
Accession Number
DB01067  (APRD00436)
Small Molecule

An oral hypoglycemic agent which is rapidly absorbed and completely metabolized.

  • 1-cyclohexyl-3-({p-[2-(5-methylpyrazinecarboxamido)ethyl]phenyl}sulfonyl)urea
  • Glipizida
  • Glipizide
  • Glipizidum
  • N-{4-[β-(5-methylpyrazine-2-carboxamido)ethyl]benzenesulphonyl}-N'-cyclohexylurea
External IDs
CP 28,720 / CP 28720 / CP-28,720 / CP-28720 / K 4024 / K-4024
Product Images
Prescription Products
NameDosageStrengthRouteLabellerMarketing StartMarketing End
GlipizideTablet, extended release5 mg/1OralRemedy Repack2011-12-082016-12-14Us
Glipizide ERTablet, extended release10 mg/1OralCardinal Health1994-04-26Not applicableUs
Glipizide XLTablet, extended release10 mg/1OralState of Florida DOH Central Pharmacy2014-01-01Not applicableUs
Glipizide XLTablet, extended release2.5 mg/1OralCardinal Health1994-04-26Not applicableUs
Glipizide XLTablet, extended release5 mg/1OralSt. Marys Medical Park Pharmacy2014-05-23Not applicableUs
Glipizide XLTablet, extended release2.5 mg/1OralGreenstone, Llc2013-05-29Not applicableUs59762 0540 01 nlmimage10 814a4092
Glipizide XLTablet, extended release10 mg/1OralState of Florida DOH Central Pharmacy2009-07-01Not applicableUs59762 5033 02 nlmimage10 8015c00e
Glipizide XLTablet, extended release5 mg/1OralGreenstone, Llc2004-06-112017-03-31Us
Glipizide XLTablet, extended release2.5 mg/1OralCardinal Health1994-04-26Not applicableUs
Glipizide XLTablet, extended release10 mg/1Oralbryant ranch prepack2004-06-112017-05-31Us
Generic Prescription Products
NameDosageStrengthRouteLabellerMarketing StartMarketing End
GlipizideTablet10 mg/1OralNucare Pharmaceuticals, Inc.2002-09-25Not applicableUs
GlipizideTablet5 mg/1OralAphena Pharma Solutions Tennessee, Inc.1995-04-07Not applicableUs
GlipizideTablet5 mg/1OralLegacy Pharmaceutical Packaging1995-04-07Not applicableUs00781 1452 01 nlmimage10 d720ebf7
GlipizideTablet5 mg/1OralNcs Health Care Of Ky, Inc Dba Vangard Labs1994-05-10Not applicableUs
GlipizideTablet5 mg/1OralPreferreed Pharmaceuticals Inc.2012-01-30Not applicableUs
GlipizideTablet10 mg/1OralStat Rx USA1995-02-27Not applicableUs
GlipizideTablet10 mg/1OralState of Florida DOH Central Pharmacy2009-07-01Not applicableUs
GlipizideTablet, film coated, extended release10 mg/1OralA S Medication Solutions2016-12-212017-06-20Us
GlipizideTablet5 mg/1OralNorthwind Pharmaceuticals2014-12-29Not applicableUs
GlipizideTablet5 mg/1OralMajor2002-09-25Not applicableUs
Unapproved/Other Products
NameDosageStrengthRouteLabellerMarketing StartMarketing End
GlipizideTablet5 mg/1OralAphena Pharma Solutions Tennessee, Inc.1994-05-10Not applicableUs
Glipizide ERTablet, film coated, extended release5 mg/1OralNu Care Pharmaceuticals,inc.2003-11-19Not applicableUs
Glipizide ERTablet, film coated, extended release5 mg/1OralRemedy Repack2017-11-08Not applicableUs
International/Other Brands
Aldiab / Digrin / Dipazide / Glibenese (Pfizer) / Glibénèse (Dexo) / Glibetin (Johnson) / Glican / Glidiab / Glipid / Glipin (Swiss Pharm) / Glix (YSP) / Gluco-Rite / Glucolip / Glucozide / Glupitel / Glupizide / Glyde / Glydiazinamide / Melizide / Mindiab (Pfizer) / Minidab / Minidiab (Pfizer) / Minodiab / Napizide / Ozidia / Sucrazide / Zitrol XR (Square)
Mixture Products
NameIngredientsDosageRouteLabellerMarketing StartMarketing End
Glipizide and Metformin HClGlipizide (5 mg/1) + Metformin Hydrochloride (500 mg/1)Tablet, film coatedOralA S Medication Solutions2010-06-292017-06-20Us
Glipizide and Metformin HClGlipizide (2.5 mg/1) + Metformin Hydrochloride (250 mg/1)Tablet, film coatedOralLake Erie Medical Dba Quality Care Produts Llc2010-06-29Not applicableUs
Glipizide and Metformin HClGlipizide (2.5 mg/1) + Metformin Hydrochloride (500 mg/1)Tablet, film coatedOralHeritage2010-06-29Not applicableUs
Glipizide and Metformin HClGlipizide (5 mg/1) + Metformin Hydrochloride (500 mg/1)Tablet, film coatedOralHeritage2010-06-29Not applicableUs
Glipizide and Metformin HClGlipizide (2.5 mg/1) + Metformin Hydrochloride (500 mg/1)Tablet, film coatedOralRemedy Repack2013-11-192016-12-24Us23155 0116 01 nlmimage10 bd3b5e8a
Glipizide and Metformin HClGlipizide (2.5 mg/1) + Metformin Hydrochloride (250 mg/1)Tablet, film coatedOralHeritage2010-06-29Not applicableUs
Glipizide and Metformin HClGlipizide (5 mg/1) + Metformin Hydrochloride (500 mg/1)Tablet, film coatedOralRemedy Repack2014-02-182017-09-09Us23155 0117 01 nlmimage10 2c461610
Glipizide and Metformin HydrochlorideGlipizide (2.5 mg/1) + Metformin Hydrochloride (250 mg/1)Tablet, film coatedOralWatson Pharmaceuticals2005-10-282016-04-20Us
Glipizide and Metformin HydrochlorideGlipizide (2.5 mg/1) + Metformin Hydrochloride (500 mg/1)Tablet, film coatedOralbryant ranch prepack2005-10-28Not applicableUs
Glipizide and Metformin HydrochlorideGlipizide (5 mg/1) + Metformin Hydrochloride (500 mg/1)Tablet, film coatedOralA S Medication Solutions2005-10-282017-06-20Us
CAS number
Average: 445.535
Monoisotopic: 445.178375067
Chemical Formula
InChI Key



