Sodium Nitrite

Identification

Name
Sodium Nitrite
Accession Number
DB09112
Type
Small Molecule
Groups
Approved
Description

Sodium Nitrite is used as part of an intravenous mixture with sodium thiosulfate to treat cyanide poisoning. It is on the World Health Organization's List of Essential Medicines, a list of the most important medications needed in a basic health system. There is also research to investigate its applicability towards treatments for heart attacks, brain aneurysms, pulmonary hypertension in infants, and Pseudomonas aeruginosa infections.

Structure
Thumb
Synonyms
Not Available
External IDs
INS NO.250 / INS-250 / NSC-77391
Prescription Products
NameDosageStrengthRouteLabellerMarketing StartMarketing End
Sodium NitriteInjection, solution30 mg/mLIntravenousHope Pharmaceuticals2012-02-14Not applicableUs
Sodium Nitrite Injection, USPSolution30 mgIntravenousHope Pharmaceuticals2016-07-20Not applicableCanada
Mixture Products
NameIngredientsDosageRouteLabellerMarketing StartMarketing End
NithiodoteSodium Nitrite + Thiosulfuric acidKitHope Pharmaceuticals2011-01-14Not applicableUs
Categories
UNII
M0KG633D4F
CAS number
7632-00-0
Weight
Average: 68.9953
Monoisotopic: 68.982672924
Chemical Formula
NNaO2
InChI Key
LPXPTNMVRIOKMN-UHFFFAOYSA-M
InChI
InChI=1S/HNO2.Na/c2-1-3;/h(H,2,3);/q;+1/p-1
IUPAC Name
sodium nitrite
SMILES
[Na+].[O-]N=O

Pharmacology

Indication

For sequential use with sodium thiosulfate for the treatment of acute cyanide poisoning that is judged to be life-threatening [FDA Label].

Structured Indications
Pharmacodynamics

Sodium nitrite reverses cyanide toxicity and produces blood vessel dilation [1].

Mechanism of action

Cyanide has a high affinity for the oxidized form of iron (Fe3+) such as that found in cytochrome oxidase a3 [2]. Cyanide binds to and inhibits cytochrome oxidase a3, preventing oxidative phophorylation from occuring. The resultant lack of ATP cannot support normal cellular processes, particularly in the brain. Compensatory increases in anaerobic respiration result in rising levels of lactic acid and subsequent acidosis.

Nitrite primarily acts by oxidizing hemoglobin to methemoglobin [1]. The now oxidized Fe3+ in methemoglobin also binds cyanide with high affinity and accepts cyanide from cytochrome a3. This leaves cytochrome a3 free to resume its function in oxidative phosphorylation. The slow dissociation of cyanide from methemoglobin allows hepatic enzymes such as rhodanese to detoxify the compound without further systemic toxicity occuring. Methemoglobin is reduced back to hemoglobin by methemoglobin reductase allowing the affected blood cells to resume normal functioning.

The reduction of nitrite by hemoglobin results in the formation of nitric oxide [3]. Nitric oxide acts as a powerful vasodilator, producing vascular smooth muscle relaxation through activation of soluble guanylate cyclase and the subsequent cyclic guanylyl triphosphate mediated signalling cascade [4].

TargetActionsOrganism
AHemoglobin subunit alpha
oxidizer
Human
AHemoglobin subunit beta
oxidizer
Human
UMyoglobin
oxidizer
Human
Absorption
Not Available
Volume of distribution
Not Available
Protein binding
Not Available
Metabolism

Reduced by deoxyhemoglobin to form nitric oxide [3]. Nitrite is also reduced to nitric oxide and further reduced to ammonia by gut bacteria [6]. Nitrite can be oxidized to nitrate by oxyhemoglobin.

Route of elimination
Not Available
Half life

Half life of 0.4-0.78h [5].

Clearance
Not Available
Toxicity

Oral LD50 of 157.9mg/kg observed in rats and 175mg/kg observed in mice [MSDS]. Estimated oral LD50 of 35mg/kg in humans [1]. Sodium nitrite toxicity manifests as cardiovascular collapse following severe hypotension due to nitrite's vasodilatory action.

