Jump to section
IdentificationPharmacologyInteractionsReferencesTrialsEconomicsPropertiesSpectraTaxonomyNitrous acid
Identification
- Name
- Nitrous acid
- Accession Number
- DB09112
- Type
- Small Molecule
- Groups
- Approved, Investigational
- Description
Nitrous acid (as sodium nitrite) is used as part of an intravenous mixture with sodium thiosulfate to treat cyanide poisoning. It is on the World Health Organization's List of Essential Medicines, a list of the most important medications needed in a basic health system. There is also research to investigate its applicability towards treatments for heart attacks, brain aneurysms, pulmonary hypertension in infants, and Pseudomonas aeruginosa infections.
- Structure
Structure for DB09112 (Nitrous acid)
- Synonyms
- dioxonitric acid
- hydroxidooxidonitrogen
- nitrosyl hydroxide
- Product Ingredients
Ingredient UNII CAS InChI Key Potassium nitrite 794654G42L Not Available Not applicable Sodium nitrite M0KG633D4F 7632-00-0 LPXPTNMVRIOKMN-UHFFFAOYSA-M - Prescription Products
Name Dosage Strength Route Labeller Marketing Start Marketing End Sodium Nitrite Injection, solution 30 mg/mL Intravenous Hope Pharmaceuticals 2012-02-14 Not applicable US 
Sodium Nitrite Injection, USP Solution 30 mg Intravenous Hope Pharmaceuticals 2016-07-20 Not applicable Canada 
- Mixture Products
Name Ingredients Dosage Route Labeller Marketing Start Marketing End Nithiodote Nitrous acid + Thiosulfuric acid Kit Hope Pharmaceuticals 2011-01-14 Not applicable US - Categories
- Acids
- Acids, Noncarboxylic
- Anions
- Antidotes
- Diet, Food, and Nutrition
- Electrolytes
- Food
- Food Additives
- Food and Beverages
- Food Preservatives
- Hypotensive Agents
- Indicators and Reagents
- Ions
- Laboratory Chemicals
- Methemoglobinemia Associated Agents
- Nitrites
- Nitrogen Compounds
- Nitrous Acid
- Physiological Phenomena
- Sodium Compounds
- UNII
- T2I5UM75DN
- CAS number
- 7782-77-6
- Weight
- Average: 47.0134
Monoisotopic: 47.000728281 - Chemical Formula
- HNO2
- InChI Key
- IOVCWXUNBOPUCH-UHFFFAOYSA-N
- InChI
- InChI=1S/HNO2/c2-1-3/h(H,2,3)
- IUPAC Name
- nitrous acid
- SMILES
- ON=O
Pharmacology
- Indication
For sequential use with sodium thiosulfate for the treatment of acute cyanide poisoning that is judged to be life-threatening [FDA Label].
- Associated Conditions
- Pharmacodynamics
Sodium nitrite reverses cyanide toxicity and produces blood vessel dilation [1].
- Mechanism of action
Cyanide has a high affinity for the oxidized form of iron (Fe3+) such as that found in cytochrome oxidase a3 [2]. Cyanide binds to and inhibits cytochrome oxidase a3, preventing oxidative phophorylation from occuring. The resultant lack of ATP cannot support normal cellular processes, particularly in the brain. Compensatory increases in anaerobic respiration result in rising levels of lactic acid and subsequent acidosis.
Nitrite primarily acts by oxidizing hemoglobin to methemoglobin [1]. The now oxidized Fe3+ in methemoglobin also binds cyanide with high affinity and accepts cyanide from cytochrome a3. This leaves cytochrome a3 free to resume its function in oxidative phosphorylation. The slow dissociation of cyanide from methemoglobin allows hepatic enzymes such as rhodanese to detoxify the compound without further systemic toxicity occuring. Methemoglobin is reduced back to hemoglobin by methemoglobin reductase allowing the affected blood cells to resume normal functioning.
The reduction of nitrite by hemoglobin results in the formation of nitric oxide [3]. Nitric oxide acts as a powerful vasodilator, producing vascular smooth muscle relaxation through activation of soluble guanylate cyclase and the subsequent cyclic guanylyl triphosphate mediated signalling cascade [4].
Target Actions Organism AHemoglobin subunit alpha oxidizerHuman AHemoglobin subunit beta oxidizerHuman UMyoglobin oxidizerHuman - Absorption
- Not Available
- Volume of distribution
- Not Available
- Protein binding
- Not Available
- Metabolism
Reduced by deoxyhemoglobin to form nitric oxide [3]. Nitrite is also reduced to nitric oxide and further reduced to ammonia by gut bacteria [6]. Nitrite can be oxidized to nitrate by oxyhemoglobin.
- Route of elimination
- Not Available
- Half life
Half life of 0.4-0.78h [5].
- Clearance
- Not Available
- Toxicity
Oral LD50 of 157.9mg/kg observed in rats and 175mg/kg observed in mice [MSDS]. Estimated oral LD50 of 35mg/kg in humans [1]. Sodium nitrite toxicity manifests as cardiovascular collapse following severe hypotension due to nitrite's vasodilatory action.
- Affected organisms
- Not Available
- Pathways
- Not Available
- Pharmacogenomic Effects/ADRs
Interacting Gene/Enzyme Allele name Genotype(s) Defining Change(s) Type(s) Description Details Glucose-6-phosphate 1-dehydrogenase Villeurbanne Not Available 1000_1002delACC ADR Inferred Increased risk of hemolytic crisis. Details Glucose-6-phosphate 1-dehydrogenase Torun Not Available 1006A->G ADR Inferred Increased risk of hemolytic crisis. Details Glucose-6-phosphate 1-dehydrogenase Sunderland Not Available 105_107delCAT ADR Inferred Increased risk of hemolytic crisis. Details Glucose-6-phosphate 1-dehydrogenase Iwatsuki Not Available 1081G->A ADR Inferred Increased risk of hemolytic crisis. Details Glucose-6-phosphate 1-dehydrogenase Serres Not Available 1082C->T ADR Inferred Increased risk of hemolytic crisis. Details Glucose-6-phosphate 1-dehydrogenase Tondela Not Available 1084_1101delCTGAACGAGCGCAAGGCC ADR Inferred Increased risk of hemolytic crisis. Details Glucose-6-phosphate 1-dehydrogenase Loma Linda Not Available 1089C->A ADR Inferred Increased risk of hemolytic crisis. Details Glucose-6-phosphate 1-dehydrogenase Aachen Not Available 1089C->G ADR Inferred Increased risk of hemolytic crisis. Details Glucose-6-phosphate 1-dehydrogenase Tenri Not Available 1096A->G ADR Inferred Increased risk of hemolytic crisis. Details Glucose-6-phosphate 1-dehydrogenase Montpellier Not Available 1132G>A ADR Inferred Increased risk of hemolytic crisis. Details Glucose-6-phosphate 1-dehydrogenase Calvo Mackenna Not Available 1138A->G ADR Inferred Increased risk of hemolytic crisis. Details Glucose-6-phosphate 1-dehydrogenase Riley Not Available 1139T->C ADR Inferred Increased risk of hemolytic crisis. Details Glucose-6-phosphate 1-dehydrogenase Olomouc Not Available 1141T->C ADR Inferred Increased risk of hemolytic crisis. Details Glucose-6-phosphate 1-dehydrogenase Tomah Not Available 1153T->C ADR Inferred Increased risk of hemolytic crisis. Details Glucose-6-phosphate 1-dehydrogenase Lynwood Not Available 1154G->T ADR Inferred Increased risk of hemolytic crisis. Details Glucose-6-phosphate 1-dehydrogenase Madrid Not Available 1155C->G ADR Inferred Increased risk of hemolytic crisis. Details Glucose-6-phosphate 1-dehydrogenase Iowa, Walter Reed, Springfield Not Available 1156A->G ADR Inferred Increased risk of hemolytic crisis. Details Glucose-6-phosphate 1-dehydrogenase Beverly Hills, Genova, Iwate, Niigata, Yamaguchi Not Available 1160G->A ADR Inferred Increased risk of hemolytic crisis. Details Glucose-6-phosphate 1-dehydrogenase Hartford Not Available 1162A->G ADR Inferred Increased risk of hemolytic crisis. Details Glucose-6-phosphate 1-dehydrogenase Praha Not Available 1166A->G ADR Inferred Increased risk of hemolytic crisis. Details