
Accession Number
DB00698  (APRD00191)
Small Molecule
Approved, Vet Approved

A bacteriostatic or bactericidal agent depending on the concentration and susceptibility of the infecting organism. Nitrofurantoin is active against some gram positive organisms such as S. aureus, S. epidermidis, S. saprophyticus, Enterococcus faecalis, S. agalactiae, group D streptococci, viridians streptococci and Corynebacterium. Its spectrum of activity against gram negative organisms includes E. coli, Enterobacter, Neisseria, Salmonella and Shigella. It may be used as an alternative to trimethoprim/sulfamethoxazole for treating urinary tract infections though it may be less effective at eradicating vaginal bacteria. May also be used in females as prophylaxis against recurrent cystitis related to coitus. Nitrofurantoin is highly stable to the development of bacterial resistance, a property thought to be due to its multiplicity of mechanisms of action.

  • 1-((5-nitro-2-furanyl)methylene)amino-2,4-imidazolidenedione
  • 1-((5-nitrofurfurylidene)amino)hydantoin
  • 5-Nitrofurantoin
  • N-(5-Nitrofurfurylidene)-1-aminohydantoin
  • Nitrofurantoin anhydrous
  • Nitrofurantoin macrocrystal
  • Nitrofurantoin macrocrystalline
  • Nitrofurantoin, macrocrystalline
  • Nitrofurantoin, macrocrystals
  • nitrofurantoina
  • nitrofurantoine
  • nitrofurantoinum
  • Nitrofurantoinum anhydrous
External IDs
NSC-2107 / NSC-44150 / USAF EA-2
Product Ingredients
IngredientUNIICASInChI Key
Nitrofurantoin monohydrateE1QI2CQQ1I17140-81-7NHBPVLAHAVEISO-JSGFVSQVSA-N
Product Images
Prescription Products
NameDosageStrengthRouteLabellerMarketing StartMarketing End
Auro-nitrofurantoinCapsule100 mgOralAuro Pharma Inc2017-10-23Not applicableCanada
FuradantinSuspension25 mg/5mLOralShionogi1953-12-23Not applicableUs
MacrobidCapsule100 mgOralAllergan Pharma Co.1993-12-31Not applicableCanada
MacrodantinCapsule25 mg/1OralALMATICA PHARMA INC.2010-09-27Not applicableUs
MacrodantinCapsule25 mgOralAlza1993-12-311999-08-06Canada
MacrodantinCapsule100 mg/1OralALMATICA PHARMA INC.2010-09-27Not applicableUs
MacrodantinCapsule50 mg/1OralALMATICA PHARMA INC.2010-09-27Not applicableUs
Macrodantin (100 Mg)Capsule100 mgOralProcter And Gamble1993-12-312010-07-07Canada
Macrodantin (50 Mg)Capsule50 mgOralProcter And Gamble1993-12-312010-07-07Canada
Macrodantin Cap 100mgCapsule100 mgOralNorwich Eaton Canada Inc.1979-12-311996-09-16Canada
Generic Prescription Products
NameDosageStrengthRouteLabellerMarketing StartMarketing End
NitrofurantionCapsule100 mg/1OralNu Care Pharmaceuticals Industries, Inc.2016-04-15Not applicableUs
NitrofurantionCapsule25 mg/1OralSun Pharmaceutical Industries Limited2016-04-15Not applicableUs
NitrofurantionCapsule100 mg/1OralSun Pharmaceutical Industries Limited2016-04-15Not applicableUs
NitrofurantionCapsule50 mg/1OralDirectrx2016-04-15Not applicableUs
NitrofurantionCapsule50 mg/1OralSun Pharmaceutical Industries Limited2016-04-15Not applicableUs
NitrofurantoinCapsule50 mg/1OralActavis Pharma Company2015-10-01Not applicableUs
NitrofurantoinSuspension25 mg/5mLOralLupin Pharmaceuticals2015-05-21Not applicableUs
NitrofurantoinSuspension25 mg/5mLOralNovel Laboratories, Inc.2014-09-08Not applicableUs
NitrofurantoinCapsule50 mg/1OralNcs Health Care Of Ky, Inc Dba Vangard Labs1997-07-09Not applicableUs51079 0584 20 nlmimage10 3b351db8
NitrofurantoinCapsule100 mg/1OralPd Rx Pharmaceuticals, Inc.2011-05-06Not applicableUs51079 0585 20 nlmimage10 313518d8
International/Other Brands
Furabid (Goldshield) / Niftran / Siraliden / Urantoin (Basel) / Urolong (Thiemann)
Mixture Products
NameIngredientsDosageRouteLabellerMarketing StartMarketing End
MacrobidNitrofurantoin (25 mg/1) + Nitrofurantoin monohydrate (75 mg/1)CapsuleOralALMATICA PHARMA INC.2011-05-31Not applicableUs
MacrobidNitrofurantoin (25 mg/1) + Nitrofurantoin monohydrate (75 mg/1)CapsuleOralCentral Texas Community Health Centers2011-05-31Not applicableUs
MacrobidNitrofurantoin (25 mg/1) + Nitrofurantoin monohydrate (75 mg/1)CapsuleOralALMATICA PHARMA INC.2011-05-31Not applicableUs
MacrobidNitrofurantoin (25 mg/1) + Nitrofurantoin monohydrate (75 mg/1)CapsuleOralCentral Texas Community Health Centers2011-05-31Not applicableUs
NitrofurantoinNitrofurantoin (25 mg/1) + Nitrofurantoin monohydrate (75 mg/1)CapsuleOralNorthwind Pharmaceuticals2014-07-18Not applicableUs
NitrofurantoinNitrofurantoin (25 mg/1) + Nitrofurantoin monohydrate (75 mg/1)CapsuleOralNorthwind Pharmaceuticals2014-07-18Not applicableUs
Nitrofurantoin (monohydrate/macrocrystals)Nitrofurantoin monohydrate (75 mg/1) + Nitrofurantoin (25 mg/1)CapsuleOralRemedy Repack2017-10-19Not applicableUs
Nitrofurantoin (monohydrate/macrocrystals)Nitrofurantoin monohydrate (75 mg/1) + Nitrofurantoin (25 mg/1)CapsuleOralAv Kare, Inc.2017-10-31Not applicableUs
Nitrofurantoin (monohydrate/macrocrystals)Nitrofurantoin (75 mg/1) + Nitrofurantoin (25 mg/1)CapsuleOralRemedy Repack2016-04-14Not applicableUs
Nitrofurantoin (monohydrate/macrocrystals)Nitrofurantoin monohydrate (75 mg/1) + Nitrofurantoin (25 mg/1)CapsuleOralbryant ranch prepack1970-11-25Not applicableUs63629 174820170720 1564 d76n11
CAS number
Average: 238.159
Monoisotopic: 238.033819309
Chemical Formula
InChI Key



