosphate 1-dehydrogenaseNot AvailableKawasaki---1229G->CADR InferredAcute hemolytic anemia. Details
Glucose-6-phosphate 1-dehydrogenaseNot AvailableMunich---1231A->GADR InferredAcute hemolytic anemia. Details
Glucose-6-phosphate 1-dehydrogenaseNot AvailableGeorgia---1284C->AADR InferredAcute hemolytic anemia. Details
Glucose-6-phosphate 1-dehydrogenaseNot AvailableSumare---1292T->GADR InferredAcute hemolytic anemia. Details
Glucose-6-phosphate 1-dehydrogenaseNot AvailableTelti/Kobe---1318C->TADR InferredAcute hemolytic anemia. Details
Glucose-6-phosphate 1-dehydrogenaseNot AvailableSantiago de Cuba, Morioka---1339G->AADR InferredAcute hemolytic anemia. Details
Glucose-6-phosphate 1-dehydrogenaseNot AvailableHarima---1358T->AADR InferredAcute hemolytic anemia. Details
Glucose-6-phosphate 1-dehydrogenaseNot AvailableFiguera da Foz---1366G->CADR InferredAcute hemolytic anemia. Details
Glucose-6-phosphate 1-dehydrogenaseNot AvailableAmiens---1367A>TADR InferredAcute hemolytic anemia. Details
Glucose-6-phosphate 1-dehydrogenaseNot AvailableBangkok Noi---1376G->T, 1502T->GADR InferredAcute hemolytic anemia. Details
Glucose-6-phosphate 1-dehydrogenaseNot AvailableFukaya---1462G->AADR InferredAcute hemolytic anemia. Details
Glucose-6-phosphate 1-dehydrogenaseNot AvailableCampinas---1463G->TADR InferredAcute hemolytic anemia. Details
Glucose-6-phosphate 1-dehydrogenaseNot AvailableBuenos Aires---1465C>TADR InferredAcute hemolytic anemia. Details
Glucose-6-phosphate 1-dehydrogenaseNot AvailableArakawa---1466C->TADR InferredAcute hemolytic anemia. Details
Glucose-6-phosphate 1-dehydrogenaseNot AvailableBrighton---1488_1490delGAAADR InferredAcute hemolytic anemia. Details
Glucose-6-phosphate 1-dehydrogenaseNot AvailableKozukata---159G->CADR InferredAcute hemolytic anemia. Details
Glucose-6-phosphate 1-dehydrogenaseNot AvailableAmsterdam---180_182delTCTADR InferredAcute hemolytic anemia. Details
Glucose-6-phosphate 1-dehydrogenaseNot AvailableNo name---202G->A, 376A->G, 1264C>GADR InferredAcute hemolytic anemia. Details
Glucose-6-phosphate 1-dehydrogenaseNot AvailableSwansea---224T->CADR InferredAcute hemolytic anemia. Details
Glucose-6-phosphate 1-dehydrogenaseNot AvailableUrayasu---281_283delAGAADR InferredAcute hemolytic anemia. Details
Glucose-6-phosphate 1-dehydrogenaseNot AvailableVancouver---317C->G544C->T592C->TADR InferredAcute hemolytic anemia. Details
Glucose-6-phosphate 1-dehydrogenaseNot AvailableMt Sinai---376A->G, 1159C->TADR InferredAcute hemolytic anemia. Details
Glucose-6-phosphate 1-dehydrogenaseNot AvailablePlymouth---488G->AADR InferredAcute hemolytic anemia. Details
Glucose-6-phosphate 1-dehydrogenaseNot AvailableVolendam---514C->TADR InferredAcute hemolytic anemia. Details
Glucose-6-phosphate 1-dehydrogenaseNot AvailableShinshu---527A->GADR InferredAcute hemolytic anemia. Details
Glucose-6-phosphate 1-dehydrogenaseNot AvailableChikugo---535A->TADR InferredAcute hemolytic anemia. Details
Glucose-6-phosphate 1-dehydrogenaseNot AvailableTsukui---561_563delCTCADR InferredAcute hemolytic anemia. Details
Glucose-6-phosphate 1-dehydrogenaseNot AvailablePedoplis-Ckaro---573C>GADR InferredAcute hemolytic anemia. Details
