
Accession Number
Approved, Investigational
Biologic Classification
Protein Based Therapies
Recombinant Enzymes

Pegloticase is a recombinant procine-like uricase drug indicated for the treatment of severe, treatment-refractory, chronic gout. Similarly to rasburicase, pegloticase metabolises the conversion of uric acid to allantoin. This reduces the risk of precipitate formation and development of gout, since allantoin is five to ten times more soluble than uric acid. In contrast to rasburicase, pegloticase is pegylated to increase its elimination half-life from about eight hours to ten or twelve days, and to decrease the immunogenicity of the foreign uricase protein. This modification allows for an application just once every two to four weeks, making this drug suitable for long-term treatment.

Protein chemical formula
Protein average weight
34192.8533 Da
> Pegloticase
Download FASTA Format
  • Puricase
Prescription Products
NameDosageStrengthRouteLabellerMarketing StartMarketing End
KrystexxaInjection, solution8 mg/1mLIntravenousSavient Pharmaceuticals2010-09-14Not applicableUs
KrystexxaInjection, solution8 mg/1mLIntravenousHorizon Pharma, Inc.2010-09-14Not applicableUs
KrystexxaInjection, solution8 mg/1mLIntravenousHorizon Pharma, Inc.2010-09-14Not applicableUs
Unapproved/Other Products
NameIngredientsDosageRouteLabellerMarketing StartMarketing End
KrystexxaPegloticase (8 mg/ml)Injection, solution, concentrateIntravenousCrealta Pharmaceuticals Llc2013-01-082016-07-22Eu
CAS number



For the treatment of chronic gout in adult patients refractory to conventional therapy.

Associated Conditions
Not Available
Mechanism of action

Pegloticase is a recombinant uricase that catalyzes the metabolism of uric acid to allantoin.

AUric acid

Approximately 24 hours following the first dose, mean plasma uric acid levels were 0.7 mg/dL. The duration of suppression of plasma uric acid appeared to be positively associated with pegloticase dose. Sustained decrease in plasma uric acid below the solubility concentration of 6 mg/dL for more than 300 hours was observed with doses of 8 mg and 12 mg.

Volume of distribution
Not Available
Protein binding
Not Available
Not Available
Route of elimination
Not Available
Half life
Not Available
Not Available

Conditions that should be monitored for when starting treatment with pegloticase include anaphylaxis, infusion reactions, an increase in gout flares, and/or an exacerbation of pre-existing congestive heart failure.