May be used as an alternative in the treatment of urinary tract infections. May be used by females pericoitally for prophylaxis against recurrent cystitis related to coitus.

Structured Indications

Nitrofurantoin exhibits bacteriostatic or bactericidal effects by inhibiting the synthesis of DNA, RNA, protein and cell wall synthesis.

Mechanism of action

Nitrofurantoin is activated by bacterial flavoproteins (nitrofuran reductase) to active reduced reactive intermediates that are thought to modulate and damage ribosomal proteins or other macromolecules, especially DNA, causing inhibition of DNA, RNA, protein, and cell wall synthesis. The overall effect is inhibition of bacterial growth or cell death.

AProbable pyruvate-flavodoxin oxidoreductase
Escherichia coli (strain K12)
AOxygen-insensitive NADPH nitroreductase
Escherichia coli (strain K12)
U30S ribosomal protein S10Not AvailableEscherichia coli (strain K12)

Readily absorbed in GI tract primarily in small intestine. Enhanced by food or delayed gastric emptying via enhanced dissolution rate of the drug.

Volume of distribution
Not Available
Protein binding

20-60% bound to plasma proteins


Partially metabolized in liver to aminofurantoin.

Route of elimination
Not Available
Half life

0.3-1 hour

Not Available

Acute toxicity may cause vomiting. Adverse effects include nausea and urine discolouration. Rare hepatotoxic and hypersensitivity reactions have occurred. Hemolytic anemia is a risk in patients with G6PD deficiency. Ascending polyneuropathy may occur with prolonged therapy or in patients with low creatinine clearance.

