You are using an unsupported browser. Please upgrade your browser to a newer version to get the best experience on DrugBank.
Accession NumberDB00698  (APRD00191)
TypeSmall Molecule
GroupsApproved, Vet Approved
DescriptionA bacteriostatic or bactericidal agent depending on the concentration and susceptibility of the infecting organism. Nitrofurantoin is active against some gram positive organisms such as S. aureus, S. epidermidis, S. saprophyticus, Enterococcus faecalis, S. agalactiae, group D streptococci, viridians streptococci and Corynebacterium. Its spectrum of activity against gram negative organisms includes E. coli, Enterobacter, Neisseria, Salmonella and Shigella. It may be used as an alternative to trimethoprim/sulfamethoxazole for treating urinary tract infections though it may be less effective at eradicating vaginal bacteria. May also be used in females as prophylaxis against recurrent cystitis related to coitus. Nitrofurantoin is highly stable to the development of bacterial resistance, a property thought to be due to its multiplicity of mechanisms of action.
Nitrofurantoin anhydrous
Nitrofurantoin macrocrystal
Nitrofurantoin macrocrystalline
Nitrofurantoin, macrocrystalline
Nitrofurantoin, macrocrystals
Nitrofurantoinum anhydrous
External IDs NSC-2107 / NSC-44150 / USAF EA-2
Product Ingredients
IngredientUNIICASInChI KeyDetails
Nitrofurantoin monohydrateE1QI2CQQ1I 17140-81-7NHBPVLAHAVEISO-JSGFVSQVSA-NDetails
Nitrofurantoin sodiumMAL9M0T5LV 54-87-5AFDJQFFKYDCYIG-JSGFVSQVSA-MDetails
Approved Prescription Products
NameDosageStrengthRouteLabellerMarketing StartMarketing End
FuradantinSuspension25 mg/5mLOralShionogi1953-12-23Not applicableUs
MacrobidCapsule100 mgOralWarner Chilcott1993-12-31Not applicableCanada
MacrodantinCapsule25 mg/1OralALMATICA PHARMA INC.2010-09-27Not applicableUs
MacrodantinCapsule50 mg/1OralALMATICA PHARMA INC.2010-09-27Not applicableUs
MacrodantinCapsule100 mg/1OralALMATICA PHARMA INC.2010-09-27Not applicableUs
MacrodantinCapsule25 mgOralAlza1993-12-311999-08-06Canada
Macrodantin (100 Mg)Capsule100 mgOralProcter And Gamble1993-12-312010-07-07Canada
Macrodantin (50 Mg)Capsule50 mgOralProcter And Gamble1993-12-312010-07-07Canada
Macrodantin Cap 100mgCapsule100 mgOralNorwich Eaton Canada Inc.1979-12-311996-09-16Canada
Macrodantin Cap 25mgCapsule25 mgOralNorwich Eaton Canada Inc.1979-12-311996-09-16Canada
Macrodantin Cap 50mgCapsule50 mgOralNorwich Eaton Canada Inc.1979-12-311996-09-16Canada
Nephronex Tab 50mgTablet50 mgOralLaboratoires Cortunon Inc.1985-04-191997-08-12Canada
Nitrofurantion MacrocrystalsCapsule50 mg/1OralLake Erie Medical Dba Quality Care Produts Llc2010-09-27Not applicableUs
Nitrofurantion MacrocrystalsCapsule100 mg/1OralAlvogen, Inc.2010-09-27Not applicableUs
Nitrofurantion MacrocrystalsCapsule100 mg/1OralProficient Rx LP2010-09-27Not applicableUs
Nitrofurantion MacrocrystalsCapsule100 mg/1OralNucare Pharmaceuticals, Inc.2010-09-27Not applicableUs
Nitrofurantion MacrocrystalsCapsule50 mg/1OralRemedy Repack2013-03-182016-12-31Us
Nitrofurantion MacrocrystalsCapsule100 mg/1OralA S Medication Solutions2010-09-27Not applicableUs
Nitrofurantion MacrocrystalsCapsule100 mg/1OralRemedy Repack2017-01-05Not applicableUs
Nitrofurantion MacrocrystalsCapsule100 mg/1OralApotheca, Inc.2010-09-27Not applicableUs
Nitrofurantion MacrocrystalsCapsule50 mg/1OralPd Rx Pharmaceuticals, Inc.2010-09-27Not applicableUs
Nitrofurantion MacrocrystalsCapsule50 mg/1OralPreferreed Pharmaceuticals Inc.2017-01-19Not applicableUs
Nitrofurantion MacrocrystalsCapsule100 mg/1OralAidarex Pharmaceuticals LLC2010-09-27Not applicableUs
Nitrofurantion MacrocrystalsCapsule100 mg/1OralA S Medication Solutions2010-09-27Not applicableUs
Nitrofurantion MacrocrystalsCapsule100 mg/1OralPd Rx Pharmaceuticals, Inc.2010-09-27Not applicableUs
Nitrofurantion MacrocrystalsCapsule25 mg/1OralAlvogen, Inc.2010-09-27Not applicableUs
Nitrofurantion MacrocrystalsCapsule100 mg/1OralRemedy Repack2013-03-192017-01-07Us
Nitrofurantion MacrocrystalsCapsule100 mg/1OralLake Erie Medical Dba Quality Care Produts Llc2010-09-27Not applicableUs
Nitrofurantion MacrocrystalsCapsule50 mg/1OralAlvogen, Inc.2010-09-27Not applicableUs
NitrofurantoinSuspension25 mg/5mLOralPrasco, Laboratories1953-12-23Not applicableUs
NitrofurantoinTablet100 mgOralAa Pharma Inc1974-12-31Not applicableCanada
NitrofurantoinTablet50 mgOralAa Pharma Inc1974-12-31Not applicableCanada
Nitrofurantoin 50 Tab 50mgTablet50 mgOralPro Doc Limitee1982-12-311999-08-12Canada
Nitrofurantoin MacrocrystalsCapsule50 mg/1OralBlue Point Laboratories2013-03-20Not applicableUs
Nitrofurantoin MacrocrystalsCapsule50 mg/1OralAmerincan Health Packaging2014-02-17Not applicableUs
Nitrofurantoin MacrocrystalsCapsule100 mg/1OralBlue Point Laboratories2013-03-20Not applicableUs
Nitrofurantoin MacrocrystalsCapsule100 mg/1OralAmerincan Health Packaging2014-02-17Not applicableUs
Nitrofurantoine 100 Tab 100mgTablet100 mgOralPro Doc Limitee1982-12-311999-08-12Canada
Novo-furan 100mgTablet100 mgOralNovopharm Limited1967-12-312005-08-10Canada
Novo-furan Sus 25mg/5mlSuspension5 mgOralNovopharm Limited1967-12-312005-08-10Canada
Novo-furan Tab 50mgTablet50 mgOralNovopharm Limited1967-12-312005-08-10Canada
Nu-nitrofurantoin TabletsTablet100 mgOralNu Pharm IncNot applicableNot applicableCanada
Nu-nitrofurantoin TabletsTablet50 mgOralNu Pharm IncNot applicableNot applicableCanada
PMS-nitrofurantoinCapsule100 mgOralPharmascience IncNot applicableNot applicableCanada
Teva-nitrofurantoinCapsule50 mgOralTeva1997-05-02Not applicableCanada
Teva-nitrofurantoinCapsule100 mgOralTeva1997-05-02Not applicableCanada