Affected organisms
Not Available
Not Available
Pharmacogenomic Effects/ADRs
Interacting Gene/EnzymeAllele nameGenotype(s)Defining Change(s)Type(s)DescriptionDetails
Glucose-6-phosphate 1-dehydrogenaseVilleurbanneNot Available1000_1002delACCADR InferredIncreased risk of potentially fatal hemolytic anemia and methemoglobinemia.Details
Glucose-6-phosphate 1-dehydrogenaseTorunNot Available1006A->GADR InferredIncreased risk of potentially fatal hemolytic anemia and methemoglobinemia.Details
Glucose-6-phosphate 1-dehydrogenaseSunderlandNot Available105_107delCATADR InferredIncreased risk of potentially fatal hemolytic anemia and methemoglobinemia.Details
Glucose-6-phosphate 1-dehydrogenaseIwatsukiNot Available1081G->AADR InferredIncreased risk of potentially fatal hemolytic anemia and methemoglobinemia.Details
Glucose-6-phosphate 1-dehydrogenaseSerresNot Available1082C->TADR InferredIncreased risk of potentially fatal hemolytic anemia and methemoglobinemia.Details
Glucose-6-phosphate 1-dehydrogenaseTondelaNot Available1084_1101delCTGAACGAGCGCAAGGCCADR InferredIncreased risk of potentially fatal hemolytic anemia and methemoglobinemia.Details
Glucose-6-phosphate 1-dehydrogenaseLoma LindaNot Available1089C->AADR InferredIncreased risk of potentially fatal hemolytic anemia and methemoglobinemia.Details
Glucose-6-phosphate 1-dehydrogenaseAachenNot Available1089C->GADR InferredIncreased risk of potentially fatal hemolytic anemia and methemoglobinemia.Details
Glucose-6-phosphate 1-dehydrogenaseTenriNot Available1096A->GADR InferredIncreased risk of potentially fatal hemolytic anemia and methemoglobinemia.Details
Glucose-6-phosphate 1-dehydrogenaseMontpellierNot Available1132G>AADR InferredIncreased risk of potentially fatal hemolytic anemia and methemoglobinemia.Details
Glucose-6-phosphate 1-dehydrogenaseCalvo MackennaNot Available1138A->GADR InferredIncreased risk of potentially fatal hemolytic anemia and methemoglobinemia.Details
Glucose-6-phosphate 1-dehydrogenaseRileyNot Available1139T->CADR InferredIncreased risk of potentially fatal hemolytic anemia and methemoglobinemia.Details
Glucose-6-phosphate 1-dehydrogenaseOlomoucNot Available1141T->CADR InferredIncreased risk of potentially fatal hemolytic anemia and methemoglobinemia.Details
Glucose-6-phosphate 1-dehydrogenaseTomahNot Available1153T->CADR InferredIncreased risk of potentially fatal hemolytic anemia and methemoglobinemia.Details
Glucose-6-phosphate 1-dehydrogenaseLynwoodNot Available1154G->TADR InferredIncreased risk of potentially fatal hemolytic anemia and methemoglobinemia.Details
Glucose-6-phosphate 1-dehydrogenaseMadridNot Available1155C->GADR InferredIncreased risk of potentially fatal hemolytic anemia and methemoglobinemia.Details
Glucose-6-phosphate 1-dehydrogenaseIowa, Walter Reed, SpringfieldNot Available1156A->GADR InferredIncreased risk of potentially fatal hemolytic anemia and methemoglobinemia.Details
Glucose-6-phosphate 1-dehydrogenaseBeverly Hills, Genova, Iwate, Niigata, YamaguchiNot Available1160G->AADR InferredIncreased risk of potentially fatal hemolytic anemia and methemoglobinemia.Details
Glucose-6-phosphate 1-dehydrogenaseHartfordNot Available1162A->GADR InferredIncreased risk of potentially fatal hemolytic anemia and methemoglobinemia.Details
Glucose-6-phosphate 1-dehydrogenasePrahaNot Available1166A->GADR InferredIncreased risk of potentially fatal hemolytic anemia and methemoglobinemia.Details
Glucose-6-phosphate 1-dehydrogenaseKrakowNot Available1175T>CADR InferredIncreased risk of potentially fatal hemolytic anemia and methemoglobinemia.Details
Glucose-6-phosphate 1-dehydrogenaseWisconsinNot Available1177C->GADR InferredIncreased risk of potentially fatal hemolytic anemia and methemoglobinemia.Details
Glucose-6-phosphate 1-dehydrogenaseNashville, Anaheim, PorticiNot Available1178G->AADR InferredIncreased risk of potentially fatal hemolytic anemia and methemoglobinemia.Details
Glucose-6-phosphate 1-dehydrogenaseAlhambraNot Available1180G->CADR InferredIncreased risk of potentially fatal hemolytic anemia and methemoglobinemia.Details
Glucose-6-phosphate 1-dehydrogenaseBariNot Available1187C->TADR InferredIncreased risk of potentially fatal hemolytic anemia and methemoglobinemia.Details
Glucose-6-phosphate 1-dehydrogenasePuerto LimonNot Available1192G->AADR InferredIncreased risk of potentially fatal hemolytic anemia and methemoglobinemia.Details
Glucose-6-phosphate 1-dehydrogenaseCovao do LoboNot Available1205C>AADR InferredIncreased risk of potentially fatal hemolytic anemia and methemoglobinemia.Details
Glucose-6-phosphate 1-dehydrogenaseClinicNot Available1215G->AADR InferredIncreased risk of potentially fatal hemolytic anemia and methemoglobinemia.Details
Glucose-6-phosphate 1-dehydrogenaseUtrechtNot Available1225C->TADR InferredIncreased risk of potentially fatal hemolytic anemia and methemoglobinemia.Details
Glucose-6-phosphate 1-dehydrogenaseSuwalkiNot Available1226C->GADR InferredIncreased risk of potentially fatal hemolytic anemia and methemoglobinemia.Details
Glucose-6-phosphate 1-dehydrogenaseRiversideNot Available1228G->TADR InferredIncreased risk of potentially fatal hemolytic anemia and methemoglobinemia.Details
Glucose-6-phosphate 1-dehydrogenaseJapan, ShinagawaNot Available1229G->AADR InferredIncreased risk of potentially fatal hemolytic anemia and methemoglobinemia.Details
Glucose-6-phosphate 1-dehydrogenaseKawasakiNot Available1229G->CADR InferredIncreased risk of potentially fatal hemolytic anemia and methemoglobinemia.Details