Glucose-6-phosphate 1-dehydrogenaseNot AvailableSantiago---593G->CADR InferredAcute hemolytic anemia. Details
Glucose-6-phosphate 1-dehydrogenaseNot AvailableMinnesota, Marion, Gastonia, LeJeune---637G->TADR InferredAcute hemolytic anemia. Details
Glucose-6-phosphate 1-dehydrogenaseNot AvailableCincinnati---637G->T, 1037A->TADR InferredAcute hemolytic anemia. Details
Glucose-6-phosphate 1-dehydrogenaseNot AvailableHarilaou---648T->GADR InferredAcute hemolytic anemia. Details
Glucose-6-phosphate 1-dehydrogenaseNot AvailableNorth Dallas---683_685delACAADR InferredAcute hemolytic anemia. Details
Glucose-6-phosphate 1-dehydrogenaseNot AvailableAsahikawa---695G->AADR InferredAcute hemolytic anemia. Details
Glucose-6-phosphate 1-dehydrogenaseNot AvailableDurham---713A->GADR InferredAcute hemolytic anemia. Details
Glucose-6-phosphate 1-dehydrogenaseNot AvailableStonybrook---724_729delGGCACTADR InferredAcute hemolytic anemia. Details
Glucose-6-phosphate 1-dehydrogenaseNot AvailableWayne---769C->GADR InferredAcute hemolytic anemia. Details
Glucose-6-phosphate 1-dehydrogenaseNot AvailableAveiro---806G->AADR InferredAcute hemolytic anemia. Details
Glucose-6-phosphate 1-dehydrogenaseNot AvailableCleveland Corum---820G->AADR InferredAcute hemolytic anemia. Details
Glucose-6-phosphate 1-dehydrogenaseNot AvailableLille---821A>TADR InferredAcute hemolytic anemia. Details
Glucose-6-phosphate 1-dehydrogenaseNot AvailableBangkok---825G>CADR InferredAcute hemolytic anemia. Details
Glucose-6-phosphate 1-dehydrogenaseNot AvailableSugao---826C->TADR InferredAcute hemolytic anemia. Details
Glucose-6-phosphate 1-dehydrogenaseNot AvailableLa Jolla---832T->CADR InferredAcute hemolytic anemia. Details
Glucose-6-phosphate 1-dehydrogenaseNot AvailableWexham---833C->TADR InferredAcute hemolytic anemia. Details
Glucose-6-phosphate 1-dehydrogenaseNot AvailablePiotrkow---851T>CADR InferredAcute hemolytic anemia. Details
Glucose-6-phosphate 1-dehydrogenaseNot AvailableWest Virginia---910G->TADR InferredAcute hemolytic anemia. Details
Glucose-6-phosphate 1-dehydrogenaseNot AvailableOmiya---921G->CADR InferredAcute hemolytic anemia. Details
Glucose-6-phosphate 1-dehydrogenaseNot AvailableNara---953_976delCCACCAAAGGGTACCTGGAC GACCADR InferredAcute hemolytic anemia. Details
Glucose-6-phosphate 1-dehydrogenaseNot AvailableManhattan---962G->AADR InferredAcute hemolytic anemia. Details
Glucose-6-phosphate 1-dehydrogenaseNot AvailableRehevot---964T->CADR InferredAcute hemolytic anemia. Details
Glucose-6-phosphate 1-dehydrogenaseNot AvailableHoniara---99A->G, 1360C->TADR InferredAcute hemolytic anemia. Details
Glucose-6-phosphate 1-dehydrogenaseNot AvailableTokyo, Fukushima---1246G->AADR InferredAcute hemolytic anemia. Details
Glucose-6-phosphate 1-dehydrogenaseNot AvailableChatham---1003G->AADR InferredAcute hemolytic anemia. Details
Glucose-6-phosphate 1-dehydrogenaseNot AvailableFushan---1004C->AADR InferredAcute hemolytic anemia. Details
Glucose-6-phosphate 1-dehydrogenaseNot AvailablePartenope---1052G->TADR InferredAcute hemolytic anemia. Details
Glucose-6-phosphate 1-dehydrogenaseNot AvailableIerapetra---1057C->TADR InferredAcute hemolytic anemia. Details