Glucose-6-phosphate 1-dehydrogenase Krakow Not Available 1175T>C ADR Inferred Increased risk of hemolytic crisis. Details Glucose-6-phosphate 1-dehydrogenase Wisconsin Not Available 1177C->G ADR Inferred Increased risk of hemolytic crisis. Details Glucose-6-phosphate 1-dehydrogenase Nashville, Anaheim, Portici Not Available 1178G->A ADR Inferred Increased risk of hemolytic crisis. Details Glucose-6-phosphate 1-dehydrogenase Alhambra Not Available 1180G->C ADR Inferred Increased risk of hemolytic crisis. Details Glucose-6-phosphate 1-dehydrogenase Bari Not Available 1187C->T ADR Inferred Increased risk of hemolytic crisis. Details Glucose-6-phosphate 1-dehydrogenase Puerto Limon Not Available 1192G->A ADR Inferred Increased risk of hemolytic crisis. Details Glucose-6-phosphate 1-dehydrogenase Covao do Lobo Not Available 1205C>A ADR Inferred Increased risk of hemolytic crisis. Details Glucose-6-phosphate 1-dehydrogenase Clinic Not Available 1215G->A ADR Inferred Increased risk of hemolytic crisis. Details Glucose-6-phosphate 1-dehydrogenase Utrecht Not Available 1225C->T ADR Inferred Increased risk of hemolytic crisis. Details Glucose-6-phosphate 1-dehydrogenase Suwalki Not Available 1226C->G ADR Inferred Increased risk of hemolytic crisis. Details Glucose-6-phosphate 1-dehydrogenase Riverside Not Available 1228G->T ADR Inferred Increased risk of hemolytic crisis. Details Glucose-6-phosphate 1-dehydrogenase Japan, Shinagawa Not Available 1229G->A ADR Inferred Increased risk of hemolytic crisis. Details Glucose-6-phosphate 1-dehydrogenase Kawasaki Not Available 1229G->C ADR Inferred Increased risk of hemolytic crisis. Details Glucose-6-phosphate 1-dehydrogenase Munich Not Available 1231A->G ADR Inferred Increased risk of hemolytic crisis. Details Glucose-6-phosphate 1-dehydrogenase Georgia Not Available 1284C->A ADR Inferred Increased risk of hemolytic crisis. Details Glucose-6-phosphate 1-dehydrogenase Sumare Not Available 1292T->G ADR Inferred Increased risk of hemolytic crisis. Details Glucose-6-phosphate 1-dehydrogenase Telti/Kobe Not Available 1318C->T ADR Inferred Increased risk of hemolytic crisis. Details Glucose-6-phosphate 1-dehydrogenase Santiago de Cuba, Morioka Not Available 1339G->A ADR Inferred Increased risk of hemolytic crisis. Details Glucose-6-phosphate 1-dehydrogenase Harima Not Available 1358T->A ADR Inferred Increased risk of hemolytic crisis. Details Glucose-6-phosphate 1-dehydrogenase Figuera da Foz Not Available 1366G->C ADR Inferred Increased risk of hemolytic crisis. Details Glucose-6-phosphate 1-dehydrogenase Amiens Not Available 1367A>T ADR Inferred Increased risk of hemolytic crisis. Details Glucose-6-phosphate 1-dehydrogenase Bangkok Noi Not Available 1376G->T, 1502T->G ADR Inferred Increased risk of hemolytic crisis. Details Glucose-6-phosphate 1-dehydrogenase Fukaya Not Available 1462G->A ADR Inferred Increased risk of hemolytic crisis. Details Glucose-6-phosphate 1-dehydrogenase Campinas Not Available 1463G->T ADR Inferred Increased risk of hemolytic crisis. Details Glucose-6-phosphate 1-dehydrogenase Buenos Aires Not Available 1465C>T ADR Inferred Increased risk of hemolytic crisis. Details Glucose-6-phosphate 1-dehydrogenase Arakawa Not Available 1466C->T ADR Inferred Increased risk of hemolytic crisis. Details Glucose-6-phosphate 1-dehydrogenase Brighton Not Available 1488_1490delGAA ADR Inferred Increased risk of hemolytic crisis. Details Glucose-6-phosphate 1-dehydrogenase Kozukata Not Available 159G->C ADR Inferred Increased risk of hemolytic crisis. Details Glucose-6-phosphate 1-dehydrogenase Amsterdam Not Available 180_182delTCT ADR Inferred Increased risk of hemolytic crisis. Details Glucose-6-phosphate 1-dehydrogenase No name Not Available 202G->A, 376A->G, 1264C>G ADR Inferred Increased risk of hemolytic crisis. Details Glucose-6-phosphate 1-dehydrogenase Swansea Not Available 224T->C ADR Inferred Increased risk of hemolytic crisis. Details Glucose-6-phosphate 1-dehydrogenase Urayasu Not Available 281_283delAGA ADR Inferred Increased risk of hemolytic crisis. Details Glucose-6-phosphate 1-dehydrogenase Vancouver Not Available 317C->G544C->T592C->T ADR Inferred Increased risk of hemolytic crisis. Details Glucose-6-phosphate 1-dehydrogenase Mt Sinai Not Available 376A->G, 1159C->T ADR Inferred Increased risk of hemolytic crisis. Details Glucose-6-phosphate 1-dehydrogenase Plymouth Not Available 488G->A ADR Inferred Increased risk of hemolytic crisis. Details Glucose-6-phosphate 1-dehydrogenase Volendam Not Available 514C->T ADR Inferred Increased risk of hemolytic crisis. Details Glucose-6-phosphate 1-dehydrogenase Shinshu Not Available 527A->G ADR Inferred Increased risk of hemolytic crisis. Details Glucose-6-phosphate 1-dehydrogenase Chikugo Not Available 535A->T ADR Inferred Increased risk of hemolytic crisis. Details Glucose-6-phosphate 1-dehydrogenase Tsukui Not Available 561_563delCTC ADR Inferred Increased risk of hemolytic crisis. Details Glucose-6-phosphate 1-dehydrogenase Pedoplis-Ckaro Not Available 573C>G ADR Inferred Increased risk of hemolytic crisis. Details Glucose-6-phosphate 1-dehydrogenase Santiago Not Available 593G->C ADR Inferred Increased risk of hemolytic crisis. Details Glucose-6-phosphate 1-dehydrogenase Minnesota, Marion, Gastonia, LeJeune Not Available 637G->T ADR Inferred Increased risk of hemolytic crisis. Details Glucose-6-phosphate 1-dehydrogenase Cincinnati Not Available 637G->T, 1037A->T ADR Inferred Increased risk of hemolytic crisis. Details Glucose-6-phosphate 1-dehydrogenase Harilaou Not Available 648T->G ADR Inferred Increased risk of hemolytic crisis. Details Glucose-6-phosphate 1-dehydrogenase North Dallas Not Available 683_685delACA ADR Inferred Increased risk of hemolytic crisis. Details Glucose-6-phosphate 1-dehydrogenase Asahikawa Not Available 695G->A ADR Inferred Increased risk of hemolytic crisis. Details Glucose-6-phosphate 1-dehydrogenase Durham Not Available 713A->G ADR Inferred Increased risk of hemolytic crisis. Details Glucose-6-phosphate 1-dehydrogenase Stonybrook Not Available 724_729delGGCACT ADR Inferred Increased risk of hemolytic crisis. Details Glucose-6-phosphate 1-dehydrogenase Wayne Not Available 769C->G ADR Inferred Increased risk of hemolytic crisis. Details Glucose-6-phosphate 1-dehydrogenase Aveiro Not Available 806G->A ADR Inferred Increased risk of hemolytic crisis. Details Glucose-6-phosphate 1-dehydrogenase Cleveland Corum Not Available 820G->A ADR Inferred Increased risk of hemolytic crisis. Details Glucose-6-phosphate 1-dehydrogenase Lille Not Available 821A>T ADR Inferred Increased risk of hemolytic crisis. Details Glucose-6-phosphate 1-dehydrogenase Bangkok Not Available 825G>C ADR Inferred Increased risk of hemolytic crisis. Details Glucose-6-phosphate 1-dehydrogenase Sugao Not Available 826C->T ADR Inferred Increased risk of hemolytic crisis. Details Glucose-6-phosphate 1-dehydrogenase La Jolla Not Available 832T->C ADR Inferred Increased risk of hemolytic crisis. Details Glucose-6-phosphate 1-dehydrogenase Wexham Not Available 833C->T ADR Inferred Increased risk of hemolytic crisis. Details Glucose-6-phosphate 1-dehydrogenase Piotrkow Not Available 851T>C ADR Inferred Increased risk of hemolytic crisis. Details Glucose-6-phosphate 1-dehydrogenase West Virginia Not Available 910G->T