Sodium Nitrite - DrugBank

ID Pharmacology Interactions References Trials Economics Properties Spectra Taxonomy

Targets (3)

Targets (3)Biointeractions (2)

Identification

Name

Sodium Nitrite

Accession Number

DB09112

Type

Small Molecule

Groups

Approved

Description

Sodium Nitrite is used as part of an intravenous mixture with sodium thiosulfate to treat cyanide poisoning. It is on the World Health Organization's List of Essential Medicines, a list of the most important medications needed in a basic health system. There is also research to investigate its applicability towards treatments for heart attacks, brain aneurysms, pulmonary hypertension in infants, and Pseudomonas aeruginosa infections.

Structure

MOL SDF PDB SMILES InChI

Synonyms

Not Available

External IDs

INS NO.250 / INS-250 / NSC-77391

Product Ingredients

Not Available

Approved Prescription Products

Name	Dosage	Strength	Route	Labeller	Marketing Start	Marketing End
Sodium Nitrite	Injection, solution	30 mg/mL	Intravenous	Hope Pharmaceuticals	2012-02-14	Not applicable	US
Sodium Nitrite Injection, USP	Solution	30 mg	Intravenous	Hope Pharmaceuticals	2016-07-20	Not applicable	Canada

Approved Generic Prescription Products

Not Available

Approved Over the Counter Products

Not Available

Unapproved/Other Products

Not Available

International Brands

Not Available

Brand mixtures

Name	Labeller	Ingredients
Nithiodote	Hope Pharmaceuticals	Sodium Nitrite Thiosulfuric acid

Categories

UNII

M0KG633D4F

CAS number

7632-00-0

Weight

Average: 68.9953
Monoisotopic: 68.982672924

Chemical Formula

NNaO₂

InChI Key

LPXPTNMVRIOKMN-UHFFFAOYSA-M

InChI

InChI=1S/HNO2.Na/c2-1-3;/h(H,2,3);/q;+1/p-1

IUPAC Name

sodium nitrite

SMILES

[Na+].[O-]N=O

Pharmacology

Indication

For sequential use with sodium thiosulfate for the treatment of acute cyanide poisoning that is judged to be life-threatening ^{[FDA Label]}.

Structured Indications

Cyanide Poisoning

Pharmacodynamics

Sodium nitrite reverses cyanide toxicity and produces blood vessel dilation ^[1].

Mechanism of action

Cyanide has a high affinity for the oxidized form of iron (Fe3+) such as that found in cytochrome oxidase a3 ^[2]. Cyanide binds to and inhibits cytochrome oxidase a3, preventing oxidative phophorylation from occuring. The resultant lack of ATP cannot support normal cellular processes, particularly in the brain. Compensatory increases in anaerobic respiration result in rising levels of lactic acid and subsequent acidosis.

Nitrite primarily acts by oxidizing hemoglobin to methemoglobin ^[1]. The now oxidized Fe3+ in methemoglobin also binds cyanide with high affinity and accepts cyanide from cytochrome a3. This leaves cytochrome a3 free to resume its function in oxidative phosphorylation. The slow dissociation of cyanide from methemoglobin allows hepatic enzymes such as rhodanese to detoxify the compound without further systemic toxicity occuring. Methemoglobin is reduced back to hemoglobin by methemoglobin reductase allowing the affected blood cells to resume normal functioning.

The reduction of nitrite by hemoglobin results in the formation of nitric oxide ^[3]. Nitric oxide acts as a powerful vasodilator, producing vascular smooth muscle relaxation through activation of soluble guanylate cyclase and the subsequent cyclic guanylyl triphosphate mediated signalling cascade ^[4].

Target	Kind	Pharmacological action	Actions	Organism	UniProt ID
Hemoglobin subunit alpha	Protein	yes	oxidizer	Human	P69905	details
Hemoglobin subunit beta	Protein	yes	oxidizer	Human	P68871	details
Myoglobin	Protein	unknown	oxidizer	Human	P02144	details

Absorption

Not Available

Volume of distribution

Not Available

Protein binding

Not Available

Metabolism

Reduced by deoxyhemoglobin to form nitric oxide ^[3]. Nitrite is also reduced to nitric oxide and further reduced to ammonia by gut bacteria ^[6]. Nitrite can be oxidized to nitrate by oxyhemoglobin.

Substrate	Enzymes	Product
Sodium Nitrite	Hemoglobin subunit alpha Hemoglobin subunit beta	Nitric Oxide	Details
Nitric Oxide	Not Available	Ammonia	Details
Sodium Nitrite	Hemoglobin subunit alpha Hemoglobin subunit beta	Nitrate	Details

Route of elimination

Not Available

Half life

Half life of 0.4-0.78h ^[5].

Clearance

Not Available

Toxicity

Oral LD50 of 157.9mg/kg observed in rats and 175mg/kg observed in mice ^[MSDS]. Estimated oral LD50 of 35mg/kg in humans ^[1]. Sodium nitrite toxicity manifests as cardiovascular collapse following severe hypotension due to nitrite's vasodilatory action.