Glucose-6-phosphate 1-dehydrogenaseNot AvailableAnadia---1193A->GADR InferredAcute hemolytic anemia. Details
Glucose-6-phosphate 1-dehydrogenaseNot AvailableAbeno---1220A->CADR InferredAcute hemolytic anemia. Details
Glucose-6-phosphate 1-dehydrogenaseNot AvailableSurabaya---1291G->AADR InferredAcute hemolytic anemia. Details
Glucose-6-phosphate 1-dehydrogenaseNot AvailablePawnee---1316G->CADR InferredAcute hemolytic anemia. Details
Glucose-6-phosphate 1-dehydrogenaseNot AvailableS. Antioco---1342A->GADR InferredAcute hemolytic anemia. Details
Glucose-6-phosphate 1-dehydrogenaseNot AvailableCassano---1347G->CADR InferredAcute hemolytic anemia. Details
Glucose-6-phosphate 1-dehydrogenaseNot AvailableHermoupolis---1347G->C, 1360C->TADR InferredAcute hemolytic anemia. Details
Glucose-6-phosphate 1-dehydrogenaseNot AvailableUnion,Maewo, Chinese-2, Kalo---1360C->TADR InferredAcute hemolytic anemia. Details
Glucose-6-phosphate 1-dehydrogenaseNot AvailableAndalus---1361G->AADR InferredAcute hemolytic anemia. Details
Glucose-6-phosphate 1-dehydrogenaseNot AvailableCosenza---1376G->CADR InferredAcute hemolytic anemia. Details
Glucose-6-phosphate 1-dehydrogenaseNot AvailableCanton, Taiwan- Hakka, Gifu-like, Agrigento-like---1376G->TADR InferredAcute hemolytic anemia. Details
Glucose-6-phosphate 1-dehydrogenaseNot AvailableFlores---1387C->AADR InferredAcute hemolytic anemia. Details
Glucose-6-phosphate 1-dehydrogenaseNot AvailableKaiping, Anant, Dhon, Sapporo-like, Wosera---1388G->AADR InferredAcute hemolytic anemia. Details
Glucose-6-phosphate 1-dehydrogenaseNot AvailableKamogawa---169C->TADR InferredAcute hemolytic anemia. Details
Glucose-6-phosphate 1-dehydrogenaseNot AvailableCostanzo---179T>CADR InferredAcute hemolytic anemia. Details
Glucose-6-phosphate 1-dehydrogenaseNot AvailableAmazonia---185C->AADR InferredAcute hemolytic anemia. Details
Glucose-6-phosphate 1-dehydrogenaseNot AvailableSongklanagarind---196T->AADR InferredAcute hemolytic anemia. Details
Glucose-6-phosphate 1-dehydrogenaseNot AvailableHechi---202G->A, 871G->AADR InferredAcute hemolytic anemia. Details
Glucose-6-phosphate 1-dehydrogenaseNot AvailableNamouru---208T->CADR InferredAcute hemolytic anemia. Details
Glucose-6-phosphate 1-dehydrogenaseNot AvailableBao Loc---352T>CADR InferredAcute hemolytic anemia. Details
Glucose-6-phosphate 1-dehydrogenaseNot AvailableCrispim---375G->T, 379G->T383T->C384C>TADR InferredAcute hemolytic anemia. Details
Glucose-6-phosphate 1-dehydrogenaseNot AvailableAcrokorinthos---376A->G, 463C->GADR InferredAcute hemolytic anemia. Details
Glucose-6-phosphate 1-dehydrogenaseNot AvailableSanta Maria---376A->G, 542A->TADR InferredAcute hemolytic anemia. Details
Glucose-6-phosphate 1-dehydrogenaseNot AvailableAnanindeua---376A->G, 871G->AADR InferredAcute hemolytic anemia. Details
Glucose-6-phosphate 1-dehydrogenaseNot AvailableVanua Lava---383T->CADR InferredAcute hemolytic anemia. Details
Glucose-6-phosphate 1-dehydrogenaseNot AvailableValladolid---406C->TADR InferredAcute hemolytic anemia. Details
Glucose-6-phosphate 1-dehydrogenaseNot AvailableBelem---409C->TADR InferredAcute hemolytic anemia. Details