ADR Inferred Increased risk of hemolytic crisis. Details Glucose-6-phosphate 1-dehydrogenase Omiya Not Available 921G->C ADR Inferred Increased risk of hemolytic crisis. Details Glucose-6-phosphate 1-dehydrogenase Nara Not Available 953_976delCCACCAAAGGGTACCTGGAC GACC ADR Inferred Increased risk of hemolytic crisis. Details Glucose-6-phosphate 1-dehydrogenase Manhattan Not Available 962G->A ADR Inferred Increased risk of hemolytic crisis. Details Glucose-6-phosphate 1-dehydrogenase Rehevot Not Available 964T->C ADR Inferred Increased risk of hemolytic crisis. Details Glucose-6-phosphate 1-dehydrogenase Honiara Not Available 99A->G / 1360C->T ADR Inferred Increased risk of hemolytic crisis. Details Glucose-6-phosphate 1-dehydrogenase Tokyo, Fukushima Not Available 1246G->A ADR Inferred Increased risk of hemolytic crisis. Details Glucose-6-phosphate 1-dehydrogenase Chatham Not Available 1003G->A ADR Inferred Increased risk of hemolytic crisis. Details Glucose-6-phosphate 1-dehydrogenase Fushan Not Available 1004C->A ADR Inferred Increased risk of hemolytic crisis. Details Glucose-6-phosphate 1-dehydrogenase Partenope Not Available 1052G->T ADR Inferred Increased risk of hemolytic crisis. Details Glucose-6-phosphate 1-dehydrogenase Ierapetra Not Available 1057C->T ADR Inferred Increased risk of hemolytic crisis. Details Glucose-6-phosphate 1-dehydrogenase Anadia Not Available 1193A->G ADR Inferred Increased risk of hemolytic crisis. Details Glucose-6-phosphate 1-dehydrogenase Abeno Not Available 1220A->C ADR Inferred Increased risk of hemolytic crisis. Details Glucose-6-phosphate 1-dehydrogenase Surabaya Not Available 1291G->A ADR Inferred Increased risk of hemolytic crisis. Details Glucose-6-phosphate 1-dehydrogenase Pawnee Not Available 1316G->C ADR Inferred Increased risk of hemolytic crisis. Details Glucose-6-phosphate 1-dehydrogenase S. Antioco Not Available 1342A->G ADR Inferred Increased risk of hemolytic crisis. Details Glucose-6-phosphate 1-dehydrogenase Cassano Not Available 1347G->C ADR Inferred Increased risk of hemolytic crisis. Details Glucose-6-phosphate 1-dehydrogenase Hermoupolis Not Available 1347G->C / 1360C->T ADR Inferred Increased risk of hemolytic crisis. Details Glucose-6-phosphate 1-dehydrogenase Union,Maewo, Chinese-2, Kalo Not Available 1360C->T ADR Inferred Increased risk of hemolytic crisis. Details Glucose-6-phosphate 1-dehydrogenase Andalus Not Available 1361G->A ADR Inferred Increased risk of hemolytic crisis. Details Glucose-6-phosphate 1-dehydrogenase Cosenza Not Available 1376G->C ADR Inferred Increased risk of hemolytic crisis. Details Glucose-6-phosphate 1-dehydrogenase Canton, Taiwan- Hakka, Gifu-like, Agrigento-like Not Available 1376G->T ADR Inferred Increased risk of hemolytic crisis. Details Glucose-6-phosphate 1-dehydrogenase Flores Not Available 1387C->A ADR Inferred Increased risk of hemolytic crisis. Details Glucose-6-phosphate 1-dehydrogenase Kaiping, Anant, Dhon, Sapporo-like, Wosera Not Available 1388G->A ADR Inferred Increased risk of hemolytic crisis. Details Glucose-6-phosphate 1-dehydrogenase Kamogawa Not Available 169C->T ADR Inferred Increased risk of hemolytic crisis. Details Glucose-6-phosphate 1-dehydrogenase Costanzo Not Available 179T>C ADR Inferred Increased risk of hemolytic crisis. Details Glucose-6-phosphate 1-dehydrogenase Amazonia Not Available 185C->A ADR Inferred Increased risk of hemolytic crisis. Details Glucose-6-phosphate 1-dehydrogenase Songklanagarind Not Available 196T->A ADR Inferred Increased risk of hemolytic crisis. Details Glucose-6-phosphate 1-dehydrogenase Hechi Not Available 202G->A / 871G->A ADR Inferred Increased risk of hemolytic crisis. Details Glucose-6-phosphate 1-dehydrogenase Namouru Not Available 208T->C ADR Inferred Increased risk of hemolytic crisis. Details Glucose-6-phosphate 1-dehydrogenase Bao Loc Not Available 352T>C ADR Inferred Increased risk of hemolytic crisis. Details Glucose-6-phosphate 1-dehydrogenase Crispim Not Available 375G->T, 379G->T383T->C384C>T ADR Inferred Increased risk of hemolytic crisis. Details Glucose-6-phosphate 1-dehydrogenase Acrokorinthos Not Available 376A->G / 463C->G ADR Inferred Increased risk of hemolytic crisis. Details Glucose-6-phosphate 1-dehydrogenase Santa Maria Not Available 376A->G / 542A->T ADR Inferred Increased risk of hemolytic crisis. Details Glucose-6-phosphate 1-dehydrogenase Ananindeua Not Available 376A->G / 871G->A ADR Inferred Increased risk of hemolytic crisis. Details Glucose-6-phosphate 1-dehydrogenase Vanua Lava Not Available 383T->C ADR Inferred Increased risk of hemolytic crisis. Details Glucose-6-phosphate 1-dehydrogenase Valladolid Not Available 406C->T ADR Inferred Increased risk of hemolytic crisis. Details Glucose-6-phosphate 1-dehydrogenase Belem Not Available 409C->T ADR Inferred Increased risk of hemolytic crisis. Details Glucose-6-phosphate 1-dehydrogenase Liuzhou Not Available 442G->A ADR Inferred Increased risk of hemolytic crisis. Details Glucose-6-phosphate 1-dehydrogenase Shenzen Not Available 473G>A ADR Inferred Increased risk of hemolytic crisis. Details Glucose-6-phosphate 1-dehydrogenase Taipei ‚ÄúChinese- 3‚Äù Not Available 493A->G ADR Inferred Increased risk of hemolytic crisis. Details Glucose-6-phosphate 1-dehydrogenase Toledo Not Available 496C>T ADR Inferred Increased risk of hemolytic crisis. Details Glucose-6-phosphate 1-dehydrogenase Naone Not Available 497G->A ADR Inferred Increased risk of hemolytic crisis. Details Glucose-6-phosphate 1-dehydrogenase Nankang Not Available 517T->C ADR Inferred Increased risk of hemolytic crisis. Details Glucose-6-phosphate 1-dehydrogenase Miaoli Not Available 519C->G ADR Inferred Increased risk of hemolytic crisis. Details Glucose-6-phosphate 1-dehydrogenase Mediterranean, Dallas, Panama‚ Sassari, Cagliari, Birmingham Not Available 563C->T ADR Inferred Increased risk of hemolytic crisis. Details Glucose-6-phosphate 1-dehydrogenase Coimbra Shunde Not Available 592C->T ADR Inferred Increased risk of hemolytic crisis. Details Glucose-6-phosphate 1-dehydrogenase Nilgiri Not Available 593G>A ADR Inferred Increased risk of hemolytic crisis. Details Glucose-6-phosphate 1-dehydrogenase Radlowo Not Available 679C->T ADR Inferred Increased risk of hemolytic crisis. Details Glucose-6-phosphate 1-dehydrogenase Roubaix Not Available 811G>C ADR Inferred Increased risk of hemolytic crisis. Details Glucose-6-phosphate 1-dehydrogenase Haikou Not Available 835A->G ADR Inferred Increased risk of hemolytic crisis. Details Glucose-6-phosphate 1-dehydrogenase Chinese-1 Not Available 835A->T ADR Inferred Increased risk of hemolytic crisis. Details Glucose-6-phosphate 1-dehydrogenase Mizushima Not Available 848A>G ADR Inferred Increased risk of hemolytic crisis. Details Glucose-6-phosphate 1-dehydrogenase Osaka Not Available 853C->T ADR Inferred Increased risk of hemolytic crisis. Details Glucose-6-phosphate 1-dehydrogenase Viangchan, Jammu Not Available 871G->A ADR Inferred Increased risk of hemolytic crisis. Details Glucose-6-phosphate 1-dehydrogenase Seoul Not Available 916G->A ADR Inferred Increased risk of hemolytic crisis. Details Glucose-6-phosphate 1-dehydrogenase Ludhiana Not Available 929G->A ADR Inferred Increased risk of hemolytic crisis. Details Glucose-6-phosphate 1-dehydrogenase Farroupilha Not