Glucose-6-phosphate 1-dehydrogenaseMunichNot Available1231A->GADR InferredIncreased risk of potentially fatal hemolytic anemia and methemoglobinemia.Details
Glucose-6-phosphate 1-dehydrogenaseGeorgiaNot Available1284C->AADR InferredIncreased risk of potentially fatal hemolytic anemia and methemoglobinemia.Details
Glucose-6-phosphate 1-dehydrogenaseSumareNot Available1292T->GADR InferredIncreased risk of potentially fatal hemolytic anemia and methemoglobinemia.Details
Glucose-6-phosphate 1-dehydrogenaseTelti/KobeNot Available1318C->TADR InferredIncreased risk of potentially fatal hemolytic anemia and methemoglobinemia.Details
Glucose-6-phosphate 1-dehydrogenaseSantiago de Cuba, MoriokaNot Available1339G->AADR InferredIncreased risk of potentially fatal hemolytic anemia and methemoglobinemia.Details
Glucose-6-phosphate 1-dehydrogenaseHarimaNot Available1358T->AADR InferredIncreased risk of potentially fatal hemolytic anemia and methemoglobinemia.Details
Glucose-6-phosphate 1-dehydrogenaseFiguera da FozNot Available1366G->CADR InferredIncreased risk of potentially fatal hemolytic anemia and methemoglobinemia.Details
Glucose-6-phosphate 1-dehydrogenaseAmiensNot Available1367A>TADR InferredIncreased risk of potentially fatal hemolytic anemia and methemoglobinemia.Details
Glucose-6-phosphate 1-dehydrogenaseBangkok NoiNot Available1376G->T, 1502T->GADR InferredIncreased risk of potentially fatal hemolytic anemia and methemoglobinemia.Details
Glucose-6-phosphate 1-dehydrogenaseFukayaNot Available1462G->AADR InferredIncreased risk of potentially fatal hemolytic anemia and methemoglobinemia.Details
Glucose-6-phosphate 1-dehydrogenaseCampinasNot Available1463G->TADR InferredIncreased risk of potentially fatal hemolytic anemia and methemoglobinemia.Details
Glucose-6-phosphate 1-dehydrogenaseBuenos AiresNot Available1465C>TADR InferredIncreased risk of potentially fatal hemolytic anemia and methemoglobinemia.Details
Glucose-6-phosphate 1-dehydrogenaseArakawaNot Available1466C->TADR InferredIncreased risk of potentially fatal hemolytic anemia and methemoglobinemia.Details
Glucose-6-phosphate 1-dehydrogenaseBrightonNot Available1488_1490delGAAADR InferredIncreased risk of potentially fatal hemolytic anemia and methemoglobinemia.Details
Glucose-6-phosphate 1-dehydrogenaseKozukataNot Available159G->CADR InferredIncreased risk of potentially fatal hemolytic anemia and methemoglobinemia.Details
Glucose-6-phosphate 1-dehydrogenaseAmsterdamNot Available180_182delTCTADR InferredIncreased risk of potentially fatal hemolytic anemia and methemoglobinemia.Details
Glucose-6-phosphate 1-dehydrogenaseNo nameNot Available202G->A, 376A->G, 1264C>GADR InferredIncreased risk of potentially fatal hemolytic anemia and methemoglobinemia.Details
Glucose-6-phosphate 1-dehydrogenaseSwanseaNot Available224T->CADR InferredIncreased risk of potentially fatal hemolytic anemia and methemoglobinemia.Details
Glucose-6-phosphate 1-dehydrogenaseUrayasuNot Available281_283delAGAADR InferredIncreased risk of potentially fatal hemolytic anemia and methemoglobinemia.Details
Glucose-6-phosphate 1-dehydrogenaseVancouverNot Available317C->G544C->T592C->TADR InferredIncreased risk of potentially fatal hemolytic anemia and methemoglobinemia.Details
Glucose-6-phosphate 1-dehydrogenaseMt SinaiNot Available376A->G, 1159C->TADR InferredIncreased risk of potentially fatal hemolytic anemia and methemoglobinemia.Details
Glucose-6-phosphate 1-dehydrogenasePlymouthNot Available488G->AADR InferredIncreased risk of potentially fatal hemolytic anemia and methemoglobinemia.Details
Glucose-6-phosphate 1-dehydrogenaseVolendamNot Available514C->TADR InferredIncreased risk of potentially fatal hemolytic anemia and methemoglobinemia.Details
Glucose-6-phosphate 1-dehydrogenaseShinshuNot Available527A->GADR InferredIncreased risk of potentially fatal hemolytic anemia and methemoglobinemia.Details
Glucose-6-phosphate 1-dehydrogenaseChikugoNot Available535A->TADR InferredIncreased risk of potentially fatal hemolytic anemia and methemoglobinemia.Details
Glucose-6-phosphate 1-dehydrogenaseTsukuiNot Available561_563delCTCADR InferredIncreased risk of potentially fatal hemolytic anemia and methemoglobinemia.Details
Glucose-6-phosphate 1-dehydrogenasePedoplis-CkaroNot Available573C>GADR InferredIncreased risk of potentially fatal hemolytic anemia and methemoglobinemia.Details
Glucose-6-phosphate 1-dehydrogenaseSantiagoNot Available593G->CADR InferredIncreased risk of potentially fatal hemolytic anemia and methemoglobinemia.Details
Glucose-6-phosphate 1-dehydrogenaseMinnesota, Marion, Gastonia, LeJeuneNot Available637G->TADR InferredIncreased risk of potentially fatal hemolytic anemia and methemoglobinemia.Details
Glucose-6-phosphate 1-dehydrogenaseCincinnatiNot Available637G->T, 1037A->TADR InferredIncreased risk of potentially fatal hemolytic anemia and methemoglobinemia.Details
Glucose-6-phosphate 1-dehydrogenaseHarilaouNot Available648T->GADR InferredIncreased risk of potentially fatal hemolytic anemia and methemoglobinemia.Details
Glucose-6-phosphate 1-dehydrogenaseNorth DallasNot Available683_685delACAADR InferredIncreased risk of potentially fatal hemolytic anemia and methemoglobinemia.Details
Glucose-6-phosphate 1-dehydrogenaseAsahikawaNot Available695G->AADR InferredIncreased risk of potentially fatal hemolytic anemia and methemoglobinemia.Details
Glucose-6-phosphate 1-dehydrogenaseDurhamNot Available713A->GADR InferredIncreased risk of potentially fatal hemolytic anemia and methemoglobinemia.Details
Glucose-6-phosphate 1-dehydrogenaseStonybrookNot Available724_729delGGCACTADR InferredIncreased risk of potentially fatal hemolytic anemia and methemoglobinemia.Details
