Metallothionein-3
Details
- Name
- Metallothionein-3
- Synonyms
- GIF
- GIFB
- Growth inhibitory factor
- Metallothionein-III
- MT-3
- MT-III
- Gene Name
- MT3
- Organism
- Humans
- Amino acid sequence
>lcl|BSEQ0017834|Metallothionein-3 MDPETCPCPSGGSCTCADSCKCEGCKCTSCKKSCCSCCPAECEKCAKDCVCKGGEAAEAE AEKCSCCQ
- Number of residues
- 68
- Molecular Weight
- 6926.855
- Theoretical pI
- Not Available
- GO Classification
- Functionsantioxidant activity / cadmium ion binding / copper ion binding / cysteine-type endopeptidase inhibitor activity involved in apoptotic process / drug binding / protein kinase activator activity / zinc ion bindingProcessesactivation of protein kinase B activity / astrocyte development / brain development / cadmium ion homeostasis / cell proliferation / cellular lipid catabolic process / cellular metal ion homeostasis / cellular response to cadmium ion / cellular response to drug / cellular response to hypoxia / cellular response to nitric oxide / cellular response to oxidative stress / cellular zinc ion homeostasis / cholesterol catabolic process / energy reserve metabolic process / ERK1 and ERK2 cascade / histone modification / leptin-mediated signaling pathway / negative regulation of apoptotic process / negative regulation of autophagy / negative regulation of axon extension / negative regulation of cell growth / negative regulation of cysteine-type endopeptidase activity / negative regulation of cysteine-type endopeptidase activity involved in apoptotic process / negative regulation of hydrogen peroxide catabolic process / negative regulation of necrotic cell death / negative regulation of neuron apoptotic process / negative regulation of oxidoreductase activity / negative regulation of reactive oxygen species metabolic process / negative regulation of transcription, DNA-templated / positive regulation of catalytic activity / positive regulation of cell death / positive regulation of ERK1 and ERK2 cascade / positive regulation of gene expression / positive regulation of lysosomal membrane permeability / positive regulation of necrotic cell death / positive regulation of oxygen metabolic process / positive regulation of protein phosphorylation / positive regulation of transcription from RNA polymerase II promoter in response to oxidative stress / positive regulation of transcription, DNA-templated / positive regulation of vascular endothelial growth factor receptor signaling pathway / protein import into nucleus, translocation / protein kinase B signaling / protein stabilization / regulation of protein glycosylation / regulation of response to food / removal of superoxide radicals / response to hypoxia / zinc II ion transport / zinc ion homeostasisComponentsastrocyte end-foot / axon / cytoplasm / dendritic spine / extracellular space / inclusion body / intracellular / microtubule / mitochondrial outer membrane / perinuclear region of cytoplasm / plasma membrane / postsynaptic density / ribosome / rough endoplasmic reticulum / synaptic vesicle
- General Function
- Zinc ion binding
- Specific Function
- Binds heavy metals. Contains three zinc and three copper atoms per polypeptide chain and only a negligible amount of cadmium. Inhibits survival and neurite formation of cortical neurons in vitro.