Available 977C->A ADR Inferred Increased risk of hemolytic crisis. Details Glucose-6-phosphate 1-dehydrogenase Chinese-5 Not Available 1024C->T ADR Inferred Increased risk of hemolytic crisis. Details Glucose-6-phosphate 1-dehydrogenase Rignano Not Available 130G>A ADR Inferred Increased risk of hemolytic crisis. Details Glucose-6-phosphate 1-dehydrogenase Orissa Not Available 131C->G ADR Inferred Increased risk of hemolytic crisis. Details Glucose-6-phosphate 1-dehydrogenase G6PDNice Not Available 1380G>C ADR Inferred Increased risk of hemolytic crisis. Details Glucose-6-phosphate 1-dehydrogenase Kamiube, Keelung Not Available 1387C->T ADR Inferred Increased risk of hemolytic crisis. Details Glucose-6-phosphate 1-dehydrogenase Neapolis Not Available 1400C->G ADR Inferred Increased risk of hemolytic crisis. Details Glucose-6-phosphate 1-dehydrogenase Aures Not Available 143T->C ADR Inferred Increased risk of hemolytic crisis. Details Glucose-6-phosphate 1-dehydrogenase Split Not Available 1442C->G ADR Inferred Increased risk of hemolytic crisis. Details Glucose-6-phosphate 1-dehydrogenase Kambos Not Available 148C->T ADR Inferred Increased risk of hemolytic crisis. Details Glucose-6-phosphate 1-dehydrogenase Palestrina Not Available 170G>A ADR Inferred Increased risk of hemolytic crisis. Details Glucose-6-phosphate 1-dehydrogenase Metaponto Not Available 172G->A ADR Inferred Increased risk of hemolytic crisis. Details Glucose-6-phosphate 1-dehydrogenase Musashino Not Available 185C->T ADR Inferred Increased risk of hemolytic crisis. Details Glucose-6-phosphate 1-dehydrogenase Asahi Not Available 202G->A ADR Inferred Increased risk of hemolytic crisis. Details Glucose-6-phosphate 1-dehydrogenase A- (202), Ferrara I Not Available 202G->A / 376A->G ADR Inferred Increased risk of hemolytic crisis. Details Glucose-6-phosphate 1-dehydrogenase Murcia Oristano Not Available 209A->G ADR Inferred Increased risk of hemolytic crisis. Details Glucose-6-phosphate 1-dehydrogenase Ube Konan Not Available 241C->T ADR Inferred Increased risk of hemolytic crisis. Details Glucose-6-phosphate 1-dehydrogenase Lagosanto Not Available 242G->A ADR Inferred Increased risk of hemolytic crisis. Details Glucose-6-phosphate 1-dehydrogenase Guangzhou Not Available 274C->T ADR Inferred Increased risk of hemolytic crisis. Details Glucose-6-phosphate 1-dehydrogenase Hammersmith Not Available 323T->A ADR Inferred Increased risk of hemolytic crisis. Details Glucose-6-phosphate 1-dehydrogenase Sinnai Not Available 34G->T ADR Inferred Increased risk of hemolytic crisis. Details Glucose-6-phosphate 1-dehydrogenase A- (680) Not Available 376A->G / 680G->T ADR Inferred Increased risk of hemolytic crisis. Details Glucose-6-phosphate 1-dehydrogenase A- (968), Betica,Selma, Guantanamo Not Available 376A->G / 968T->C ADR Inferred Increased risk of hemolytic crisis. Details Glucose-6-phosphate 1-dehydrogenase Salerno Pyrgos Not Available 383T>G ADR Inferred Increased risk of hemolytic crisis. Details Glucose-6-phosphate 1-dehydrogenase Quing Yan Not Available 392G->T ADR Inferred Increased risk of hemolytic crisis. Details Glucose-6-phosphate 1-dehydrogenase Lages Not Available 40G->A ADR Inferred Increased risk of hemolytic crisis. Details Glucose-6-phosphate 1-dehydrogenase Ilesha Not Available 466G->A ADR Inferred Increased risk of hemolytic crisis. Details Glucose-6-phosphate 1-dehydrogenase Mahidol Not Available 487G->A ADR Inferred Increased risk of hemolytic crisis. Details Glucose-6-phosphate 1-dehydrogenase Malaga Not Available 542A->T ADR Inferred Increased risk of hemolytic crisis. Details Glucose-6-phosphate 1-dehydrogenase Sibari Not Available 634A->G ADR Inferred Increased risk of hemolytic crisis. Details Glucose-6-phosphate 1-dehydrogenase Mexico City Not Available 680G->A ADR Inferred Increased risk of hemolytic crisis. Details Glucose-6-phosphate 1-dehydrogenase Nanning Not Available 703C->T ADR Inferred Increased risk of hemolytic crisis. Details Glucose-6-phosphate 1-dehydrogenase Seattle, Lodi, Modena, Ferrara II, Athens-like Not Available 844G->C ADR Inferred Increased risk of hemolytic crisis. Details Glucose-6-phosphate 1-dehydrogenase Bajo Maumere Not Available 844G->T ADR Inferred Increased risk of hemolytic crisis. Details Glucose-6-phosphate 1-dehydrogenase Montalbano Not Available 854G->A ADR Inferred Increased risk of hemolytic crisis. Details Glucose-6-phosphate 1-dehydrogenase Kalyan-Kerala, Jamnaga, Rohini Not Available 949G->A ADR Inferred Increased risk of hemolytic crisis. Details Glucose-6-phosphate 1-dehydrogenase Gaohe Not Available 95A->G ADR Inferred Increased risk of hemolytic crisis. Details
Interactions
- Drug Interactions
Drug Interaction Drug group Acebutolol The risk or severity of adverse effects can be increased when Nitrous acid is combined with Acebutolol. Approved, Investigational Acetaminophen The risk or severity of adverse effects can be increased when Acetaminophen is combined with Nitrous acid. Approved Aldesleukin The risk or severity of adverse effects can be increased when Nitrous acid is combined with Aldesleukin. Approved Aliskiren The risk or severity of adverse effects can be increased when Nitrous acid is combined with Aliskiren. Approved, Investigational Amifostine The risk or severity of adverse effects can be increased when Amifostine is combined with Nitrous acid. Approved, Investigational Amiloride The risk or severity of adverse effects can be increased when Nitrous acid is combined with Amiloride. Approved Amiodarone The risk or severity of adverse effects can be increased when Amiodarone is combined with Nitrous acid. Approved, Investigational Amlodipine The risk or severity of adverse effects can be increased when Nitrous acid is combined with Amlodipine. Approved Amobarbital Amobarbital may increase the hypotensive activities of Nitrous acid. Approved, Illicit Amphotericin B The risk or severity of adverse effects can be increased when Amphotericin B is combined with Nitrous acid. Approved, Investigational Amyl Nitrite The risk or severity of adverse effects can be increased when Amyl Nitrite is combined with Nitrous acid. Approved Antipyrine The risk or severity of adverse effects can be increased when Antipyrine is combined with Nitrous acid. Approved, Investigational Apomorphine The risk or severity of adverse effects can be increased when Apomorphine is combined with Nitrous acid. Approved, Investigational Apraclonidine The risk or severity of adverse effects can be increased when Nitrous acid is combined with Apraclonidine. Approved Aripiprazole Aripiprazole may increase the hypotensive activities of Nitrous acid. Approved, Investigational Arotinolol The risk or severity of adverse effects can be increased when Arotinolol is combined with Nitrous acid. Investigational Arsenic trioxide The risk or severity of adverse effects can be increased when Arsenic trioxide is combined with Nitrous acid. Approved, Investigational Atenolol The risk or severity of adverse effects can be increased when Nitrous acid is combined with Atenolol. Approved Azilsartan medoxomil The risk or severity of adverse effects can be increased when Nitrous acid is combined with Azilsartan medoxomil. Approved, Investigational Barbexaclone Barbexaclone may increase the hypotensive activities of Nitrous