Approved Generic Prescription Products
NameDosageStrengthRouteLabellerMarketing StartMarketing End
NitrofurantionCapsule50 mg/1OralDirectrx2016-04-15Not applicableUs
NitrofurantionCapsule100 mg/1OralSun Pharmaceutical Industries Limited2016-04-15Not applicableUs
NitrofurantionCapsule100 mg/1OralNu Care Pharmaceuticals Industries, Inc.2016-04-15Not applicableUs
NitrofurantionCapsule25 mg/1OralSun Pharmaceutical Industries Limited2016-04-15Not applicableUs
NitrofurantionCapsule50 mg/1OralSun Pharmaceutical Industries Limited2016-04-15Not applicableUs
NitrofurantoinCapsule25 mg/1OralActavis Pharma Company2015-10-01Not applicableUs
NitrofurantoinSuspension25 mg/5mLOralActavis Pharma Company2016-10-10Not applicableUs
NitrofurantoinSuspension25 mg/5mLOralCaraco Pharmaceutical Laboratories, Ltd.2012-03-042017-03-04Us
NitrofurantoinCapsule50 mg/1OralActavis Pharma Company2015-10-01Not applicableUs
NitrofurantoinCapsule100 mg/1OralPd Rx Pharmaceuticals, Inc.2011-05-06Not applicableUs
NitrofurantoinSuspension25 mg/5mLOralNovel Laboratories, Inc.2014-09-08Not applicableUs
NitrofurantoinCapsule100 mg/1OralActavis Pharma Company2015-10-01Not applicableUs
NitrofurantoinSuspension25 mg/5mLOralGavis Pharmaceuticals, LLC.2015-05-21Not applicableUs
NitrofurantoinSuspension25 mg/5mLOralAmneal Pharmaceuticals2011-03-24Not applicableUs
NitrofurantoinCapsule50 mg/1OralNcs Health Care Of Ky, Inc Dba Vangard Labs1997-07-09Not applicableUs
NitrofurantoinSuspension25 mg/5mLOralNostrum Laboratories, Inc.2012-03-04Not applicableUs
NitrofurantoinCapsule100 mg/1OralRemedy Repack2011-11-102016-10-13Us
NitrofurantoinCapsule100 mg/1OralNcs Health Care Of Ky, Inc Dba Vangard Labs2011-05-06Not applicableUs
NitrofurantoinCapsule100 mg/1OralRemedy Repack2010-09-172016-10-13Us
Nitrofurantoin (macrocrystals)Capsule100 mg/1OralLake Erie Medical &Surgical Supply Dba Quality Care Products Llc2012-04-30Not applicableUs
Nitrofurantoin (macrocrystals)Capsule50 mg/1OralMylan Institutional2006-08-16Not applicableUs
Nitrofurantoin (macrocrystals)Capsule50 mg/1OralMylan Pharmaceuticals1997-09-09Not applicableUs
Nitrofurantoin (macrocrystals)Capsule100 mg/1OralMylan Institutional2006-08-16Not applicableUs
Nitrofurantoin (macrocrystals)Capsule100 mg/1OralMylan Pharmaceuticals2004-09-21Not applicableUs
Nitrofurantoin (macrocrystals)Capsule50 mg/1OralA S Medication Solutions2012-10-24Not applicableUs
Nitrofurantoin (macrocrystals)Capsule50 mg/1OralPd Rx Pharmaceuticals, Inc.2011-05-06Not applicableUs
Nitrofurantoin MacrocrystalsCapsule100 mg/1OralPd Rx Pharmaceuticals, Inc.2007-03-08Not applicableUs
Nitrofurantoin MacrocrystalsCapsule100 mg/1OralStat Rx USA1993-01-28Not applicableUs
Nitrofurantoin MacrocrystalsCapsule100 mg/1OralRebel Distributors2011-09-19Not applicableUs
Nitrofurantoin MacrocrystalsCapsule100 mg/1OralUnit Dose Services2007-03-08Not applicableUs
Nitrofurantoin MacrocrystalsCapsule50 mg/1OralImpax Generics2007-03-08Not applicableUs
Nitrofurantoin MacrocrystalsCapsule50 mg/1Oralbryant ranch prepack2007-03-08Not applicableUs
Nitrofurantoin MacrocrystalsCapsule100 mg/1OralImpax Generics2007-03-08Not applicableUs
Nitrofurantoin MacrocrystalsCapsule100 mg/1OralRed Pharm Drug, Inc.2011-01-10Not applicableUs
Nitrofurantoin MacrocrystalsCapsule50 mg/1OralTeva2007-03-082018-01-31Us
Nitrofurantoin MacrocrystalsCapsule100 mg/1OralLiberty Pharmaceuticals, Inc.2007-03-08Not applicableUs
Nitrofurantoin MacrocrystalsCapsule100 mg/1OralLake Erie Medical &Surgical Supply Dba Quality Care Products Llc2012-04-03Not applicableUs
Nitrofurantoin MacrocrystalsCapsule50 mg/1OralPhysicians Total Care, Inc.2003-08-13Not applicableUs
Nitrofurantoin MacrocrystalsCapsule100 mg/1OralTeva2007-03-082017-12-31Us
Nitrofurantoin MacrocrystalsCapsule100 mg/1OralLiberty Pharmaceuticals, Inc.2007-03-08Not applicableUs
Nitrofurantoin MacrocrystalsCapsule100 mg/1OralBlenheim Pharmacal, Inc.2010-04-23Not applicableUs
Nitrofurantoin MacrocrystalsCapsule50 mg/1OralA S Medication Solutions2007-03-08Not applicableUs
Nitrofurantoin MacrocrystalsCapsule100 mg/1OralPhysicians Total Care, Inc.2000-03-01Not applicableUs
Approved Over the Counter ProductsNot Available
Unapproved/Other Products Not Available
International Brands
NiftranNot Available
SiralidenNot Available
Brand mixtures
NitrofurantoinNorthwind Pharmaceuticals
Nitrofurantoin (monohydrate/macrocrystals)Amerincan Health Packaging
Nitrofurantoin Monohydrate MacrocrystallineDirectrx
Nitrofurantoin Monohydrate MacrocrystalsPreferreed Pharmaceuticals Inc.
Nitrofurantoin Monohydrate/A S Medication Solutions
Nitrofurantoin Monohydrate/ MacrocrystallineBlenheim Pharmacal, Inc.
Nitrofurantoin Monohydrate/macrocrystallineBlue Point Laboratories
Nitrofurantoin Monohydrate/macrocrystalsMylan Pharmaceuticals
CAS number67-20-9
WeightAverage: 238.159
Monoisotopic: 238.033819309
Chemical FormulaC8H6N4O5
IndicationMay be used as an alternative in the treatment of urinary tract infections. May be used by females pericoitally for prophylaxis against recurrent cystitis related to coitus.
Structured Indications
PharmacodynamicsNitrofurantoin exhibits bacteriostatic or bactericidal effects by inhibiting the synthesis of DNA, RNA, protein and cell wall synthesis.
Mechanism of actionNitrofurantoin is activated by bacterial flavoproteins (nitrofuran reductase) to active reduced reactive intermediates that are thought to modulate and damage ribosomal proteins or other macromolecules, especially DNA, causing inhibition of DNA, RNA, protein, and cell wall synthesis. The overall effect is inhibition of bacterial growth or cell death.