Glucose-6-phosphate 1-dehydrogenaseWayneNot Available769C->GADR InferredIncreased risk of potentially fatal hemolytic anemia and methemoglobinemia.Details
Glucose-6-phosphate 1-dehydrogenaseAveiroNot Available806G->AADR InferredIncreased risk of potentially fatal hemolytic anemia and methemoglobinemia.Details
Glucose-6-phosphate 1-dehydrogenaseCleveland CorumNot Available820G->AADR InferredIncreased risk of potentially fatal hemolytic anemia and methemoglobinemia.Details
Glucose-6-phosphate 1-dehydrogenaseLilleNot Available821A>TADR InferredIncreased risk of potentially fatal hemolytic anemia and methemoglobinemia.Details
Glucose-6-phosphate 1-dehydrogenaseBangkokNot Available825G>CADR InferredIncreased risk of potentially fatal hemolytic anemia and methemoglobinemia.Details
Glucose-6-phosphate 1-dehydrogenaseSugaoNot Available826C->TADR InferredIncreased risk of potentially fatal hemolytic anemia and methemoglobinemia.Details
Glucose-6-phosphate 1-dehydrogenaseLa JollaNot Available832T->CADR InferredIncreased risk of potentially fatal hemolytic anemia and methemoglobinemia.Details
Glucose-6-phosphate 1-dehydrogenaseWexhamNot Available833C->TADR InferredIncreased risk of potentially fatal hemolytic anemia and methemoglobinemia.Details
Glucose-6-phosphate 1-dehydrogenasePiotrkowNot Available851T>CADR InferredIncreased risk of potentially fatal hemolytic anemia and methemoglobinemia.Details
Glucose-6-phosphate 1-dehydrogenaseWest VirginiaNot Available910G->TADR InferredIncreased risk of potentially fatal hemolytic anemia and methemoglobinemia.Details
Glucose-6-phosphate 1-dehydrogenaseOmiyaNot Available921G->CADR InferredIncreased risk of potentially fatal hemolytic anemia and methemoglobinemia.Details
Glucose-6-phosphate 1-dehydrogenaseNaraNot Available953_976delCCACCAAAGGGTACCTGGAC GACCADR InferredIncreased risk of potentially fatal hemolytic anemia and methemoglobinemia.Details
Glucose-6-phosphate 1-dehydrogenaseManhattanNot Available962G->AADR InferredIncreased risk of potentially fatal hemolytic anemia and methemoglobinemia.Details
Glucose-6-phosphate 1-dehydrogenaseRehevotNot Available964T->CADR InferredIncreased risk of potentially fatal hemolytic anemia and methemoglobinemia.Details
Glucose-6-phosphate 1-dehydrogenaseHoniaraNot Available99A->G / 1360C->TADR InferredIncreased risk of potentially fatal hemolytic anemia and methemoglobinemia.Details
Glucose-6-phosphate 1-dehydrogenaseTokyo, FukushimaNot Available1246G->AADR InferredIncreased risk of potentially fatal hemolytic anemia and methemoglobinemia.Details
Glucose-6-phosphate 1-dehydrogenaseChathamNot Available1003G->AADR InferredIncreased risk of potentially fatal hemolytic anemia and methemoglobinemia.Details
Glucose-6-phosphate 1-dehydrogenaseFushanNot Available1004C->AADR InferredIncreased risk of potentially fatal hemolytic anemia and methemoglobinemia.Details
Glucose-6-phosphate 1-dehydrogenasePartenopeNot Available1052G->TADR InferredIncreased risk of potentially fatal hemolytic anemia and methemoglobinemia.Details
Glucose-6-phosphate 1-dehydrogenaseIerapetraNot Available1057C->TADR InferredIncreased risk of potentially fatal hemolytic anemia and methemoglobinemia.Details
Glucose-6-phosphate 1-dehydrogenaseAnadiaNot Available1193A->GADR InferredIncreased risk of potentially fatal hemolytic anemia and methemoglobinemia.Details
Glucose-6-phosphate 1-dehydrogenaseAbenoNot Available1220A->CADR InferredIncreased risk of potentially fatal hemolytic anemia and methemoglobinemia.Details
Glucose-6-phosphate 1-dehydrogenaseSurabayaNot Available1291G->AADR InferredIncreased risk of potentially fatal hemolytic anemia and methemoglobinemia.Details
Glucose-6-phosphate 1-dehydrogenasePawneeNot Available1316G->CADR InferredIncreased risk of potentially fatal hemolytic anemia and methemoglobinemia.Details
Glucose-6-phosphate 1-dehydrogenaseS. AntiocoNot Available1342A->GADR InferredIncreased risk of potentially fatal hemolytic anemia and methemoglobinemia.Details
Glucose-6-phosphate 1-dehydrogenaseCassanoNot Available1347G->CADR InferredIncreased risk of potentially fatal hemolytic anemia and methemoglobinemia.Details
Glucose-6-phosphate 1-dehydrogenaseHermoupolisNot Available1347G->C / 1360C->TADR InferredIncreased risk of potentially fatal hemolytic anemia and methemoglobinemia.Details
Glucose-6-phosphate 1-dehydrogenaseUnion,Maewo, Chinese-2, KaloNot Available1360C->TADR InferredIncreased risk of potentially fatal hemolytic anemia and methemoglobinemia.Details
Glucose-6-phosphate 1-dehydrogenaseAndalusNot Available1361G->AADR InferredIncreased risk of potentially fatal hemolytic anemia and methemoglobinemia.Details
Glucose-6-phosphate 1-dehydrogenaseCosenzaNot Available1376G->CADR InferredIncreased risk of potentially fatal hemolytic anemia and methemoglobinemia.Details
Glucose-6-phosphate 1-dehydrogenaseCanton, Taiwan- Hakka, Gifu-like, Agrigento-likeNot Available1376G->TADR InferredIncreased risk of potentially fatal hemolytic anemia and methemoglobinemia.Details
Glucose-6-phosphate 1-dehydrogenaseFloresNot Available1387C->AADR InferredIncreased risk of potentially fatal hemolytic anemia and methemoglobinemia.Details
Glucose-6-phosphate 1-dehydrogenaseKaiping, Anant, Dhon, Sapporo-like, WoseraNot Available1388G->AADR InferredIncreased risk of potentially fatal hemolytic anemia and methemoglobinemia.Details
Glucose-6-phosphate 1-dehydrogenaseKamogawaNot Available169C->TADR InferredIncreased risk of potentially fatal hemolytic anemia and methemoglobinemia.Details