Affected organisms
Not Available
Pathways
Not Available
Pharmacogenomic Effects/ADRs
Interacting Gene/EnzymeAllele nameGenotype(s)Defining Change(s)Type(s)DescriptionDetails
Glucose-6-phosphate 1-dehydrogenaseVilleurbanneNot Available1000_1002delACCADR InferredIncreased risk of hemolytic crisis.Details
Glucose-6-phosphate 1-dehydrogenaseTorunNot Available1006A->GADR InferredIncreased risk of hemolytic crisis.Details
Glucose-6-phosphate 1-dehydrogenaseSunderlandNot Available105_107delCATADR InferredIncreased risk of hemolytic crisis.Details
Glucose-6-phosphate 1-dehydrogenaseIwatsukiNot Available1081G->AADR InferredIncreased risk of hemolytic crisis.Details
Glucose-6-phosphate 1-dehydrogenaseSerresNot Available1082C->TADR InferredIncreased risk of hemolytic crisis.Details
Glucose-6-phosphate 1-dehydrogenaseTondelaNot Available1084_1101delCTGAACGAGCGCAAGGCCADR InferredIncreased risk of hemolytic crisis.Details
Glucose-6-phosphate 1-dehydrogenaseLoma LindaNot Available1089C->AADR InferredIncreased risk of hemolytic crisis.Details
Glucose-6-phosphate 1-dehydrogenaseAachenNot Available1089C->GADR InferredIncreased risk of hemolytic crisis.Details
Glucose-6-phosphate 1-dehydrogenaseTenriNot Available1096A->GADR InferredIncreased risk of hemolytic crisis.Details
Glucose-6-phosphate 1-dehydrogenaseMontpellierNot Available1132G>AADR InferredIncreased risk of hemolytic crisis.Details
Glucose-6-phosphate 1-dehydrogenaseCalvo MackennaNot Available1138A->GADR InferredIncreased risk of hemolytic crisis.Details
Glucose-6-phosphate 1-dehydrogenaseRileyNot Available1139T->CADR InferredIncreased risk of hemolytic crisis.Details
Glucose-6-phosphate 1-dehydrogenaseOlomoucNot Available1141T->CADR InferredIncreased risk of hemolytic crisis.Details
Glucose-6-phosphate 1-dehydrogenaseTomahNot Available1153T->CADR InferredIncreased risk of hemolytic crisis.Details
Glucose-6-phosphate 1-dehydrogenaseLynwoodNot Available1154G->TADR InferredIncreased risk of hemolytic crisis.Details
Glucose-6-phosphate 1-dehydrogenaseMadridNot Available1155C->GADR InferredIncreased risk of hemolytic crisis.Details
Glucose-6-phosphate 1-dehydrogenaseIowa, Walter Reed, SpringfieldNot Available1156A->GADR InferredIncreased risk of hemolytic crisis.Details
Glucose-6-phosphate 1-dehydrogenaseBeverly Hills, Genova, Iwate, Niigata, YamaguchiNot Available1160G->AADR InferredIncreased risk of hemolytic crisis.Details
Glucose-6-phosphate 1-dehydrogenaseHartfordNot Available1162A->GADR InferredIncreased risk of hemolytic crisis.Details
Glucose-6-phosphate 1-dehydrogenasePrahaNot Available1166A->GADR InferredIncreased risk of hemolytic crisis.Details
Glucose-6-phosphate 1-dehydrogenaseKrakowNot Available1175T>CADR InferredIncreased risk of hemolytic crisis.Details
Glucose-6-phosphate 1-dehydrogenaseWisconsinNot Available1177C->GADR InferredIncreased risk of hemolytic crisis.Details
Glucose-6-phosphate 1-dehydrogenaseNashville, Anaheim, PorticiNot Available1178G->AADR InferredIncreased risk of hemolytic crisis.Details
Glucose-6-phosphate 1-dehydrogenaseAlhambraNot Available1180G->CADR InferredIncreased risk of hemolytic crisis.Details
Glucose-6-phosphate 1-dehydrogenaseBariNot Available1187C->TADR InferredIncreased risk of hemolytic crisis.Details
Glucose-6-phosphate 1-dehydrogenasePuerto LimonNot Available1192G->AADR InferredIncreased risk of hemolytic crisis.Details
Glucose-6-phosphate 1-dehydrogenaseCovao do LoboNot Available1205C>AADR InferredIncreased risk of hemolytic crisis.Details
Glucose-6-phosphate 1-dehydrogenaseClinicNot Available1215G->AADR InferredIncreased risk of hemolytic crisis.Details
Glucose-6-phosphate 1-dehydrogenaseUtrechtNot Available1225C->TADR InferredIncreased risk of hemolytic crisis.Details
Glucose-6-phosphate 1-dehydrogenaseSuwalkiNot Available1226C->GADR InferredIncreased risk of hemolytic crisis.Details
Glucose-6-phosphate 1-dehydrogenaseRiversideNot Available1228G->TADR InferredIncreased risk of hemolytic crisis.Details
Glucose-6-phosphate 1-dehydrogenaseJapan, ShinagawaNot Available1229G->AADR InferredIncreased risk of hemolytic crisis.Details
Glucose-6-phosphate 1-dehydrogenaseKawasakiNot Available1229G->CADR InferredIncreased risk of hemolytic crisis.Details
Glucose-6-phosphate 1-dehydrogenaseMunichNot Available1231A->GADR InferredIncreased risk of hemolytic crisis.Details
Glucose-6-phosphate 1-dehydrogenaseGeorgiaNot Available1284C->AADR InferredIncreased risk of hemolytic crisis.Details
Glucose-6-phosphate 1-dehydrogenaseSumareNot Available1292T->GADR InferredIncreased risk of hemolytic crisis.Details
Glucose-6-phosphate 1-dehydrogenaseTelti/KobeNot Available1318C->TADR InferredIncreased risk of hemolytic crisis.Details
Glucose-6-phosphate 1-dehydrogenaseSantiago de Cuba, MoriokaNot Available1339G->AADR InferredIncreased risk of hemolytic crisis.Details
Glucose-6-phosphate 1-dehydrogenaseHarimaNot Available1358T->AADR InferredIncreased risk of hemolytic crisis.Details
Glucose-6-phosphate 1-dehydrogenaseFiguera da FozNot Available1366G->CADR InferredIncreased risk of hemolytic crisis.Details
Glucose-6-phosphate 1-dehydrogenaseAmiensNot Available1367A>TADR InferredIncreased risk of hemolytic crisis.Details
Glucose-6-phosphate 1-dehydrogenaseBangkok NoiNot Available1376G->T, 1502T->GADR InferredIncreased risk of hemolytic crisis.Details
Glucose-6-phosphate 1-dehydrogenaseFukayaNot Available1462G->AADR InferredIncreased risk of hemolytic crisis.Details
Glucose-6-phosphate 1-dehydrogenaseCampinasNot Available1463G->TADR InferredIncreased risk of hemolytic crisis.Details
Glucose-6-phosphate 1-dehydrogenaseBuenos AiresNot Available1465C>TADR InferredIncreased risk of hemolytic crisis.Details
Glucose-6-phosphate 1-dehydrogenaseArakawaNot Available1466C->TADR InferredIncreased risk of hemolytic crisis.Details
Glucose-6-phosphate 1-dehydrogenaseBrightonNot Available1488_1490delGAAADR InferredIncreased risk of hemolytic crisis.Details
Glucose-6-phosphate 1-dehydrogenaseKozukataNot Available159G->CADR InferredIncreased risk of hemolytic crisis.Details
Glucose-6-phosphate 1-dehydrogenaseAmsterdamNot Available180_182delTCTADR InferredIncreased risk of hemolytic crisis.Details
Glucose-6-phosphate 1-dehydrogenaseNo nameNot Available202G->A, 376A->G, 1264C>GADR InferredIncreased risk of hemolytic crisis.Details
Glucose-6-phosphate 1-dehydrogenaseSwanseaNot Available224T->CADR InferredIncreased risk of hemolytic crisis.Details
Glucose-6-phosphate 1-dehydrogenaseUrayasuNot Available281_283delAGAADR InferredIncreased risk of hemolytic crisis.Details
Glucose-6-phosphate 1-dehydrogenaseVancouverNot Available317C->G544C->T592C->TADR InferredIncreased risk of hemolytic crisis.Details
Glucose-6-phosphate 1-dehydrogenaseMt SinaiNot Available376A->G, 1159C->TADR InferredIncreased risk of hemolytic crisis.Details
Glucose-6-phosphate 1-dehydrogenasePlymouthNot Available488G->AADR InferredIncreased risk of hemolytic crisis.Details
Glucose-6-phosphate 1-dehydrogenaseVolendamNot Available514C->TADR InferredIncreased risk of hemolytic crisis.Details