For use as an adjunct to diet for the control of hyperglycemia and its associated symptomatology in patients with non-insulin-dependent diabetes mellitus (NIDDM; type II), formerly known as maturity-onset diabetes, after an adequate trial of dietary therapy has proved unsatisfactory.

Structured Indications

Glipizide, a second-generation sulfonylurea, is used with diet to lower blood glucose in patients with diabetes mellitus type II. The primary mode of action of glipizide in experimental animals appears to be the stimulation of insulin secretion from the beta cells of pancreatic islet tissue and is thus dependent on functioning beta cells in the pancreatic islets. In humans glipizide appears to lower the blood glucose acutely by stimulating the release of insulin from the pancreas, an effect dependent upon functioning beta cells in the pancreatic islets. In man, stimulation of insulin secretion by glipizide in response to a meal is undoubtedly of major importance. Fasting insulin levels are not elevated even on long-term glipizide administration, but the postprandial insulin response continues to be enhanced after at least 6 months of treatment. Some patients fail to respond initially, or gradually lose their responsiveness to sulfonylurea drugs, including glipizide.

Mechanism of action

Sulfonylureas likely bind to ATP-sensitive potassium-channel receptors on the pancreatic cell surface, reducing potassium conductance and causing depolarization of the membrane. Depolarization stimulates calcium ion influx through voltage-sensitive calcium channels, raising intracellular concentrations of calcium ions, which induces the secretion, or exocytosis, of insulin.

AATP-binding cassette sub-family C member 8
UPeroxisome proliferator-activated receptor gamma

Gastrointestinal absorption is uniform, rapid, and essentially complete.

Volume of distribution
  • 11 L
Protein binding

98-99%, primarily to albumin.


Hepatic. The major metabolites of glipizide are products of aromatic hydroxylation and have no hypoglycemic activity. A minor metabolite which accounts for less than 2% of a dose, an acetylaminoethyl benzine derivatives, is reported to have 1/10 to 1/3 as much hypoglycemic activity as the parent compound.