Affected organisms
  • Gram negative and gram positive bacteria
Not Available
Pharmacogenomic Effects/ADRs
Interacting Gene/EnzymeAllele nameGenotype(s)Defining Change(s)Type(s)DescriptionDetails
Glucose-6-phosphate 1-dehydrogenaseVilleurbanneNot Available1000_1002delACCADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseTorunNot Available1006A->GADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseSunderlandNot Available105_107delCATADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseIwatsukiNot Available1081G->AADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseSerresNot Available1082C->TADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseTondelaNot Available1084_1101delCTGAACGAGCGCAAGGCCADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseLoma LindaNot Available1089C->AADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseAachenNot Available1089C->GADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseTenriNot Available1096A->GADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseMontpellierNot Available1132G>AADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseCalvo MackennaNot Available1138A->GADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseRileyNot Available1139T->CADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseOlomoucNot Available1141T->CADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseTomahNot Available1153T->CADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseLynwoodNot Available1154G->TADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseMadridNot Available1155C->GADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseIowa, Walter Reed, SpringfieldNot Available1156A->GADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseBeverly Hills, Genova, Iwate, Niigata, YamaguchiNot Available1160G->AADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseHartfordNot Available1162A->GADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenasePrahaNot Available1166A->GADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseKrakowNot Available1175T>CADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseWisconsinNot Available1177C->GADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseNashville, Anaheim, PorticiNot Available1178G->AADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseAlhambraNot Available1180G->CADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseBariNot Available1187C->TADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenasePuerto LimonNot Available1192G->AADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseCovao do LoboNot Available1205C>AADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseClinicNot Available1215G->AADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseUtrechtNot Available1225C->TADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseSuwalkiNot Available1226C->GADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseRiversideNot Available1228G->TADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseJapan, ShinagawaNot Available1229G->AADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseKawasakiNot Available1229G->CADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseMunichNot Available1231A->GADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseGeorgiaNot Available1284C->AADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseSumareNot Available1292T->GADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseTelti/KobeNot Available1318C->TADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseSantiago de Cuba, MoriokaNot Available1339G->AADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseHarimaNot Available1358T->AADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseFiguera da FozNot Available1366G->CADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseAmiensNot Available1367A>TADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseBangkok NoiNot Available1376G->T, 1502T->GADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseFukayaNot Available1462G->AADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseCampinasNot Available1463G->TADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseBuenos AiresNot Available1465C>TADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseArakawaNot Available1466C->TADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseBrightonNot Available1488_1490delGAAADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseKozukataNot Available159G->CADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseAmsterdamNot Available180_182delTCTADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseNo nameNot Available202G->A, 376A->G, 1264C>GADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseSwanseaNot Available224T->CADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseUrayasuNot Available281_283delAGAADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseVancouverNot Available317C->G544C->T592C->TADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseMt SinaiNot Available376A->G, 1159C->TADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenasePlymouthNot Available488G->AADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseVolendamNot Available514C->TADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseShinshuNot Available527A->GADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseChikugoNot Available535A->TADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseTsukuiNot Available561_563delCTCADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenasePedoplis-CkaroNot Available573C>GADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseSantiagoNot Available593G->CADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseMinnesota, Marion, Gastonia, LeJeuneNot Available637G->TADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseCincinnatiNot Available637G->T, 1037A->TADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseHarilaouNot Available648T->GADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseNorth DallasNot Available683_685delACAADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseAsahikawaNot Available695G->AADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseDurhamNot Available713A->GADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseStonybrookNot Available724_729delGGCACTADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseWayneNot Available769C->GADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseAveiroNot Available806G->AADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseCleveland CorumNot Available820G->AADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseLilleNot Available821A>TADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseBangkokNot Available825G>CADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseSugaoNot Available826C->TADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseLa JollaNot Available832T->CADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseWexhamNot Available833C->TADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenasePiotrkowNot Available851T>CADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseWest VirginiaNot Available910G->TADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseOmiyaNot Available921G->CADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseNaraNot Available953_976delCCACCAAAGGGTACCTGGAC GACCADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseManhattanNot Available962G->AADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseRehevotNot Available964T->CADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseHoniaraNot Available99A->G / 1360C->TADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseTokyo, FukushimaNot Available1246G->AADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseChathamNot Available1003G->AADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseFushanNot Available1004C->AADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenasePartenopeNot Available1052G->TADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseIerapetraNot Available1057C->TADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseAnadiaNot Available1193A->GADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseAbenoNot Available1220A->CADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseSurabayaNot Available1291G->AADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenasePawneeNot Available1316G->CADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseS. AntiocoNot Available1342A->GADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseCassanoNot Available1347G->CADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseHermoupolisNot Available1347G->C / 1360C->TADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseUnion,Maewo, Chinese-2, KaloNot Available1360C->TADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseAndalusNot Available1361G->AADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseCosenzaNot Available1376G->CADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseCanton, Taiwan- Hakka, Gifu-like, Agrigento-likeNot Available1376G->TADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseFloresNot Available1387C->AADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseKaiping, Anant, Dhon, Sapporo-like, WoseraNot Available1388G->AADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseKamogawaNot Available169C->TADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseCostanzoNot Available179T>CADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseAmazoniaNot Available185C->AADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseSongklanagarindNot Available196T->AADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseHechiNot Available202G->A / 871G->AADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseNamouruNot Available208T->CADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseBao LocNot Available352T>CADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseCrispimNot Available375G->T, 379G->T383T->C384C>TADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseAcrokorinthosNot Available376A->G / 463C->GADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseSanta MariaNot Available376A->G / 542A->TADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseAnanindeuaNot Available376A->G / 871G->AADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseVanua LavaNot Available383T->CADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseValladolidNot Available406C->TADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseBelemNot Available409C->TADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseLiuzhouNot Available442G->AADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseShenzenNot Available473G>AADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseTaipei “Chinese- 3”Not Available493A->GADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseToledoNot Available496C>TADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseNaoneNot Available497G->AADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseNankangNot Available517T->CADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseMiaoliNot Available519C->GADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseMediterranean, Dallas, Panama‚ Sassari, Cagliari, BirminghamNot Available563C->TADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseCoimbra ShundeNot Available592C->TADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseNilgiriNot Available593G>AADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseRadlowoNot Available679C->TADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseRoubaixNot Available811G>CADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseHaikouNot Available835A->GADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseChinese-1Not Available835A->TADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseMizushimaNot Available848A>GADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseOsakaNot Available853C->TADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseViangchan, JammuNot Available871G->AADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseSeoulNot Available916G->AADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseLudhianaNot Available929G->AADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseFarroupilhaNot Available977C->AADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseChinese-5Not Available1024C->TADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseRignanoNot Available130G>AADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseOrissaNot Available131C->GADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseG6PDNiceNot Available1380G>CADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseKamiube, KeelungNot Available1387C->TADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseNeapolisNot Available1400C->GADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseAuresNot Available143T->CADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseSplitNot Available1442C->GADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseKambosNot Available148C->TADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenasePalestrinaNot Available170G>AADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseMetapontoNot Available172G->AADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseMusashinoNot Available185C->TADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseAsahiNot Available202G->AADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseA- (202), Ferrara INot Available202G->A / 376A->GADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseMurcia OristanoNot Available209A->GADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseUbe KonanNot Available241C->TADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseLagosantoNot Available242G->AADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseGuangzhouNot Available274C->TADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseHammersmithNot Available323T->AADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseSinnaiNot Available34G->TADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseA- (680)Not Available376A->G / 680G->TADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseA- (968), Betica,Selma, GuantanamoNot Available376A->G / 968T->CADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseSalerno PyrgosNot Available383T>GADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseQuing YanNot Available392G->TADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseLagesNot Available40G->AADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseIleshaNot Available466G->AADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseMahidolNot Available487G->AADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseMalagaNot Available542A->TADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseSibariNot Available634A->GADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseMexico CityNot Available680G->AADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseNanningNot Available703C->TADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseSeattle, Lodi, Modena, Ferrara II, Athens-likeNot Available844G->CADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseBajo MaumereNot Available844G->TADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseMontalbanoNot Available854G->AADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseKalyan-Kerala, Jamnaga, RohiniNot Available949G->AADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseGaoheNot Available95A->GADR InferredIncreased risk of hemolytic anemia.Details