Affected organisms

Not Available

Pathways

Not Available

Pharmacogenomic Effects/ADRs

Interacting Gene/Enzyme	Allele name	Genotype(s)	Defining Change(s)	Type(s)	Description	Details
Glucose-6-phosphate 1-dehydrogenase	Villeurbanne	Not Available	1000_1002delACC	ADR Inferred	Increased risk of hemolytic crisis.	Details
Glucose-6-phosphate 1-dehydrogenase	Torun	Not Available	1006A->G	ADR Inferred	Increased risk of hemolytic crisis.	Details
Glucose-6-phosphate 1-dehydrogenase	Sunderland	Not Available	105_107delCAT	ADR Inferred	Increased risk of hemolytic crisis.	Details
Glucose-6-phosphate 1-dehydrogenase	Iwatsuki	Not Available	1081G->A	ADR Inferred	Increased risk of hemolytic crisis.	Details
Glucose-6-phosphate 1-dehydrogenase	Serres	Not Available	1082C->T	ADR Inferred	Increased risk of hemolytic crisis.	Details
Glucose-6-phosphate 1-dehydrogenase	Tondela	Not Available	1084_1101delCTGAACGAGCGCAAGGCC	ADR Inferred	Increased risk of hemolytic crisis.	Details
Glucose-6-phosphate 1-dehydrogenase	Loma Linda	Not Available	1089C->A	ADR Inferred	Increased risk of hemolytic crisis.	Details
Glucose-6-phosphate 1-dehydrogenase	Aachen	Not Available	1089C->G	ADR Inferred	Increased risk of hemolytic crisis.	Details
Glucose-6-phosphate 1-dehydrogenase	Tenri	Not Available	1096A->G	ADR Inferred	Increased risk of hemolytic crisis.	Details
Glucose-6-phosphate 1-dehydrogenase	Montpellier	Not Available	1132G>A	ADR Inferred	Increased risk of hemolytic crisis.	Details
Glucose-6-phosphate 1-dehydrogenase	Calvo Mackenna	Not Available	1138A->G	ADR Inferred	Increased risk of hemolytic crisis.	Details
Glucose-6-phosphate 1-dehydrogenase	Riley	Not Available	1139T->C	ADR Inferred	Increased risk of hemolytic crisis.	Details
Glucose-6-phosphate 1-dehydrogenase	Olomouc	Not Available	1141T->C	ADR Inferred	Increased risk of hemolytic crisis.	Details
Glucose-6-phosphate 1-dehydrogenase	Tomah	Not Available	1153T->C	ADR Inferred	Increased risk of hemolytic crisis.	Details
Glucose-6-phosphate 1-dehydrogenase	Lynwood	Not Available	1154G->T	ADR Inferred	Increased risk of hemolytic crisis.	Details
Glucose-6-phosphate 1-dehydrogenase	Madrid	Not Available	1155C->G	ADR Inferred	Increased risk of hemolytic crisis.	Details
Glucose-6-phosphate 1-dehydrogenase	Iowa, Walter Reed, Springfield	Not Available	1156A->G	ADR Inferred	Increased risk of hemolytic crisis.	Details
Glucose-6-phosphate 1-dehydrogenase	Beverly Hills, Genova, Iwate, Niigata, Yamaguchi	Not Available	1160G->A	ADR Inferred	Increased risk of hemolytic crisis.	Details
Glucose-6-phosphate 1-dehydrogenase	Hartford	Not Available	1162A->G	ADR Inferred	Increased risk of hemolytic crisis.	Details
Glucose-6-phosphate 1-dehydrogenase	Praha	Not Available	1166A->G	ADR Inferred	Increased risk of hemolytic crisis.	Details
Glucose-6-phosphate 1-dehydrogenase	Krakow	Not Available	1175T>C	ADR Inferred	Increased risk of hemolytic crisis.	Details
Glucose-6-phosphate 1-dehydrogenase	Wisconsin	Not Available	1177C->G	ADR Inferred	Increased risk of hemolytic crisis.	Details
Glucose-6-phosphate 1-dehydrogenase	Nashville, Anaheim, Portici	Not Available	1178G->A	ADR Inferred	Increased risk of hemolytic crisis.	Details
Glucose-6-phosphate 1-dehydrogenase	Alhambra	Not Available	1180G->C	ADR Inferred	Increased risk of hemolytic crisis.	Details
Glucose-6-phosphate 1-dehydrogenase	Bari	Not Available	1187C->T	ADR Inferred	Increased risk of hemolytic crisis.	Details
Glucose-6-phosphate 1-dehydrogenase	Puerto Limon	Not Available	1192G->A	ADR Inferred	Increased risk of hemolytic crisis.	Details
Glucose-6-phosphate 1-dehydrogenase	Covao do Lobo	Not Available	1205C>A	ADR Inferred	Increased risk of hemolytic crisis.	Details
Glucose-6-phosphate 1-dehydrogenase	Clinic	Not Available	1215G->A	ADR Inferred	Increased risk of hemolytic crisis.	Details
Glucose-6-phosphate 1-dehydrogenase	Utrecht	Not Available	1225C->T	ADR Inferred	Increased risk of hemolytic crisis.	Details
Glucose-6-phosphate 1-dehydrogenase	Suwalki	Not Available	1226C->G	ADR Inferred	Increased risk of hemolytic crisis.	Details
Glucose-6-phosphate 1-dehydrogenase	Riverside	Not Available	1228G->T	ADR Inferred	Increased risk of hemolytic crisis.	Details
Glucose-6-phosphate 1-dehydrogenase	Japan, Shinagawa	Not Available	1229G->A	ADR Inferred	Increased risk of hemolytic crisis.	Details
Glucose-6-phosphate 1-dehydrogenase	Kawasaki	Not Available	1229G->C	ADR Inferred	Increased risk of hemolytic crisis.	Details
Glucose-6-phosphate 1-dehydrogenase	Munich	Not Available	1231A->G	ADR Inferred	Increased risk of hemolytic crisis.	Details
Glucose-6-phosphate 1-dehydrogenase	Georgia	Not Available	1284C->A	ADR Inferred	Increased risk of hemolytic crisis.	Details
Glucose-6-phosphate 1-dehydrogenase	Sumare	Not Available	1292T->G	ADR Inferred	Increased risk of hemolytic crisis.	Details
Glucose-6-phosphate 1-dehydrogenase	Telti/Kobe	Not Available	1318C->T	ADR Inferred	Increased risk of hemolytic crisis.	Details
Glucose-6-phosphate 1-dehydrogenase	Santiago de Cuba, Morioka	Not Available	1339G->A	ADR Inferred	Increased risk of hemolytic crisis.	Details
Glucose-6-phosphate 1-dehydrogenase	Harima	Not Available	1358T->A	ADR Inferred	Increased risk of hemolytic crisis.	Details
Glucose-6-phosphate 1-dehydrogenase	Figuera da Foz	Not Available	1366G->C	ADR Inferred	Increased risk of hemolytic crisis.	Details
Glucose-6-phosphate 1-dehydrogenase	Amiens	Not Available	1367A>T	ADR Inferred	Increased risk of hemolytic crisis.	Details
Glucose-6-phosphate 1-dehydrogenase	Bangkok Noi	Not Available	1376G->T, 1502T->G	ADR Inferred	Increased risk of hemolytic crisis.	Details
Glucose-6-phosphate 1-dehydrogenase	Fukaya	Not Available	1462G->A	ADR Inferred	Increased risk of hemolytic crisis.	Details
Glucose-6-phosphate 1-dehydrogenase	Campinas	Not Available	1463G->T	ADR Inferred	Increased risk of hemolytic crisis.	Details
Glucose-6-phosphate 1-dehydrogenase	Buenos Aires	Not Available	1465C>T	ADR Inferred	Increased risk of hemolytic crisis.	Details
Glucose-6-phosphate 1-dehydrogenase	Arakawa	Not Available	1466C->T	ADR Inferred	Increased risk of hemolytic crisis.	Details
Glucose-6-phosphate 1-dehydrogenase	Brighton	Not Available	1488_1490delGAA	ADR Inferred	Increased risk of hemolytic crisis.	Details
Glucose-6-phosphate 1-dehydrogenase	Kozukata	Not Available	159G->C	ADR Inferred	Increased risk of hemolytic crisis.	Details
Glucose-6-phosphate 1-dehydrogenase	Amsterdam	Not Available	180_182delTCT	ADR Inferred	Increased risk of hemolytic crisis.	Details
Glucose-6-phosphate 1-dehydrogenase	No name	Not Available	202G->A, 376A->G, 1264C>G	ADR Inferred	Increased risk of hemolytic crisis.	Details
Glucose-6-phosphate 1-dehydrogenase	Swansea	Not Available	224T->C	ADR Inferred	Increased risk of hemolytic crisis.	Details
Glucose-6-phosphate 1-dehydrogenase	Urayasu	Not Available	281_283delAGA	ADR Inferred	Increased risk of hemolytic crisis.	Details
Glucose-6-phosphate 1-dehydrogenase	Vancouver	Not Available	317C->G544C->T592C->T	ADR Inferred	Increased risk of hemolytic crisis.	Details
Glucose-6-phosphate 1-dehydrogenase	Mt Sinai	Not Available	376A->G, 1159C->T	ADR Inferred	Increased risk of hemolytic crisis.	Details
Glucose-6-phosphate 1-dehydrogenase	Plymouth	Not Available	488G->A	ADR Inferred	Increased risk of hemolytic crisis.	Details
Glucose-6-phosphate 1-dehydrogenase	Volendam	Not Available	514C->T	ADR Inferred	Increased risk of hemolytic crisis.	Details