Glucose-6-phosphate 1-dehydrogenaseShinshuNot Available527A->GADR InferredIncreased risk of hemolytic crisis.Details
Glucose-6-phosphate 1-dehydrogenaseChikugoNot Available535A->TADR InferredIncreased risk of hemolytic crisis.Details
Glucose-6-phosphate 1-dehydrogenaseTsukuiNot Available561_563delCTCADR InferredIncreased risk of hemolytic crisis.Details
Glucose-6-phosphate 1-dehydrogenasePedoplis-CkaroNot Available573C>GADR InferredIncreased risk of hemolytic crisis.Details
Glucose-6-phosphate 1-dehydrogenaseSantiagoNot Available593G->CADR InferredIncreased risk of hemolytic crisis.Details
Glucose-6-phosphate 1-dehydrogenaseMinnesota, Marion, Gastonia, LeJeuneNot Available637G->TADR InferredIncreased risk of hemolytic crisis.Details
Glucose-6-phosphate 1-dehydrogenaseCincinnatiNot Available637G->T, 1037A->TADR InferredIncreased risk of hemolytic crisis.Details
Glucose-6-phosphate 1-dehydrogenaseHarilaouNot Available648T->GADR InferredIncreased risk of hemolytic crisis.Details
Glucose-6-phosphate 1-dehydrogenaseNorth DallasNot Available683_685delACAADR InferredIncreased risk of hemolytic crisis.Details
Glucose-6-phosphate 1-dehydrogenaseAsahikawaNot Available695G->AADR InferredIncreased risk of hemolytic crisis.Details
Glucose-6-phosphate 1-dehydrogenaseDurhamNot Available713A->GADR InferredIncreased risk of hemolytic crisis.Details
Glucose-6-phosphate 1-dehydrogenaseStonybrookNot Available724_729delGGCACTADR InferredIncreased risk of hemolytic crisis.Details
Glucose-6-phosphate 1-dehydrogenaseWayneNot Available769C->GADR InferredIncreased risk of hemolytic crisis.Details
Glucose-6-phosphate 1-dehydrogenaseAveiroNot Available806G->AADR InferredIncreased risk of hemolytic crisis.Details
Glucose-6-phosphate 1-dehydrogenaseCleveland CorumNot Available820G->AADR InferredIncreased risk of hemolytic crisis.Details
Glucose-6-phosphate 1-dehydrogenaseLilleNot Available821A>TADR InferredIncreased risk of hemolytic crisis.Details
Glucose-6-phosphate 1-dehydrogenaseBangkokNot Available825G>CADR InferredIncreased risk of hemolytic crisis.Details
Glucose-6-phosphate 1-dehydrogenaseSugaoNot Available826C->TADR InferredIncreased risk of hemolytic crisis.Details
Glucose-6-phosphate 1-dehydrogenaseLa JollaNot Available832T->CADR InferredIncreased risk of hemolytic crisis.Details
Glucose-6-phosphate 1-dehydrogenaseWexhamNot Available833C->TADR InferredIncreased risk of hemolytic crisis.Details
Glucose-6-phosphate 1-dehydrogenasePiotrkowNot Available851T>CADR InferredIncreased risk of hemolytic crisis.Details
Glucose-6-phosphate 1-dehydrogenaseWest VirginiaNot Available910G->TADR InferredIncreased risk of hemolytic crisis.Details
Glucose-6-phosphate 1-dehydrogenaseOmiyaNot Available921G->CADR InferredIncreased risk of hemolytic crisis.Details
Glucose-6-phosphate 1-dehydrogenaseNaraNot Available953_976delCCACCAAAGGGTACCTGGAC GACCADR InferredIncreased risk of hemolytic crisis.Details
Glucose-6-phosphate 1-dehydrogenaseManhattanNot Available962G->AADR InferredIncreased risk of hemolytic crisis.Details
Glucose-6-phosphate 1-dehydrogenaseRehevotNot Available964T->CADR InferredIncreased risk of hemolytic crisis.Details
Glucose-6-phosphate 1-dehydrogenaseHoniaraNot Available99A->G / 1360C->TADR InferredIncreased risk of hemolytic crisis.Details
Glucose-6-phosphate 1-dehydrogenaseTokyo, FukushimaNot Available1246G->AADR InferredIncreased risk of hemolytic crisis.Details
Glucose-6-phosphate 1-dehydrogenaseChathamNot Available1003G->AADR InferredIncreased risk of hemolytic crisis.Details
Glucose-6-phosphate 1-dehydrogenaseFushanNot Available1004C->AADR InferredIncreased risk of hemolytic crisis.Details
Glucose-6-phosphate 1-dehydrogenasePartenopeNot Available1052G->TADR InferredIncreased risk of hemolytic crisis.Details
Glucose-6-phosphate 1-dehydrogenaseIerapetraNot Available1057C->TADR InferredIncreased risk of hemolytic crisis.Details
Glucose-6-phosphate 1-dehydrogenaseAnadiaNot Available1193A->GADR InferredIncreased risk of hemolytic crisis.Details
Glucose-6-phosphate 1-dehydrogenaseAbenoNot Available1220A->CADR InferredIncreased risk of hemolytic crisis.Details
Glucose-6-phosphate 1-dehydrogenaseSurabayaNot Available1291G->AADR InferredIncreased risk of hemolytic crisis.Details
Glucose-6-phosphate 1-dehydrogenasePawneeNot Available1316G->CADR InferredIncreased risk of hemolytic crisis.Details
Glucose-6-phosphate 1-dehydrogenaseS. AntiocoNot Available1342A->GADR InferredIncreased risk of hemolytic crisis.Details
Glucose-6-phosphate 1-dehydrogenaseCassanoNot Available1347G->CADR InferredIncreased risk of hemolytic crisis.Details
Glucose-6-phosphate 1-dehydrogenaseHermoupolisNot Available1347G->C / 1360C->TADR InferredIncreased risk of hemolytic crisis.Details
Glucose-6-phosphate 1-dehydrogenaseUnion,Maewo, Chinese-2, KaloNot Available1360C->TADR InferredIncreased risk of hemolytic crisis.Details
Glucose-6-phosphate 1-dehydrogenaseAndalusNot Available1361G->AADR InferredIncreased risk of hemolytic crisis.Details
Glucose-6-phosphate 1-dehydrogenaseCosenzaNot Available1376G->CADR InferredIncreased risk of hemolytic crisis.Details
Glucose-6-phosphate 1-dehydrogenaseCanton, Taiwan- Hakka, Gifu-like, Agrigento-likeNot Available1376G->TADR InferredIncreased risk of hemolytic crisis.Details
Glucose-6-phosphate 1-dehydrogenaseFloresNot Available1387C->AADR InferredIncreased risk of hemolytic crisis.Details
Glucose-6-phosphate 1-dehydrogenaseKaiping, Anant, Dhon, Sapporo-like, WoseraNot Available1388G->AADR InferredIncreased risk of hemolytic crisis.Details
Glucose-6-phosphate 1-dehydrogenaseKamogawaNot Available169C->TADR InferredIncreased risk of hemolytic crisis.Details
Glucose-6-phosphate 1-dehydrogenaseCostanzoNot Available179T>CADR InferredIncreased risk of hemolytic crisis.Details
Glucose-6-phosphate 1-dehydrogenaseAmazoniaNot Available185C->AADR InferredIncreased risk of hemolytic crisis.Details
Glucose-6-phosphate 1-dehydrogenaseSongklanagarindNot Available196T->AADR InferredIncreased risk of hemolytic crisis.Details
Glucose-6-phosphate 1-dehydrogenaseHechiNot Available202G->A / 871G->AADR InferredIncreased risk of hemolytic crisis.Details
Glucose-6-phosphate 1-dehydrogenaseNamouruNot Available208T->CADR InferredIncreased risk of hemolytic crisis.Details
Glucose-6-phosphate 1-dehydrogenaseBao LocNot Available352T>CADR InferredIncreased risk of hemolytic crisis.Details
Glucose-6-phosphate 1-dehydrogenaseCrispimNot Available375G->T, 379G->T383T->C384C>TADR InferredIncreased risk of hemolytic crisis.Details
Glucose-6-phosphate 1-dehydrogenaseAcrokorinthosNot Available376A->G / 463C->GADR InferredIncreased risk of hemolytic crisis.Details
Glucose-6-phosphate 1-dehydrogenaseSanta MariaNot Available376A->G / 542A->TADR InferredIncreased risk of hemolytic crisis.Details
Glucose-6-phosphate 1-dehydrogenaseAnanindeuaNot Available376A->G / 871G->AADR InferredIncreased risk of hemolytic crisis.Details
Glucose-6-phosphate 1-dehydrogenaseVanua LavaNot Available383T->CADR InferredIncreased risk of hemolytic crisis.Details