acid. Experimental Barbital Barbital may increase the hypotensive activities of Nitrous acid. Illicit Barnidipine The risk or severity of adverse effects can be increased when Barnidipine is combined with Nitrous acid. Approved Benazepril The risk or severity of adverse effects can be increased when Nitrous acid is combined with Benazepril. Approved, Investigational Bendroflumethiazide The risk or severity of adverse effects can be increased when Nitrous acid is combined with Bendroflumethiazide. Approved Benzocaine The risk or severity of adverse effects can be increased when Benzocaine is combined with Nitrous acid. Approved, Investigational Bepridil The risk or severity of adverse effects can be increased when Bepridil is combined with Nitrous acid. Approved, Withdrawn Betaxolol The risk or severity of adverse effects can be increased when Nitrous acid is combined with Betaxolol. Approved, Investigational Bisoprolol The risk or severity of adverse effects can be increased when Nitrous acid is combined with Bisoprolol. Approved Bortezomib The risk or severity of adverse effects can be increased when Bortezomib is combined with Nitrous acid. Approved, Investigational Bretylium The risk or severity of adverse effects can be increased when Nitrous acid is combined with Bretylium. Approved Brimonidine The risk or severity of adverse effects can be increased when Nitrous acid is combined with Brimonidine. Approved Bromocriptine The risk or severity of adverse effects can be increased when Bromocriptine is combined with Nitrous acid. Approved, Investigational Bumetanide The risk or severity of adverse effects can be increased when Nitrous acid is combined with Bumetanide. Approved Bupivacaine The risk or severity of adverse effects can be increased when Bupivacaine is combined with Nitrous acid. Approved, Investigational Butalbital The risk or severity of adverse effects can be increased when Butalbital is combined with Nitrous acid. Approved, Illicit Canagliflozin The risk or severity of adverse effects can be increased when Nitrous acid is combined with Canagliflozin. Approved Candesartan cilexetil The risk or severity of adverse effects can be increased when Nitrous acid is combined with Candesartan cilexetil. Approved Captopril The risk or severity of adverse effects can be increased when Nitrous acid is combined with Captopril. Approved Carbetocin The risk or severity of adverse effects can be increased when Carbetocin is combined with Nitrous acid. Approved, Investigational Carteolol The risk or severity of adverse effects can be increased when Nitrous acid is combined with Carteolol. Approved Carvedilol The risk or severity of adverse effects can be increased when Nitrous acid is combined with Carvedilol. Approved, Investigational Celecoxib The risk or severity of adverse effects can be increased when Celecoxib is combined with Nitrous acid. Approved, Investigational Chloroquine The risk or severity of adverse effects can be increased when Chloroquine is combined with Nitrous acid. Approved, Investigational, Vet Approved Chlorothiazide The risk or severity of adverse effects can be increased when Nitrous acid is combined with Chlorothiazide. Approved, Vet Approved Chlorpromazine The risk or severity of adverse effects can be increased when Chlorpromazine is combined with Nitrous acid. Approved, Investigational, Vet Approved Chlorthalidone The risk or severity of adverse effects can be increased when Nitrous acid is combined with Chlorthalidone. Approved Cilazapril The risk or severity of adverse effects can be increased when Nitrous acid is combined with Cilazapril. Approved Cilnidipine The risk or severity of adverse effects can be increased when Cilnidipine is combined with Nitrous acid. Approved, Investigational Clevidipine The risk or severity of adverse effects can be increased when Nitrous acid is combined with Clevidipine. Approved, Investigational Clofarabine The risk or severity of adverse effects can be increased when Clofarabine is combined with Nitrous acid. Approved, Investigational Clomipramine The risk or severity of adverse effects can be increased when Clomipramine is combined with Nitrous acid. Approved, Investigational, Vet Approved Clonidine The risk or severity of adverse effects can be increased when Nitrous acid is combined with Clonidine. Approved Clozapine The risk or severity of adverse effects can be increased when Clozapine is combined with Nitrous acid. Approved Conivaptan The risk or severity of adverse effects can be increased when Conivaptan is combined with Nitrous acid. Approved, Investigational Dapagliflozin The risk or severity of adverse effects can be increased when Nitrous acid is combined with Dapagliflozin. Approved Dapsone The risk or severity of adverse effects can be increased when Dapsone is combined with Nitrous acid. Approved, Investigational Desflurane The risk or severity of adverse effects can be increased when Desflurane is combined with Nitrous acid. Approved Dexmedetomidine The risk or severity of adverse effects can be increased when Nitrous acid is combined with Dexmedetomidine. Approved, Vet Approved Diclofenamide The risk or severity of adverse effects can be increased when Nitrous acid is combined with Diclofenamide. Approved, Investigational Diltiazem The risk or severity of adverse effects can be increased when Nitrous acid is combined with Diltiazem. Approved, Investigational Dinutuximab The risk or severity of adverse effects can be increased when Nitrous acid is combined with Dinutuximab. Approved, Investigational Dipyridamole The risk or severity of adverse effects can be increased when Nitrous acid is combined with Dipyridamole. Approved Doxazosin The risk or severity of adverse effects can be increased when Nitrous acid is combined with Doxazosin. Approved Duloxetine Nitrous acid may increase the orthostatic hypotensive activities of Duloxetine. Approved Efonidipine The risk or severity of adverse effects can be increased when Efonidipine is combined with Nitrous acid. Approved, Investigational Empagliflozin The risk or severity of adverse effects can be increased when Nitrous acid is combined with Empagliflozin. Approved Enalapril The risk or severity of adverse effects can be increased when Nitrous acid is combined with Enalapril. Approved, Vet Approved Enalaprilat The risk or severity of adverse effects can be increased when Enalaprilat is combined with Nitrous acid. Approved Eplerenone The risk or severity of adverse effects can be increased when Nitrous acid is combined with Eplerenone. Approved Epoprostenol The risk or severity of adverse effects can be increased when Epoprostenol is combined with Nitrous acid. Approved Eprosartan The risk or severity of adverse effects can be increased when Nitrous acid is combined with Eprosartan. Approved Esmolol The risk or severity of adverse effects can be increased when Nitrous acid is combined with Esmolol. Approved Etacrynic acid The risk or severity of adverse effects can be increased when Nitrous acid is combined with Etacrynic acid. Approved, Investigational Felodipine The risk or severity of adverse effects can be increased when Nitrous acid is combined with Felodipine. Approved, Investigational Fenoldopam The risk or severity of adverse effects can be increased when Fenoldopam