TargetKindPharmacological actionActionsOrganismUniProt ID
Probable pyruvate-flavodoxin oxidoreductaseProteinyes
Escherichia coli (strain K12)P52647 details
Oxygen-insensitive NADPH nitroreductaseProteinyes
Escherichia coli (strain K12)P17117 details
30S ribosomal protein S10ProteinunknownNot AvailableEscherichia coli (strain K12)P0A7R5 details
Related Articles
AbsorptionReadily absorbed in GI tract primarily in small intestine. Enhanced by food or delayed gastric emptying via enhanced dissolution rate of the drug.
Volume of distributionNot Available
Protein binding20-60% bound to plasma proteins

Partially metabolized in liver to aminofurantoin.

Not Available
Route of eliminationNot Available
Half life0.3-1 hour
ClearanceNot Available
ToxicityAcute toxicity may cause vomiting. Adverse effects include nausea and urine discolouration. Rare hepatotoxic and hypersensitivity reactions have occurred. Hemolytic anemia is a risk in patients with G6PD deficiency. Ascending polyneuropathy may occur with prolonged therapy or in patients with low creatinine clearance.
Affected organisms
  • Gram negative and gram positive bacteria
PathwaysNot Available
Pharmacogenomic Effects/ADRs
Interacting Gene/EnzymeSNP RS IDsAllele nameGenotypeDefining ChangeType(s)DescriptionDetails
Glucose-6-phosphate 1-dehydrogenaseNot AvailableVilleurbanne---1000_1002delACCADR InferredIncreased risk of hemolytic anemia. Details
Glucose-6-phosphate 1-dehydrogenaseNot AvailableTorun---1006A->GADR InferredIncreased risk of hemolytic anemia. Details
Glucose-6-phosphate 1-dehydrogenaseNot AvailableSunderland---105_107delCATADR InferredIncreased risk of hemolytic anemia. Details
Glucose-6-phosphate 1-dehydrogenaseNot AvailableIwatsuki---1081G->AADR InferredIncreased risk of hemolytic anemia. Details
Glucose-6-phosphate 1-dehydrogenaseNot AvailableSerres---1082C->TADR InferredIncreased risk of hemolytic anemia. Details
Glucose-6-phosphate 1-dehydrogenaseNot AvailableTondela---1084_1101delCTGAACGAGCGCAAGGCCADR InferredIncreased risk of hemolytic anemia. Details
Glucose-6-phosphate 1-dehydrogenaseNot AvailableLoma Linda---1089C->AADR InferredIncreased risk of hemolytic anemia. Details
Glucose-6-phosphate 1-dehydrogenaseNot AvailableAachen---1089C->GADR InferredIncreased risk of hemolytic anemia. Details
Glucose-6-phosphate 1-dehydrogenaseNot AvailableTenri---1096A->GADR InferredIncreased risk of hemolytic anemia. Details
Glucose-6-phosphate 1-dehydrogenaseNot AvailableMontpellier---1132G>AADR InferredIncreased risk of hemolytic anemia. Details
Glucose-6-phosphate 1-dehydrogenaseNot AvailableCalvo Mackenna---1138A->GADR InferredIncreased risk of hemolytic anemia. Details
Glucose-6-phosphate 1-dehydrogenaseNot AvailableRiley---1139T->CADR InferredIncreased risk of hemolytic anemia. Details
Glucose-6-phosphate 1-dehydrogenaseNot AvailableOlomouc---1141T->CADR InferredIncreased risk of hemolytic anemia. Details
Glucose-6-phosphate 1-dehydrogenaseNot AvailableTomah---1153T->CADR InferredIncreased risk of hemolytic anemia. Details
Glucose-6-phosphate 1-dehydrogenaseNot AvailableLynwood---1154G->TADR InferredIncreased risk of hemolytic anemia. Details
Glucose-6-phosphate 1-dehydrogenaseNot AvailableMadrid---1155C->GADR InferredIncreased risk of hemolytic anemia. Details
Glucose-6-phosphate 1-dehydrogenaseNot AvailableIowa, Walter Reed, Springfield---1156A->GADR InferredIncreased risk of hemolytic anemia. Details
Glucose-6-phosphate 1-dehydrogenaseNot AvailableBeverly Hills, Genova, Iwate, Niigata, Yamaguchi---1160G->AADR InferredIncreased risk of hemolytic anemia. Details
Glucose-6-phosphate 1-dehydrogenaseNot AvailableHartford---1162A->GADR InferredIncreased risk of hemolytic anemia. Details
Glucose-6-phosphate 1-dehydrogenaseNot AvailablePraha---1166A->GADR InferredIncreased risk of hemolytic anemia. Details
Glucose-6-phosphate 1-dehydrogenaseNot AvailableKrakow---1175T>CADR InferredIncreased risk of hemolytic anemia. Details
Glucose-6-phosphate 1-dehydrogenaseNot AvailableWisconsin---1177C->GADR InferredIncreased risk of hemolytic anemia. Details
Glucose-6-phosphate 1-dehydrogenaseNot AvailableNashville, Anaheim, Portici---1178G->AADR InferredIncreased risk of hemolytic anemia. Details
Glucose-6-phosphate 1-dehydrogenaseNot AvailableAlhambra---1180G->CADR InferredIncreased risk of hemolytic anemia. Details
Glucose-6-phosphate 1-dehydrogenaseNot AvailableBari---1187C->TADR InferredIncreased risk of hemolytic anemia. Details
Glucose-6-phosphate 1-dehydrogenaseNot AvailablePuerto Limon---1192G->AADR InferredIncreased risk of hemolytic anemia. Details
Glucose-6-phosphate 1-dehydrogenaseNot AvailableCovao do Lobo---1205C>AADR InferredIncreased risk of hemolytic anemia. Details
Glucose-6-phosphate 1-dehydrogenaseNot AvailableClinic---1215G->AADR InferredIncreased risk of hemolytic anemia. Details
Glucose-6-phosphate 1-dehydrogenaseNot AvailableUtrecht---1225C->TADR InferredIncreased risk of hemolytic anemia. Details
Glucose-6-phosphate 1-dehydrogenaseNot AvailableSuwalki---1226C->GADR InferredIncreased risk of hemolytic anemia. Details
Glucose-6-phosphate 1-dehydrogenaseNot AvailableRiverside---1228G->TADR InferredIncreased risk of hemolytic anemia. Details
Glucose-6-phosphate 1-dehydrogenaseNot AvailableJapan, Shinagawa---1229G->AADR InferredIncreased risk of hemolytic anemia. Details
Glucose-6-phosphate 1-dehydrogenaseNot AvailableKawasaki---1229G->CADR InferredIncreased risk of hemolytic anemia. Details
Glucose-6-phosphate 1-dehydrogenaseNot AvailableMunich---1231A->GADR InferredIncreased risk of hemolytic anemia. Details
Glucose-6-phosphate 1-dehydrogenaseNot AvailableGeorgia---1284C->AADR InferredIncreased risk of hemolytic anemia. Details
Glucose-6-phosphate 1-dehydrogenaseNot AvailableSumare---1292T->GADR InferredIncreased risk of hemolytic anemia. Details
Glucose-6-phosphate 1-dehydrogenaseNot AvailableTelti/Kobe---1318C->TADR InferredIncreased risk of hemolytic anemia. Details
Glucose-6-phosphate 1-dehydrogenaseNot AvailableSantiago de Cuba, Morioka---1339G->AADR InferredIncreased risk of hemolytic anemia. Details