Drug Interactions
DrugInteractionDrug group
DapsoneThe risk or severity of adverse effects can be increased when Dapsone is combined with Nitrofurantoin.Approved, Investigational
EltrombopagThe serum concentration of Nitrofurantoin can be increased when it is combined with Eltrombopag.Approved
EplerenoneNitrofurantoin may increase the hyperkalemic activities of Eplerenone.Approved
Magnesium TrisilicateThe serum concentration of Nitrofurantoin can be decreased when it is combined with Magnesium Trisilicate.Approved
Nitric OxideThe risk or severity of adverse effects can be increased when Nitric Oxide is combined with Nitrofurantoin.Approved
NorfloxacinThe therapeutic efficacy of Norfloxacin can be decreased when used in combination with Nitrofurantoin.Approved
PrilocaineThe risk or severity of adverse effects can be increased when Nitrofurantoin is combined with Prilocaine.Approved
ProbenecidThe serum concentration of Nitrofurantoin can be increased when it is combined with Probenecid.Approved
RolapitantThe serum concentration of Nitrofurantoin can be increased when it is combined with Rolapitant.Approved
Sodium NitriteThe risk or severity of adverse effects can be increased when Nitrofurantoin is combined with Sodium Nitrite.Approved
SpironolactoneNitrofurantoin may increase the hyperkalemic activities of Spironolactone.Approved
TeriflunomideThe serum concentration of Nitrofurantoin can be increased when it is combined with Teriflunomide.Approved
Food Interactions
  • Do not take magnesium at the same time.
  • Take with food since it increases bioavailability and reduces irritation.