Glucose-6-phosphate 1-dehydrogenaseValladolidNot Available406C->TADR InferredIncreased risk of hemolytic crisis.Details
Glucose-6-phosphate 1-dehydrogenaseBelemNot Available409C->TADR InferredIncreased risk of hemolytic crisis.Details
Glucose-6-phosphate 1-dehydrogenaseLiuzhouNot Available442G->AADR InferredIncreased risk of hemolytic crisis.Details
Glucose-6-phosphate 1-dehydrogenaseShenzenNot Available473G>AADR InferredIncreased risk of hemolytic crisis.Details
Glucose-6-phosphate 1-dehydrogenaseTaipei “Chinese- 3”Not Available493A->GADR InferredIncreased risk of hemolytic crisis.Details
Glucose-6-phosphate 1-dehydrogenaseToledoNot Available496C>TADR InferredIncreased risk of hemolytic crisis.Details
Glucose-6-phosphate 1-dehydrogenaseNaoneNot Available497G->AADR InferredIncreased risk of hemolytic crisis.Details
Glucose-6-phosphate 1-dehydrogenaseNankangNot Available517T->CADR InferredIncreased risk of hemolytic crisis.Details
Glucose-6-phosphate 1-dehydrogenaseMiaoliNot Available519C->GADR InferredIncreased risk of hemolytic crisis.Details
Glucose-6-phosphate 1-dehydrogenaseMediterranean, Dallas, Panama‚ Sassari, Cagliari, BirminghamNot Available563C->TADR InferredIncreased risk of hemolytic crisis.Details
Glucose-6-phosphate 1-dehydrogenaseCoimbra ShundeNot Available592C->TADR InferredIncreased risk of hemolytic crisis.Details
Glucose-6-phosphate 1-dehydrogenaseNilgiriNot Available593G>AADR InferredIncreased risk of hemolytic crisis.Details
Glucose-6-phosphate 1-dehydrogenaseRadlowoNot Available679C->TADR InferredIncreased risk of hemolytic crisis.Details
Glucose-6-phosphate 1-dehydrogenaseRoubaixNot Available811G>CADR InferredIncreased risk of hemolytic crisis.Details
Glucose-6-phosphate 1-dehydrogenaseHaikouNot Available835A->GADR InferredIncreased risk of hemolytic crisis.Details
Glucose-6-phosphate 1-dehydrogenaseChinese-1Not Available835A->TADR InferredIncreased risk of hemolytic crisis.Details
Glucose-6-phosphate 1-dehydrogenaseMizushimaNot Available848A>GADR InferredIncreased risk of hemolytic crisis.Details
Glucose-6-phosphate 1-dehydrogenaseOsakaNot Available853C->TADR InferredIncreased risk of hemolytic crisis.Details
Glucose-6-phosphate 1-dehydrogenaseViangchan, JammuNot Available871G->AADR InferredIncreased risk of hemolytic crisis.Details
Glucose-6-phosphate 1-dehydrogenaseSeoulNot Available916G->AADR InferredIncreased risk of hemolytic crisis.Details
Glucose-6-phosphate 1-dehydrogenaseLudhianaNot Available929G->AADR InferredIncreased risk of hemolytic crisis.Details
Glucose-6-phosphate 1-dehydrogenaseFarroupilhaNot Available977C->AADR InferredIncreased risk of hemolytic crisis.Details
Glucose-6-phosphate 1-dehydrogenaseChinese-5Not Available1024C->TADR InferredIncreased risk of hemolytic crisis.Details
Glucose-6-phosphate 1-dehydrogenaseRignanoNot Available130G>AADR InferredIncreased risk of hemolytic crisis.Details
Glucose-6-phosphate 1-dehydrogenaseOrissaNot Available131C->GADR InferredIncreased risk of hemolytic crisis.Details
Glucose-6-phosphate 1-dehydrogenaseG6PDNiceNot Available1380G>CADR InferredIncreased risk of hemolytic crisis.Details
Glucose-6-phosphate 1-dehydrogenaseKamiube, KeelungNot Available1387C->TADR InferredIncreased risk of hemolytic crisis.Details
Glucose-6-phosphate 1-dehydrogenaseNeapolisNot Available1400C->GADR InferredIncreased risk of hemolytic crisis.Details
Glucose-6-phosphate 1-dehydrogenaseAuresNot Available143T->CADR InferredIncreased risk of hemolytic crisis.Details
Glucose-6-phosphate 1-dehydrogenaseSplitNot Available1442C->GADR InferredIncreased risk of hemolytic crisis.Details
Glucose-6-phosphate 1-dehydrogenaseKambosNot Available148C->TADR InferredIncreased risk of hemolytic crisis.Details
Glucose-6-phosphate 1-dehydrogenasePalestrinaNot Available170G>AADR InferredIncreased risk of hemolytic crisis.Details
Glucose-6-phosphate 1-dehydrogenaseMetapontoNot Available172G->AADR InferredIncreased risk of hemolytic crisis.Details
Glucose-6-phosphate 1-dehydrogenaseMusashinoNot Available185C->TADR InferredIncreased risk of hemolytic crisis.Details
Glucose-6-phosphate 1-dehydrogenaseAsahiNot Available202G->AADR InferredIncreased risk of hemolytic crisis.Details
Glucose-6-phosphate 1-dehydrogenaseA- (202), Ferrara INot Available202G->A / 376A->GADR InferredIncreased risk of hemolytic crisis.Details
Glucose-6-phosphate 1-dehydrogenaseMurcia OristanoNot Available209A->GADR InferredIncreased risk of hemolytic crisis.Details
Glucose-6-phosphate 1-dehydrogenaseUbe KonanNot Available241C->TADR InferredIncreased risk of hemolytic crisis.Details
Glucose-6-phosphate 1-dehydrogenaseLagosantoNot Available242G->AADR InferredIncreased risk of hemolytic crisis.Details
Glucose-6-phosphate 1-dehydrogenaseGuangzhouNot Available274C->TADR InferredIncreased risk of hemolytic crisis.Details
Glucose-6-phosphate 1-dehydrogenaseHammersmithNot Available323T->AADR InferredIncreased risk of hemolytic crisis.Details
Glucose-6-phosphate 1-dehydrogenaseSinnaiNot Available34G->TADR InferredIncreased risk of hemolytic crisis.Details
Glucose-6-phosphate 1-dehydrogenaseA- (680)Not Available376A->G / 680G->TADR InferredIncreased risk of hemolytic crisis.Details
Glucose-6-phosphate 1-dehydrogenaseA- (968), Betica,Selma, GuantanamoNot Available376A->G / 968T->CADR InferredIncreased risk of hemolytic crisis.Details
Glucose-6-phosphate 1-dehydrogenaseSalerno PyrgosNot Available383T>GADR InferredIncreased risk of hemolytic crisis.Details
Glucose-6-phosphate 1-dehydrogenaseQuing YanNot Available392G->TADR InferredIncreased risk of hemolytic crisis.Details
Glucose-6-phosphate 1-dehydrogenaseLagesNot Available40G->AADR InferredIncreased risk of hemolytic crisis.Details
Glucose-6-phosphate 1-dehydrogenaseIleshaNot Available466G->AADR InferredIncreased risk of hemolytic crisis.Details
Glucose-6-phosphate 1-dehydrogenaseMahidolNot Available487G->AADR InferredIncreased risk of hemolytic crisis.Details
Glucose-6-phosphate 1-dehydrogenaseMalagaNot Available542A->TADR InferredIncreased risk of hemolytic crisis.Details
Glucose-6-phosphate 1-dehydrogenaseSibariNot Available634A->GADR InferredIncreased risk of hemolytic crisis.Details
Glucose-6-phosphate 1-dehydrogenaseMexico CityNot Available680G->AADR InferredIncreased risk of hemolytic crisis.Details
Glucose-6-phosphate 1-dehydrogenaseNanningNot Available703C->TADR InferredIncreased risk of hemolytic crisis.Details
Glucose-6-phosphate 1-dehydrogenaseSeattle, Lodi, Modena, Ferrara II, Athens-likeNot Available844G->CADR InferredIncreased risk of hemolytic crisis.Details
Glucose-6-phosphate 1-dehydrogenaseBajo MaumereNot Available844G->TADR InferredIncreased risk of hemolytic crisis.Details
Glucose-6-phosphate 1-dehydrogenaseMontalbanoNot Available854G->AADR InferredIncreased risk of hemolytic crisis.Details
Glucose-6-phosphate 1-dehydrogenaseKalyan-Kerala, Jamnaga, RohiniNot Available949G->AADR InferredIncreased risk of hemolytic crisis.Details
Glucose-6-phosphate 1-dehydrogenaseGaoheNot Available95A->GADR InferredIncreased risk of hemolytic crisis.Details