Glucose-6-phosphate 1-dehydrogenaseNot AvailableHarima---1358T->AADR InferredIncreased risk of hemolytic anemia. Details
Glucose-6-phosphate 1-dehydrogenaseNot AvailableFiguera da Foz---1366G->CADR InferredIncreased risk of hemolytic anemia. Details
Glucose-6-phosphate 1-dehydrogenaseNot AvailableAmiens---1367A>TADR InferredIncreased risk of hemolytic anemia. Details
Glucose-6-phosphate 1-dehydrogenaseNot AvailableBangkok Noi---1376G->T, 1502T->GADR InferredIncreased risk of hemolytic anemia. Details
Glucose-6-phosphate 1-dehydrogenaseNot AvailableFukaya---1462G->AADR InferredIncreased risk of hemolytic anemia. Details
Glucose-6-phosphate 1-dehydrogenaseNot AvailableCampinas---1463G->TADR InferredIncreased risk of hemolytic anemia. Details
Glucose-6-phosphate 1-dehydrogenaseNot AvailableBuenos Aires---1465C>TADR InferredIncreased risk of hemolytic anemia. Details
Glucose-6-phosphate 1-dehydrogenaseNot AvailableArakawa---1466C->TADR InferredIncreased risk of hemolytic anemia. Details
Glucose-6-phosphate 1-dehydrogenaseNot AvailableBrighton---1488_1490delGAAADR InferredIncreased risk of hemolytic anemia. Details
Glucose-6-phosphate 1-dehydrogenaseNot AvailableKozukata---159G->CADR InferredIncreased risk of hemolytic anemia. Details
Glucose-6-phosphate 1-dehydrogenaseNot AvailableAmsterdam---180_182delTCTADR InferredIncreased risk of hemolytic anemia. Details
Glucose-6-phosphate 1-dehydrogenaseNot AvailableNo name---202G->A, 376A->G, 1264C>GADR InferredIncreased risk of hemolytic anemia. Details
Glucose-6-phosphate 1-dehydrogenaseNot AvailableSwansea---224T->CADR InferredIncreased risk of hemolytic anemia. Details
Glucose-6-phosphate 1-dehydrogenaseNot AvailableUrayasu---281_283delAGAADR InferredIncreased risk of hemolytic anemia. Details
Glucose-6-phosphate 1-dehydrogenaseNot AvailableVancouver---317C->G544C->T592C->TADR InferredIncreased risk of hemolytic anemia. Details
Glucose-6-phosphate 1-dehydrogenaseNot AvailableMt Sinai---376A->G, 1159C->TADR InferredIncreased risk of hemolytic anemia. Details
Glucose-6-phosphate 1-dehydrogenaseNot AvailablePlymouth---488G->AADR InferredIncreased risk of hemolytic anemia. Details
Glucose-6-phosphate 1-dehydrogenaseNot AvailableVolendam---514C->TADR InferredIncreased risk of hemolytic anemia. Details
Glucose-6-phosphate 1-dehydrogenaseNot AvailableShinshu---527A->GADR InferredIncreased risk of hemolytic anemia. Details
Glucose-6-phosphate 1-dehydrogenaseNot AvailableChikugo---535A->TADR InferredIncreased risk of hemolytic anemia. Details
Glucose-6-phosphate 1-dehydrogenaseNot AvailableTsukui---561_563delCTCADR InferredIncreased risk of hemolytic anemia. Details
Glucose-6-phosphate 1-dehydrogenaseNot AvailablePedoplis-Ckaro---573C>GADR InferredIncreased risk of hemolytic anemia. Details
Glucose-6-phosphate 1-dehydrogenaseNot AvailableSantiago---593G->CADR InferredIncreased risk of hemolytic anemia. Details
Glucose-6-phosphate 1-dehydrogenaseNot AvailableMinnesota, Marion, Gastonia, LeJeune---637G->TADR InferredIncreased risk of hemolytic anemia. Details
Glucose-6-phosphate 1-dehydrogenaseNot AvailableCincinnati---637G->T, 1037A->TADR InferredIncreased risk of hemolytic anemia. Details
Glucose-6-phosphate 1-dehydrogenaseNot AvailableHarilaou---648T->GADR InferredIncreased risk of hemolytic anemia. Details
Glucose-6-phosphate 1-dehydrogenaseNot AvailableNorth Dallas---683_685delACAADR InferredIncreased risk of hemolytic anemia. Details
Glucose-6-phosphate 1-dehydrogenaseNot AvailableAsahikawa---695G->AADR InferredIncreased risk of hemolytic anemia. Details
Glucose-6-phosphate 1-dehydrogenaseNot AvailableDurham---713A->GADR InferredIncreased risk of hemolytic anemia. Details
Glucose-6-phosphate 1-dehydrogenaseNot AvailableStonybrook---724_729delGGCACTADR InferredIncreased risk of hemolytic anemia. Details
Glucose-6-phosphate 1-dehydrogenaseNot AvailableWayne---769C->GADR InferredIncreased risk of hemolytic anemia. Details
Glucose-6-phosphate 1-dehydrogenaseNot AvailableAveiro---806G->AADR InferredIncreased risk of hemolytic anemia. Details
Glucose-6-phosphate 1-dehydrogenaseNot AvailableCleveland Corum---820G->AADR InferredIncreased risk of hemolytic anemia. Details
Glucose-6-phosphate 1-dehydrogenaseNot AvailableLille---821A>TADR InferredIncreased risk of hemolytic anemia. Details
Glucose-6-phosphate 1-dehydrogenaseNot AvailableBangkok---825G>CADR InferredIncreased risk of hemolytic anemia. Details
Glucose-6-phosphate 1-dehydrogenaseNot AvailableSugao---826C->TADR InferredIncreased risk of hemolytic anemia. Details
Glucose-6-phosphate 1-dehydrogenaseNot AvailableLa Jolla---832T->CADR InferredIncreased risk of hemolytic anemia. Details
Glucose-6-phosphate 1-dehydrogenaseNot AvailableWexham---833C->TADR InferredIncreased risk of hemolytic anemia. Details
Glucose-6-phosphate 1-dehydrogenaseNot AvailablePiotrkow---851T>CADR InferredIncreased risk of hemolytic anemia. Details
Glucose-6-phosphate 1-dehydrogenaseNot AvailableWest Virginia---910G->TADR InferredIncreased risk of hemolytic anemia. Details
Glucose-6-phosphate 1-dehydrogenaseNot AvailableOmiya---921G->CADR InferredIncreased risk of hemolytic anemia. Details
Glucose-6-phosphate 1-dehydrogenaseNot AvailableNara---953_976delCCACCAAAGGGTACCTGGAC GACCADR InferredIncreased risk of hemolytic anemia. Details
Glucose-6-phosphate 1-dehydrogenaseNot AvailableManhattan---962G->AADR InferredIncreased risk of hemolytic anemia. Details
Glucose-6-phosphate 1-dehydrogenaseNot AvailableRehevot---964T->CADR InferredIncreased risk of hemolytic anemia. Details
Glucose-6-phosphate 1-dehydrogenaseNot AvailableHoniara---99A->G, 1360C->TADR InferredIncreased risk of hemolytic anemia. Details
Glucose-6-phosphate 1-dehydrogenaseNot AvailableTokyo, Fukushima---1246G->AADR InferredIncreased risk of hemolytic anemia. Details
Glucose-6-phosphate 1-dehydrogenaseNot AvailableChatham---1003G->AADR InferredIncreased risk of hemolytic anemia. Details
Glucose-6-phosphate 1-dehydrogenaseNot AvailableFushan---1004C->AADR InferredIncreased risk of hemolytic anemia. Details
Glucose-6-phosphate 1-dehydrogenaseNot AvailablePartenope---1052G->TADR InferredIncreased risk of hemolytic anemia. Details