Synthesis Reference

Tara Bielski, Kerry Benson, "Novel orally administrable formulation of nitrofurantoin and a method for preparing said formulation." U.S. Patent US20050202079, issued September 15, 2005.

General References
Not Available
External Links
KEGG Compound
PubChem Compound
PubChem Substance
Therapeutic Targets Database
RxList Drug Page Drug Page
ATC Codes
J01XE51 — Nitrofurantoin, combinationsJ01XE01 — Nitrofurantoin
AHFS Codes
  • 08:36.00 — Urinary Anti-infectives
FDA label
Download (923 KB)
Download (73.6 KB)

Clinical Trials

Clinical Trials
0Not Yet RecruitingPreventionComplications of Surgical Procedures1
1CompletedNot AvailableHealthy Volunteers3
2CompletedTreatmentUrinary Tract Infections (UTIs)1
3RecruitingPreventionChronic Kidney Disease (CKD) / Renal Hypodysplasia, Nonsyndromic, 1 / Vesicoureteral Reflux1
4Active Not RecruitingPreventionCalcium Nephrolithiasis / Urinary Tract Infections (UTIs)1
4Active Not RecruitingTreatmentCystitis / Urinary Tract Infections (UTIs)1
4CompletedPreventionUrinary Tract Infection: [Site Not Specified] or [Recurrent] / Urinary Tract Infections, Recurrent1
4CompletedPreventionUrinary Tract Infections (UTIs)1
4CompletedTreatmentPost-Operative Urinary Tract Infection in Patients Undergoing Placement of a Sub-Urethral Sling for the Treatment of Stress Urinary Incontinence / Stress Urinary Incontinence (SUI)1
4CompletedTreatmentUncomplicated Bacterial Cystitis1
4CompletedTreatmentUrinary Tract Infections (UTIs)1
4Enrolling by InvitationPreventionRenal Stones1
4RecruitingPreventionCatheter-Associated Urinary Tract Infection1
4RecruitingPreventionPelvic Organ Prolapse (POP)1
4RecruitingTreatmentUrinary Tract Infections (UTIs)1
Not AvailableCompletedNot AvailableHealthy Volunteers1
Not AvailableRecruitingPreventionCalcium Nephrolithiasis / Sepsis / Urinary Tract Infections (UTIs)1
Not AvailableRecruitingTreatmentBacteriuria (Asymptomatic) in Pregnancy1
Not AvailableTerminatedTreatmentUrinary Tract Infections (UTIs)1