Glucose-6-phosphate 1-dehydrogenase	Shinshu	Not Available	527A->G	ADR Inferred	Increased risk of hemolytic crisis.	Details
Glucose-6-phosphate 1-dehydrogenase	Chikugo	Not Available	535A->T	ADR Inferred	Increased risk of hemolytic crisis.	Details
Glucose-6-phosphate 1-dehydrogenase	Tsukui	Not Available	561_563delCTC	ADR Inferred	Increased risk of hemolytic crisis.	Details
Glucose-6-phosphate 1-dehydrogenase	Pedoplis-Ckaro	Not Available	573C>G	ADR Inferred	Increased risk of hemolytic crisis.	Details
Glucose-6-phosphate 1-dehydrogenase	Santiago	Not Available	593G->C	ADR Inferred	Increased risk of hemolytic crisis.	Details
Glucose-6-phosphate 1-dehydrogenase	Minnesota, Marion, Gastonia, LeJeune	Not Available	637G->T	ADR Inferred	Increased risk of hemolytic crisis.	Details
Glucose-6-phosphate 1-dehydrogenase	Cincinnati	Not Available	637G->T, 1037A->T	ADR Inferred	Increased risk of hemolytic crisis.	Details
Glucose-6-phosphate 1-dehydrogenase	Harilaou	Not Available	648T->G	ADR Inferred	Increased risk of hemolytic crisis.	Details
Glucose-6-phosphate 1-dehydrogenase	North Dallas	Not Available	683_685delACA	ADR Inferred	Increased risk of hemolytic crisis.	Details
Glucose-6-phosphate 1-dehydrogenase	Asahikawa	Not Available	695G->A	ADR Inferred	Increased risk of hemolytic crisis.	Details
Glucose-6-phosphate 1-dehydrogenase	Durham	Not Available	713A->G	ADR Inferred	Increased risk of hemolytic crisis.	Details
Glucose-6-phosphate 1-dehydrogenase	Stonybrook	Not Available	724_729delGGCACT	ADR Inferred	Increased risk of hemolytic crisis.	Details
Glucose-6-phosphate 1-dehydrogenase	Wayne	Not Available	769C->G	ADR Inferred	Increased risk of hemolytic crisis.	Details
Glucose-6-phosphate 1-dehydrogenase	Aveiro	Not Available	806G->A	ADR Inferred	Increased risk of hemolytic crisis.	Details
Glucose-6-phosphate 1-dehydrogenase	Cleveland Corum	Not Available	820G->A	ADR Inferred	Increased risk of hemolytic crisis.	Details
Glucose-6-phosphate 1-dehydrogenase	Lille	Not Available	821A>T	ADR Inferred	Increased risk of hemolytic crisis.	Details
Glucose-6-phosphate 1-dehydrogenase	Bangkok	Not Available	825G>C	ADR Inferred	Increased risk of hemolytic crisis.	Details
Glucose-6-phosphate 1-dehydrogenase	Sugao	Not Available	826C->T	ADR Inferred	Increased risk of hemolytic crisis.	Details
Glucose-6-phosphate 1-dehydrogenase	La Jolla	Not Available	832T->C	ADR Inferred	Increased risk of hemolytic crisis.	Details
Glucose-6-phosphate 1-dehydrogenase	Wexham	Not Available	833C->T	ADR Inferred	Increased risk of hemolytic crisis.	Details
Glucose-6-phosphate 1-dehydrogenase	Piotrkow	Not Available	851T>C	ADR Inferred	Increased risk of hemolytic crisis.	Details
Glucose-6-phosphate 1-dehydrogenase	West Virginia	Not Available	910G->T	ADR Inferred	Increased risk of hemolytic crisis.	Details
Glucose-6-phosphate 1-dehydrogenase	Omiya	Not Available	921G->C	ADR Inferred	Increased risk of hemolytic crisis.	Details
Glucose-6-phosphate 1-dehydrogenase	Nara	Not Available	953_976delCCACCAAAGGGTACCTGGAC GACC	ADR Inferred	Increased risk of hemolytic crisis.	Details
Glucose-6-phosphate 1-dehydrogenase	Manhattan	Not Available	962G->A	ADR Inferred	Increased risk of hemolytic crisis.	Details
Glucose-6-phosphate 1-dehydrogenase	Rehevot	Not Available	964T->C	ADR Inferred	Increased risk of hemolytic crisis.	Details
Glucose-6-phosphate 1-dehydrogenase	Honiara	Not Available	99A->G / 1360C->T	ADR Inferred	Increased risk of hemolytic crisis.	Details
Glucose-6-phosphate 1-dehydrogenase	Tokyo, Fukushima	Not Available	1246G->A	ADR Inferred	Increased risk of hemolytic crisis.	Details
Glucose-6-phosphate 1-dehydrogenase	Chatham	Not Available	1003G->A	ADR Inferred	Increased risk of hemolytic crisis.	Details
Glucose-6-phosphate 1-dehydrogenase	Fushan	Not Available	1004C->A	ADR Inferred	Increased risk of hemolytic crisis.	Details
Glucose-6-phosphate 1-dehydrogenase	Partenope	Not Available	1052G->T	ADR Inferred	Increased risk of hemolytic crisis.	Details
Glucose-6-phosphate 1-dehydrogenase	Ierapetra	Not Available	1057C->T	ADR Inferred	Increased risk of hemolytic crisis.	Details
Glucose-6-phosphate 1-dehydrogenase	Anadia	Not Available	1193A->G	ADR Inferred	Increased risk of hemolytic crisis.	Details
Glucose-6-phosphate 1-dehydrogenase	Abeno	Not Available	1220A->C	ADR Inferred	Increased risk of hemolytic crisis.	Details
Glucose-6-phosphate 1-dehydrogenase	Surabaya	Not Available	1291G->A	ADR Inferred	Increased risk of hemolytic crisis.	Details
Glucose-6-phosphate 1-dehydrogenase	Pawnee	Not Available	1316G->C	ADR Inferred	Increased risk of hemolytic crisis.	Details
Glucose-6-phosphate 1-dehydrogenase	S. Antioco	Not Available	1342A->G	ADR Inferred	Increased risk of hemolytic crisis.	Details
Glucose-6-phosphate 1-dehydrogenase	Cassano	Not Available	1347G->C	ADR Inferred	Increased risk of hemolytic crisis.	Details
Glucose-6-phosphate 1-dehydrogenase	Hermoupolis	Not Available	1347G->C / 1360C->T	ADR Inferred	Increased risk of hemolytic crisis.	Details
Glucose-6-phosphate 1-dehydrogenase	Union,Maewo, Chinese-2, Kalo	Not Available	1360C->T	ADR Inferred	Increased risk of hemolytic crisis.	Details
Glucose-6-phosphate 1-dehydrogenase	Andalus	Not Available	1361G->A	ADR Inferred	Increased risk of hemolytic crisis.	Details
Glucose-6-phosphate 1-dehydrogenase	Cosenza	Not Available	1376G->C	ADR Inferred	Increased risk of hemolytic crisis.	Details
Glucose-6-phosphate 1-dehydrogenase	Canton, Taiwan- Hakka, Gifu-like, Agrigento-like	Not Available	1376G->T	ADR Inferred	Increased risk of hemolytic crisis.	Details
Glucose-6-phosphate 1-dehydrogenase	Flores	Not Available	1387C->A	ADR Inferred	Increased risk of hemolytic crisis.	Details
Glucose-6-phosphate 1-dehydrogenase	Kaiping, Anant, Dhon, Sapporo-like, Wosera	Not Available	1388G->A	ADR Inferred	Increased risk of hemolytic crisis.	Details
Glucose-6-phosphate 1-dehydrogenase	Kamogawa	Not Available	169C->T	ADR Inferred	Increased risk of hemolytic crisis.	Details
Glucose-6-phosphate 1-dehydrogenase	Costanzo	Not Available	179T>C	ADR Inferred	Increased risk of hemolytic crisis.	Details
Glucose-6-phosphate 1-dehydrogenase	Amazonia	Not Available	185C->A	ADR Inferred	Increased risk of hemolytic crisis.	Details
Glucose-6-phosphate 1-dehydrogenase	Songklanagarind	Not Available	196T->A	ADR Inferred	Increased risk of hemolytic crisis.	Details
Glucose-6-phosphate 1-dehydrogenase	Hechi	Not Available	202G->A / 871G->A	ADR Inferred	Increased risk of hemolytic crisis.	Details
Glucose-6-phosphate 1-dehydrogenase	Namouru	Not Available	208T->C	ADR Inferred	Increased risk of hemolytic crisis.	Details
Glucose-6-phosphate 1-dehydrogenase	Bao Loc	Not Available	352T>C	ADR Inferred	Increased risk of hemolytic crisis.	Details
Glucose-6-phosphate 1-dehydrogenase	Crispim	Not Available	375G->T, 379G->T383T->C384C>T	ADR Inferred	Increased risk of hemolytic crisis.	Details
Glucose-6-phosphate 1-dehydrogenase	Acrokorinthos	Not Available	376A->G / 463C->G	ADR Inferred	Increased risk of hemolytic crisis.	Details
Glucose-6-phosphate 1-dehydrogenase	Santa Maria	Not Available	376A->G / 542A->T	ADR Inferred	Increased risk of hemolytic crisis.	Details
Glucose-6-phosphate 1-dehydrogenase	Ananindeua	Not Available	376A->G / 871G->A	ADR Inferred	Increased risk of hemolytic crisis.	Details
Glucose-6-phosphate 1-dehydrogenase	Vanua Lava	Not Available	383T->C	ADR Inferred	Increased risk of hemolytic crisis.	Details