Glucose-6-phosphate 1-dehydrogenaseNot AvailableIerapetra---1057C->TADR InferredIncreased risk of hemolytic anemia. Details
Glucose-6-phosphate 1-dehydrogenaseNot AvailableAnadia---1193A->GADR InferredIncreased risk of hemolytic anemia. Details
Glucose-6-phosphate 1-dehydrogenaseNot AvailableAbeno---1220A->CADR InferredIncreased risk of hemolytic anemia. Details
Glucose-6-phosphate 1-dehydrogenaseNot AvailableSurabaya---1291G->AADR InferredIncreased risk of hemolytic anemia. Details
Glucose-6-phosphate 1-dehydrogenaseNot AvailablePawnee---1316G->CADR InferredIncreased risk of hemolytic anemia. Details
Glucose-6-phosphate 1-dehydrogenaseNot AvailableS. Antioco---1342A->GADR InferredIncreased risk of hemolytic anemia. Details
Glucose-6-phosphate 1-dehydrogenaseNot AvailableCassano---1347G->CADR InferredIncreased risk of hemolytic anemia. Details
Glucose-6-phosphate 1-dehydrogenaseNot AvailableHermoupolis---1347G->C, 1360C->TADR InferredIncreased risk of hemolytic anemia. Details
Glucose-6-phosphate 1-dehydrogenaseNot AvailableUnion,Maewo, Chinese-2, Kalo---1360C->TADR InferredIncreased risk of hemolytic anemia. Details
Glucose-6-phosphate 1-dehydrogenaseNot AvailableAndalus---1361G->AADR InferredIncreased risk of hemolytic anemia. Details
Glucose-6-phosphate 1-dehydrogenaseNot AvailableCosenza---1376G->CADR InferredIncreased risk of hemolytic anemia. Details
Glucose-6-phosphate 1-dehydrogenaseNot AvailableCanton, Taiwan- Hakka, Gifu-like, Agrigento-like---1376G->TADR InferredIncreased risk of hemolytic anemia. Details
Glucose-6-phosphate 1-dehydrogenaseNot AvailableFlores---1387C->AADR InferredIncreased risk of hemolytic anemia. Details
Glucose-6-phosphate 1-dehydrogenaseNot AvailableKaiping, Anant, Dhon, Sapporo-like, Wosera---1388G->AADR InferredIncreased risk of hemolytic anemia. Details
Glucose-6-phosphate 1-dehydrogenaseNot AvailableKamogawa---169C->TADR InferredIncreased risk of hemolytic anemia. Details
Glucose-6-phosphate 1-dehydrogenaseNot AvailableCostanzo---179T>CADR InferredIncreased risk of hemolytic anemia. Details
Glucose-6-phosphate 1-dehydrogenaseNot AvailableAmazonia---185C->AADR InferredIncreased risk of hemolytic anemia. Details
Glucose-6-phosphate 1-dehydrogenaseNot AvailableSongklanagarind---196T->AADR InferredIncreased risk of hemolytic anemia. Details
Glucose-6-phosphate 1-dehydrogenaseNot AvailableHechi---202G->A, 871G->AADR InferredIncreased risk of hemolytic anemia. Details
Glucose-6-phosphate 1-dehydrogenaseNot AvailableNamouru---208T->CADR InferredIncreased risk of hemolytic anemia. Details
Glucose-6-phosphate 1-dehydrogenaseNot AvailableBao Loc---352T>CADR InferredIncreased risk of hemolytic anemia. Details
Glucose-6-phosphate 1-dehydrogenaseNot AvailableCrispim---375G->T, 379G->T383T->C384C>TADR InferredIncreased risk of hemolytic anemia. Details
Glucose-6-phosphate 1-dehydrogenaseNot AvailableAcrokorinthos---376A->G, 463C->GADR InferredIncreased risk of hemolytic anemia. Details
Glucose-6-phosphate 1-dehydrogenaseNot AvailableSanta Maria---376A->G, 542A->TADR InferredIncreased risk of hemolytic anemia. Details
Glucose-6-phosphate 1-dehydrogenaseNot AvailableAnanindeua---376A->G, 871G->AADR InferredIncreased risk of hemolytic anemia. Details
Glucose-6-phosphate 1-dehydrogenaseNot AvailableVanua Lava---383T->CADR InferredIncreased risk of hemolytic anemia. Details
Glucose-6-phosphate 1-dehydrogenaseNot AvailableValladolid---406C->TADR InferredIncreased risk of hemolytic anemia. Details
Glucose-6-phosphate 1-dehydrogenaseNot AvailableBelem---409C->TADR InferredIncreased risk of hemolytic anemia. Details
Glucose-6-phosphate 1-dehydrogenaseNot AvailableLiuzhou---442G->AADR InferredIncreased risk of hemolytic anemia. Details
Glucose-6-phosphate 1-dehydrogenaseNot AvailableShenzen---473G>AADR InferredIncreased risk of hemolytic anemia. Details
Glucose-6-phosphate 1-dehydrogenaseNot AvailableTaipei “Chinese- 3”---493A->GADR InferredIncreased risk of hemolytic anemia. Details
Glucose-6-phosphate 1-dehydrogenaseNot AvailableToledo---496C>TADR InferredIncreased risk of hemolytic anemia. Details
Glucose-6-phosphate 1-dehydrogenaseNot AvailableNaone---497G->AADR InferredIncreased risk of hemolytic anemia. Details
Glucose-6-phosphate 1-dehydrogenaseNot AvailableNankang---517T->CADR InferredIncreased risk of hemolytic anemia. Details
Glucose-6-phosphate 1-dehydrogenaseNot AvailableMiaoli---519C->GADR InferredIncreased risk of hemolytic anemia. Details
Glucose-6-phosphate 1-dehydrogenaseNot AvailableMediterranean, Dallas, Panama‚ Sassari, Cagliari, Birmingham---563C->TADR InferredIncreased risk of hemolytic anemia. Details
Glucose-6-phosphate 1-dehydrogenaseNot AvailableCoimbra Shunde---592C->TADR InferredIncreased risk of hemolytic anemia. Details
Glucose-6-phosphate 1-dehydrogenaseNot AvailableNilgiri---593G>AADR InferredIncreased risk of hemolytic anemia. Details
Glucose-6-phosphate 1-dehydrogenaseNot AvailableRadlowo---679C->TADR InferredIncreased risk of hemolytic anemia. Details
Glucose-6-phosphate 1-dehydrogenaseNot AvailableRoubaix---811G>CADR InferredIncreased risk of hemolytic anemia. Details
Glucose-6-phosphate 1-dehydrogenaseNot AvailableHaikou---835A->GADR InferredIncreased risk of hemolytic anemia. Details
Glucose-6-phosphate 1-dehydrogenaseNot AvailableChinese-1---835A->TADR InferredIncreased risk of hemolytic anemia. Details
Glucose-6-phosphate 1-dehydrogenaseNot AvailableMizushima---848A>GADR InferredIncreased risk of hemolytic anemia. Details
Glucose-6-phosphate 1-dehydrogenaseNot AvailableOsaka---853C->TADR InferredIncreased risk of hemolytic anemia. Details
Glucose-6-phosphate 1-dehydrogenaseNot AvailableViangchan, Jammu---871G->AADR InferredIncreased risk of hemolytic anemia. Details
Glucose-6-phosphate 1-dehydrogenaseNot AvailableSeoul---916G->AADR InferredIncreased risk of hemolytic anemia. Details
Glucose-6-phosphate 1-dehydrogenaseNot AvailableLudhiana---929G->AADR InferredIncreased risk of hemolytic anemia. Details
Glucose-6-phosphate 1-dehydrogenaseNot AvailableFarroupilha---977C->AADR InferredIncreased risk of hemolytic anemia. Details