Route of elimination

The primary metabolites are inactive hydroxylation products and polar conjugates and are excreted mainly in the urine.

Half life

2-5 hours

Not Available

The acute oral toxicity was extremely low in all species tested (LD50 greater than 4 g/kg). Overdosage of sulfonylureas including glipizide can produce hypoglycemia.

Affected organisms
  • Humans and other mammals
Not Available
Pharmacogenomic Effects/ADRs
Interacting Gene/EnzymeAllele nameGenotype(s)Defining Change(s)Type(s)DescriptionDetails
Cytochrome P450 2C9CYP2C9*3(C;C) / (A;C)C AlleleEffect Directly StudiedPatients with this genotype have reduced metabolism of glipizide.Details
Glucose-6-phosphate 1-dehydrogenaseVilleurbanneNot Available1000_1002delACCADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseTorunNot Available1006A->GADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseSunderlandNot Available105_107delCATADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseIwatsukiNot Available1081G->AADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseSerresNot Available1082C->TADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseTondelaNot Available1084_1101delCTGAACGAGCGCAAGGCCADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseLoma LindaNot Available1089C->AADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseAachenNot Available1089C->GADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseTenriNot Available1096A->GADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseMontpellierNot Available1132G>AADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseCalvo MackennaNot Available1138A->GADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseRileyNot Available1139T->CADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseOlomoucNot Available1141T->CADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseTomahNot Available1153T->CADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseLynwoodNot Available1154G->TADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseMadridNot Available1155C->GADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseIowa, Walter Reed, SpringfieldNot Available1156A->GADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseBeverly Hills, Genova, Iwate, Niigata, YamaguchiNot Available1160G->AADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseHartfordNot Available1162A->GADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenasePrahaNot Available1166A->GADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseKrakowNot Available1175T>CADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseWisconsinNot Available1177C->GADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseNashville, Anaheim, PorticiNot Available1178G->AADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseAlhambraNot Available1180G->CADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseBariNot Available1187C->TADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenasePuerto LimonNot Available1192G->AADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseCovao do LoboNot Available1205C>AADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseClinicNot Available1215G->AADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseUtrechtNot Available1225C->TADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseSuwalkiNot Available1226C->GADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseRiversideNot Available1228G->TADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseJapan, ShinagawaNot Available1229G->AADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseKawasakiNot Available1229G->CADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseMunichNot Available1231A->GADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseGeorgiaNot Available1284C->AADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseSumareNot Available1292T->GADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseTelti/KobeNot Available1318C->TADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseSantiago de Cuba, MoriokaNot Available1339G->AADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseHarimaNot Available1358T->AADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseFiguera da FozNot Available1366G->CADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseAmiensNot Available1367A>TADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseBangkok NoiNot Available1376G->T, 1502T->GADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseFukayaNot Available1462G->AADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseCampinasNot Available1463G->TADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseBuenos AiresNot Available1465C>TADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseArakawaNot Available1466C->TADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseBrightonNot Available1488_1490delGAAADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseKozukataNot Available159G->CADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseAmsterdamNot Available180_182delTCTADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseNo nameNot Available202G->A, 376A->G, 1264C>GADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseSwanseaNot Available224T->CADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseUrayasuNot Available281_283delAGAADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseVancouverNot Available317C->G544C->T592C->TADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseMt SinaiNot Available376A->G, 1159C->TADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenasePlymouthNot Available488G->AADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseVolendamNot Available514C->TADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseShinshuNot Available527A->GADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseChikugoNot Available535A->TADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseTsukuiNot Available561_563delCTCADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenasePedoplis-CkaroNot