Interactions

Drug Interactions
DrugInteractionDrug group
AcebutololThe risk or severity of adverse effects can be increased when Sodium Nitrite is combined with Acebutolol.Approved
AcetaminophenThe risk or severity of adverse effects can be increased when Acetaminophen is combined with Sodium Nitrite.Approved
AldesleukinThe risk or severity of adverse effects can be increased when Sodium Nitrite is combined with Aldesleukin.Approved
AliskirenThe risk or severity of adverse effects can be increased when Sodium Nitrite is combined with Aliskiren.Approved, Investigational
AmifostineThe risk or severity of adverse effects can be increased when Amifostine is combined with Sodium Nitrite.Approved, Investigational
AmilorideThe risk or severity of adverse effects can be increased when Sodium Nitrite is combined with Amiloride.Approved
AmiodaroneThe risk or severity of adverse effects can be increased when Amiodarone is combined with Sodium Nitrite.Approved, Investigational
AmlodipineThe risk or severity of adverse effects can be increased when Sodium Nitrite is combined with Amlodipine.Approved
AmobarbitalAmobarbital may increase the hypotensive activities of Sodium Nitrite.Approved, Illicit
Amphotericin BThe risk or severity of adverse effects can be increased when Amphotericin B is combined with Sodium Nitrite.Approved, Investigational
Amyl NitriteThe risk or severity of adverse effects can be increased when Amyl Nitrite is combined with Sodium Nitrite.Approved
AntipyrineThe risk or severity of adverse effects can be increased when Antipyrine is combined with Sodium Nitrite.Approved
ApomorphineThe risk or severity of adverse effects can be increased when Apomorphine is combined with Sodium Nitrite.Approved, Investigational
ApraclonidineThe risk or severity of adverse effects can be increased when Sodium Nitrite is combined with Apraclonidine.Approved
AripiprazoleAripiprazole may increase the hypotensive activities of Sodium Nitrite.Approved, Investigational
ArotinololThe risk or severity of adverse effects can be increased when Arotinolol is combined with Sodium Nitrite.Approved, Investigational
Arsenic trioxideThe risk or severity of adverse effects can be increased when Arsenic trioxide is combined with Sodium Nitrite.Approved, Investigational
AtenololThe risk or severity of adverse effects can be increased when Sodium Nitrite is combined with Atenolol.Approved
Azilsartan medoxomilThe risk or severity of adverse effects can be increased when Sodium Nitrite is combined with Azilsartan medoxomil.Approved
BarbexacloneBarbexaclone may increase the hypotensive activities of Sodium Nitrite.Experimental
BarbitalBarbital may increase the hypotensive activities of Sodium Nitrite.Illicit
BarnidipineThe risk or severity of adverse effects can be increased when Barnidipine is combined with Sodium Nitrite.Approved
BenazeprilThe risk or severity of adverse effects can be increased when Sodium Nitrite is combined with Benazepril.Approved, Investigational
BendroflumethiazideThe risk or severity of adverse effects can be increased when Sodium Nitrite is combined with Bendroflumethiazide.Approved
BenzocaineThe risk or severity of adverse effects can be increased when Benzocaine is combined with Sodium Nitrite.Approved
BepridilThe risk or severity of adverse effects can be increased when Bepridil is combined with Sodium Nitrite.Approved, Withdrawn
BetaxololThe risk or severity of adverse effects can be increased when Sodium Nitrite is combined with Betaxolol.Approved
BisoprololThe risk or severity of adverse effects can be increased when Sodium Nitrite is combined with Bisoprolol.Approved
BortezomibThe risk or severity of adverse effects can be increased when Bortezomib is combined with Sodium Nitrite.Approved, Investigational
BretyliumThe risk or severity of adverse effects can be increased when Sodium Nitrite is combined with Bretylium.Approved
BrimonidineThe risk or severity of adverse effects can be increased when Sodium Nitrite is combined with Brimonidine.Approved
BromocriptineThe risk or severity of adverse effects can be increased when Bromocriptine is combined with Sodium Nitrite.Approved, Investigational
BumetanideThe risk or severity of adverse effects can be increased when Sodium Nitrite is combined with Bumetanide.Approved
BupivacaineThe risk or severity of adverse effects can be increased when Bupivacaine is combined with Sodium Nitrite.Approved, Investigational
ButalbitalThe risk or severity of adverse effects can be increased when Butalbital is combined with Sodium Nitrite.Approved, Illicit
CanagliflozinThe risk or severity of adverse effects can be increased when Sodium Nitrite is combined with Canagliflozin.Approved
Candesartan cilexetilThe risk or severity of adverse effects can be increased when Sodium Nitrite is combined with Candesartan cilexetil.Approved
CaptoprilThe risk or severity of adverse effects can be increased when Sodium Nitrite is combined with Captopril.Approved
CarbetocinThe risk or severity of adverse effects can be increased when Carbetocin is combined with Sodium Nitrite.Approved
CarteololThe risk or severity of adverse effects can be increased when Sodium Nitrite is combined with Carteolol.Approved
CarvedilolThe risk or severity of adverse effects can be increased when Sodium Nitrite is combined with Carvedilol.Approved, Investigational
CelecoxibThe risk or severity of adverse effects can be increased when Celecoxib is combined with Sodium Nitrite.Approved, Investigational
ChloroquineThe risk or severity of adverse effects can be increased when Chloroquine is combined with Sodium Nitrite.Approved, Vet Approved
ChlorothiazideThe risk or severity of adverse effects can be increased when Sodium Nitrite is combined with Chlorothiazide.Approved, Vet Approved
ChlorpromazineThe risk or severity of adverse effects can be increased when Chlorpromazine is combined with Sodium Nitrite.Approved, Vet Approved
ChlorthalidoneThe risk or severity of adverse effects can be increased when Sodium Nitrite is combined with Chlorthalidone.Approved
CilazaprilThe risk or severity of adverse effects can be increased when Sodium Nitrite is combined with Cilazapril.Approved
CilnidipineThe risk or severity of adverse effects can be increased when Cilnidipine is combined with Sodium Nitrite.Approved, Investigational
ClevidipineThe risk or severity of adverse effects can be increased when Sodium Nitrite is combined with Clevidipine.Approved
ClofarabineThe risk or severity of adverse effects can be increased when Clofarabine is combined with Sodium Nitrite.Approved, Investigational
ClomipramineThe risk or severity of adverse effects can be increased when Clomipramine is combined with Sodium Nitrite.Approved, Vet Approved
ClonidineThe risk or severity of adverse effects can be increased when Sodium Nitrite is combined with Clonidine.Approved
ClozapineThe risk or severity of adverse effects can be increased when Clozapine is combined with Sodium Nitrite.Approved
ConivaptanThe risk or severity of adverse effects can be increased when Conivaptan is combined with Sodium Nitrite.Approved, Investigational
DapagliflozinThe risk or severity of adverse effects can be increased when Sodium Nitrite is combined with Dapagliflozin.Approved
DapsoneThe risk or severity of adverse effects can be increased when Dapsone is combined with Sodium Nitrite.Approved, Investigational
DesfluraneThe risk or severity of adverse effects can be increased when Desflurane is combined with Sodium Nitrite.Approved
DexmedetomidineThe risk or severity of adverse effects can be increased when Sodium Nitrite is combined with Dexmedetomidine.Approved, Vet Approved
DiclofenamideThe risk or severity of adverse effects can be increased when Sodium Nitrite is combined with Diclofenamide.Approved
DiltiazemThe risk or severity of adverse effects can be increased when Sodium Nitrite is combined with Diltiazem.Approved
DinutuximabThe risk or severity of adverse effects can be increased when Sodium Nitrite is combined with Dinutuximab.Approved
DipyridamoleThe risk or severity of adverse effects can be increased when Sodium Nitrite is combined with Dipyridamole.Approved
DoxazosinThe risk or severity of adverse effects can be increased when Sodium Nitrite is combined with Doxazosin.Approved
DuloxetineSodium Nitrite may increase the orthostatic hypotensive activities of Duloxetine.Approved
EfonidipineThe risk or severity of adverse effects can be increased when Efonidipine is combined with Sodium Nitrite.Approved, Investigational
EmpagliflozinThe risk or severity of adverse effects can be increased when Sodium Nitrite is combined with Empagliflozin.Approved
EnalaprilThe risk or severity of adverse effects can be increased when Sodium Nitrite is combined with Enalapril.Approved, Vet Approved
EnalaprilatThe risk or severity of adverse effects can be increased when Enalaprilat is combined with Sodium Nitrite.Approved
EplerenoneThe risk or severity of adverse effects can be increased when Sodium Nitrite is combined with Eplerenone.Approved
EpoprostenolThe risk or severity of adverse effects can be increased when Epoprostenol is combined with Sodium Nitrite.Approved
EprosartanThe risk or severity of adverse effects can be increased when Sodium Nitrite is combined with Eprosartan.Approved
EsmololThe risk or severity of adverse effects can be increased when Sodium Nitrite is combined with Esmolol.Approved
Etacrynic acidThe risk or severity of adverse effects can be increased when Sodium Nitrite is combined with Etacrynic acid.Approved
FelodipineThe risk or severity of adverse effects can be increased when Sodium Nitrite is combined with Felodipine.Approved, Investigational
FenoldopamThe risk or severity of adverse effects can be increased when Fenoldopam is combined with Sodium Nitrite.Approved
FimasartanThe risk or severity of adverse effects can be increased when Fimasartan is combined with Sodium Nitrite.Approved, Investigational
FlutamideThe risk or severity of adverse effects can be increased when Flutamide is combined with Sodium Nitrite.Approved
FosinoprilThe risk or severity of adverse effects can be increased when Sodium Nitrite is combined with Fosinopril.Approved
FurosemideThe risk or severity of adverse effects can be increased when Sodium Nitrite is combined with Furosemide.Approved, Vet Approved
GuanfacineThe risk or severity of adverse effects can be increased when Sodium Nitrite is combined with Guanfacine.Approved, Investigational
HalothaneThe risk or severity of adverse effects can be increased when Halothane is combined with Sodium Nitrite.Approved, Vet Approved
HexobarbitalHexobarbital may increase the hypotensive activities of Sodium Nitrite.Approved
HydralazineThe risk or severity of adverse effects can be increased when Sodium Nitrite is combined with Hydralazine.Approved
HydrochlorothiazideThe risk or severity of adverse effects can be increased when Sodium Nitrite is combined with Hydrochlorothiazide.Approved, Vet Approved
HydroflumethiazideThe risk or severity of adverse effects can be increased when Hydroflumethiazide is combined with Sodium Nitrite.Approved, Investigational
IloprostThe risk or severity of adverse effects can be increased when Iloprost is combined with Sodium Nitrite.Approved, Investigational
ImidaprilThe risk or severity of adverse effects can be increased when Imidapril is combined with Sodium Nitrite.Investigational
ImipramineThe risk or severity of adverse effects can be increased when Imipramine is combined with Sodium Nitrite.Approved
IndapamideThe risk or severity of adverse effects can be increased when Sodium Nitrite is combined with Indapamide.Approved
IndoraminThe risk or severity of adverse effects can be increased when Indoramin is combined with Sodium Nitrite.Withdrawn
IrbesartanThe risk or severity of adverse effects can be increased when Sodium Nitrite is combined with Irbesartan.Approved, Investigational
IsocarboxazidThe risk or severity of adverse effects can be increased when Isocarboxazid is combined with Sodium Nitrite.Approved
IsofluraneThe risk or severity of adverse effects can be increased when Isoflurane is combined with Sodium Nitrite.Approved, Vet Approved
IsomethepteneThe risk or severity of adverse effects can be increased when Isometheptene is combined with Sodium Nitrite.Approved
Isosorbide DinitrateThe risk or severity of adverse effects can be increased when Isosorbide Dinitrate is combined with Sodium Nitrite.Approved
Isosorbide MononitrateThe risk or severity of adverse effects can be increased when Isosorbide Mononitrate is combined with Sodium Nitrite.Approved
IsoxsuprineThe risk or severity of adverse effects can be increased when Sodium Nitrite is combined with Isoxsuprine.Approved, Withdrawn
IsradipineThe risk or severity of adverse effects can be increased when Sodium Nitrite is combined with Isradipine.Approved
LabetalolThe risk or severity of adverse effects can be increased when Sodium Nitrite is combined with Labetalol.Approved
LacidipineThe risk or severity of adverse effects can be increased when Lacidipine is combined with Sodium Nitrite.Approved, Investigational
LercanidipineThe risk or severity of adverse effects can be increased when Lercanidipine is combined with Sodium Nitrite.Approved, Investigational
LevobunololThe risk or severity of adverse effects can be increased when Sodium Nitrite is combined with Levobunolol.Approved