Glucose-6-phosphate 1-dehydrogenaseCostanzoNot Available179T>CADR InferredIncreased risk of potentially fatal hemolytic anemia and methemoglobinemia.Details
Glucose-6-phosphate 1-dehydrogenaseAmazoniaNot Available185C->AADR InferredIncreased risk of potentially fatal hemolytic anemia and methemoglobinemia.Details
Glucose-6-phosphate 1-dehydrogenaseSongklanagarindNot Available196T->AADR InferredIncreased risk of potentially fatal hemolytic anemia and methemoglobinemia.Details
Glucose-6-phosphate 1-dehydrogenaseHechiNot Available202G->A / 871G->AADR InferredIncreased risk of potentially fatal hemolytic anemia and methemoglobinemia.Details
Glucose-6-phosphate 1-dehydrogenaseNamouruNot Available208T->CADR InferredIncreased risk of potentially fatal hemolytic anemia and methemoglobinemia.Details
Glucose-6-phosphate 1-dehydrogenaseBao LocNot Available352T>CADR InferredIncreased risk of potentially fatal hemolytic anemia and methemoglobinemia.Details
Glucose-6-phosphate 1-dehydrogenaseCrispimNot Available375G->T, 379G->T383T->C384C>TADR InferredIncreased risk of potentially fatal hemolytic anemia and methemoglobinemia.Details
Glucose-6-phosphate 1-dehydrogenaseAcrokorinthosNot Available376A->G / 463C->GADR InferredIncreased risk of potentially fatal hemolytic anemia and methemoglobinemia.Details
Glucose-6-phosphate 1-dehydrogenaseSanta MariaNot Available376A->G / 542A->TADR InferredIncreased risk of potentially fatal hemolytic anemia and methemoglobinemia.Details
Glucose-6-phosphate 1-dehydrogenaseAnanindeuaNot Available376A->G / 871G->AADR InferredIncreased risk of potentially fatal hemolytic anemia and methemoglobinemia.Details
Glucose-6-phosphate 1-dehydrogenaseVanua LavaNot Available383T->CADR InferredIncreased risk of potentially fatal hemolytic anemia and methemoglobinemia.Details
Glucose-6-phosphate 1-dehydrogenaseValladolidNot Available406C->TADR InferredIncreased risk of potentially fatal hemolytic anemia and methemoglobinemia.Details
Glucose-6-phosphate 1-dehydrogenaseBelemNot Available409C->TADR InferredIncreased risk of potentially fatal hemolytic anemia and methemoglobinemia.Details
Glucose-6-phosphate 1-dehydrogenaseLiuzhouNot Available442G->AADR InferredIncreased risk of potentially fatal hemolytic anemia and methemoglobinemia.Details
Glucose-6-phosphate 1-dehydrogenaseShenzenNot Available473G>AADR InferredIncreased risk of potentially fatal hemolytic anemia and methemoglobinemia.Details
Glucose-6-phosphate 1-dehydrogenaseTaipei “Chinese- 3”Not Available493A->GADR InferredIncreased risk of potentially fatal hemolytic anemia and methemoglobinemia.Details
Glucose-6-phosphate 1-dehydrogenaseToledoNot Available496C>TADR InferredIncreased risk of potentially fatal hemolytic anemia and methemoglobinemia.Details
Glucose-6-phosphate 1-dehydrogenaseNaoneNot Available497G->AADR InferredIncreased risk of potentially fatal hemolytic anemia and methemoglobinemia.Details
Glucose-6-phosphate 1-dehydrogenaseNankangNot Available517T->CADR InferredIncreased risk of potentially fatal hemolytic anemia and methemoglobinemia.Details
Glucose-6-phosphate 1-dehydrogenaseMiaoliNot Available519C->GADR InferredIncreased risk of potentially fatal hemolytic anemia and methemoglobinemia.Details
Glucose-6-phosphate 1-dehydrogenaseMediterranean, Dallas, Panama‚ Sassari, Cagliari, BirminghamNot Available563C->TADR InferredIncreased risk of potentially fatal hemolytic anemia and methemoglobinemia.Details
Glucose-6-phosphate 1-dehydrogenaseCoimbra ShundeNot Available592C->TADR InferredIncreased risk of potentially fatal hemolytic anemia and methemoglobinemia.Details
Glucose-6-phosphate 1-dehydrogenaseNilgiriNot Available593G>AADR InferredIncreased risk of potentially fatal hemolytic anemia and methemoglobinemia.Details
Glucose-6-phosphate 1-dehydrogenaseRadlowoNot Available679C->TADR InferredIncreased risk of potentially fatal hemolytic anemia and methemoglobinemia.Details
Glucose-6-phosphate 1-dehydrogenaseRoubaixNot Available811G>CADR InferredIncreased risk of potentially fatal hemolytic anemia and methemoglobinemia.Details
Glucose-6-phosphate 1-dehydrogenaseHaikouNot Available835A->GADR InferredIncreased risk of potentially fatal hemolytic anemia and methemoglobinemia.Details
Glucose-6-phosphate 1-dehydrogenaseChinese-1Not Available835A->TADR InferredIncreased risk of potentially fatal hemolytic anemia and methemoglobinemia.Details
Glucose-6-phosphate 1-dehydrogenaseMizushimaNot Available848A>GADR InferredIncreased risk of potentially fatal hemolytic anemia and methemoglobinemia.Details
Glucose-6-phosphate 1-dehydrogenaseOsakaNot Available853C->TADR InferredIncreased risk of potentially fatal hemolytic anemia and methemoglobinemia.Details
Glucose-6-phosphate 1-dehydrogenaseViangchan, JammuNot Available871G->AADR InferredIncreased risk of potentially fatal hemolytic anemia and methemoglobinemia.Details
Glucose-6-phosphate 1-dehydrogenaseSeoulNot Available916G->AADR InferredIncreased risk of potentially fatal hemolytic anemia and methemoglobinemia.Details
Glucose-6-phosphate 1-dehydrogenaseLudhianaNot Available929G->AADR InferredIncreased risk of potentially fatal hemolytic anemia and methemoglobinemia.Details
Glucose-6-phosphate 1-dehydrogenaseFarroupilhaNot Available977C->AADR InferredIncreased risk of potentially fatal hemolytic anemia and methemoglobinemia.Details
Glucose-6-phosphate 1-dehydrogenaseChinese-5Not Available1024C->TADR InferredIncreased risk of potentially fatal hemolytic anemia and methemoglobinemia.Details
Glucose-6-phosphate 1-dehydrogenaseRignanoNot Available130G>AADR InferredIncreased risk of potentially fatal hemolytic anemia and methemoglobinemia.Details
