30S ribosomal protein Thx
Details
- Name
- 30S ribosomal protein Thx
- Synonyms
- S31
- Gene Name
- rpsU
- Organism
- Thermus thermophilus (strain HB8 / ATCC 27634 / DSM 579)
- Amino acid sequence
>lcl|BSEQ0019542|30S ribosomal protein Thx MGKGDRRTRRGKIWRGTYGKYRPRKKK
- Number of residues
- 27
- Molecular Weight
- 3336.96
- Theoretical pI
- 12.41
- GO Classification
- FunctionsrRNA bindingComponentsribosome
- General Function
- Rrna binding
- Specific Function
- Binds at the top of the head of the 30S subunit. It stabilizes a number of different RNA elements and thus is important for subunit structure.
- Pfam Domain Function
- Thx (PF17070)
- Transmembrane Regions
- Not Available
- Cellular Location
- Not Available
- Gene sequence
>lcl|BSEQ0019543|30S ribosomal protein Thx (rpsU) ATGGGCAAGGGCGACCGCAGGACCCGGCGCGGCAAGATCTGGCGCGGCACCTACGGCAAG TACCGGCCCCGGAAGAAGAAGTAG
- Chromosome Location
- Not Available
- Locus
- Not Available
- External Identifiers
Resource Link UniProtKB ID Q5SIH3 UniProtKB Entry Name RSHX_THET8 GenBank Protein ID 11125386 GenBank Gene ID AJ295159 - General References
- Leontiadou F, Triantafillidou D, Choli-Papadopoulou T: On the characterization of the putative S20-thx operon of Thermus thermophilus. Biol Chem. 2001 Jul;382(7):1001-6. [Article]
- Choli T, Franceschi F, Yonath A, Wittmann-Liebold B: Isolation and characterization of a new ribosomal protein from the thermophilic eubacteria, Thermus thermophilus, T. aquaticus and T. flavus. Biol Chem Hoppe Seyler. 1993 Jun;374(6):377-83. [Article]
- Tsiboli P, Herfurth E, Choli T: Purification and characterization of the 30S ribosomal proteins from the bacterium Thermus thermophilus. Eur J Biochem. 1994 Nov 15;226(1):169-77. [Article]
- Suh MJ, Hamburg DM, Gregory ST, Dahlberg AE, Limbach PA: Extending ribosomal protein identifications to unsequenced bacterial strains using matrix-assisted laser desorption/ionization mass spectrometry. Proteomics. 2005 Dec;5(18):4818-31. [Article]
- Wimberly BT, Brodersen DE, Clemons WM Jr, Morgan-Warren RJ, Carter AP, Vonrhein C, Hartsch T, Ramakrishnan V: Structure of the 30S ribosomal subunit. Nature. 2000 Sep 21;407(6802):327-39. [Article]
- Brodersen DE, Clemons WM Jr, Carter AP, Morgan-Warren RJ, Wimberly BT, Ramakrishnan V: The structural basis for the action of the antibiotics tetracycline, pactamycin, and hygromycin B on the 30S ribosomal subunit. Cell. 2000 Dec 22;103(7):1143-54. [Article]
- Carter AP, Clemons WM, Brodersen DE, Morgan-Warren RJ, Wimberly BT, Ramakrishnan V: Functional insights from the structure of the 30S ribosomal subunit and its interactions with antibiotics. Nature. 2000 Sep 21;407(6802):340-8. [Article]
- Yusupova GZ, Yusupov MM, Cate JH, Noller HF: The path of messenger RNA through the ribosome. Cell. 2001 Jul 27;106(2):233-41. [Article]
- Pioletti M, Schlunzen F, Harms J, Zarivach R, Gluhmann M, Avila H, Bashan A, Bartels H, Auerbach T, Jacobi C, Hartsch T, Yonath A, Franceschi F: Crystal structures of complexes of the small ribosomal subunit with tetracycline, edeine and IF3. EMBO J. 2001 Apr 17;20(8):1829-39. [Article]
- Carter AP, Clemons WM Jr, Brodersen DE, Morgan-Warren RJ, Hartsch T, Wimberly BT, Ramakrishnan V: Crystal structure of an initiation factor bound to the 30S ribosomal subunit. Science. 2001 Jan 19;291(5503):498-501. [Article]
- Yusupov MM, Yusupova GZ, Baucom A, Lieberman K, Earnest TN, Cate JH, Noller HF: Crystal structure of the ribosome at 5.5 A resolution. Science. 2001 May 4;292(5518):883-96. Epub 2001 Mar 29. [Article]
- Ogle JM, Brodersen DE, Clemons WM Jr, Tarry MJ, Carter AP, Ramakrishnan V: Recognition of cognate transfer RNA by the 30S ribosomal subunit. Science. 2001 May 4;292(5518):897-902. [Article]
- Brodersen DE, Clemons WM Jr, Carter AP, Wimberly BT, Ramakrishnan V: Crystal structure of the 30 S ribosomal subunit from Thermus thermophilus: structure of the proteins and their interactions with 16 S RNA. J Mol Biol. 2002 Feb 22;316(3):725-68. [Article]