LevobupivacaineThe risk or severity of adverse effects can be increased when Levobupivacaine is combined with Sodium Nitrite.Approved, Investigational
LevodopaSodium Nitrite may increase the orthostatic hypotensive activities of Levodopa.Approved
LevosimendanThe risk or severity of adverse effects can be increased when Levosimendan is combined with Sodium Nitrite.Approved, Investigational
LidocaineThe risk or severity of adverse effects can be increased when Lidocaine is combined with Sodium Nitrite.Approved, Vet Approved
LisinoprilThe risk or severity of adverse effects can be increased when Sodium Nitrite is combined with Lisinopril.Approved, Investigational
LofexidineThe risk or severity of adverse effects can be increased when Lofexidine is combined with Sodium Nitrite.Approved, Investigational
LosartanThe risk or severity of adverse effects can be increased when Sodium Nitrite is combined with Losartan.Approved
MafenideThe risk or severity of adverse effects can be increased when Mafenide is combined with Sodium Nitrite.Approved, Vet Approved
MannitolThe risk or severity of adverse effects can be increased when Sodium Nitrite is combined with Mannitol.Approved, Investigational
MecamylamineThe risk or severity of adverse effects can be increased when Sodium Nitrite is combined with Mecamylamine.Approved
MethazolamideThe risk or severity of adverse effects can be increased when Sodium Nitrite is combined with Methazolamide.Approved
MethohexitalMethohexital may increase the hypotensive activities of Sodium Nitrite.Approved
MethyclothiazideThe risk or severity of adverse effects can be increased when Sodium Nitrite is combined with Methyclothiazide.Approved
MethyldopaThe risk or severity of adverse effects can be increased when Sodium Nitrite is combined with Methyldopa.Approved
MethylphenobarbitalMethylphenobarbital may increase the hypotensive activities of Sodium Nitrite.Approved
MetipranololThe risk or severity of adverse effects can be increased when Sodium Nitrite is combined with Metipranolol.Approved
MetoclopramideThe risk or severity of adverse effects can be increased when Metoclopramide is combined with Sodium Nitrite.Approved, Investigational
MetolazoneThe risk or severity of adverse effects can be increased when Sodium Nitrite is combined with Metolazone.Approved
MetoprololThe risk or severity of adverse effects can be increased when Sodium Nitrite is combined with Metoprolol.Approved, Investigational
MinoxidilThe risk or severity of adverse effects can be increased when Sodium Nitrite is combined with Minoxidil.Approved
MoexiprilThe risk or severity of adverse effects can be increased when Sodium Nitrite is combined with Moexipril.Approved
MorphineThe risk or severity of adverse effects can be increased when Morphine is combined with Sodium Nitrite.Approved, Investigational
MoxonidineThe risk or severity of adverse effects can be increased when Moxonidine is combined with Sodium Nitrite.Approved, Investigational
NabiloneThe risk or severity of adverse effects can be increased when Nabilone is combined with Sodium Nitrite.Approved, Investigational
NadololThe risk or severity of adverse effects can be increased when Sodium Nitrite is combined with Nadolol.Approved
NebivololThe risk or severity of adverse effects can be increased when Sodium Nitrite is combined with Nebivolol.Approved, Investigational
NesiritideThe risk or severity of adverse effects can be increased when Sodium Nitrite is combined with Nesiritide.Approved, Investigational
NicardipineThe risk or severity of adverse effects can be increased when Sodium Nitrite is combined with Nicardipine.Approved
NicorandilNicorandil may increase the hypotensive activities of Sodium Nitrite.Approved, Investigational
NifedipineThe risk or severity of adverse effects can be increased when Sodium Nitrite is combined with Nifedipine.Approved
NilvadipineThe risk or severity of adverse effects can be increased when Nilvadipine is combined with Sodium Nitrite.Approved, Investigational
NimodipineThe risk or severity of adverse effects can be increased when Sodium Nitrite is combined with Nimodipine.Approved
NisoldipineThe risk or severity of adverse effects can be increased when Sodium Nitrite is combined with Nisoldipine.Approved
NitrendipineThe risk or severity of adverse effects can be increased when Nitrendipine is combined with Sodium Nitrite.Approved, Investigational
Nitric OxideThe risk or severity of adverse effects can be increased when Nitric Oxide is combined with Sodium Nitrite.Approved
NitrofurantoinThe risk or severity of adverse effects can be increased when Nitrofurantoin is combined with Sodium Nitrite.Approved, Vet Approved
NitroglycerinThe risk or severity of adverse effects can be increased when Nitroglycerin is combined with Sodium Nitrite.Approved, Investigational
NitroprussideThe risk or severity of adverse effects can be increased when Nitroprusside is combined with Sodium Nitrite.Approved
ObinutuzumabThe risk or severity of adverse effects can be increased when Obinutuzumab is combined with Sodium Nitrite.Approved
OlmesartanThe risk or severity of adverse effects can be increased when Sodium Nitrite is combined with Olmesartan.Approved, Investigational
OxprenololThe risk or severity of adverse effects can be increased when Oxprenolol is combined with Sodium Nitrite.Approved
PaclitaxelThe risk or severity of adverse effects can be increased when Paclitaxel is combined with Sodium Nitrite.Approved, Vet Approved
PapaverineThe risk or severity of adverse effects can be increased when Sodium Nitrite is combined with Papaverine.Approved
PenbutololThe risk or severity of adverse effects can be increased when Sodium Nitrite is combined with Penbutolol.Approved, Investigational
PentobarbitalPentobarbital may increase the hypotensive activities of Sodium Nitrite.Approved, Vet Approved
PerindoprilThe risk or severity of adverse effects can be increased when Sodium Nitrite is combined with Perindopril.Approved
PhenazopyridineThe risk or severity of adverse effects can be increased when Phenazopyridine is combined with Sodium Nitrite.Approved
PhenelzineThe risk or severity of adverse effects can be increased when Phenelzine is combined with Sodium Nitrite.Approved
PhenobarbitalThe risk or severity of adverse effects can be increased when Phenobarbital is combined with Sodium Nitrite.Approved
PhenoxybenzamineThe risk or severity of adverse effects can be increased when Phenoxybenzamine is combined with Sodium Nitrite.Approved
PhentolamineThe risk or severity of adverse effects can be increased when Phentolamine is combined with Sodium Nitrite.Approved
PhenytoinThe risk or severity of adverse effects can be increased when Phenytoin is combined with Sodium Nitrite.Approved, Vet Approved
PindololThe risk or severity of adverse effects can be increased when Sodium Nitrite is combined with Pindolol.Approved
PipamperoneThe risk or severity of adverse effects can be increased when Pipamperone is combined with Sodium Nitrite.Approved, Investigational
PramipexoleThe risk or severity of adverse effects can be increased when Pramipexole is combined with Sodium Nitrite.Approved, Investigational
PrazosinThe risk or severity of adverse effects can be increased when Sodium Nitrite is combined with Prazosin.Approved
PrilocaineThe risk or severity of adverse effects can be increased when Sodium Nitrite is combined with Prilocaine.Approved
PrimaquineThe risk or severity of adverse effects can be increased when Primaquine is combined with Sodium Nitrite.Approved
PrimidonePrimidone may increase the hypotensive activities of Sodium Nitrite.Approved, Vet Approved
PropofolThe risk or severity of adverse effects can be increased when Propofol is combined with Sodium Nitrite.Approved, Investigational, Vet Approved
PropranololThe risk or severity of adverse effects can be increased when Sodium Nitrite is combined with Propranolol.Approved, Investigational
QuetiapineThe risk or severity of adverse effects can be increased when Sodium Nitrite is combined with Quetiapine.Approved
QuinaprilThe risk or severity of adverse effects can be increased when Sodium Nitrite is combined with Quinapril.Approved, Investigational
QuinineThe risk or severity of adverse effects can be increased when Quinine is combined with Sodium Nitrite.Approved
RamiprilThe risk or severity of adverse effects can be increased when Sodium Nitrite is combined with Ramipril.Approved
RasagilineThe risk or severity of adverse effects can be increased when Rasagiline is combined with Sodium Nitrite.Approved
RemifentanilThe risk or severity of adverse effects can be increased when Remifentanil is combined with Sodium Nitrite.Approved
ReserpineThe risk or severity of adverse effects can be increased when Sodium Nitrite is combined with Reserpine.Approved, Investigational
RiociguatThe risk or severity of adverse effects can be increased when Sodium Nitrite is combined with Riociguat.Approved
RisperidoneSodium Nitrite may increase the hypotensive activities of Risperidone.Approved, Investigational
RopiniroleThe risk or severity of adverse effects can be increased when Ropinirole is combined with Sodium Nitrite.Approved, Investigational
RopivacaineThe risk or severity of adverse effects can be increased when Ropivacaine is combined with Sodium Nitrite.Approved
RotigotineThe risk or severity of adverse effects can be increased when Rotigotine is combined with Sodium Nitrite.Approved
SacubitrilThe risk or severity of adverse effects can be increased when Sacubitril is combined with Sodium Nitrite.Approved
SecobarbitalSecobarbital may increase the hypotensive activities of Sodium Nitrite.Approved, Vet Approved
SelegilineThe risk or severity of adverse effects can be increased when Selegiline is combined with Sodium Nitrite.Approved, Investigational, Vet Approved
SevofluraneThe risk or severity of adverse effects can be increased when Sevoflurane is combined with Sodium Nitrite.Approved, Vet Approved
SotalolThe risk or severity of adverse effects can be increased when Sodium Nitrite is combined with Sotalol.Approved
SpironolactoneThe risk or severity of adverse effects can be increased when Sodium Nitrite is combined with Spironolactone.Approved
StreptokinaseThe risk or severity of adverse effects can be increased when Sodium Nitrite is combined with Streptokinase.Approved, Investigational
SufentanilThe risk or severity of adverse effects can be increased when Sodium Nitrite is combined with Sufentanil.Approved, Investigational
SulfadiazineThe risk or severity of adverse effects can be increased when Sulfadiazine is combined with Sodium Nitrite.Approved, Vet Approved
SulfamethoxazoleThe risk or severity of adverse effects can be increased when Sulfamethoxazole is combined with Sodium Nitrite.Approved
TamsulosinThe risk or severity of adverse effects can be increased when Sodium Nitrite is combined with Tamsulosin.Approved, Investigational
TelmisartanThe risk or severity of adverse effects can be increased when Sodium Nitrite is combined with Telmisartan.Approved, Investigational
TerazosinThe risk or severity of adverse effects can be increased when Sodium Nitrite is combined with Terazosin.Approved
ThalidomideThe risk or severity of adverse effects can be increased when Sodium Nitrite is combined with Thalidomide.Approved, Investigational, Withdrawn
ThiamylalThiamylal may increase the hypotensive activities of Sodium Nitrite.Approved, Vet Approved
ThiopentalThiopental may increase the hypotensive activities of Sodium Nitrite.Approved, Vet Approved
ThioridazineThe risk or severity of adverse effects can be increased when Sodium Nitrite is combined with Thioridazine.Approved, Withdrawn
TimololThe risk or severity of adverse effects can be increased when Sodium Nitrite is combined with Timolol.Approved
TizanidineThe risk or severity of adverse effects can be increased when Sodium Nitrite is combined with Tizanidine.Approved
TolazolineThe risk or severity of adverse effects can be increased when Sodium Nitrite is combined with Tolazoline.Approved, Vet Approved
TolcaponeThe risk or severity of adverse effects can be increased when Sodium Nitrite is combined with Tolcapone.Approved, Withdrawn
TorasemideThe risk or severity of adverse effects can be increased when Sodium Nitrite is combined with Torasemide.Approved
TrandolaprilThe risk or severity of adverse effects can be increased when Sodium Nitrite is combined with Trandolapril.Approved
TranylcypromineThe risk or severity of adverse effects can be increased when Sodium Nitrite is combined with Tranylcypromine.Approved
TretinoinThe risk or severity of adverse effects can be increased when Sodium Nitrite is combined with Tretinoin.Approved, Investigational, Nutraceutical
TriamtereneThe risk or severity of adverse effects can be increased when Sodium Nitrite is combined with Triamterene.Approved
ValsartanThe risk or severity of adverse effects can be increased when Sodium Nitrite is combined with Valsartan.Approved, Investigational
VerapamilThe risk or severity of adverse effects can be increased when Sodium Nitrite is combined with Verapamil.Approved
ZopicloneThe risk or severity of adverse effects can be increased when Zopiclone is combined with Sodium Nitrite.Approved
Food Interactions
Not Available