Glucose-6-phosphate 1-dehydrogenaseOrissaNot Available131C->GADR InferredIncreased risk of potentially fatal hemolytic anemia and methemoglobinemia.Details
Glucose-6-phosphate 1-dehydrogenaseG6PDNiceNot Available1380G>CADR InferredIncreased risk of potentially fatal hemolytic anemia and methemoglobinemia.Details
Glucose-6-phosphate 1-dehydrogenaseKamiube, KeelungNot Available1387C->TADR InferredIncreased risk of potentially fatal hemolytic anemia and methemoglobinemia.Details
Glucose-6-phosphate 1-dehydrogenaseNeapolisNot Available1400C->GADR InferredIncreased risk of potentially fatal hemolytic anemia and methemoglobinemia.Details
Glucose-6-phosphate 1-dehydrogenaseAuresNot Available143T->CADR InferredIncreased risk of potentially fatal hemolytic anemia and methemoglobinemia.Details
Glucose-6-phosphate 1-dehydrogenaseSplitNot Available1442C->GADR InferredIncreased risk of potentially fatal hemolytic anemia and methemoglobinemia.Details
Glucose-6-phosphate 1-dehydrogenaseKambosNot Available148C->TADR InferredIncreased risk of potentially fatal hemolytic anemia and methemoglobinemia.Details
Glucose-6-phosphate 1-dehydrogenasePalestrinaNot Available170G>AADR InferredIncreased risk of potentially fatal hemolytic anemia and methemoglobinemia.Details
Glucose-6-phosphate 1-dehydrogenaseMetapontoNot Available172G->AADR InferredIncreased risk of potentially fatal hemolytic anemia and methemoglobinemia.Details
Glucose-6-phosphate 1-dehydrogenaseMusashinoNot Available185C->TADR InferredIncreased risk of potentially fatal hemolytic anemia and methemoglobinemia.Details
Glucose-6-phosphate 1-dehydrogenaseAsahiNot Available202G->AADR InferredIncreased risk of potentially fatal hemolytic anemia and methemoglobinemia.Details
Glucose-6-phosphate 1-dehydrogenaseA- (202), Ferrara INot Available202G->A / 376A->GADR InferredIncreased risk of potentially fatal hemolytic anemia and methemoglobinemia.Details
Glucose-6-phosphate 1-dehydrogenaseMurcia OristanoNot Available209A->GADR InferredIncreased risk of potentially fatal hemolytic anemia and methemoglobinemia.Details
Glucose-6-phosphate 1-dehydrogenaseUbe KonanNot Available241C->TADR InferredIncreased risk of potentially fatal hemolytic anemia and methemoglobinemia.Details
Glucose-6-phosphate 1-dehydrogenaseLagosantoNot Available242G->AADR InferredIncreased risk of potentially fatal hemolytic anemia and methemoglobinemia.Details
Glucose-6-phosphate 1-dehydrogenaseGuangzhouNot Available274C->TADR InferredIncreased risk of potentially fatal hemolytic anemia and methemoglobinemia.Details
Glucose-6-phosphate 1-dehydrogenaseHammersmithNot Available323T->AADR InferredIncreased risk of potentially fatal hemolytic anemia and methemoglobinemia.Details
Glucose-6-phosphate 1-dehydrogenaseSinnaiNot Available34G->TADR InferredIncreased risk of potentially fatal hemolytic anemia and methemoglobinemia.Details
Glucose-6-phosphate 1-dehydrogenaseA- (680)Not Available376A->G / 680G->TADR InferredIncreased risk of potentially fatal hemolytic anemia and methemoglobinemia.Details
Glucose-6-phosphate 1-dehydrogenaseA- (968), Betica,Selma, GuantanamoNot Available376A->G / 968T->CADR InferredIncreased risk of potentially fatal hemolytic anemia and methemoglobinemia.Details
Glucose-6-phosphate 1-dehydrogenaseSalerno PyrgosNot Available383T>GADR InferredIncreased risk of potentially fatal hemolytic anemia and methemoglobinemia.Details
Glucose-6-phosphate 1-dehydrogenaseQuing YanNot Available392G->TADR InferredIncreased risk of potentially fatal hemolytic anemia and methemoglobinemia.Details
Glucose-6-phosphate 1-dehydrogenaseLagesNot Available40G->AADR InferredIncreased risk of potentially fatal hemolytic anemia and methemoglobinemia.Details
Glucose-6-phosphate 1-dehydrogenaseIleshaNot Available466G->AADR InferredIncreased risk of potentially fatal hemolytic anemia and methemoglobinemia.Details
Glucose-6-phosphate 1-dehydrogenaseMahidolNot Available487G->AADR InferredIncreased risk of potentially fatal hemolytic anemia and methemoglobinemia.Details
Glucose-6-phosphate 1-dehydrogenaseMalagaNot Available542A->TADR InferredIncreased risk of potentially fatal hemolytic anemia and methemoglobinemia.Details
Glucose-6-phosphate 1-dehydrogenaseSibariNot Available634A->GADR InferredIncreased risk of potentially fatal hemolytic anemia and methemoglobinemia.Details
Glucose-6-phosphate 1-dehydrogenaseMexico CityNot Available680G->AADR InferredIncreased risk of potentially fatal hemolytic anemia and methemoglobinemia.Details
Glucose-6-phosphate 1-dehydrogenaseNanningNot Available703C->TADR InferredIncreased risk of potentially fatal hemolytic anemia and methemoglobinemia.Details
Glucose-6-phosphate 1-dehydrogenaseSeattle, Lodi, Modena, Ferrara II, Athens-likeNot Available844G->CADR InferredIncreased risk of potentially fatal hemolytic anemia and methemoglobinemia.Details
Glucose-6-phosphate 1-dehydrogenaseBajo MaumereNot Available844G->TADR InferredIncreased risk of potentially fatal hemolytic anemia and methemoglobinemia.Details
Glucose-6-phosphate 1-dehydrogenaseMontalbanoNot Available854G->AADR InferredIncreased risk of potentially fatal hemolytic anemia and methemoglobinemia.Details
Glucose-6-phosphate 1-dehydrogenaseKalyan-Kerala, Jamnaga, RohiniNot Available949G->AADR InferredIncreased risk of potentially fatal hemolytic anemia and methemoglobinemia.Details
Glucose-6-phosphate 1-dehydrogenaseGaoheNot Available95A->GADR InferredIncreased risk of potentially fatal hemolytic anemia and methemoglobinemia.Details