Glucose-6-phosphate 1-dehydrogenase	Valladolid	Not Available	406C->T	ADR Inferred	Increased risk of hemolytic crisis.	Details
Glucose-6-phosphate 1-dehydrogenase	Belem	Not Available	409C->T	ADR Inferred	Increased risk of hemolytic crisis.	Details
Glucose-6-phosphate 1-dehydrogenase	Liuzhou	Not Available	442G->A	ADR Inferred	Increased risk of hemolytic crisis.	Details
Glucose-6-phosphate 1-dehydrogenase	Shenzen	Not Available	473G>A	ADR Inferred	Increased risk of hemolytic crisis.	Details
Glucose-6-phosphate 1-dehydrogenase	Taipei ‚ÄúChinese- 3‚Äù	Not Available	493A->G	ADR Inferred	Increased risk of hemolytic crisis.	Details
Glucose-6-phosphate 1-dehydrogenase	Toledo	Not Available	496C>T	ADR Inferred	Increased risk of hemolytic crisis.	Details
Glucose-6-phosphate 1-dehydrogenase	Naone	Not Available	497G->A	ADR Inferred	Increased risk of hemolytic crisis.	Details
Glucose-6-phosphate 1-dehydrogenase	Nankang	Not Available	517T->C	ADR Inferred	Increased risk of hemolytic crisis.	Details
Glucose-6-phosphate 1-dehydrogenase	Miaoli	Not Available	519C->G	ADR Inferred	Increased risk of hemolytic crisis.	Details
Glucose-6-phosphate 1-dehydrogenase	Mediterranean, Dallas, Panama‚ Sassari, Cagliari, Birmingham	Not Available	563C->T	ADR Inferred	Increased risk of hemolytic crisis.	Details
Glucose-6-phosphate 1-dehydrogenase	Coimbra Shunde	Not Available	592C->T	ADR Inferred	Increased risk of hemolytic crisis.	Details
Glucose-6-phosphate 1-dehydrogenase	Nilgiri	Not Available	593G>A	ADR Inferred	Increased risk of hemolytic crisis.	Details
Glucose-6-phosphate 1-dehydrogenase	Radlowo	Not Available	679C->T	ADR Inferred	Increased risk of hemolytic crisis.	Details
Glucose-6-phosphate 1-dehydrogenase	Roubaix	Not Available	811G>C	ADR Inferred	Increased risk of hemolytic crisis.	Details
Glucose-6-phosphate 1-dehydrogenase	Haikou	Not Available	835A->G	ADR Inferred	Increased risk of hemolytic crisis.	Details
Glucose-6-phosphate 1-dehydrogenase	Chinese-1	Not Available	835A->T	ADR Inferred	Increased risk of hemolytic crisis.	Details
Glucose-6-phosphate 1-dehydrogenase	Mizushima	Not Available	848A>G	ADR Inferred	Increased risk of hemolytic crisis.	Details
Glucose-6-phosphate 1-dehydrogenase	Osaka	Not Available	853C->T	ADR Inferred	Increased risk of hemolytic crisis.	Details
Glucose-6-phosphate 1-dehydrogenase	Viangchan, Jammu	Not Available	871G->A	ADR Inferred	Increased risk of hemolytic crisis.	Details
Glucose-6-phosphate 1-dehydrogenase	Seoul	Not Available	916G->A	ADR Inferred	Increased risk of hemolytic crisis.	Details
Glucose-6-phosphate 1-dehydrogenase	Ludhiana	Not Available	929G->A	ADR Inferred	Increased risk of hemolytic crisis.	Details
Glucose-6-phosphate 1-dehydrogenase	Farroupilha	Not Available	977C->A	ADR Inferred	Increased risk of hemolytic crisis.	Details
Glucose-6-phosphate 1-dehydrogenase	Chinese-5	Not Available	1024C->T	ADR Inferred	Increased risk of hemolytic crisis.	Details
Glucose-6-phosphate 1-dehydrogenase	Rignano	Not Available	130G>A	ADR Inferred	Increased risk of hemolytic crisis.	Details
Glucose-6-phosphate 1-dehydrogenase	Orissa	Not Available	131C->G	ADR Inferred	Increased risk of hemolytic crisis.	Details
Glucose-6-phosphate 1-dehydrogenase	G6PDNice	Not Available	1380G>C	ADR Inferred	Increased risk of hemolytic crisis.	Details
Glucose-6-phosphate 1-dehydrogenase	Kamiube, Keelung	Not Available	1387C->T	ADR Inferred	Increased risk of hemolytic crisis.	Details
Glucose-6-phosphate 1-dehydrogenase	Neapolis	Not Available	1400C->G	ADR Inferred	Increased risk of hemolytic crisis.	Details
Glucose-6-phosphate 1-dehydrogenase	Aures	Not Available	143T->C	ADR Inferred	Increased risk of hemolytic crisis.	Details
Glucose-6-phosphate 1-dehydrogenase	Split	Not Available	1442C->G	ADR Inferred	Increased risk of hemolytic crisis.	Details
Glucose-6-phosphate 1-dehydrogenase	Kambos	Not Available	148C->T	ADR Inferred	Increased risk of hemolytic crisis.	Details
Glucose-6-phosphate 1-dehydrogenase	Palestrina	Not Available	170G>A	ADR Inferred	Increased risk of hemolytic crisis.	Details
Glucose-6-phosphate 1-dehydrogenase	Metaponto	Not Available	172G->A	ADR Inferred	Increased risk of hemolytic crisis.	Details
Glucose-6-phosphate 1-dehydrogenase	Musashino	Not Available	185C->T	ADR Inferred	Increased risk of hemolytic crisis.	Details
Glucose-6-phosphate 1-dehydrogenase	Asahi	Not Available	202G->A	ADR Inferred	Increased risk of hemolytic crisis.	Details
Glucose-6-phosphate 1-dehydrogenase	A- (202), Ferrara I	Not Available	202G->A / 376A->G	ADR Inferred	Increased risk of hemolytic crisis.	Details
Glucose-6-phosphate 1-dehydrogenase	Murcia Oristano	Not Available	209A->G	ADR Inferred	Increased risk of hemolytic crisis.	Details
Glucose-6-phosphate 1-dehydrogenase	Ube Konan	Not Available	241C->T	ADR Inferred	Increased risk of hemolytic crisis.	Details
Glucose-6-phosphate 1-dehydrogenase	Lagosanto	Not Available	242G->A	ADR Inferred	Increased risk of hemolytic crisis.	Details
Glucose-6-phosphate 1-dehydrogenase	Guangzhou	Not Available	274C->T	ADR Inferred	Increased risk of hemolytic crisis.	Details
Glucose-6-phosphate 1-dehydrogenase	Hammersmith	Not Available	323T->A	ADR Inferred	Increased risk of hemolytic crisis.	Details
Glucose-6-phosphate 1-dehydrogenase	Sinnai	Not Available	34G->T	ADR Inferred	Increased risk of hemolytic crisis.	Details
Glucose-6-phosphate 1-dehydrogenase	A- (680)	Not Available	376A->G / 680G->T	ADR Inferred	Increased risk of hemolytic crisis.	Details
Glucose-6-phosphate 1-dehydrogenase	A- (968), Betica,Selma, Guantanamo	Not Available	376A->G / 968T->C	ADR Inferred	Increased risk of hemolytic crisis.	Details
Glucose-6-phosphate 1-dehydrogenase	Salerno Pyrgos	Not Available	383T>G	ADR Inferred	Increased risk of hemolytic crisis.	Details
Glucose-6-phosphate 1-dehydrogenase	Quing Yan	Not Available	392G->T	ADR Inferred	Increased risk of hemolytic crisis.	Details
Glucose-6-phosphate 1-dehydrogenase	Lages	Not Available	40G->A	ADR Inferred	Increased risk of hemolytic crisis.	Details
Glucose-6-phosphate 1-dehydrogenase	Ilesha	Not Available	466G->A	ADR Inferred	Increased risk of hemolytic crisis.	Details
Glucose-6-phosphate 1-dehydrogenase	Mahidol	Not Available	487G->A	ADR Inferred	Increased risk of hemolytic crisis.	Details
Glucose-6-phosphate 1-dehydrogenase	Malaga	Not Available	542A->T	ADR Inferred	Increased risk of hemolytic crisis.	Details
Glucose-6-phosphate 1-dehydrogenase	Sibari	Not Available	634A->G	ADR Inferred	Increased risk of hemolytic crisis.	Details
Glucose-6-phosphate 1-dehydrogenase	Mexico City	Not Available	680G->A	ADR Inferred	Increased risk of hemolytic crisis.	Details
Glucose-6-phosphate 1-dehydrogenase	Nanning	Not Available	703C->T	ADR Inferred	Increased risk of hemolytic crisis.	Details
Glucose-6-phosphate 1-dehydrogenase	Seattle, Lodi, Modena, Ferrara II, Athens-like	Not Available	844G->C	ADR Inferred	Increased risk of hemolytic crisis.	Details
Glucose-6-phosphate 1-dehydrogenase	Bajo Maumere	Not Available	844G->T	ADR Inferred	Increased risk of hemolytic crisis.	Details
Glucose-6-phosphate 1-dehydrogenase	Montalbano	Not Available	854G->A	ADR Inferred	Increased risk of hemolytic crisis.	Details
Glucose-6-phosphate 1-dehydrogenase	Kalyan-Kerala, Jamnaga, Rohini	Not Available	949G->A	ADR Inferred	Increased risk of hemolytic crisis.	Details
Glucose-6-phosphate 1-dehydrogenase	Gaohe	Not Available	95A->G	ADR Inferred	Increased risk of hemolytic crisis.	Details