References

General References
  1. Baskin SI, Horowitz AM, Nealley EW: The antidotal action of sodium nitrite and sodium thiosulfate against cyanide poisoning. J Clin Pharmacol. 1992 Apr;32(4):368-75. [PubMed:1569239]
  2. Beasley DM, Glass WI: Cyanide poisoning: pathophysiology and treatment recommendations. Occup Med (Lond). 1998 Oct;48(7):427-31. [PubMed:10024740]
  3. Lundberg JO, Weitzberg E, Gladwin MT: The nitrate-nitrite-nitric oxide pathway in physiology and therapeutics. Nat Rev Drug Discov. 2008 Feb;7(2):156-67. doi: 10.1038/nrd2466. [PubMed:18167491]
  4. Denninger JW, Marletta MA: Guanylate cyclase and the .NO/cGMP signaling pathway. Biochim Biophys Acta. 1999 May 5;1411(2-3):334-50. [PubMed:10320667]
  5. Rix PJ, Vick A, Attkins NJ, Barker GE, Bott AW, Alcorn H Jr, Gladwin MT, Shiva S, Bradley S, Hussaini A, Hoye WL, Parsley EL, Masamune H: Pharmacokinetics, pharmacodynamics, safety, and tolerability of nebulized sodium nitrite (AIR001) following repeat-dose inhalation in healthy subjects. Clin Pharmacokinet. 2015 Mar;54(3):261-72. doi: 10.1007/s40262-014-0201-y. [PubMed:25421879]
  6. Tiso M, Schechter AN: Nitrate reduction to nitrite, nitric oxide and ammonia by gut bacteria under physiological conditions. PLoS One. 2015 Mar 24;10(3):e0119712. doi: 10.1371/journal.pone.0119712. eCollection 2015. [PubMed:25803049]
External Links
PubChem Compound
23668193
PubChem Substance
310265030
ChemSpider
22689
ChEBI
78870
ChEMBL
CHEMBL93268
PharmGKB
PA166115361
ATC Codes
V03AB08 — Sodium nitrite
AHFS Codes
  • 92:12.00 — Antidotes
FDA label
Download (250 KB)
MSDS
Download (105 KB)