  • Watson laboratories inc
  • Shionogi pharma inc
  • Procter and gamble pharmaceuticals inc sub procter and gamble co
  • Lannett co inc
  • Elkins sinn div ah robins co inc
  • Ivax pharmaceuticals inc sub teva pharmaceuticals usa
  • Sandoz inc
  • Whiteworth towne paulsen inc
  • Alvogen inc
  • Mylan pharmaceuticals inc
Dosage forms
CapsuleOral25 mg
CapsuleOral100 mg/1
CapsuleOral25 mg/1
CapsuleOral50 mg/1
SuspensionOral25 mg/5mL
TabletOral100 mg
TabletOral50 mg
SuspensionOral5 mg
CapsuleOral100 mg
CapsuleOral50 mg
Unit descriptionCostUnit
Macrobid 100 mg capsule3.02USD capsule
Macrodantin 100 mg capsule2.67USD capsule
Furadantin 25 mg/5ml Suspension2.22USD ml
Furadantin 25 mg/5 ml susp2.13USD ml
Nitrofurantoin powder2.13USD g
Nitrofurantoin Monohyd Macro 100 mg capsule2.12USD capsule
Nitrofurantoin mono-mcr 100 mg2.04USD each
Nitrofurantoin-macro 100 mg2.04USD each
Nitrofurantoin Macrocrystal 100 mg capsule1.88USD capsule
Nitrofurantoin mcr 100 mg capsule1.86USD capsule
Macrodantin 50 mg capsule1.67USD capsule
Macrodantin 25 mg capsule1.3USD capsule
Nitrofurantoin Macrocrystal 50 mg capsule1.14USD capsule
Nitrofurantoin mcr 50 mg capsule1.09USD capsule
Macrobid 100 mg Capsule (Macrocrystals/Monohydrate)0.78USD capsule
Novo-Furantoin 100 mg Capsule (Macrocrystals)0.66USD capsule
Novo-Furantoin 50 mg Capsule (Macrocrystals)0.35USD capsule
Apo-Nitrofurantoin 100 mg Tablet0.23USD tablet
Apo-Nitrofurantoin 50 mg Tablet0.17USD tablet
DrugBank does not sell nor buy drugs. Pricing information is supplied for informational purposes only.
Not Available


Experimental Properties
melting point (°C)223-228Gever, G.; U.S. Patent 2,802,002; August 6, 1957; assigned to The Norwich Pharmacal Co.
water solubility79.5 mg/L (at 24 °C)YALKOWSKY,SH & DANNENFELSER,RM (1992)
logP-0.47HANSCH,C ET AL. (1995)
pKa7.2SANGSTER (1994)
Predicted Properties
Water Solubility0.415 mg/mLALOGPS
pKa (Strongest Acidic)8.23ChemAxon
pKa (Strongest Basic)-2.2ChemAxon
Physiological Charge0ChemAxon
Hydrogen Acceptor Count5ChemAxon
Hydrogen Donor Count1ChemAxon
Polar Surface Area118.05 Å2ChemAxon
Rotatable Bond Count3ChemAxon
Refractivity52.11 m3·mol-1ChemAxon
Polarizability20.49 Å3ChemAxon
Number of Rings2ChemAxon
Rule of FiveYesChemAxon
Ghose FilterYesChemAxon
Veber's RuleNoChemAxon
MDDR-like RuleNoChemAxon
Predicted ADMET features
Human Intestinal Absorption+0.9832
Blood Brain Barrier+0.958
Caco-2 permeable-0.575
P-glycoprotein substrateNon-substrate0.6374
P-glycoprotein inhibitor INon-inhibitor0.8661
P-glycoprotein inhibitor IINon-inhibitor0.9834
Renal organic cation transporterNon-inhibitor0.8835
CYP450 2C9 substrateNon-substrate0.8373
CYP450 2D6 substrateNon-substrate0.8757
CYP450 3A4 substrateSubstrate0.5799
CYP450 1A2 substrateInhibitor0.9107
CYP450 2C9 inhibitorNon-inhibitor0.9071
CYP450 2D6 inhibitorNon-inhibitor0.9231
CYP450 2C19 inhibitorNon-inhibitor0.9025
CYP450 3A4 inhibitorNon-inhibitor0.9069
CYP450 inhibitory promiscuityLow CYP Inhibitory Promiscuity0.8943
Ames testAMES toxic0.9231
BiodegradationReady biodegradable0.7448
Rat acute toxicity2.5717 LD50, mol/kg Not applicable
hERG inhibition (predictor I)Weak inhibitor0.7981
hERG inhibition (predictor II)Non-inhibitor0.94
ADMET data is predicted using admetSAR, a free tool for evaluating chemical ADMET properties. (23092397)