Glucose-6-phosphate 1-dehydrogenaseNot AvailableChinese-5---1024C->TADR InferredIncreased risk of hemolytic anemia. Details
Glucose-6-phosphate 1-dehydrogenaseNot AvailableRignano---130G>AADR InferredIncreased risk of hemolytic anemia. Details
Glucose-6-phosphate 1-dehydrogenaseNot AvailableOrissa---131C->GADR InferredIncreased risk of hemolytic anemia. Details
Glucose-6-phosphate 1-dehydrogenaseNot AvailableG6PDNice---1380G>CADR InferredIncreased risk of hemolytic anemia. Details
Glucose-6-phosphate 1-dehydrogenaseNot AvailableKamiube, Keelung---1387C->TADR InferredIncreased risk of hemolytic anemia. Details
Glucose-6-phosphate 1-dehydrogenaseNot AvailableNeapolis---1400C->GADR InferredIncreased risk of hemolytic anemia. Details
Glucose-6-phosphate 1-dehydrogenaseNot AvailableAures---143T->CADR InferredIncreased risk of hemolytic anemia. Details
Glucose-6-phosphate 1-dehydrogenaseNot AvailableSplit---1442C->GADR InferredIncreased risk of hemolytic anemia. Details
Glucose-6-phosphate 1-dehydrogenaseNot AvailableKambos---148C->TADR InferredIncreased risk of hemolytic anemia. Details
Glucose-6-phosphate 1-dehydrogenaseNot AvailablePalestrina---170G>AADR InferredIncreased risk of hemolytic anemia. Details
Glucose-6-phosphate 1-dehydrogenaseNot AvailableMetaponto---172G->AADR InferredIncreased risk of hemolytic anemia. Details
Glucose-6-phosphate 1-dehydrogenaseNot AvailableMusashino---185C->TADR InferredIncreased risk of hemolytic anemia. Details
Glucose-6-phosphate 1-dehydrogenaseNot AvailableAsahi---202G->AADR InferredIncreased risk of hemolytic anemia. Details
Glucose-6-phosphate 1-dehydrogenaseNot AvailableA- (202), Ferrara I---202G->A, 376A->GADR InferredIncreased risk of hemolytic anemia. Details
Glucose-6-phosphate 1-dehydrogenaseNot AvailableMurcia Oristano---209A->GADR InferredIncreased risk of hemolytic anemia. Details
Glucose-6-phosphate 1-dehydrogenaseNot AvailableUbe Konan---241C->TADR InferredIncreased risk of hemolytic anemia. Details
Glucose-6-phosphate 1-dehydrogenaseNot AvailableLagosanto---242G->AADR InferredIncreased risk of hemolytic anemia. Details
Glucose-6-phosphate 1-dehydrogenaseNot AvailableGuangzhou---274C->TADR InferredIncreased risk of hemolytic anemia. Details
Glucose-6-phosphate 1-dehydrogenaseNot AvailableHammersmith---323T->AADR InferredIncreased risk of hemolytic anemia. Details
Glucose-6-phosphate 1-dehydrogenaseNot AvailableSinnai---34G->TADR InferredIncreased risk of hemolytic anemia. Details
Glucose-6-phosphate 1-dehydrogenaseNot AvailableA- (680)---376A->G, 680G->TADR InferredIncreased risk of hemolytic anemia. Details
Glucose-6-phosphate 1-dehydrogenaseNot AvailableA- (968), Betica,Selma, Guantanamo---376A->G, 968T->CADR InferredIncreased risk of hemolytic anemia. Details
Glucose-6-phosphate 1-dehydrogenaseNot AvailableSalerno Pyrgos---383T>GADR InferredIncreased risk of hemolytic anemia. Details
Glucose-6-phosphate 1-dehydrogenaseNot AvailableQuing Yan---392G->TADR InferredIncreased risk of hemolytic anemia. Details
Glucose-6-phosphate 1-dehydrogenaseNot AvailableLages---40G->AADR InferredIncreased risk of hemolytic anemia. Details
Glucose-6-phosphate 1-dehydrogenaseNot AvailableIlesha---466G->AADR InferredIncreased risk of hemolytic anemia. Details
Glucose-6-phosphate 1-dehydrogenaseNot AvailableMahidol---487G->AADR InferredIncreased risk of hemolytic anemia. Details
Glucose-6-phosphate 1-dehydrogenaseNot AvailableMalaga---542A->TADR InferredIncreased risk of hemolytic anemia. Details
Glucose-6-phosphate 1-dehydrogenaseNot AvailableSibari---634A->GADR InferredIncreased risk of hemolytic anemia. Details
Glucose-6-phosphate 1-dehydrogenaseNot AvailableMexico City---680G->AADR InferredIncreased risk of hemolytic anemia. Details
Glucose-6-phosphate 1-dehydrogenaseNot AvailableNanning---703C->TADR InferredIncreased risk of hemolytic anemia. Details
Glucose-6-phosphate 1-dehydrogenaseNot AvailableSeattle, Lodi, Modena, Ferrara II, Athens-like---844G->CADR InferredIncreased risk of hemolytic anemia. Details
Glucose-6-phosphate 1-dehydrogenaseNot AvailableBajo Maumere---844G->TADR InferredIncreased risk of hemolytic anemia. Details
Glucose-6-phosphate 1-dehydrogenaseNot AvailableMontalbano---854G->AADR InferredIncreased risk of hemolytic anemia. Details
Glucose-6-phosphate 1-dehydrogenaseNot AvailableKalyan-Kerala, Jamnaga, Rohini---949G->AADR InferredIncreased risk of hemolytic anemia. Details
Glucose-6-phosphate 1-dehydrogenaseNot AvailableGaohe---95A->GADR InferredIncreased risk of hemolytic anemia. Details
Drug Interactions
DrugInteractionDrug group
DapsoneThe risk or severity of adverse effects can be increased when Dapsone is combined with Nitrofurantoin.Approved, Investigational
EltrombopagThe serum concentration of Nitrofurantoin can be increased when it is combined with Eltrombopag.Approved
EplerenoneNitrofurantoin may increase the hyperkalemic activities of Eplerenone.Approved
Magnesium TrisilicateThe serum concentration of Nitrofurantoin can be decreased when it is combined with Magnesium Trisilicate.Approved
Nitric OxideThe risk or severity of adverse effects can be increased when Nitric Oxide is combined with Nitrofurantoin.Approved
NorfloxacinThe therapeutic efficacy of Norfloxacin can be decreased when used in combination with Nitrofurantoin.Approved
PrilocaineThe risk or severity of adverse effects can be increased when Nitrofurantoin is combined with Prilocaine.Approved
ProbenecidThe serum concentration of Nitrofurantoin can be increased when it is combined with Probenecid.Approved
RolapitantThe serum concentration of Nitrofurantoin can be increased when it is combined with Rolapitant.Approved
Sodium NitriteThe risk or severity of adverse effects can be increased when Nitrofurantoin is combined with Sodium Nitrite.Approved
SpironolactoneNitrofurantoin may increase the hyperkalemic activities of Spironolactone.Approved
TeriflunomideThe serum concentration of Nitrofurantoin can be increased when it is combined with Teriflunomide.Approved
Food Interactions
  • Do not take magnesium at the same time.