Interactions

Drug Interactions

Drug	Interaction	Drug group
Acebutolol	The risk or severity of adverse effects can be increased when Acebutolol is combined with Sodium Nitrite.	Approved
Acetaminophen	The risk or severity of adverse effects can be increased when Acetaminophen is combined with Sodium Nitrite.	Approved
Acetazolamide	The risk or severity of adverse effects can be increased when Sodium Nitrite is combined with Acetazolamide.	Approved, Vet Approved
Aldesleukin	The risk or severity of adverse effects can be increased when Aldesleukin is combined with Sodium Nitrite.	Approved
Aliskiren	The risk or severity of adverse effects can be increased when Aliskiren is combined with Sodium Nitrite.	Approved, Investigational
Amifostine	The risk or severity of adverse effects can be increased when Amifostine is combined with Sodium Nitrite.	Approved, Investigational
Amiloride	The risk or severity of adverse effects can be increased when Amiloride is combined with Sodium Nitrite.	Approved
Amiodarone	The risk or severity of adverse effects can be increased when Amiodarone is combined with Sodium Nitrite.	Approved, Investigational
Amlodipine	The risk or severity of adverse effects can be increased when Amlodipine is combined with Sodium Nitrite.	Approved
Amobarbital	Amobarbital may increase the hypotensive activities of Sodium Nitrite.	Approved, Illicit
Amphotericin B	The risk or severity of adverse effects can be increased when Amphotericin B is combined with Sodium Nitrite.	Approved, Investigational
Amyl Nitrite	The risk or severity of adverse effects can be increased when Amyl Nitrite is combined with Sodium Nitrite.	Approved
Antipyrine	The risk or severity of adverse effects can be increased when Antipyrine is combined with Sodium Nitrite.	Approved
Apomorphine	The risk or severity of adverse effects can be increased when Apomorphine is combined with Sodium Nitrite.	Approved, Investigational
Apraclonidine	The risk or severity of adverse effects can be increased when Apraclonidine is combined with Sodium Nitrite.	Approved
Aripiprazole	Aripiprazole may increase the hypotensive activities of Sodium Nitrite.	Approved, Investigational
Arotinolol	The risk or severity of adverse effects can be increased when Arotinolol is combined with Sodium Nitrite.	Approved
Arsenic trioxide	The risk or severity of adverse effects can be increased when Arsenic trioxide is combined with Sodium Nitrite.	Approved, Investigational
Atenolol	The risk or severity of adverse effects can be increased when Atenolol is combined with Sodium Nitrite.	Approved
Azilsartan medoxomil	The risk or severity of adverse effects can be increased when Azilsartan medoxomil is combined with Sodium Nitrite.	Approved
Barbexaclone	Barbexaclone may increase the hypotensive activities of Sodium Nitrite.	Experimental
Barbital	Barbital may increase the hypotensive activities of Sodium Nitrite.	Illicit
Barnidipine	The risk or severity of adverse effects can be increased when Barnidipine is combined with Sodium Nitrite.	Approved
Benazepril	The risk or severity of adverse effects can be increased when Benazepril is combined with Sodium Nitrite.	Approved, Investigational
Bendroflumethiazide	The risk or severity of adverse effects can be increased when Bendroflumethiazide is combined with Sodium Nitrite.	Approved
Benzocaine	The risk or severity of adverse effects can be increased when Benzocaine is combined with Sodium Nitrite.	Approved
Bepridil	The risk or severity of adverse effects can be increased when Bepridil is combined with Sodium Nitrite.	Approved, Withdrawn
Betaxolol	The risk or severity of adverse effects can be increased when Betaxolol is combined with Sodium Nitrite.	Approved
Bisoprolol	The risk or severity of adverse effects can be increased when Bisoprolol is combined with Sodium Nitrite.	Approved
Bortezomib	The risk or severity of adverse effects can be increased when Bortezomib is combined with Sodium Nitrite.	Approved, Investigational
Bretylium	The risk or severity of adverse effects can be increased when Bretylium is combined with Sodium Nitrite.	Approved
Brimonidine	The risk or severity of adverse effects can be increased when Brimonidine is combined with Sodium Nitrite.	Approved
Bromocriptine	The risk or severity of adverse effects can be increased when Bromocriptine is combined with Sodium Nitrite.	Approved, Investigational
Bumetanide	The risk or severity of adverse effects can be increased when Bumetanide is combined with Sodium Nitrite.	Approved
Bupivacaine	The risk or severity of adverse effects can be increased when Bupivacaine is combined with Sodium Nitrite.	Approved, Investigational
Butalbital	The risk or severity of adverse effects can be increased when Butalbital is combined with Sodium Nitrite.	Approved, Illicit
Canagliflozin	The risk or severity of adverse effects can be increased when Canagliflozin is combined with Sodium Nitrite.	Approved
Candesartan	The risk or severity of adverse effects can be increased when Candesartan is combined with Sodium Nitrite.	Approved
Captopril	The risk or severity of adverse effects can be increased when Captopril is combined with Sodium Nitrite.	Approved
Carbetocin	The risk or severity of adverse effects can be increased when Carbetocin is combined with Sodium Nitrite.	Approved
Carteolol	The risk or severity of adverse effects can be increased when Carteolol is combined with Sodium Nitrite.	Approved
Carvedilol	The risk or severity of adverse effects can be increased when Carvedilol is combined with Sodium Nitrite.	Approved, Investigational
Celecoxib	The risk or severity of adverse effects can be increased when Celecoxib is combined with Sodium Nitrite.	Approved, Investigational
Chloroquine	The risk or severity of adverse effects can be increased when Chloroquine is combined with Sodium Nitrite.	Approved, Vet Approved
Chlorothiazide	The risk or severity of adverse effects can be increased when Chlorothiazide is combined with Sodium Nitrite.	Approved, Vet Approved
Chlorpromazine	The risk or severity of adverse effects can be increased when Chlorpromazine is combined with Sodium Nitrite.	Approved, Vet Approved
Chlorthalidone	The risk or severity of adverse effects can be increased when Chlorthalidone is combined with Sodium Nitrite.	Approved
Cilazapril	The risk or severity of adverse effects can be increased when Cilazapril is combined with Sodium Nitrite.	Approved
Cilnidipine	The risk or severity of adverse effects can be increased when Cilnidipine is combined with Sodium Nitrite.	Approved
Clevidipine	The risk or severity of adverse effects can be increased when Clevidipine is combined with Sodium Nitrite.	Approved
Clofarabine	The risk or severity of adverse effects can be increased when Clofarabine is combined with Sodium Nitrite.	Approved, Investigational
Clomipramine	The risk or severity of adverse effects can be increased when Clomipramine is combined with Sodium Nitrite.	Approved, Vet Approved
Clonidine	The risk or severity of adverse effects can be increased when Clonidine is combined with Sodium Nitrite.	Approved
Clozapine	The risk or severity of adverse effects can be increased when Clozapine is combined with Sodium Nitrite.	Approved
Conivaptan	The risk or severity of adverse effects can be increased when Conivaptan is combined with Sodium Nitrite.	Approved, Investigational
Dapagliflozin	The risk or severity of adverse effects can be increased when Dapagliflozin is combined with Sodium Nitrite.	Approved
Dapsone	The risk or severity of adverse effects can be increased when Dapsone is combined with Sodium Nitrite.	Approved, Investigational
Desflurane	The risk or severity of adverse effects can be increased when Desflurane is combined with Sodium Nitrite.	Approved
Dexmedetomidine	The risk or severity of adverse effects can be increased when Dexmedetomidine is combined with Sodium Nitrite.	Approved, Vet Approved
Diclofenamide	The risk or severity of adverse effects can be increased when Diclofenamide is combined with Sodium Nitrite.	Approved
Diltiazem	The risk or severity of adverse effects can be increased when Diltiazem is combined with Sodium Nitrite.	Approved
Dinutuximab	The risk or severity of adverse effects can be increased when Dinutuximab is combined with Sodium Nitrite.	Approved
Dipyridamole	The risk or severity of adverse effects can be increased when Dipyridamole is combined with Sodium Nitrite.	Approved
Doxazosin	The risk or severity of adverse effects can be increased when Doxazosin is combined with Sodium Nitrite.	Approved
Duloxetine	Sodium Nitrite may increase the orthostatic hypotensive activities of Duloxetine.	Approved
Efonidipine	The risk or severity of adverse effects can be increased when Efonidipine is combined with Sodium Nitrite.	Approved
Empagliflozin	The risk or severity of adverse effects can be increased when Empagliflozin is combined with Sodium Nitrite.	Approved
Enalapril	The risk or severity of adverse effects can be increased when Enalapril is combined with Sodium Nitrite.	Approved, Vet Approved
Enalaprilat	The risk or severity of adverse effects can be increased when Enalaprilat is combined with Sodium Nitrite.	Approved
Eplerenone	The risk or severity of adverse effects can be increased when Eplerenone is combined with Sodium Nitrite.	Approved
Epoprostenol	The risk or severity of adverse effects can be increased when Epoprostenol is combined with Sodium Nitrite.	Approved
Eprosartan	The risk or severity of adverse effects can be increased when Eprosartan is combined with Sodium Nitrite.	Approved
Esmolol	The risk or severity of adverse effects can be increased when Esmolol is combined with Sodium Nitrite.	Approved
Etacrynic acid	The risk or severity of adverse effects can be increased when Etacrynic acid is combined with Sodium Nitrite.	Approved
Felodipine	The risk or severity of adverse effects can be increased when Felodipine is combined with Sodium Nitrite.	Approved, Investigational
Fenoldopam	The risk or severity of adverse effects can be increased when Fenoldopam is combined with Sodium Nitrite.	Approved
Fimasartan	The risk or severity of adverse effects can be increased when Fimasartan is combined with Sodium Nitrite.	Approved
Flutamide	The risk or severity of adverse effects can be increased when Flutamide is combined with Sodium Nitrite.	Approved
Fosinopril	The risk or severity of adverse effects can be increased when Fosinopril is combined with Sodium Nitrite.	Approved
Furosemide	The risk or severity of adverse effects can be increased when Furosemide is combined with Sodium Nitrite.	Approved, Vet Approved
Guanfacine	The risk or severity of adverse effects can be increased when Guanfacine is combined with Sodium Nitrite.	Approved, Investigational
Halothane	The risk or severity of adverse effects can be increased when Halothane is combined with Sodium Nitrite.	Approved, Vet Approved
Hexobarbital	Hexobarbital may increase the hypotensive activities of Sodium Nitrite.	Approved
Hydralazine	The risk or severity of adverse effects can be increased when Hydralazine is combined with Sodium Nitrite.	Approved
Hydrochlorothiazide	The risk or severity of adverse effects can be increased when Hydrochlorothiazide is combined with Sodium Nitrite.	Approved, Vet Approved
Hydroflumethiazide	The risk or severity of adverse effects can be increased when Hydroflumethiazide is combined with Sodium Nitrite.	Approved
Iloprost	The risk or severity of adverse effects can be increased when Iloprost is combined with Sodium Nitrite.	Approved, Investigational
Imidapril	The risk or severity of adverse effects can be increased when Imidapril is combined with Sodium Nitrite.	Investigational
Imipramine	The risk or severity of adverse effects can be increased when Imipramine is combined with Sodium Nitrite.	Approved
Indapamide	The risk or severity of adverse effects can be increased when Indapamide is combined with Sodium Nitrite.	Approved
Indoramin	The risk or severity of adverse effects can be increased when Indoramin is combined with Sodium Nitrite.	Withdrawn
Irbesartan	The risk or severity of adverse effects can be increased when Irbesartan is combined with Sodium Nitrite.	Approved, Investigational
Isocarboxazid	The risk or severity of adverse effects can be increased when Isocarboxazid is combined with Sodium Nitrite.	Approved
Isoflurane	The risk or severity of adverse effects can be increased when Isoflurane is combined with Sodium Nitrite.	Approved, Vet Approved
Isometheptene	The risk or severity of adverse effects can be increased when Isometheptene is combined with Sodium Nitrite.	Approved
Isosorbide Dinitrate	The risk or severity of adverse effects can be increased when Isosorbide Dinitrate is combined with Sodium Nitrite.	Approved
Isosorbide Mononitrate	The risk or severity of adverse effects can be increased when Isosorbide Mononitrate is combined with Sodium Nitrite.	Approved
Isoxsuprine	The risk or severity of adverse effects can be increased when Isoxsuprine is combined with Sodium Nitrite.	Approved, Withdrawn
Isradipine	The risk or severity of adverse effects can be increased when Isradipine is combined with Sodium Nitrite.	Approved
Labetalol	The risk or severity of adverse effects can be increased when Labetalol is combined with Sodium Nitrite.	Approved
Lacidipine	The risk or severity of adverse effects can be increased when Lacidipine is combined with Sodium Nitrite.	Approved
Lercanidipine	The risk or severity of adverse effects can be increased when Lercanidipine is combined with Sodium Nitrite.	Approved, Investigational