Clinical Trials

Clinical Trials
PhaseStatusPurposeConditionsCount
1CompletedBasic ScienceHealthy Volunteers1
1CompletedTreatmentChronic Hemolytic Disorders / Sickle Cell Disorders1
1CompletedTreatmentHealthy Volunteers2
1CompletedTreatmentOut-Of-Hospital Cardiac Arrest1
1CompletedTreatmentPulmonary Hypertension (PH)1
1CompletedTreatmentSickle Cell Disorders1
1RecruitingBasic ScienceHealthy Volunteers1
1TerminatedTreatmentHealthy Volunteers / HV1
1Unknown StatusBasic ScienceHigh Blood Pressure (Hypertension)1
1, 2CompletedTreatmentVascular Aging1
1, 2RecruitingTreatmentCystic Fibrosis (CF)1
1, 2TerminatedTreatmentSickle Cell Disorders1
2Active Not RecruitingTreatmentDiabetes Mellitus (DM)1
2CompletedDiagnosticHeart Failure, Unspecified1
2CompletedTreatmentCardiovascular Disease (CVD) / Myocardial Infarction (MI) / Myocardial Ischemia / Reperfusion Injury1
2CompletedTreatmentEndothelium-Derived Relaxing Factor / Healthy Volunteers / Nitric Oxide1
2CompletedTreatmentHeart Failure, Unspecified1
2CompletedTreatmentPeripheral Arterial Disease (PAD)1
2CompletedTreatmentSubarachnoid Hemorrhage1
2Not Yet RecruitingTreatmentHeart Failure, Unspecified / Pulmonary Hypertension Secondary1
2Not Yet RecruitingTreatmentHigh Blood Pressure (Hypertension) / Metabolic Syndromes1
2RecruitingTreatmentAcute Myocardial Infarction (AMI)1
2RecruitingTreatmentAsthma Bronchial1
2RecruitingTreatmentChronic Kidney Disease (CKD)1
2RecruitingTreatmentHeart Failure, Unspecified1
2RecruitingTreatmentHigh Blood Pressure (Hypertension) / Metabolic Syndromes1
2RecruitingTreatmentPulmonary Arterial Hypertension (PAH) / Pulmonary Hypertension (PH)1
2RecruitingTreatmentSickle Cell Disorders1
2TerminatedPreventionPrimary Graft Dysfunction1
2TerminatedTreatmentPulmonary Arterial Hypertension (PAH)1
2TerminatedTreatmentSubarachnoid Hemorrhage1
2Unknown StatusTreatmentCoronary Artery Bypass Surgery1
2, 3CompletedTreatmentAcute ST Elevation Myocardial Infarction1
3Not Yet RecruitingPreventionAcute Kidney Injury (AKI)1
Not AvailableRecruitingNot AvailableAgeing1

Pharmacoeconomics

Manufacturers
Not Available
Packagers
Not Available
Dosage forms
FormRouteStrength
Kit
Injection, solutionIntravenous30 mg/mL
SolutionIntravenous30 mg
Prices
Not Available
Patents
Patent NumberPediatric ExtensionApprovedExpires (estimated)
US8496973No2011-03-292031-03-29Us
US8568793No2011-12-242031-12-24Us
US9585912No2011-03-292031-03-29Us
US9345724No2011-03-292031-03-29Us

Properties

State
Solid
Experimental Properties
PropertyValueSource
melting point (°C)271MSDS
boiling point (°C)320MSDS
water solubility820g/LMSDS
logP-3.7MSDS
Predicted Properties
PropertyValueSource
logP0.17ChemAxon
pKa (Strongest Acidic)3.32ChemAxon
pKa (Strongest Basic)-3.5ChemAxon
Physiological Charge-1ChemAxon
Hydrogen Acceptor Count3ChemAxon
Hydrogen Donor Count0ChemAxon
Polar Surface Area52.49 Å2ChemAxon
Rotatable Bond Count0ChemAxon
Refractivity7.6 m3·mol-1ChemAxon
Polarizability2.44 Å3ChemAxon
Number of Rings0ChemAxon
Bioavailability1ChemAxon
Rule of FiveYesChemAxon
Ghose FilterNoChemAxon
Veber's RuleNoChemAxon
MDDR-like RuleNoChemAxon
Predicted ADMET features
Not Available

Spectra

Mass Spec (NIST)
Not Available
Spectra
SpectrumSpectrum TypeSplash Key
Predicted GC-MS Spectrum - GC-MSPredicted GC-MSNot Available

Taxonomy

Description
This compound belongs to the class of inorganic compounds known as alkali metal nitrites. These are inorganic compounds in which the largest oxoanion is nitrite, and in which the heaviest atom not in an oxoanion is an alkali metal.
Kingdom
Inorganic compounds
Super Class
Mixed metal/non-metal compounds
Class
Alkali metal oxoanionic compounds
Sub Class
Alkali metal nitrites
Direct Parent
Alkali metal nitrites
Alternative Parents
Inorganic nitrites / Inorganic sodium salts / Inorganic oxides
Substituents
Alkali metal nitrite / Inorganic nitrite / Inorganic sodium salt / Inorganic oxide / Inorganic salt
Molecular Framework
Not Available
External Descriptors
inorganic sodium salt, nitrite salt (CHEBI:78870)

Targets

Kind
Protein
Organism
Human
Pharmacological action
Yes
Actions
Oxidizer
General Function
Oxygen transporter activity
Specific Function
Involved in oxygen transport from the lung to the various peripheral tissues.
Gene Name
HBA1
Uniprot ID
P69905
Uniprot Name
Hemoglobin subunit alpha
Molecular Weight
15257.405 Da
References
  1. Baskin SI, Horowitz AM, Nealley EW: The antidotal action of sodium nitrite and sodium thiosulfate against cyanide poisoning. J Clin Pharmacol. 1992 Apr;32(4):368-75. [PubMed:1569239]
Kind
Protein
Organism
Human
Pharmacological action
Yes
Actions
Oxidizer
General Function
Oxygen transporter activity
Specific Function
Involved in oxygen transport from the lung to the various peripheral tissues.LVV-hemorphin-7 potentiates the activity of bradykinin, causing a decrease in blood pressure.Spinorphin: functions as an...
Gene Name
HBB
Uniprot ID
P68871
Uniprot Name
Hemoglobin subunit beta
Molecular Weight
15998.34 Da
References
  1. Baskin SI, Horowitz AM, Nealley EW: The antidotal action of sodium nitrite and sodium thiosulfate against cyanide poisoning. J Clin Pharmacol. 1992 Apr;32(4):368-75. [PubMed:1569239]
Kind
Protein
Organism
Human
Pharmacological action
Unknown
Actions
Oxidizer
General Function
Oxygen transporter activity
Specific Function
Serves as a reserve supply of oxygen and facilitates the movement of oxygen within muscles.
Gene Name
MB
Uniprot ID
P02144
Uniprot Name
Myoglobin
Molecular Weight
17183.725 Da
References
  1. Baskin SI, Horowitz AM, Nealley EW: The antidotal action of sodium nitrite and sodium thiosulfate against cyanide poisoning. J Clin Pharmacol. 1992 Apr;32(4):368-75. [PubMed:1569239]

Drug created on September 21, 2015 10:24 / Updated on December 11, 2017 13:01