Glucose-6-phosphate 1-dehydrogenaseNot AvailableLiuzhou---442G->AADR InferredAcute hemolytic anemia. Details
Glucose-6-phosphate 1-dehydrogenaseNot AvailableShenzen---473G>AADR InferredAcute hemolytic anemia. Details
Glucose-6-phosphate 1-dehydrogenaseNot AvailableTaipei “Chinese- 3”---493A->GADR InferredAcute hemolytic anemia. Details
Glucose-6-phosphate 1-dehydrogenaseNot AvailableToledo---496C>TADR InferredAcute hemolytic anemia. Details
Glucose-6-phosphate 1-dehydrogenaseNot AvailableNaone---497G->AADR InferredAcute hemolytic anemia. Details
Glucose-6-phosphate 1-dehydrogenaseNot AvailableNankang---517T->CADR InferredAcute hemolytic anemia. Details
Glucose-6-phosphate 1-dehydrogenaseNot AvailableMiaoli---519C->GADR InferredAcute hemolytic anemia. Details
Glucose-6-phosphate 1-dehydrogenaseNot AvailableMediterranean, Dallas, Panama‚ Sassari, Cagliari, Birmingham---563C->TADR InferredAcute hemolytic anemia. Details
Glucose-6-phosphate 1-dehydrogenaseNot AvailableCoimbra Shunde---592C->TADR InferredAcute hemolytic anemia. Details
Glucose-6-phosphate 1-dehydrogenaseNot AvailableNilgiri---593G>AADR InferredAcute hemolytic anemia. Details
Glucose-6-phosphate 1-dehydrogenaseNot AvailableRadlowo---679C->TADR InferredAcute hemolytic anemia. Details
Glucose-6-phosphate 1-dehydrogenaseNot AvailableRoubaix---811G>CADR InferredAcute hemolytic anemia. Details
Glucose-6-phosphate 1-dehydrogenaseNot AvailableHaikou---835A->GADR InferredAcute hemolytic anemia. Details
Glucose-6-phosphate 1-dehydrogenaseNot AvailableChinese-1---835A->TADR InferredAcute hemolytic anemia. Details
Glucose-6-phosphate 1-dehydrogenaseNot AvailableMizushima---848A>GADR InferredAcute hemolytic anemia. Details
Glucose-6-phosphate 1-dehydrogenaseNot AvailableOsaka---853C->TADR InferredAcute hemolytic anemia. Details
Glucose-6-phosphate 1-dehydrogenaseNot AvailableViangchan, Jammu---871G->AADR InferredAcute hemolytic anemia. Details
Glucose-6-phosphate 1-dehydrogenaseNot AvailableSeoul---916G->AADR InferredAcute hemolytic anemia. Details
Glucose-6-phosphate 1-dehydrogenaseNot AvailableLudhiana---929G->AADR InferredAcute hemolytic anemia. Details
Glucose-6-phosphate 1-dehydrogenaseNot AvailableFarroupilha---977C->AADR InferredAcute hemolytic anemia. Details
Glucose-6-phosphate 1-dehydrogenaseNot AvailableChinese-5---1024C->TADR InferredAcute hemolytic anemia. Details
Glucose-6-phosphate 1-dehydrogenaseNot AvailableRignano---130G>AADR InferredAcute hemolytic anemia. Details
Glucose-6-phosphate 1-dehydrogenaseNot AvailableOrissa---131C->GADR InferredAcute hemolytic anemia. Details
Glucose-6-phosphate 1-dehydrogenaseNot AvailableG6PDNice---1380G>CADR InferredAcute hemolytic anemia. Details
Glucose-6-phosphate 1-dehydrogenaseNot AvailableKamiube, Keelung---1387C->TADR InferredAcute hemolytic anemia. Details
Glucose-6-phosphate 1-dehydrogenaseNot AvailableNeapolis---1400C->GADR InferredAcute hemolytic anemia. Details
Glucose-6-phosphate 1-dehydrogenaseNot AvailableAures---143T->CADR InferredAcute hemolytic anemia. Details
Glucose-6-phosphate 1-dehydrogenaseNot AvailableSplit---1442C->GADR InferredAcute hemolytic anemia. Details
Glucose-6-phosphate 1-dehydrogenaseNot AvailableKambos---148C->TADR InferredAcute hemolytic anemia. Details