Mass Spec (NIST)
Not Available
SpectrumSpectrum TypeSplash Key
Predicted GC-MS Spectrum - GC-MSPredicted GC-MSNot Available
Predicted MS/MS Spectrum - 10V, Positive (Annotated)Predicted LC-MS/MSNot Available
Predicted MS/MS Spectrum - 20V, Positive (Annotated)Predicted LC-MS/MSNot Available
Predicted MS/MS Spectrum - 40V, Positive (Annotated)Predicted LC-MS/MSNot Available
Predicted MS/MS Spectrum - 10V, Negative (Annotated)Predicted LC-MS/MSNot Available
Predicted MS/MS Spectrum - 20V, Negative (Annotated)Predicted LC-MS/MSNot Available
Predicted MS/MS Spectrum - 40V, Negative (Annotated)Predicted LC-MS/MSNot Available


This compound belongs to the class of organic compounds known as hydantoins. These are heterocyclic compounds containing an imidazolidine substituted by ketone group at positions 2 and 4.
Organic compounds
Super Class
Organoheterocyclic compounds
Sub Class
Direct Parent
Alternative Parents
Alpha amino acids and derivatives / Nitroaromatic compounds / Nitrofurans / Semicarbazones / Dicarboximides / Heteroaromatic compounds / Organic carbonic acids and derivatives / Propargyl-type 1,3-dipolar organic compounds / Organic oxoazanium compounds / Oxacyclic compounds
show 6 more
Hydantoin / Alpha-amino acid or derivatives / Nitroaromatic compound / 2-nitrofuran / Semicarbazone / Dicarboximide / Furan / Heteroaromatic compound / Semicarbazide / C-nitro compound
show 19 more
Molecular Framework
Aromatic heteromonocyclic compounds
External Descriptors
organooxygen heterocyclic antibiotic, organonitrogen heterocyclic antibiotic, imidazolidine-2,4-dione, nitrofuran antibiotic (CHEBI:71415)