is combined with Nitrous acid. Approved Fimasartan The risk or severity of adverse effects can be increased when Fimasartan is combined with Nitrous acid. Approved, Investigational Flutamide The risk or severity of adverse effects can be increased when Flutamide is combined with Nitrous acid. Approved, Investigational Fosinopril The risk or severity of adverse effects can be increased when Nitrous acid is combined with Fosinopril. Approved Furosemide The risk or severity of adverse effects can be increased when Nitrous acid is combined with Furosemide. Approved, Vet Approved Guanfacine The risk or severity of adverse effects can be increased when Nitrous acid is combined with Guanfacine. Approved, Investigational Halothane The risk or severity of adverse effects can be increased when Halothane is combined with Nitrous acid. Approved, Vet Approved Hexobarbital Hexobarbital may increase the hypotensive activities of Nitrous acid. Approved Hydralazine The risk or severity of adverse effects can be increased when Nitrous acid is combined with Hydralazine. Approved Hydrochlorothiazide The risk or severity of adverse effects can be increased when Nitrous acid is combined with Hydrochlorothiazide. Approved, Vet Approved Hydroflumethiazide The risk or severity of adverse effects can be increased when Hydroflumethiazide is combined with Nitrous acid. Approved, Investigational Iloprost The risk or severity of adverse effects can be increased when Iloprost is combined with Nitrous acid. Approved, Investigational Imidapril The risk or severity of adverse effects can be increased when Imidapril is combined with Nitrous acid. Investigational Imipramine The risk or severity of adverse effects can be increased when Imipramine is combined with Nitrous acid. Approved Indapamide The risk or severity of adverse effects can be increased when Nitrous acid is combined with Indapamide. Approved Indoramin The risk or severity of adverse effects can be increased when Indoramin is combined with Nitrous acid. Withdrawn Irbesartan The risk or severity of adverse effects can be increased when Nitrous acid is combined with Irbesartan. Approved, Investigational Isocarboxazid The risk or severity of adverse effects can be increased when Isocarboxazid is combined with Nitrous acid. Approved Isoflurane The risk or severity of adverse effects can be increased when Isoflurane is combined with Nitrous acid. Approved, Vet Approved Isometheptene The risk or severity of adverse effects can be increased when Isometheptene is combined with Nitrous acid. Approved Isosorbide Dinitrate The risk or severity of adverse effects can be increased when Isosorbide Dinitrate is combined with Nitrous acid. Approved, Investigational Isosorbide Mononitrate The risk or severity of adverse effects can be increased when Isosorbide Mononitrate is combined with Nitrous acid. Approved Isoxsuprine The risk or severity of adverse effects can be increased when Nitrous acid is combined with Isoxsuprine. Approved, Withdrawn Isradipine The risk or severity of adverse effects can be increased when Nitrous acid is combined with Isradipine. Approved, Investigational Labetalol The risk or severity of adverse effects can be increased when Nitrous acid is combined with Labetalol. Approved Lacidipine Nitrous acid may increase the hypotensive activities of Lacidipine. Approved, Investigational Lercanidipine The risk or severity of adverse effects can be increased when Lercanidipine is combined with Nitrous acid. Approved, Investigational Levobunolol The risk or severity of adverse effects can be increased when Nitrous acid is combined with Levobunolol. Approved Levobupivacaine The risk or severity of adverse effects can be increased when Levobupivacaine is combined with Nitrous acid. Approved, Investigational Levodopa Nitrous acid may increase the orthostatic hypotensive activities of Levodopa. Approved Levosimendan The risk or severity of adverse effects can be increased when Levosimendan is combined with Nitrous acid. Approved, Investigational Lidocaine The risk or severity of adverse effects can be increased when Lidocaine is combined with Nitrous acid. Approved, Vet Approved Lisinopril The risk or severity of adverse effects can be increased when Nitrous acid is combined with Lisinopril. Approved, Investigational Lofexidine The risk or severity of adverse effects can be increased when Lofexidine is combined with Nitrous acid. Approved, Investigational Losartan The risk or severity of adverse effects can be increased when Nitrous acid is combined with Losartan. Approved Mafenide The risk or severity of adverse effects can be increased when Mafenide is combined with Nitrous acid. Approved, Vet Approved Mannitol The risk or severity of adverse effects can be increased when Nitrous acid is combined with Mannitol. Approved, Investigational Mecamylamine The risk or severity of adverse effects can be increased when Nitrous acid is combined with Mecamylamine. Approved, Investigational Methazolamide The risk or severity of adverse effects can be increased when Nitrous acid is combined with Methazolamide. Approved Methohexital Methohexital may increase the hypotensive activities of Nitrous acid. Approved Methyclothiazide The risk or severity of adverse effects can be increased when Nitrous acid is combined with Methyclothiazide. Approved Methyldopa The risk or severity of adverse effects can be increased when Nitrous acid is combined with Methyldopa. Approved Methylphenobarbital Methylphenobarbital may increase the hypotensive activities of Nitrous acid. Approved Metipranolol The risk or severity of adverse effects can be increased when Nitrous acid is combined with Metipranolol. Approved Metoclopramide The risk or severity of adverse effects can be increased when Metoclopramide is combined with Nitrous acid. Approved, Investigational Metolazone The risk or severity of adverse effects can be increased when Nitrous acid is combined with Metolazone. Approved Metoprolol The risk or severity of adverse effects can be increased when Nitrous acid is combined with Metoprolol. Approved, Investigational Minoxidil The risk or severity of adverse effects can be increased when Nitrous acid is combined with Minoxidil. Approved, Investigational Moexipril The risk or severity of adverse effects can be increased when Nitrous acid is combined with Moexipril. Approved Morphine The risk or severity of adverse effects can be increased when Morphine is combined with Nitrous acid. Approved, Investigational Moxonidine The risk or severity of adverse effects can be increased when Moxonidine is combined with Nitrous acid. Approved, Investigational Nabilone The risk or severity of adverse effects can be increased when Nabilone is combined with Nitrous acid. Approved, Investigational Nadolol The risk or severity of adverse effects can be increased when Nitrous acid is combined with Nadolol. Approved Nebivolol The risk or severity of adverse effects can be increased when Nitrous acid is combined with Nebivolol. Approved, Investigational Nesiritide The risk or severity of adverse effects can be increased when Nitrous acid is combined with Nesiritide. Approved, Investigational Nicardipine The risk or severity of adverse effects can be increased when Nitrous acid is combined with Nicardipine. Approved, Investigational