Levobunolol	The risk or severity of adverse effects can be increased when Levobunolol is combined with Sodium Nitrite.	Approved
Levobupivacaine	The risk or severity of adverse effects can be increased when Levobupivacaine is combined with Sodium Nitrite.	Approved
Levodopa	Sodium Nitrite may increase the orthostatic hypotensive activities of Levodopa.	Approved
Levosimendan	The risk or severity of adverse effects can be increased when Levosimendan is combined with Sodium Nitrite.	Approved, Investigational
Lidocaine	The risk or severity of adverse effects can be increased when Lidocaine is combined with Sodium Nitrite.	Approved, Vet Approved
Lisinopril	The risk or severity of adverse effects can be increased when Lisinopril is combined with Sodium Nitrite.	Approved, Investigational
Lofexidine	The risk or severity of adverse effects can be increased when Lofexidine is combined with Sodium Nitrite.	Approved, Investigational
Losartan	The risk or severity of adverse effects can be increased when Losartan is combined with Sodium Nitrite.	Approved
Mafenide	The risk or severity of adverse effects can be increased when Mafenide is combined with Sodium Nitrite.	Approved, Vet Approved
Mannitol	The risk or severity of adverse effects can be increased when Mannitol is combined with Sodium Nitrite.	Approved, Investigational
Mecamylamine	The risk or severity of adverse effects can be increased when Mecamylamine is combined with Sodium Nitrite.	Approved
Methazolamide	The risk or severity of adverse effects can be increased when Methazolamide is combined with Sodium Nitrite.	Approved
Methohexital	Methohexital may increase the hypotensive activities of Sodium Nitrite.	Approved
Methyclothiazide	The risk or severity of adverse effects can be increased when Methyclothiazide is combined with Sodium Nitrite.	Approved
Methyldopa	The risk or severity of adverse effects can be increased when Methyldopa is combined with Sodium Nitrite.	Approved
Methylphenobarbital	Methylphenobarbital may increase the hypotensive activities of Sodium Nitrite.	Approved
Metipranolol	The risk or severity of adverse effects can be increased when Metipranolol is combined with Sodium Nitrite.	Approved
Metoclopramide	The risk or severity of adverse effects can be increased when Metoclopramide is combined with Sodium Nitrite.	Approved, Investigational
Metolazone	The risk or severity of adverse effects can be increased when Metolazone is combined with Sodium Nitrite.	Approved
Metoprolol	The risk or severity of adverse effects can be increased when Metoprolol is combined with Sodium Nitrite.	Approved, Investigational
Minoxidil	The risk or severity of adverse effects can be increased when Minoxidil is combined with Sodium Nitrite.	Approved
Moexipril	The risk or severity of adverse effects can be increased when Moexipril is combined with Sodium Nitrite.	Approved
Morphine	The risk or severity of adverse effects can be increased when Morphine is combined with Sodium Nitrite.	Approved, Investigational
Moxonidine	The risk or severity of adverse effects can be increased when Moxonidine is combined with Sodium Nitrite.	Approved
Nabilone	The risk or severity of adverse effects can be increased when Nabilone is combined with Sodium Nitrite.	Approved, Investigational
Nadolol	The risk or severity of adverse effects can be increased when Nadolol is combined with Sodium Nitrite.	Approved
Nebivolol	The risk or severity of adverse effects can be increased when Nebivolol is combined with Sodium Nitrite.	Approved, Investigational
Nesiritide	The risk or severity of adverse effects can be increased when Nesiritide is combined with Sodium Nitrite.	Approved, Investigational
Nicardipine	The risk or severity of adverse effects can be increased when Nicardipine is combined with Sodium Nitrite.	Approved
Nicorandil	Nicorandil may increase the hypotensive activities of Sodium Nitrite.	Approved
Nifedipine	The risk or severity of adverse effects can be increased when Nifedipine is combined with Sodium Nitrite.	Approved
Nilvadipine	The risk or severity of adverse effects can be increased when Nilvadipine is combined with Sodium Nitrite.	Approved
Nimodipine	The risk or severity of adverse effects can be increased when Nimodipine is combined with Sodium Nitrite.	Approved
Nisoldipine	The risk or severity of adverse effects can be increased when Nisoldipine is combined with Sodium Nitrite.	Approved
Nitrendipine	The risk or severity of adverse effects can be increased when Nitrendipine is combined with Sodium Nitrite.	Approved
Nitric Oxide	The risk or severity of adverse effects can be increased when Nitric Oxide is combined with Sodium Nitrite.	Approved
Nitrofurantoin	The risk or severity of adverse effects can be increased when Nitrofurantoin is combined with Sodium Nitrite.	Approved, Vet Approved
Nitroglycerin	The risk or severity of adverse effects can be increased when Nitroglycerin is combined with Sodium Nitrite.	Approved, Investigational
Nitroprusside	The risk or severity of adverse effects can be increased when Nitroprusside is combined with Sodium Nitrite.	Approved
Obinutuzumab	The risk or severity of adverse effects can be increased when Obinutuzumab is combined with Sodium Nitrite.	Approved
Olmesartan	The risk or severity of adverse effects can be increased when Olmesartan is combined with Sodium Nitrite.	Approved, Investigational
Oxprenolol	The risk or severity of adverse effects can be increased when Oxprenolol is combined with Sodium Nitrite.	Approved
Paclitaxel	The risk or severity of adverse effects can be increased when Paclitaxel is combined with Sodium Nitrite.	Approved, Vet Approved
Papaverine	The risk or severity of adverse effects can be increased when Papaverine is combined with Sodium Nitrite.	Approved
Penbutolol	The risk or severity of adverse effects can be increased when Penbutolol is combined with Sodium Nitrite.	Approved, Investigational
Pentobarbital	Pentobarbital may increase the hypotensive activities of Sodium Nitrite.	Approved, Vet Approved
Perindopril	The risk or severity of adverse effects can be increased when Perindopril is combined with Sodium Nitrite.	Approved
Phenazopyridine	The risk or severity of adverse effects can be increased when Phenazopyridine is combined with Sodium Nitrite.	Approved
Phenelzine	The risk or severity of adverse effects can be increased when Phenelzine is combined with Sodium Nitrite.	Approved
Phenobarbital	The risk or severity of adverse effects can be increased when Phenobarbital is combined with Sodium Nitrite.	Approved
Phenoxybenzamine	The risk or severity of adverse effects can be increased when Phenoxybenzamine is combined with Sodium Nitrite.	Approved
Phentolamine	The risk or severity of adverse effects can be increased when Phentolamine is combined with Sodium Nitrite.	Approved
Phenytoin	The risk or severity of adverse effects can be increased when Phenytoin is combined with Sodium Nitrite.	Approved, Vet Approved
Pindolol	The risk or severity of adverse effects can be increased when Pindolol is combined with Sodium Nitrite.	Approved
Pipamperone	The risk or severity of adverse effects can be increased when Pipamperone is combined with Sodium Nitrite.	Approved
Pramipexole	The risk or severity of adverse effects can be increased when Pramipexole is combined with Sodium Nitrite.	Approved, Investigational
Prazosin	The risk or severity of adverse effects can be increased when Prazosin is combined with Sodium Nitrite.	Approved
Prilocaine	The risk or severity of adverse effects can be increased when Sodium Nitrite is combined with Prilocaine.	Approved
Primaquine	The risk or severity of adverse effects can be increased when Primaquine is combined with Sodium Nitrite.	Approved
Primidone	Primidone may increase the hypotensive activities of Sodium Nitrite.	Approved, Vet Approved
Propofol	The risk or severity of adverse effects can be increased when Propofol is combined with Sodium Nitrite.	Approved, Investigational, Vet Approved
Propranolol	The risk or severity of adverse effects can be increased when Propranolol is combined with Sodium Nitrite.	Approved, Investigational
Quetiapine	The risk or severity of adverse effects can be increased when Quetiapine is combined with Sodium Nitrite.	Approved
Quinapril	The risk or severity of adverse effects can be increased when Quinapril is combined with Sodium Nitrite.	Approved, Investigational
Quinine	The risk or severity of adverse effects can be increased when Quinine is combined with Sodium Nitrite.	Approved
Ramipril	The risk or severity of adverse effects can be increased when Ramipril is combined with Sodium Nitrite.	Approved
Rasagiline	The risk or severity of adverse effects can be increased when Rasagiline is combined with Sodium Nitrite.	Approved
Remifentanil	The risk or severity of adverse effects can be increased when Remifentanil is combined with Sodium Nitrite.	Approved
Reserpine	The risk or severity of adverse effects can be increased when Reserpine is combined with Sodium Nitrite.	Approved
Riociguat	The risk or severity of adverse effects can be increased when Riociguat is combined with Sodium Nitrite.	Approved
Risperidone	Sodium Nitrite may increase the hypotensive activities of Risperidone.	Approved, Investigational
Ropinirole	The risk or severity of adverse effects can be increased when Ropinirole is combined with Sodium Nitrite.	Approved, Investigational
Ropivacaine	The risk or severity of adverse effects can be increased when Ropivacaine is combined with Sodium Nitrite.	Approved
Rotigotine	The risk or severity of adverse effects can be increased when Rotigotine is combined with Sodium Nitrite.	Approved
Sacubitril	The risk or severity of adverse effects can be increased when Sacubitril is combined with Sodium Nitrite.	Approved
Secobarbital	Secobarbital may increase the hypotensive activities of Sodium Nitrite.	Approved, Vet Approved
Selegiline	The risk or severity of adverse effects can be increased when Selegiline is combined with Sodium Nitrite.	Approved, Investigational, Vet Approved
Sevoflurane	The risk or severity of adverse effects can be increased when Sevoflurane is combined with Sodium Nitrite.	Approved, Vet Approved
Sotalol	The risk or severity of adverse effects can be increased when Sotalol is combined with Sodium Nitrite.	Approved
Spironolactone	The risk or severity of adverse effects can be increased when Spironolactone is combined with Sodium Nitrite.	Approved
Streptokinase	The risk or severity of adverse effects can be increased when Sodium Nitrite is combined with Streptokinase.	Approved
Sufentanil	The risk or severity of adverse effects can be increased when Sodium Nitrite is combined with Sufentanil.	Approved, Investigational
Sulfadiazine	The risk or severity of adverse effects can be increased when Sulfadiazine is combined with Sodium Nitrite.	Approved, Vet Approved
Sulfamethoxazole	The risk or severity of adverse effects can be increased when Sulfamethoxazole is combined with Sodium Nitrite.	Approved
Tamsulosin	The risk or severity of adverse effects can be increased when Sodium Nitrite is combined with Tamsulosin.	Approved, Investigational
Telmisartan	The risk or severity of adverse effects can be increased when Telmisartan is combined with Sodium Nitrite.	Approved, Investigational
Terazosin	The risk or severity of adverse effects can be increased when Terazosin is combined with Sodium Nitrite.	Approved
Thalidomide	The risk or severity of adverse effects can be increased when Sodium Nitrite is combined with Thalidomide.	Approved, Investigational, Withdrawn
Thiamylal	Thiamylal may increase the hypotensive activities of Sodium Nitrite.	Approved, Vet Approved
Thiopental	Thiopental may increase the hypotensive activities of Sodium Nitrite.	Approved, Vet Approved
Thioridazine	The risk or severity of adverse effects can be increased when Sodium Nitrite is combined with Thioridazine.	Withdrawn
Timolol	The risk or severity of adverse effects can be increased when Timolol is combined with Sodium Nitrite.	Approved
Tizanidine	The risk or severity of adverse effects can be increased when Tizanidine is combined with Sodium Nitrite.	Approved
Tolazoline	The risk or severity of adverse effects can be increased when Sodium Nitrite is combined with Tolazoline.	Approved, Vet Approved
Tolcapone	The risk or severity of adverse effects can be increased when Sodium Nitrite is combined with Tolcapone.	Approved, Withdrawn
Torasemide	The risk or severity of adverse effects can be increased when Torasemide is combined with Sodium Nitrite.	Approved
Trandolapril	The risk or severity of adverse effects can be increased when Trandolapril is combined with Sodium Nitrite.	Approved
Tranylcypromine	The risk or severity of adverse effects can be increased when Sodium Nitrite is combined with Tranylcypromine.	Approved
Tretinoin	The risk or severity of adverse effects can be increased when Sodium Nitrite is combined with Tretinoin.	Approved, Investigational, Nutraceutical
Triamterene	The risk or severity of adverse effects can be increased when Triamterene is combined with Sodium Nitrite.	Approved
Valsartan	The risk or severity of adverse effects can be increased when Valsartan is combined with Sodium Nitrite.	Approved, Investigational
Verapamil	The risk or severity of adverse effects can be increased when Verapamil is combined with Sodium Nitrite.	Approved
Zopiclone	The risk or severity of adverse effects can be increased when Zopiclone is combined with Sodium Nitrite.	Approved