Glucose-6-phosphate 1-dehydrogenaseNot AvailablePalestrina---170G>AADR InferredAcute hemolytic anemia. Details
Glucose-6-phosphate 1-dehydrogenaseNot AvailableMetaponto---172G->AADR InferredAcute hemolytic anemia. Details
Glucose-6-phosphate 1-dehydrogenaseNot AvailableMusashino---185C->TADR InferredAcute hemolytic anemia. Details
Glucose-6-phosphate 1-dehydrogenaseNot AvailableAsahi---202G->AADR InferredAcute hemolytic anemia. Details
Glucose-6-phosphate 1-dehydrogenaseNot AvailableA- (202), Ferrara I---202G->A, 376A->GADR InferredAcute hemolytic anemia. Details
Glucose-6-phosphate 1-dehydrogenaseNot AvailableMurcia Oristano---209A->GADR InferredAcute hemolytic anemia. Details
Glucose-6-phosphate 1-dehydrogenaseNot AvailableUbe Konan---241C->TADR InferredAcute hemolytic anemia. Details
Glucose-6-phosphate 1-dehydrogenaseNot AvailableLagosanto---242G->AADR InferredAcute hemolytic anemia. Details
Glucose-6-phosphate 1-dehydrogenaseNot AvailableGuangzhou---274C->TADR InferredAcute hemolytic anemia. Details
Glucose-6-phosphate 1-dehydrogenaseNot AvailableHammersmith---323T->AADR InferredAcute hemolytic anemia. Details
Glucose-6-phosphate 1-dehydrogenaseNot AvailableSinnai---34G->TADR InferredAcute hemolytic anemia. Details
Glucose-6-phosphate 1-dehydrogenaseNot AvailableA- (680)---376A->G, 680G->TADR InferredAcute hemolytic anemia. Details
Glucose-6-phosphate 1-dehydrogenaseNot AvailableA- (968), Betica,Selma, Guantanamo---376A->G, 968T->CADR InferredAcute hemolytic anemia. Details
Glucose-6-phosphate 1-dehydrogenaseNot AvailableSalerno Pyrgos---383T>GADR InferredAcute hemolytic anemia. Details
Glucose-6-phosphate 1-dehydrogenaseNot AvailableQuing Yan---392G->TADR InferredAcute hemolytic anemia. Details
Glucose-6-phosphate 1-dehydrogenaseNot AvailableLages---40G->AADR InferredAcute hemolytic anemia. Details
Glucose-6-phosphate 1-dehydrogenaseNot AvailableIlesha---466G->AADR InferredAcute hemolytic anemia. Details
Glucose-6-phosphate 1-dehydrogenaseNot AvailableMahidol---487G->AADR InferredAcute hemolytic anemia. Details
Glucose-6-phosphate 1-dehydrogenaseNot AvailableMalaga---542A->TADR InferredAcute hemolytic anemia. Details
Glucose-6-phosphate 1-dehydrogenaseNot AvailableSibari---634A->GADR InferredAcute hemolytic anemia. Details
Glucose-6-phosphate 1-dehydrogenaseNot AvailableMexico City---680G->AADR InferredAcute hemolytic anemia. Details
Glucose-6-phosphate 1-dehydrogenaseNot AvailableNanning---703C->TADR InferredAcute hemolytic anemia. Details
Glucose-6-phosphate 1-dehydrogenaseNot AvailableSeattle, Lodi, Modena, Ferrara II, Athens-like---844G->CADR InferredAcute hemolytic anemia. Details
Glucose-6-phosphate 1-dehydrogenaseNot AvailableBajo Maumere---844G->TADR InferredAcute hemolytic anemia. Details
Glucose-6-phosphate 1-dehydrogenaseNot AvailableMontalbano---854G->AADR InferredAcute hemolytic anemia. Details
Glucose-6-phosphate 1-dehydrogenaseNot AvailableKalyan-Kerala, Jamnaga, Rohini---949G->AADR InferredAcute hemolytic anemia. Details
Glucose-6-phosphate 1-dehydrogenaseNot AvailableGaohe---95A->GADR InferredAcute hemolytic anemia. Details
Drug Interactions No interactions found.
