Alpha-7 nicotinic cholinergic receptor subunit

Details

Name
Alpha-7 nicotinic cholinergic receptor subunit
Synonyms
Not Available
Gene Name
CHRNA7
Organism
Humans
Amino acid sequence
>lcl|BSEQ0022322|Alpha-7 nicotinic cholinergic receptor subunit
ITVLLSLTVFMLLVAEIMPATSDSVPLI
Number of residues
28
Molecular Weight
2987.635
Theoretical pI
3.55
GO Classification
Processes
ion transport
Components
integral component of membrane
General Function
Not Available
Specific Function
Not Available
Pfam Domain Function
Transmembrane Regions
Not Available
Cellular Location
Not Available
Gene sequence
>lcl|BSEQ0006706|87 bp
GGATAACAGTCTTACTCTCTCTTACCGTCTTCATGCTGCTCGTGGCTGAGATCATGCCCG
CAACATCCGATTCGGTACCATTGATAG
Chromosome Location
Not Available
Locus
Not Available
External Identifiers
ResourceLink
UniProtKB IDQ693P7
UniProtKB Entry NameQ693P7_HUMAN
GenBank Gene IDAY641831
GenAtlas IDCHRFAM7A
General References
Not Available

Drug Relations

Drug Relations
DrugBank IDNameDrug groupPharmacological action?ActionsDetails
DB06090BradaniclineinvestigationalunknownDetails
DB00202SuccinylcholineapprovedyesagonistDetails
DB01043Memantineapproved, investigationalunknownantagonistDetails
DB01520Tenocyclidineexperimental, illicit, investigationalunknownantagonistDetails
DB00193Tramadolapproved, investigationalunknownantagonistDetails
DB01221Ketamineapproved, vet_approvedyesantagonistDetails