Food Interactions

Not Available

References

Synthesis Reference

Not Available

General References

Baskin SI, Horowitz AM, Nealley EW: The antidotal action of sodium nitrite and sodium thiosulfate against cyanide poisoning. J Clin Pharmacol. 1992 Apr;32(4):368-75. [PubMed:1569239 ]
Beasley DM, Glass WI: Cyanide poisoning: pathophysiology and treatment recommendations. Occup Med (Lond). 1998 Oct;48(7):427-31. [PubMed:10024740 ]
Lundberg JO, Weitzberg E, Gladwin MT: The nitrate-nitrite-nitric oxide pathway in physiology and therapeutics. Nat Rev Drug Discov. 2008 Feb;7(2):156-67. doi: 10.1038/nrd2466. [PubMed:18167491 ]
Denninger JW, Marletta MA: Guanylate cyclase and the .NO/cGMP signaling pathway. Biochim Biophys Acta. 1999 May 5;1411(2-3):334-50. [PubMed:10320667 ]
Rix PJ, Vick A, Attkins NJ, Barker GE, Bott AW, Alcorn H Jr, Gladwin MT, Shiva S, Bradley S, Hussaini A, Hoye WL, Parsley EL, Masamune H: Pharmacokinetics, pharmacodynamics, safety, and tolerability of nebulized sodium nitrite (AIR001) following repeat-dose inhalation in healthy subjects. Clin Pharmacokinet. 2015 Mar;54(3):261-72. doi: 10.1007/s40262-014-0201-y. [PubMed:25421879 ]
Tiso M, Schechter AN: Nitrate reduction to nitrite, nitric oxide and ammonia by gut bacteria under physiological conditions. PLoS One. 2015 Mar 24;10(3):e0119712. doi: 10.1371/journal.pone.0119712. eCollection 2015. [PubMed:25803049 ]