Food InteractionsNot Available
Synthesis Reference

Roy Eugene Snoke, Hugh Arthur Risley, Charles Thomas Goodhue, “Production of uricase from micrococcus luteus.” U.S. Patent US4062731, issued May, 1974.

General References
  1. Collings I, Watier Y, Giffard M, Dagogo S, Kahn R, Bonnete F, Wright JP, Fitch AN, Margiolaki I: Polymorphism of microcrystalline urate oxidase from Aspergillus flavus. Acta Crystallogr D Biol Crystallogr. 2010 May;66(Pt 5):539-48. doi: 10.1107/S0907444910005354. Epub 2010 Apr 21. [PubMed:20445229 ]
  2. Giraldez M, Puto K: A single, fixed dose of rasburicase (6 mg maximum) for treatment of tumor lysis syndrome in adults. Eur J Haematol. 2010 Aug;85(2):177-9. doi: 10.1111/j.1600-0609.2010.01457.x. Epub 2010 Apr 12. [PubMed:20394650 ]
External Links
ATC CodesV03AF07M04AX01
AHFS Codes
  • 44:00.00
PDB Entries
FDA labelDownload (49.1 KB)
MSDSNot Available
Clinical Trials
Clinical Trials
1CompletedOtherHealthy Volunteers1
1, 2CompletedTreatmentLeukemias / Lymphoma NOS / Tumour lysis syndrome1
2CompletedTreatmentChildhood Burkitt Lymphoma / Childhood Diffuse Large Cell Lymphoma / Childhood Immunoblastic Large Cell Lymphoma / Stage I Childhood Large Cell Lymphoma / Stage I Childhood Small Noncleaved Cell Lymphoma / Stage II Childhood Large Cell Lymphoma / Stage II Childhood Small Noncleaved Cell Lymphoma / Stage III Childhood Large Cell Lymphoma / Stage III Childhood Small Noncleaved Cell Lymphoma / Stage IV Childhood Large Cell Lymphoma / Stage IV Childhood Small Noncleaved Cell Lymphoma / Untreated Childhood Acute Lymphoblastic Leukemia1
2CompletedTreatmentHyperuricemia / Leukemias / Lymphoma NOS1
2CompletedTreatmentLeukemias / Lymphoma NOS1
2CompletedTreatmentNutritional and Metabolic Diseases1
2CompletedTreatmentTumour lysis syndrome1
2TerminatedTreatmentAdult Acute Myeloid Leukemia With 11q23 (MLL) Abnormalities / Adult Acute Myeloid Leukemia With Del(5q) / Adult Acute Myeloid Leukemia With Inv(16)(p13;q22) / Adult Acute Myeloid Leukemia With T(15;17)(q22;q12) / Adult Acute Myeloid Leukemia With T(16;16)(p13;q22) / Adult Acute Myeloid Leukemia With T(8;21)(q22;q22) / Blastic Phase Chronic Myelogenous Leukemia / Contiguous Stage II Adult Burkitt Lymphoma / De Novo Myelodysplastic Syndromes / Noncontiguous Stage II Adult Burkitt Lymphoma / Previously Treated Myelodysplastic Syndromes / Recurrent Adult Acute Lymphoblastic Leukemia / Recurrent Adult Acute Myeloid Leukemia / Recurrent Adult Burkitt Lymphoma / Stage I Adult Burkitt Lymphoma / Stage III Adult Burkitt Lymphoma / Stage IV Adult Burkitt Lymphoma / Untreated Adult Acute Lymphoblastic Leukemia / Untreated Adult Acute Myeloid Leukemia1
2, 3RecruitingTreatmentMature B-Cell Lymphoma1
3CompletedPreventionCancers / Hyperuricemia / Tumour lysis syndrome1
3CompletedTreatmentAdult Acute Lymphocytic Leukemia / Lymphoma, High-Grade1