Drug Interactions
Abicipar PegolThe therapeutic efficacy of Abicipar Pegol can be decreased when used in combination with Pegloticase.
AllopurinolThe risk or severity of adverse effects can be increased when Allopurinol is combined with Pegloticase.
Antihemophilic Factor (Recombinant), PEGylatedThe therapeutic efficacy of Antihemophilic Factor (Recombinant), PEGylated can be decreased when used in combination with Pegloticase.
Cepeginterferon alfa-2BThe therapeutic efficacy of Cepeginterferon alfa-2B can be decreased when used in combination with Pegloticase.
Certolizumab pegolThe therapeutic efficacy of Certolizumab pegol can be decreased when used in combination with Pegloticase.
Damoctocog alfa pegolThe therapeutic efficacy of Damoctocog alfa pegol can be decreased when used in combination with Pegloticase.
Egaptivon pegolThe therapeutic efficacy of Pegloticase can be decreased when used in combination with Egaptivon pegol.
ElapegademaseThe therapeutic efficacy of Elapegademase can be decreased when used in combination with Pegloticase.
Eptacog alfa pegol (activated)The therapeutic efficacy of Eptacog alfa pegol (activated) can be decreased when used in combination with Pegloticase.
FebuxostatThe risk or severity of adverse effects can be increased when Febuxostat is combined with Pegloticase.
Food Interactions
Not Available