Escherichia coli (strain K12)
Pharmacological action
General Function
Thiamine pyrophosphate binding
Specific Function
Oxidoreductase required for the transfer of electrons from pyruvate to flavodoxin.
Gene Name
Uniprot ID
Uniprot Name
Probable pyruvate-flavodoxin oxidoreductase
Molecular Weight
128823.205 Da
  1. Overington JP, Al-Lazikani B, Hopkins AL: How many drug targets are there? Nat Rev Drug Discov. 2006 Dec;5(12):993-6. [PubMed:17139284]
  2. Imming P, Sinning C, Meyer A: Drugs, their targets and the nature and number of drug targets. Nat Rev Drug Discov. 2006 Oct;5(10):821-34. [PubMed:17016423]
  3. Breeze AS, Obaseiki-Ebor EE: Nitrofuran reductase activity in nitrofurantoin-resistant strains of Escherichia coli K12: some with chromosomally determined resistance and others carrying R-plasmids. J Antimicrob Chemother. 1983 Dec;12(6):543-7. [PubMed:6363380]
  4. Sisson G, Goodwin A, Raudonikiene A, Hughes NJ, Mukhopadhyay AK, Berg DE, Hoffman PS: Enzymes associated with reductive activation and action of nitazoxanide, nitrofurans, and metronidazole in Helicobacter pylori. Antimicrob Agents Chemother. 2002 Jul;46(7):2116-23. [PubMed:12069963]
Escherichia coli (strain K12)
Pharmacological action
General Function
Oxidoreductase activity, acting on nad(p)h, nitrogenous group as acceptor
Specific Function
Reduction of nitroaromatic compounds using NADH. Reduces nitrofurazone by a ping-pong bi-bi mechanism possibly to generate a two-electron transfer product. Major component of the oxygen-insensitive...
Gene Name
Uniprot ID
Uniprot Name
Oxygen-insensitive NADPH nitroreductase
Molecular Weight
26800.375 Da
  1. Overington JP, Al-Lazikani B, Hopkins AL: How many drug targets are there? Nat Rev Drug Discov. 2006 Dec;5(12):993-6. [PubMed:17139284]
  2. Imming P, Sinning C, Meyer A: Drugs, their targets and the nature and number of drug targets. Nat Rev Drug Discov. 2006 Oct;5(10):821-34. [PubMed:17016423]
  3. Kutty R, Bennett GN: Biochemical characterization of trinitrotoluene transforming oxygen-insensitive nitroreductases from Clostridium acetobutylicum ATCC 824. Arch Microbiol. 2005 Nov;184(3):158-67. Epub 2005 Nov 10. [PubMed:16187099]
  4. Lightfoot RT, Shuman D, Ischiropoulos H: Oxygen-insensitive nitroreductases of Escherichia coli do not reduce 3-nitrotyrosine. Free Radic Biol Med. 2000 Apr 1;28(7):1132-6. [PubMed:10832075]
Escherichia coli (strain K12)
Pharmacological action
General Function
Trna binding
Specific Function
Involved in the binding of tRNA to the ribosomes.
Gene Name
Uniprot ID
Uniprot Name
30S ribosomal protein S10
Molecular Weight
11735.47 Da
  1. Overington JP, Al-Lazikani B, Hopkins AL: How many drug targets are there? Nat Rev Drug Discov. 2006 Dec;5(12):993-6. [PubMed:17139284]
  2. Imming P, Sinning C, Meyer A: Drugs, their targets and the nature and number of drug targets. Nat Rev Drug Discov. 2006 Oct;5(10):821-34. [PubMed:17016423]


Pharmacological action
General Function
Oxidoreductase activity, acting on paired donors, with incorporation or reduction of molecular oxygen, nad(p)h as one donor, and incorporation of one atom of oxygen
Specific Function
This enzyme is required for electron transfer from NADP to cytochrome P450 in microsomes. It can also provide electron transfer to heme oxygenase and cytochrome B5.
Gene Name
Uniprot ID
Uniprot Name
NADPH--cytochrome P450 reductase
Molecular Weight
76689.12 Da
  1. Wang Y, Gray JP, Mishin V, Heck DE, Laskin DL, Laskin JD: Role of cytochrome P450 reductase in nitrofurantoin-induced redox cycling and cytotoxicity. Free Radic Biol Med. 2008 Mar 15;44(6):1169-79. doi: 10.1016/j.freeradbiomed.2007.12.013. Epub 2007 Dec 23. [PubMed:18206659]


Pharmacological action
General Function
Xenobiotic-transporting atpase activity
Specific Function
High-capacity urate exporter functioning in both renal and extrarenal urate excretion. Plays a role in porphyrin homeostasis as it is able to mediates the export of protoporhyrin IX (PPIX) both fro...
Gene Name
Uniprot ID
Uniprot Name
ATP-binding cassette sub-family G member 2
Molecular Weight
72313.47 Da
  1. Perez M, Real R, Mendoza G, Merino G, Prieto JG, Alvarez AI: Milk secretion of nitrofurantoin, as a specific BCRP/ABCG2 substrate, in assaf sheep: modulation by isoflavones. J Vet Pharmacol Ther. 2009 Oct;32(5):498-502. doi: 10.1111/j.1365-2885.2008.01050.x. [PubMed:19754918]

Drug created on June 13, 2005 07:24 / Updated on December 11, 2017 12:50