External Links

Resource	Link
PubChem Compound	23668193
PubChem Substance	310265030
ChemSpider	22689
ChEBI	78870
ChEMBL	CHEMBL93268
Drug Product Database	9134

ATC Codes

V03AB08 — Sodium nitrite

AHFS Codes

Not Available

PDB Entries

Not Available

FDA label

Download (250 KB)

MSDS

Download (105 KB)

Clinical Trials

Phase	Status	Purpose	Conditions	Count
1	Completed	Basic Science	Healthy Volunteers	1
1	Completed	Treatment	Chronic Hemolytic Disorders / Sickle Cell Disorders	1
1	Completed	Treatment	Healthy Volunteers	2
1	Completed	Treatment	Out-Of-Hospital Cardiac Arrest	1
1	Completed	Treatment	Pulmonary Hypertension (PH)	1
1	Completed	Treatment	Sickle Cell Disorders	1
1	Recruiting	Basic Science	Healthy Volunteers	1
1	Terminated	Treatment	Healthy Volunteers / HV	1
1	Unknown Status	Basic Science	Hypertensive	1
1, 2	Completed	Treatment	Vascular Aging	1
1, 2	Recruiting	Treatment	Cystic Fibrosis (CF)	1
1, 2	Terminated	Treatment	Sickle Cell Disorders	1
2	Active Not Recruiting	Treatment	Cardiovascular Disease (CVD) / Myocardial Infarction (MI) / Myocardial Ischemia / Reperfusion Injury	1
2	Active Not Recruiting	Treatment	Diabetes	1
2	Completed	Diagnostic	Heart Failure, Unspecified	1
2	Completed	Treatment	Endothelium-Derived Relaxing Factor / Healthy Volunteers / Nitric Oxide	1
2	Completed	Treatment	Heart Failure, Unspecified	1
2	Completed	Treatment	Peripheral Arterial Disease (PAD)	1
2	Completed	Treatment	Subarachnoid Hemorrhage	1
2	Not Yet Recruiting	Treatment	Heart Failure, Unspecified / Pulmonary Hypertension Secondary	1
2	Not Yet Recruiting	Treatment	Hypertensive / Metabolic Syndromes	1
2	Not Yet Recruiting	Treatment	Sickle Cell Disorders	1
2	Recruiting	Prevention	Primary Graft Dysfunction	1
2	Recruiting	Treatment	Acute Myocardial Infarction (AMI)	1
2	Recruiting	Treatment	Asthma Bronchial	1
2	Recruiting	Treatment	Chronic Kidney Disease (CKD)	1
2	Recruiting	Treatment	Heart Failure, Unspecified	1
2	Recruiting	Treatment	Hypertensive / Metabolic Syndromes	1
2	Recruiting	Treatment	Pulmonary Arterial Hypertension (PAH) / Pulmonary Hypertension (PH)	1
2	Terminated	Treatment	Pulmonary Arterial Hypertension (PAH)	1
2	Terminated	Treatment	Subarachnoid Hemorrhage	1
2	Unknown Status	Treatment	Coronary Artery Bypass Surgery	1
2, 3	Completed	Treatment	Acute ST Elevation Myocardial Infarction	1
Not Available	Recruiting	Not Available	Ageing	1

Pharmacoeconomics

Manufacturers

Not Available

Packagers

Not Available

Dosage forms

Form	Route	Strength
Kit
Injection, solution	Intravenous	30 mg/mL
Solution	Intravenous	30 mg

Prices

Not Available

Patents

Patent Number	Pediatric Extension	Approved	Expires (estimated)
US8496973	No	2011-03-29	2031-03-29	US
US8568793	No	2011-12-24	2031-12-24	US

Properties

State

Solid

Experimental Properties

Property	Value	Source
melting point (°C)	271	MSDS
boiling point (°C)	320	MSDS
water solubility	820g/L	MSDS
logP	-3.7	MSDS

Predicted Properties

Property	Value	Source
logP	0.17	ChemAxon
pKa (Strongest Acidic)	3.32	ChemAxon
pKa (Strongest Basic)	-3.5	ChemAxon
Physiological Charge	-1	ChemAxon
Hydrogen Acceptor Count	3	ChemAxon
Hydrogen Donor Count	0	ChemAxon
Polar Surface Area	52.49 Å²	ChemAxon
Rotatable Bond Count	0	ChemAxon
Refractivity	7.6 m³·mol^-1	ChemAxon
Polarizability	2.44 Å³	ChemAxon
Number of Rings	0	ChemAxon
Bioavailability	1	ChemAxon
Rule of Five	Yes	ChemAxon
Ghose Filter	Yes	ChemAxon
Veber's Rule	Yes	ChemAxon
MDDR-like Rule	Yes	ChemAxon

Predicted ADMET features

Not Available

Spectra

Mass Spec (NIST)

Not Available

Spectra

Not Available

Taxonomy

Description

This compound belongs to the class of chemical entities known as alkali metal nitrites. These are inorganic compounds in which the largest oxoanion is nitrite, and in which the heaviest atom not in an oxoanion is an alkali metal.

Kingdom

Chemical entities

Super Class

Inorganic compounds

Class

Mixed metal/non-metal compounds

Sub Class

Alkali metal oxoanionic compounds

Direct Parent

Alkali metal nitrites

Alternative Parents

Inorganic nitrites / Inorganic sodium salts / Inorganic oxides

Substituents

Alkali metal nitrite / Inorganic nitrite / Inorganic sodium salt / Inorganic oxide / Inorganic salt

Molecular Framework

Not Available

External Descriptors

inorganic sodium salt, nitrite salt (CHEBI:78870 )

Targets

Details

1. Hemoglobin subunit alpha

Kind: Protein
Organism: Human
Pharmacological action: yes
Actions: oxidizer

General Function:: Oxygen transporter activity
Specific Function:: Involved in oxygen transport from the lung to the various peripheral tissues.
Gene Name:: HBA1
Uniprot ID:: P69905
Molecular Weight:: 15257.405 Da

References

Baskin SI, Horowitz AM, Nealley EW: The antidotal action of sodium nitrite and sodium thiosulfate against cyanide poisoning. J Clin Pharmacol. 1992 Apr;32(4):368-75. [PubMed:1569239 ]

Details

2. Hemoglobin subunit beta

Kind: Protein
Organism: Human
Pharmacological action: yes
Actions: oxidizer

General Function:: Oxygen transporter activity
Specific Function:: Involved in oxygen transport from the lung to the various peripheral tissues.LVV-hemorphin-7 potentiates the activity of bradykinin, causing a decrease in blood pressure.Spinorphin: functions as an endogenous inhibitor of enkephalin-degrading enzymes such as DPP3, and as a selective antagonist of the P2RX3 receptor which is involved in pain signaling, these properties implicate it as a regulato...
Gene Name:: HBB
Uniprot ID:: P68871
Molecular Weight:: 15998.34 Da

References

Baskin SI, Horowitz AM, Nealley EW: The antidotal action of sodium nitrite and sodium thiosulfate against cyanide poisoning. J Clin Pharmacol. 1992 Apr;32(4):368-75. [PubMed:1569239 ]

Details

3. Myoglobin

Kind: Protein
Organism: Human
Pharmacological action: unknown
Actions: oxidizer

General Function:: Oxygen transporter activity
Specific Function:: Serves as a reserve supply of oxygen and facilitates the movement of oxygen within muscles.
Gene Name:: MB
Uniprot ID:: P02144
Molecular Weight:: 17183.725 Da

References

Baskin SI, Horowitz AM, Nealley EW: The antidotal action of sodium nitrite and sodium thiosulfate against cyanide poisoning. J Clin Pharmacol. 1992 Apr;32(4):368-75. [PubMed:1569239 ]

Drug created on September 21, 2015 10:24 / Updated on July 11, 2017 02:04

Get DrugBank to go!

Structure for DB09112 (Sodium Nitrite)

Targets

References

References

References