General References
  1. Sattui SE, Gaffo AL: Treatment of hyperuricemia in gout: current therapeutic options, latest developments and clinical implications. Ther Adv Musculoskelet Dis. 2016 Aug;8(4):145-59. doi: 10.1177/1759720X16646703. Epub 2016 May 2. [PubMed:27493693]
External Links
PubChem Substance
RxList Drug Page Drug Page
ATC Codes
M04AX02 — Pegloticase
FDA label
Download (373 KB)

Clinical Trials

Clinical Trials
1CompletedNot AvailableHemodialysis-dependent chronic kidney disease (HDD-CKD)1
2CompletedTreatmentAcute Gouty Arthritis2
2RecruitingOtherAcute Gouty Arthritis1
2RecruitingTreatmentAcute Gouty Arthritis1
2RecruitingTreatmentGout Chronic1
3CompletedTreatmentAcute Gouty Arthritis2
3CompletedTreatmentChronic Gout Refractory to Conventional Therapy1
Not AvailableCompletedNot AvailableGout Chronic1


Not Available
Not Available
Dosage forms
Injection, solutionIntravenous8 mg/1mL
Injection, solution, concentrateIntravenous8 mg/ml
Not Available
Not Available


Experimental Properties
Not Available


Not Available
Organic Compounds
Super Class
Organic Acids
Carboxylic Acids and Derivatives
Sub Class
Amino Acids, Peptides, and Analogues
Direct Parent
Alternative Parents
Not Available
Not Available
Molecular Framework
Not Available
External Descriptors
Not Available


Small molecule
Pharmacological action

Drug created on October 20, 2015 13:34 / Updated on November 02, 2018 07:00