Nicorandil Nicorandil may increase the hypotensive activities of Nitrous acid. Approved, Investigational Nifedipine The risk or severity of adverse effects can be increased when Nitrous acid is combined with Nifedipine. Approved Nilvadipine The risk or severity of adverse effects can be increased when Nilvadipine is combined with Nitrous acid. Approved, Investigational Nimodipine The risk or severity of adverse effects can be increased when Nitrous acid is combined with Nimodipine. Approved, Investigational Nisoldipine The risk or severity of adverse effects can be increased when Nitrous acid is combined with Nisoldipine. Approved Nitrendipine The risk or severity of adverse effects can be increased when Nitrendipine is combined with Nitrous acid. Approved, Investigational Nitric Oxide The risk or severity of adverse effects can be increased when Nitric Oxide is combined with Nitrous acid. Approved Nitrofurantoin The risk or severity of adverse effects can be increased when Nitrofurantoin is combined with Nitrous acid. Approved, Vet Approved Nitroglycerin The risk or severity of adverse effects can be increased when Nitroglycerin is combined with Nitrous acid. Approved, Investigational Nitroprusside The risk or severity of adverse effects can be increased when Nitroprusside is combined with Nitrous acid. Approved, Investigational Obinutuzumab The risk or severity of adverse effects can be increased when Obinutuzumab is combined with Nitrous acid. Approved, Investigational Olmesartan The risk or severity of adverse effects can be increased when Nitrous acid is combined with Olmesartan. Approved, Investigational Oxprenolol The risk or severity of adverse effects can be increased when Oxprenolol is combined with Nitrous acid. Approved Paclitaxel The risk or severity of adverse effects can be increased when Paclitaxel is combined with Nitrous acid. Approved, Vet Approved Papaverine The risk or severity of adverse effects can be increased when Nitrous acid is combined with Papaverine. Approved, Investigational Penbutolol The risk or severity of adverse effects can be increased when Nitrous acid is combined with Penbutolol. Approved, Investigational Pentobarbital Pentobarbital may increase the hypotensive activities of Nitrous acid. Approved, Investigational, Vet Approved Perindopril The risk or severity of adverse effects can be increased when Nitrous acid is combined with Perindopril. Approved Phenazopyridine The risk or severity of adverse effects can be increased when Phenazopyridine is combined with Nitrous acid. Approved Phenelzine The risk or severity of adverse effects can be increased when Phenelzine is combined with Nitrous acid. Approved Phenobarbital The risk or severity of adverse effects can be increased when Phenobarbital is combined with Nitrous acid. Approved, Investigational Phenoxybenzamine The risk or severity of adverse effects can be increased when Phenoxybenzamine is combined with Nitrous acid. Approved Phentolamine The risk or severity of adverse effects can be increased when Phentolamine is combined with Nitrous acid. Approved Phenytoin The risk or severity of adverse effects can be increased when Phenytoin is combined with Nitrous acid. Approved, Vet Approved Pindolol The risk or severity of adverse effects can be increased when Nitrous acid is combined with Pindolol. Approved, Investigational Pipamperone The risk or severity of adverse effects can be increased when Pipamperone is combined with Nitrous acid. Approved, Investigational Pramipexole The risk or severity of adverse effects can be increased when Pramipexole is combined with Nitrous acid. Approved, Investigational Prazosin The risk or severity of adverse effects can be increased when Nitrous acid is combined with Prazosin. Approved Prilocaine The risk or severity of adverse effects can be increased when Nitrous acid is combined with Prilocaine. Approved Primaquine The risk or severity of adverse effects can be increased when Primaquine is combined with Nitrous acid. Approved Primidone Primidone may increase the hypotensive activities of Nitrous acid. Approved, Vet Approved Propofol The risk or severity of adverse effects can be increased when Propofol is combined with Nitrous acid. Approved, Investigational, Vet Approved Propranolol The risk or severity of adverse effects can be increased when Nitrous acid is combined with Propranolol. Approved, Investigational Quetiapine The risk or severity of adverse effects can be increased when Nitrous acid is combined with Quetiapine. Approved Quinapril The risk or severity of adverse effects can be increased when Nitrous acid is combined with Quinapril. Approved, Investigational Quinine The risk or severity of adverse effects can be increased when Quinine is combined with Nitrous acid. Approved Ramipril The risk or severity of adverse effects can be increased when Nitrous acid is combined with Ramipril. Approved Rasagiline The risk or severity of adverse effects can be increased when Rasagiline is combined with Nitrous acid. Approved Remifentanil The risk or severity of adverse effects can be increased when Remifentanil is combined with Nitrous acid. Approved Reserpine The risk or severity of adverse effects can be increased when Nitrous acid is combined with Reserpine. Approved, Investigational Riociguat The risk or severity of adverse effects can be increased when Nitrous acid is combined with Riociguat. Approved Risperidone Nitrous acid may increase the hypotensive activities of Risperidone. Approved, Investigational Ropinirole The risk or severity of adverse effects can be increased when Ropinirole is combined with Nitrous acid. Approved, Investigational Ropivacaine The risk or severity of adverse effects can be increased when Ropivacaine is combined with Nitrous acid. Approved Rotigotine The risk or severity of adverse effects can be increased when Rotigotine is combined with Nitrous acid. Approved Sacubitril The risk or severity of adverse effects can be increased when Sacubitril is combined with Nitrous acid. Approved Secobarbital Secobarbital may increase the hypotensive activities of Nitrous acid. Approved, Vet Approved Selegiline The risk or severity of adverse effects can be increased when Selegiline is combined with Nitrous acid. Approved, Investigational, Vet Approved Sevoflurane The risk or severity of adverse effects can be increased when Sevoflurane is combined with Nitrous acid. Approved, Vet Approved Sotalol The risk or severity of adverse effects can be increased when Nitrous acid is combined with Sotalol. Approved Spironolactone The risk or severity of adverse effects can be increased when Nitrous acid is combined with Spironolactone. Approved Streptokinase The risk or severity of adverse effects can be increased when Nitrous acid is combined with Streptokinase. Approved, Investigational Sufentanil The risk or severity of adverse effects can be increased when Nitrous acid is combined with Sufentanil. Approved, Investigational Sulfadiazine The risk or severity of adverse effects can be increased when Sulfadiazine is combined with Nitrous acid. Approved, Investigational, Vet Approved Sulfamethoxazole The risk or severity of adverse effects can be increased when Sulfamethoxazole is combined with Nitrous acid. Approved Tamsulosin The risk or severity