Available573C>GADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseSantiagoNot Available593G->CADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseMinnesota, Marion, Gastonia, LeJeuneNot Available637G->TADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseCincinnatiNot Available637G->T, 1037A->TADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseHarilaouNot Available648T->GADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseNorth DallasNot Available683_685delACAADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseAsahikawaNot Available695G->AADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseDurhamNot Available713A->GADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseStonybrookNot Available724_729delGGCACTADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseWayneNot Available769C->GADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseAveiroNot Available806G->AADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseCleveland CorumNot Available820G->AADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseLilleNot Available821A>TADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseBangkokNot Available825G>CADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseSugaoNot Available826C->TADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseLa JollaNot Available832T->CADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseWexhamNot Available833C->TADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenasePiotrkowNot Available851T>CADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseWest VirginiaNot Available910G->TADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseOmiyaNot Available921G->CADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseNaraNot Available953_976delCCACCAAAGGGTACCTGGAC GACCADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseManhattanNot Available962G->AADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseRehevotNot Available964T->CADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseHoniaraNot Available99A->G / 1360C->TADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseTokyo, FukushimaNot Available1246G->AADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseChathamNot Available1003G->AADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseFushanNot Available1004C->AADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenasePartenopeNot Available1052G->TADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseIerapetraNot Available1057C->TADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseAnadiaNot Available1193A->GADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseAbenoNot Available1220A->CADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseSurabayaNot Available1291G->AADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenasePawneeNot Available1316G->CADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseS. AntiocoNot Available1342A->GADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseCassanoNot Available1347G->CADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseHermoupolisNot Available1347G->C / 1360C->TADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseUnion,Maewo, Chinese-2, KaloNot Available1360C->TADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseAndalusNot Available1361G->AADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseCosenzaNot Available1376G->CADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseCanton, Taiwan- Hakka, Gifu-like, Agrigento-likeNot Available1376G->TADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseFloresNot Available1387C->AADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseKaiping, Anant, Dhon, Sapporo-like, WoseraNot Available1388G->AADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseKamogawaNot Available169C->TADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseCostanzoNot Available179T>CADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseAmazoniaNot Available185C->AADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseSongklanagarindNot Available196T->AADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseHechiNot Available202G->A / 871G->AADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseNamouruNot Available208T->CADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseBao LocNot Available352T>CADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseCrispimNot Available375G->T, 379G->T383T->C384C>TADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseAcrokorinthosNot Available376A->G / 463C->GADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseSanta MariaNot Available376A->G / 542A->TADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseAnanindeuaNot Available376A->G / 871G->AADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseVanua LavaNot Available383T->CADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseValladolidNot Available406C->TADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseBelemNot Available409C->TADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseLiuzhouNot Available442G->AADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseShenzenNot Available473G>AADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseTaipei “Chinese- 3”Not Available493A->GADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseToledoNot Available496C>TADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseNaoneNot Available497G->AADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseNankangNot Available517T->CADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseMiaoliNot Available519C->GADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseMediterranean, Dallas, Panama‚ Sassari, Cagliari, BirminghamNot Available563C->TADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseCoimbra ShundeNot Available592C->TADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseNilgiriNot Available593G>AADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseRadlowoNot Available679C->TADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseRoubaixNot Available811G>CADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseHaikouNot Available835A->GADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseChinese-1Not Available835A->TADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseMizushimaNot Available848A>GADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseOsakaNot Available853C->TADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseViangchan, JammuNot Available871G->AADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseSeoulNot Available916G->AADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseLudhianaNot Available929G->AADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseFarroupilhaNot Available977C->AADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseChinese-5Not Available1024C->TADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseRignanoNot Available130G>AADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseOrissaNot Available131C->GADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseG6PDNiceNot Available1380G>CADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseKamiube, KeelungNot Available1387C->TADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseNeapolisNot Available1400C->GADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseAuresNot Available143T->CADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseSplitNot Available1442C->GADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseKambosNot Available148C->TADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenasePalestrinaNot Available170G>AADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseMetapontoNot Available172G->AADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseMusashinoNot Available185C->TADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseAsahiNot Available202G->AADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseA- (202), Ferrara INot Available202G->A / 376A->GADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseMurcia OristanoNot Available209A->GADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseUbe KonanNot Available241C->TADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseLagosantoNot Available242G->AADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseGuangzhouNot Available274C->TADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseHammersmithNot Available323T->AADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseSinnaiNot Available34G->TADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseA- (680)Not Available376A->G / 680G->TADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseA- (968), Betica,Selma, GuantanamoNot Available376A->G / 968T->CADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseSalerno PyrgosNot Available383T>GADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseQuing YanNot Available392G->TADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseLagesNot Available40G->AADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseIleshaNot Available466G->AADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseMahidolNot Available487G->AADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseMalagaNot Available542A->TADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseSibariNot Available634A->GADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseMexico CityNot Available680G->AADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseNanningNot Available703C->TADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseSeattle, Lodi, Modena, Ferrara II, Athens-likeNot Available844G->CADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseBajo MaumereNot Available844G->TADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseMontalbanoNot Available854G->AADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseKalyan-Kerala, Jamnaga, RohiniNot Available949G->AADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseGaoheNot Available95A->GADR InferredIncreased risk of hemolytic anemia.Details
Cytochrome P450 2C9CYP2C9*6Not Available818delAEffect InferredPoor drug metabolizer, lower dose requirementsDetails
Cytochrome P450 2C9CYP2C9*15Not Available485C>AEffect InferredPoor drug metabolizer, lower dose requirementsDetails
Cytochrome P450 2C9CYP2C9*25Not Available353_362delAGAAATGGAAEffect InferredPoor drug metabolizer, lower dose requirementsDetails
Cytochrome P450 2C9CYP2C9*35Not Available374G>T / 430C>TEffect InferredPoor drug metabolizer, lower dose requirementsDetails
Cytochrome P450 2C9CYP2C9*2Not Available430C>TEffect InferredPoor drug metabolizer, lower dose requirementsDetails
Cytochrome P450 2C9CYP2C9*4Not Available1076T>CEffect InferredPoor drug metabolizer, lower dose requirementsDetails
Cytochrome P450 2C9CYP2C9*5Not Available1080C>GEffect InferredPoor drug metabolizer, lower dose requirementsDetails
Cytochrome P450 2C9CYP2C9*8Not Available449G>AEffect InferredPoor drug metabolizer, lower dose requirementsDetails
Cytochrome P450 2C9CYP2C9*11Not Available1003C>TEffect InferredPoor drug metabolizer, lower dose requirementsDetails
Cytochrome P450 2C9CYP2C9*12Not Available1465C>TEffect InferredPoor drug metabolizer, lower dose requirementsDetails
Cytochrome P450 2C9CYP2C9*13Not Available269T>CEffect InferredPoor drug metabolizer, lower dose requirementsDetails
Cytochrome P450 2C9CYP2C9*14Not Available374G>AEffect InferredPoor drug metabolizer, lower dose requirementsDetails
Cytochrome P450 2C9CYP2C9*16Not Available895A>GEffect InferredPoor drug metabolizer, lower dose requirementsDetails
Cytochrome P450 2C9CYP2C9*18Not Available1075A>C / 1190A>C  … show all Effect InferredPoor drug metabolizer, lower dose requirementsDetails
Cytochrome P450 2C9CYP2C9*26Not Available389C>GEffect InferredPoor drug metabolizer, lower dose requirementsDetails
Cytochrome P450 2C9CYP2C9*28Not Available641A>TEffect InferredPoor drug metabolizer, lower dose requirementsDetails
Cytochrome P450 2C9CYP2C9*30Not Available1429G>AEffect InferredPoor drug metabolizer, lower dose requirementsDetails
Cytochrome P450 2C9CYP2C9*33Not Available395G>AEffect InferredPoor drug metabolizer, lower dose requirementsDetails