4CompletedNot AvailableHyperuricemia / Leukemias / Lymphoma NOS / Tumour lysis syndrome1
4CompletedPreventionHyperuricemia / Tumors / Tumour lysis syndrome1
4CompletedTreatmentTumour lysis syndrome1
Not AvailableCompletedNot AvailableBMI >30 kg/m2 / Hyperuricemia / Metabolic Syndromes1
Not AvailableCompletedSupportive CareChronic Myeloproliferative Disorders / Graft Versus Host Disease (GVHD) / Leukemias / Lymphoma NOS / Multiple Myeloma and Plasma Cell Neoplasm / Myelodysplastic Syndromes / Myelodysplastic/Myeloproliferative Neoplasms1
ManufacturersNot Available
Dosage forms
Injection, powder, for solutionIntravenous1.5 mg/ml
Powder, for solutionIntravenous1.5 mg
Powder, for solutionIntravenous7.5 mg
Unit descriptionCostUnit
Elitek 7.5 mg vial3136.18USD vial
Elitek 1.5 mg vial627.23USD vial
DrugBank does not sell nor buy drugs. Pricing information is supplied for informational purposes only.
Patent NumberPediatric ExtensionApprovedExpires (estimated)
CA2148537 No2002-07-162015-05-03Canada
CA2175971 No2003-12-302016-05-07Canada
Experimental Properties
hydrophobicity-0.465Not Available
isoelectric point7.16Not Available
DescriptionNot Available
KingdomOrganic Compounds
Super ClassOrganic Acids
ClassCarboxylic Acids and Derivatives
Sub ClassAmino Acids, Peptides, and Analogues
Direct ParentPeptides
Alternative ParentsNot Available
SubstituentsNot Available
Molecular FrameworkNot Available
External DescriptorsNot Available


Small molecule
Pharmacological action
  1. Overington JP, Al-Lazikani B, Hopkins AL: How many drug targets are there? Nat Rev Drug Discov. 2006 Dec;5(12):993-6. [PubMed:17139284 ]
  2. Imming P, Sinning C, Meyer A: Drugs, their targets and the nature and number of drug targets. Nat Rev Drug Discov. 2006 Oct;5(10):821-34. [PubMed:17016423 ]
  3. Cete S, Yasar A, Arslan F: An amperometric biosensor for uric acid determination prepared from uricase immobilized in polypyrrole film. Artif Cells Blood Substit Immobil Biotechnol. 2006;34(3):367-80. [PubMed:16809136 ]
  4. Gabison L, Chiadmi M, Colloc'h N, Castro B, El Hajji M, Prange T: Recapture of [S]-allantoin, the product of the two-step degradation of uric acid, by urate oxidase. FEBS Lett. 2006 Apr 3;580(8):2087-91. Epub 2006 Mar 10. [PubMed:16545381 ]
  5. Zhao Y, Zhao L, Yang G, Tao J, Bu Y, Liao F: Characterization of a uricase from Bacillus fastidious A.T.C.C. 26904 and its application to serum uric acid assay by a patented kinetic uricase method. Biotechnol Appl Biochem. 2006 Sep;45(Pt 2):75-80. [PubMed:16689679 ]
  6. Giraldez M, Puto K: A single, fixed dose of rasburicase (6 mg maximum) for treatment of tumor lysis syndrome in adults. Eur J Haematol. 2010 Aug;85(2):177-9. doi: 10.1111/j.1600-0609.2010.01457.x. Epub 2010 Apr 12. [PubMed:20394650 ]
comments powered by Disqus
Drug created on June 13, 2005 07:24 / Updated on April 21, 2017 10:59