of adverse effects can be increased when Nitrous acid is combined with Tamsulosin. Approved, Investigational Telmisartan The risk or severity of adverse effects can be increased when Nitrous acid is combined with Telmisartan. Approved, Investigational Terazosin The risk or severity of adverse effects can be increased when Nitrous acid is combined with Terazosin. Approved Thalidomide The risk or severity of adverse effects can be increased when Nitrous acid is combined with Thalidomide. Approved, Investigational, Withdrawn Thiamylal Thiamylal may increase the hypotensive activities of Nitrous acid. Approved, Vet Approved Thiopental Thiopental may increase the hypotensive activities of Nitrous acid. Approved, Vet Approved Thioridazine The risk or severity of adverse effects can be increased when Nitrous acid is combined with Thioridazine. Approved, Withdrawn Timolol The risk or severity of adverse effects can be increased when Nitrous acid is combined with Timolol. Approved Tizanidine The risk or severity of adverse effects can be increased when Nitrous acid is combined with Tizanidine. Approved, Investigational Tolazoline The risk or severity of adverse effects can be increased when Nitrous acid is combined with Tolazoline. Approved, Vet Approved Tolcapone The risk or severity of adverse effects can be increased when Nitrous acid is combined with Tolcapone. Approved, Withdrawn Torasemide The risk or severity of adverse effects can be increased when Nitrous acid is combined with Torasemide. Approved Trandolapril The risk or severity of adverse effects can be increased when Nitrous acid is combined with Trandolapril. Approved Tranylcypromine The risk or severity of adverse effects can be increased when Nitrous acid is combined with Tranylcypromine. Approved, Investigational Tretinoin The risk or severity of adverse effects can be increased when Nitrous acid is combined with Tretinoin. Approved, Investigational, Nutraceutical Triamterene The risk or severity of adverse effects can be increased when Nitrous acid is combined with Triamterene. Approved Valsartan The risk or severity of adverse effects can be increased when Nitrous acid is combined with Valsartan. Approved, Investigational Verapamil The risk or severity of adverse effects can be increased when Nitrous acid is combined with Verapamil. Approved Zopiclone The risk or severity of adverse effects can be increased when Zopiclone is combined with Nitrous acid. Approved - Food Interactions
- Not Available
References
- General References
- Baskin SI, Horowitz AM, Nealley EW: The antidotal action of sodium nitrite and sodium thiosulfate against cyanide poisoning. J Clin Pharmacol. 1992 Apr;32(4):368-75. [PubMed:1569239]
- Beasley DM, Glass WI: Cyanide poisoning: pathophysiology and treatment recommendations. Occup Med (Lond). 1998 Oct;48(7):427-31. [PubMed:10024740]
- Lundberg JO, Weitzberg E, Gladwin MT: The nitrate-nitrite-nitric oxide pathway in physiology and therapeutics. Nat Rev Drug Discov. 2008 Feb;7(2):156-67. doi: 10.1038/nrd2466. [PubMed:18167491]
- Denninger JW, Marletta MA: Guanylate cyclase and the .NO/cGMP signaling pathway. Biochim Biophys Acta. 1999 May 5;1411(2-3):334-50. [PubMed:10320667]
- Rix PJ, Vick A, Attkins NJ, Barker GE, Bott AW, Alcorn H Jr, Gladwin MT, Shiva S, Bradley S, Hussaini A, Hoye WL, Parsley EL, Masamune H: Pharmacokinetics, pharmacodynamics, safety, and tolerability of nebulized sodium nitrite (AIR001) following repeat-dose inhalation in healthy subjects. Clin Pharmacokinet. 2015 Mar;54(3):261-72. doi: 10.1007/s40262-014-0201-y. [PubMed:25421879]
- Tiso M, Schechter AN: Nitrate reduction to nitrite, nitric oxide and ammonia by gut bacteria under physiological conditions. PLoS One. 2015 Mar 24;10(3):e0119712. doi: 10.1371/journal.pone.0119712. eCollection 2015. [PubMed:25803049]
- External Links
- KEGG Compound
- C00088
- PubChem Compound
- 23668193
- PubChem Substance
- 310265030
- ChemSpider
- 22936
- BindingDB
- 50147619
- ChEBI
- 25567
- ChEMBL
- CHEMBL1161681
- PharmGKB
- PA166115361
- Wikipedia
- Nitrous_acid
- ATC Codes
- V03AB08 — Sodium nitrite
- AHFS Codes
- 92:12.00 — Antidotes
- FDA label
- Download (250 KB)
- MSDS
- Download (105 KB)
Clinical Trials
- Clinical Trials
Pharmacoeconomics
- Manufacturers
- Not Available
- Packagers
- Not Available
- Dosage forms
Form Route Strength Kit Injection, solution Intravenous 30 mg/mL Solution Intravenous 30 mg - Prices
- Not Available
- Patents
Patent Number Pediatric Extension Approved Expires (estimated) US8496973 No 2011-03-29 2031-03-29 US US8568793 No 2011-12-24 2031-12-24 US US9585912 No 2011-03-29 2031-03-29 US US9345724 No 2011-03-29 2031-03-29 US
Properties
- State
- Solid
- Experimental Properties
Property Value Source melting point (°C) 271 MSDS boiling point (°C) 320 MSDS water solubility 820g/L MSDS logP -3.7 MSDS - Predicted Properties
Property Value Source logP 0.17 ChemAxon pKa (Strongest Basic) -3.5 ChemAxon Physiological Charge 0 ChemAxon Hydrogen Acceptor Count 3 ChemAxon Hydrogen Donor Count 1 ChemAxon Polar Surface Area 49.66 Å2 ChemAxon Rotatable Bond Count 0 ChemAxon Refractivity 8.72 m3·mol-1 ChemAxon Polarizability 2.81 Å3 ChemAxon Number of Rings 0 ChemAxon Bioavailability 1 ChemAxon Rule of Five Yes ChemAxon Ghose Filter No ChemAxon Veber's Rule No ChemAxon MDDR-like Rule No ChemAxon - Predicted ADMET features
- Not Available
Spectra
- Mass Spec (NIST)
- Not Available
- Spectra
Taxonomy
- Classification
- Not classified
Targets
- Kind
- Protein
- Organism
- Human
- Pharmacological action
- Yes
- Actions
- Oxidizer
- General Function
- Oxygen transporter activity
- Specific Function
- Involved in oxygen transport from the lung to the various peripheral tissues.
- Gene Name
- HBA1
- Uniprot ID
- P69905
- Uniprot Name
- Hemoglobin subunit alpha
- Molecular Weight
- 15257.405 Da
References
- Baskin SI, Horowitz AM, Nealley EW: The antidotal action of sodium nitrite and sodium thiosulfate against cyanide poisoning. J Clin Pharmacol. 1992 Apr;32(4):368-75. [PubMed:1569239]
- Kind
- Protein
- Organism
- Human
- Pharmacological action
- Yes
- Actions
- Oxidizer
- General Function
- Oxygen transporter activity
- Specific Function
- Involved in oxygen transport from the lung to the various peripheral tissues.LVV-hemorphin-7 potentiates the activity of bradykinin, causing a decrease in blood pressure.Spinorphin: functions as an...
- Gene Name
- HBB
- Uniprot ID
- P68871
- Uniprot Name
- Hemoglobin subunit beta
- Molecular Weight
- 15998.34 Da
References
- Baskin SI, Horowitz AM, Nealley EW: The antidotal action of sodium nitrite and sodium thiosulfate against cyanide poisoning. J Clin Pharmacol. 1992 Apr;32(4):368-75. [PubMed:1569239]
- Kind
- Protein
- Organism
- Human
- Pharmacological action
- Unknown
- Actions
- Oxidizer
- General Function
- Oxygen transporter activity
- Specific Function
- Serves as a reserve supply of oxygen and facilitates the movement of oxygen within muscles.
- Gene Name
- MB
- Uniprot ID
- P02144
- Uniprot Name
- Myoglobin
- Molecular Weight
- 17183.725 Da
References
- Baskin SI, Horowitz AM, Nealley EW: The antidotal action of sodium nitrite and sodium thiosulfate against cyanide poisoning. J Clin Pharmacol. 1992 Apr;32(4):368-75. [PubMed:1569239]
Drug created on September 21, 2015 10:24 / Updated on June 19, 2018 10:51