  • Take with food since it increases bioavailability and reduces irritation.
Synthesis Reference

Tara Bielski, Kerry Benson, “Novel orally administrable formulation of nitrofurantoin and a method for preparing said formulation.” U.S. Patent US20050202079, issued September 15, 2005.

General ReferencesNot Available
External Links
ATC CodesJ01XE51J01XE01
AHFS Codes
  • 08:36.00
PDB Entries
FDA labelDownload (923 KB)
MSDSDownload (73.6 KB)
Clinical Trials
Clinical Trials
0Not Yet RecruitingPreventionComplications of Surgical Procedures1
1CompletedNot AvailableHealthy Volunteers3
2CompletedTreatmentUrinary Tract Infections (UTIs)1
3RecruitingPreventionChronic Kidney Disease (CKD) / Renal HYPODYSPLASIA, Nonsyndromic, 1 / Vesicoureteral Reflux1
4CompletedPreventionUrinary Tract Infection: [Site Not Specified] or [Recurrent] / Urinary Tract Infections, Recurrent1
4CompletedPreventionUrinary Tract Infections (UTIs)1
4CompletedTreatmentPost-Operative Urinary Tract Infection in Patients Undergoing Placement of a Sub-Urethral Sling for the Treatment of Stress Urinary Incontinence / Stress Incontinence1
4CompletedTreatmentUncomplicated Bacterial Cystitis1
4CompletedTreatmentUrinary Tract Infections (UTIs)1
4Enrolling by InvitationPreventionKidney Stones / Renal Calculus1
4RecruitingPreventionCalcium Nephrolithiasis / Urinary Tract Infections (UTIs)1
4RecruitingPreventionPelvic Organ Prolapse (POP)1
4RecruitingTreatmentCystitis / Urinary Tract Infections (UTIs)1
Not AvailableCompletedNot AvailableHealthy Volunteers1
Not AvailableRecruitingPreventionCalcium Nephrolithiasis / Sepsis / Urinary Tract Infections (UTIs)1
Not AvailableRecruitingTreatmentBacteriuria (Asymptomatic) in Pregnancy1
Not AvailableTerminatedTreatmentUrinary Tract Infections (UTIs)1
  • Watson laboratories inc
  • Shionogi pharma inc
  • Procter and gamble pharmaceuticals inc sub procter and gamble co
  • Lannett co inc
  • Elkins sinn div ah robins co inc
  • Ivax pharmaceuticals inc sub teva pharmaceuticals usa
  • Sandoz inc
  • Whiteworth towne paulsen inc
  • Alvogen inc
  • Mylan pharmaceuticals inc
Dosage forms
CapsuleOral25 mg
CapsuleOral25 mg/1
SuspensionOral25 mg/5mL
TabletOral100 mg
TabletOral50 mg
CapsuleOral100 mg/1
CapsuleOral50 mg/1
SuspensionOral5 mg
CapsuleOral100 mg
CapsuleOral50 mg
Unit descriptionCostUnit
Macrobid 100 mg capsule3.02USD capsule
Macrodantin 100 mg capsule2.67USD capsule
Furadantin 25 mg/5ml Suspension2.22USD ml
Furadantin 25 mg/5 ml susp2.13USD ml
Nitrofurantoin powder2.13USD g
Nitrofurantoin Monohyd Macro 100 mg capsule2.12USD capsule
Nitrofurantoin mono-mcr 100 mg2.04USD each
Nitrofurantoin-macro 100 mg2.04USD each
Nitrofurantoin Macrocrystal 100 mg capsule1.88USD capsule
Nitrofurantoin mcr 100 mg capsule1.86USD capsule
Macrodantin 50 mg capsule1.67USD capsule
Macrodantin 25 mg capsule1.3USD capsule
Nitrofurantoin Macrocrystal 50 mg capsule1.14USD capsule
Nitrofurantoin mcr 50 mg capsule1.09USD capsule
Macrobid 100 mg Capsule (Macrocrystals/Monohydrate)0.78USD capsule
Novo-Furantoin 100 mg Capsule (Macrocrystals)0.66USD capsule
Novo-Furantoin 50 mg Capsule (Macrocrystals)0.35USD capsule
Apo-Nitrofurantoin 100 mg Tablet0.23USD tablet
Apo-Nitrofurantoin 50 mg Tablet0.17USD tablet
DrugBank does not sell nor buy drugs. Pricing information is supplied for informational purposes only.
PatentsNot Available
Experimental Properties
melting point223-228Gever, G.; U.S. Patent 2,802,002; August 6, 1957; assigned to The Norwich Pharmacal Co.
water solubility79.5 mg/L (at 24 °C)YALKOWSKY,SH & DANNENFELSER,RM (1992)
logP-0.47HANSCH,C ET AL. (1995)
pKa7.2SANGSTER (1994)
Predicted Properties
Water Solubility0.415 mg/mLALOGPS
pKa (Strongest Acidic)8.23ChemAxon
pKa (Strongest Basic)-2.2ChemAxon
Physiological Charge0ChemAxon
Hydrogen Acceptor Count5ChemAxon
Hydrogen Donor Count1ChemAxon
Polar Surface Area118.05 Å2ChemAxon
Rotatable Bond Count3ChemAxon
Refractivity52.11 m3·mol-1ChemAxon
Polarizability20.49 Å3ChemAxon
Number of Rings2ChemAxon
Rule of FiveYesChemAxon
Ghose FilterYesChemAxon
Veber's RuleYesChemAxon
MDDR-like RuleYesChemAxon
Predicted ADMET features
Human Intestinal Absorption+0.9832
Blood Brain Barrier+0.958
Caco-2 permeable-0.575
P-glycoprotein substrateNon-substrate0.6374
P-glycoprotein inhibitor INon-inhibitor0.8661
P-glycoprotein inhibitor IINon-inhibitor0.9834
Renal organic cation transporterNon-inhibitor0.8835
CYP450 2C9 substrateNon-substrate0.8373
CYP450 2D6 substrateNon-substrate0.8757
CYP450 3A4 substrateSubstrate0.5799
CYP450 1A2 substrateInhibitor0.9107
CYP450 2C9 inhibitorNon-inhibitor0.9071
CYP450 2D6 inhibitorNon-inhibitor0.9231
CYP450 2C19 inhibitorNon-inhibitor0.9025
CYP450 3A4 inhibitorNon-inhibitor0.9069
CYP450 inhibitory promiscuityLow CYP Inhibitory Promiscuity0.8943
Ames testAMES toxic0.9231
BiodegradationReady biodegradable0.7448
Rat acute toxicity2.5717 LD50, mol/kg Not applicable
hERG inhibition (predictor I)Weak inhibitor0.7981
hERG inhibition (predictor II)Non-inhibitor0.94
ADMET data is predicted using admetSAR, a free tool for evaluating chemical ADMET properties. (23092397 )
Mass Spec (NIST)Not Available
SpectraNot Available
DescriptionThis compound belongs to the class of organic compounds known as hydantoins. These are heterocyclic compounds containing an imidazolidine substituted by ketone group at positions 2 and 4.