- Pfam Domain Function
- Metallothio (PF00131)
- Transmembrane Regions
- Not Available
- Cellular Location
- Not Available
- Gene sequence
>lcl|BSEQ0017835|Metallothionein-3 (MT3) ATGGACCCTGAGACCTGCCCCTGCCCTTCTGGTGGCTCCTGCACCTGCGCGGACTCCTGC AAGTGCGAGGGATGCAAATGCACCTCCTGCAAGAAGAGCTGCTGCTCCTGCTGCCCTGCG GAGTGTGAGAAGTGTGCCAAGGACTGTGTGTGCAAAGGCGGAGAGGCAGCTGAGGCAGAA GCAGAGAAGTGCAGCTGCTGCCAGTGA
- Chromosome Location
- 16
- Locus
- Not Available
- External Identifiers
Resource Link UniProtKB ID P25713 UniProtKB Entry Name MT3_HUMAN HGNC ID HGNC:7408 - General References
- Uchida Y, Takio K, Titani K, Ihara Y, Tomonaga M: The growth inhibitory factor that is deficient in the Alzheimer's disease brain is a 68 amino acid metallothionein-like protein. Neuron. 1991 Aug;7(2):337-47. [Article]
- Palmiter RD, Findley SD, Whitmore TE, Durnam DM: MT-III, a brain-specific member of the metallothionein gene family. Proc Natl Acad Sci U S A. 1992 Jul 15;89(14):6333-7. [Article]
- Tsuji S, Kobayashi H, Uchida Y, Ihara Y, Miyatake T: Molecular cloning of human growth inhibitory factor cDNA and its down-regulation in Alzheimer's disease. EMBO J. 1992 Dec;11(13):4843-50. [Article]
- Naruse S, Igarashi S, Furuya T, Kobayashi H, Miyatake T, Tsuji S: Structures of the human and mouse growth inhibitory factor-encoding genes. Gene. 1994 Jul 8;144(2):283-7. [Article]
- Amoureux MC, Wurch T, Pauwels PJ: Modulation of metallothionein-III mRNA content and growth rate of rat C6-glial cells by transfection with human 5-HT1D receptor genes. Biochem Biophys Res Commun. 1995 Sep 14;214(2):639-45. [Article]
- Gerhard DS, Wagner L, Feingold EA, Shenmen CM, Grouse LH, Schuler G, Klein SL, Old S, Rasooly R, Good P, Guyer M, Peck AM, Derge JG, Lipman D, Collins FS, Jang W, Sherry S, Feolo M, Misquitta L, Lee E, Rotmistrovsky K, Greenhut SF, Schaefer CF, Buetow K, Bonner TI, Haussler D, Kent J, Kiekhaus M, Furey T, Brent M, Prange C, Schreiber K, Shapiro N, Bhat NK, Hopkins RF, Hsie F, Driscoll T, Soares MB, Casavant TL, Scheetz TE, Brown-stein MJ, Usdin TB, Toshiyuki S, Carninci P, Piao Y, Dudekula DB, Ko MS, Kawakami K, Suzuki Y, Sugano S, Gruber CE, Smith MR, Simmons B, Moore T, Waterman R, Johnson SL, Ruan Y, Wei CL, Mathavan S, Gunaratne PH, Wu J, Garcia AM, Hulyk SW, Fuh E, Yuan Y, Sneed A, Kowis C, Hodgson A, Muzny DM, McPherson J, Gibbs RA, Fahey J, Helton E, Ketteman M, Madan A, Rodrigues S, Sanchez A, Whiting M, Madari A, Young AC, Wetherby KD, Granite SJ, Kwong PN, Brinkley CP, Pearson RL, Bouffard GG, Blakesly RW, Green ED, Dickson MC, Rodriguez AC, Grimwood J, Schmutz J, Myers RM, Butterfield YS, Griffith M, Griffith OL, Krzywinski MI, Liao N, Morin R, Palmquist D, Petrescu AS, Skalska U, Smailus DE, Stott JM, Schnerch A, Schein JE, Jones SJ, Holt RA, Baross A, Marra MA, Clifton S, Makowski KA, Bosak S, Malek J: The status, quality, and expansion of the NIH full-length cDNA project: the Mammalian Gene Collection (MGC). Genome Res. 2004 Oct;14(10B):2121-7. [Article]
Drug Relations
- Drug Relations
DrugBank ID Name Drug group Pharmacological action? Actions Details DB01593 Zinc approved, investigational unknown Details DB14487 Zinc acetate approved, investigational unknown Details DB14533 Zinc chloride approved, investigational unknown cofactor Details DB14548 Zinc sulfate, unspecified form approved, experimental unknown cofactor Details DB09130 Copper approved, investigational no binder Details DB12965 Silver approved, investigational unknown binder Details