KingdomOrganic compounds
Super ClassOrganoheterocyclic compounds
Sub ClassImidazolidines
Direct ParentHydantoins
Alternative Parents
  • Hydantoin
  • Alpha-amino acid or derivatives
  • Nitroaromatic compound
  • 2-nitrofuran
  • Ureide
  • Semicarbazone
  • Dicarboximide
  • Furan
  • Heteroaromatic compound
  • Semicarbazide
  • C-nitro compound
  • Organic nitro compound
  • Organic 1,3-dipolar compound
  • Propargyl-type 1,3-dipolar organic compound
  • Carboxylic acid derivative
  • Oxacycle
  • Organic oxoazanium
  • Azacycle
  • Allyl-type 1,3-dipolar organic compound
  • Organic oxygen compound
  • Carbonyl group
  • Organic nitrogen compound
  • Organonitrogen compound
  • Organooxygen compound
  • Organic oxide
  • Organic salt
  • Organic zwitterion
  • Hydrocarbon derivative
  • Aromatic heteromonocyclic compound
Molecular FrameworkAromatic heteromonocyclic compounds
External Descriptors


Escherichia coli (strain K12)
Pharmacological action
General Function:
Thiamine pyrophosphate binding
Specific Function:
Oxidoreductase required for the transfer of electrons from pyruvate to flavodoxin.
Gene Name:
Uniprot ID:
Molecular Weight:
128823.205 Da
  1. Overington JP, Al-Lazikani B, Hopkins AL: How many drug targets are there? Nat Rev Drug Discov. 2006 Dec;5(12):993-6. [PubMed:17139284 ]
  2. Imming P, Sinning C, Meyer A: Drugs, their targets and the nature and number of drug targets. Nat Rev Drug Discov. 2006 Oct;5(10):821-34. [PubMed:17016423 ]
  3. Breeze AS, Obaseiki-Ebor EE: Nitrofuran reductase activity in nitrofurantoin-resistant strains of Escherichia coli K12: some with chromosomally determined resistance and others carrying R-plasmids. J Antimicrob Chemother. 1983 Dec;12(6):543-7. [PubMed:6363380 ]
  4. Sisson G, Goodwin A, Raudonikiene A, Hughes NJ, Mukhopadhyay AK, Berg DE, Hoffman PS: Enzymes associated with reductive activation and action of nitazoxanide, nitrofurans, and metronidazole in Helicobacter pylori. Antimicrob Agents Chemother. 2002 Jul;46(7):2116-23. [PubMed:12069963 ]
Escherichia coli (strain K12)
Pharmacological action
General Function:
Oxidoreductase activity, acting on nad(p)h, nitrogenous group as acceptor
Specific Function:
Reduction of nitroaromatic compounds using NADH. Reduces nitrofurazone by a ping-pong bi-bi mechanism possibly to generate a two-electron transfer product. Major component of the oxygen-insensitive nitroreductase activity in E.coli.
Gene Name:
Uniprot ID:
Molecular Weight:
26800.375 Da
  1. Overington JP, Al-Lazikani B, Hopkins AL: How many drug targets are there? Nat Rev Drug Discov. 2006 Dec;5(12):993-6. [PubMed:17139284 ]
  2. Imming P, Sinning C, Meyer A: Drugs, their targets and the nature and number of drug targets. Nat Rev Drug Discov. 2006 Oct;5(10):821-34. [PubMed:17016423 ]
  3. Kutty R, Bennett GN: Biochemical characterization of trinitrotoluene transforming oxygen-insensitive nitroreductases from Clostridium acetobutylicum ATCC 824. Arch Microbiol. 2005 Nov;184(3):158-67. Epub 2005 Nov 10. [PubMed:16187099 ]
  4. Lightfoot RT, Shuman D, Ischiropoulos H: Oxygen-insensitive nitroreductases of Escherichia coli do not reduce 3-nitrotyrosine. Free Radic Biol Med. 2000 Apr 1;28(7):1132-6. [PubMed:10832075 ]
Escherichia coli (strain K12)
Pharmacological action
General Function:
Trna binding
Specific Function:
Involved in the binding of tRNA to the ribosomes.
Gene Name:
Uniprot ID:
Molecular Weight:
11735.47 Da
  1. Overington JP, Al-Lazikani B, Hopkins AL: How many drug targets are there? Nat Rev Drug Discov. 2006 Dec;5(12):993-6. [PubMed:17139284 ]
  2. Imming P, Sinning C, Meyer A: Drugs, their targets and the nature and number of drug targets. Nat Rev Drug Discov. 2006 Oct;5(10):821-34. [PubMed:17016423 ]


Pharmacological action
General Function:
Oxidoreductase activity, acting on paired donors, with incorporation or reduction of molecular oxygen, nad(p)h as one donor, and incorporation of one atom of oxygen
Specific Function:
This enzyme is required for electron transfer from NADP to cytochrome P450 in microsomes. It can also provide electron transfer to heme oxygenase and cytochrome B5.
Gene Name:
Uniprot ID:
Molecular Weight:
76689.12 Da
  1. Wang Y, Gray JP, Mishin V, Heck DE, Laskin DL, Laskin JD: Role of cytochrome P450 reductase in nitrofurantoin-induced redox cycling and cytotoxicity. Free Radic Biol Med. 2008 Mar 15;44(6):1169-79. doi: 10.1016/j.freeradbiomed.2007.12.013. Epub 2007 Dec 23. [PubMed:18206659 ]


Pharmacological action
General Function:
Xenobiotic-transporting atpase activity
Specific Function:
High-capacity urate exporter functioning in both renal and extrarenal urate excretion. Plays a role in porphyrin homeostasis as it is able to mediates the export of protoporhyrin IX (PPIX) both from mitochondria to cytosol and from cytosol to extracellular space, and cellular export of hemin, and heme. Xenobiotic transporter that may play an important role in the exclusion of xenobiotics from t...
Gene Name:
Uniprot ID:
Molecular Weight:
72313.47 Da
  1. Perez M, Real R, Mendoza G, Merino G, Prieto JG, Alvarez AI: Milk secretion of nitrofurantoin, as a specific BCRP/ABCG2 substrate, in assaf sheep: modulation by isoflavones. J Vet Pharmacol Ther. 2009 Oct;32(5):498-502. doi: 10.1111/j.1365-2885.2008.01050.x. [PubMed:19754918 ]
comments powered by Disqus
Drug created on June 13, 2005 07:24 / Updated on April 21, 2017 10:58