Drug Interactions
DrugInteractionDrug group
2,4-thiazolidinedione2,4-thiazolidinedione may increase the hypoglycemic activities of Glipizide.Investigational
7,8-Dichloro-1,2,3,4-tetrahydroisoquinoline7,8-Dichloro-1,2,3,4-tetrahydroisoquinoline may increase the hypoglycemic activities of Glipizide.Experimental
AbirateroneThe metabolism of Glipizide can be decreased when combined with Abiraterone.Approved
AcarboseAcarbose may increase the hypoglycemic activities of Glipizide.Approved, Investigational
AcebutololAcebutolol may increase the hypoglycemic activities of Glipizide.Approved
AcenocoumarolGlipizide may increase the anticoagulant activities of Acenocoumarol.Approved
AcetohexamideAcetohexamide may increase the hypoglycemic activities of Glipizide.Investigational, Withdrawn
Acetylsalicylic acidAcetylsalicylic acid may increase the hypoglycemic activities of Glipizide.Approved, Vet Approved
AICA ribonucleotideAICA ribonucleotide may increase the hypoglycemic activities of Glipizide.Experimental, Investigational
AlaproclateAlaproclate may increase the hypoglycemic activities of Glipizide.Experimental
AlbiglutideAlbiglutide may increase the hypoglycemic activities of Glipizide.Approved
AllicinAllicin may increase the hypoglycemic activities of Glipizide.Investigational
AlogliptinAlogliptin may increase the hypoglycemic activities of Glipizide.Approved
AloxiprinAloxiprin may increase the hypoglycemic activities of Glipizide.Experimental
AlprenololAlprenolol may increase the hypoglycemic activities of Glipizide.Approved, Withdrawn
Aluminium clofibrateAluminium clofibrate may increase the hypoglycemic activities of Glipizide.Experimental
Aminosalicylic AcidAminosalicylic Acid may increase the hypoglycemic activities of Glipizide.Approved
AmiodaroneThe metabolism of Glipizide can be decreased when combined with Amiodarone.Approved, Investigational
AmphetamineAmphetamine may increase the hypoglycemic activities of Glipizide.Approved, Illicit
AprepitantThe serum concentration of Glipizide can be increased when it is combined with Aprepitant.Approved, Investigational
AripiprazoleThe therapeutic efficacy of Glipizide can be decreased when used in combination with Aripiprazole.Approved, Investigational
ArotinololArotinolol may increase the hypoglycemic activities of Glipizide.Approved, Investigational
Arsenic trioxideThe therapeutic efficacy of Glipizide can be decreased when used in combination with Arsenic trioxide.Approved, Investigational
ArticaineThe therapeutic efficacy of Glipizide can be decreased when used in combination with Articaine.Approved
AsenapineThe therapeutic efficacy of Glipizide can be decreased when used in combination with Asenapine.Approved
AtazanavirThe metabolism of Glipizide can be decreased when combined with Atazanavir.Approved, Investigational
AtenololAtenolol may increase the hypoglycemic activities of Glipizide.Approved
AtomoxetineThe metabolism of Glipizide can be decreased when combined with Atomoxetine.Approved
AtorvastatinAtorvastatin may increase the hypoglycemic activities of Glipizide.Approved
BalaglitazoneBalaglitazone may increase the hypoglycemic activities of Glipizide.Investigational
BalsalazideBalsalazide may increase the hypoglycemic activities of Glipizide.Approved, Investigational
BefunololBefunolol may increase the hypoglycemic activities of Glipizide.Experimental
Bempedoic acidBempedoic acid may increase the hypoglycemic activities of Glipizide.Investigational
BendroflumethiazideThe therapeutic efficacy of Glipizide can be decreased when used in combination with Bendroflumethiazide.Approved
BenmoxinBenmoxin may increase the hypoglycemic activities of Glipizide.Withdrawn
BetamethasoneThe therapeutic efficacy of Glipizide can be decreased when used in combination with Betamethasone.Approved, Vet Approved
BetaxololBetaxolol may increase the hypoglycemic activities of Glipizide.Approved
BevantololBevantolol may increase the hypoglycemic activities of Glipizide.Approved
BezafibrateBezafibrate may increase the hypoglycemic activities of Glipizide.Approved
BisoprololBisoprolol may increase the hypoglycemic activities of Glipizide.Approved
BoceprevirThe metabolism of Glipizide can be decreased when combined with Boceprevir.Approved, Withdrawn
BopindololBopindolol may increase the hypoglycemic activities of Glipizide.Approved
BortezomibThe metabolism of Glipizide can be decreased when combined with Bortezomib.Approved, Investigational
BosentanThe serum concentration of Glipizide can be decreased when it is combined with Bosentan.Approved, Investigational
BrexpiprazoleThe therapeutic efficacy of Glipizide can be decreased when used in combination with Brexpiprazole.Approved
BrofaromineBrofaromine may increase the hypoglycemic activities of Glipizide.Experimental
BucindololBucindolol may increase the hypoglycemic activities of Glipizide.Investigational
BuforminBuformin may increase the hypoglycemic activities of Glipizide.Investigational, Withdrawn
BufuralolBufuralol may increase the hypoglycemic activities of Glipizide.Experimental, Investigational
BumetanideThe therapeutic efficacy of Glipizide can be decreased when used in combination with Bumetanide.Approved
BupranololBupranolol may increase the hypoglycemic activities of Glipizide.Approved
BuserelinThe therapeutic efficacy of Glipizide can be decreased when used in combination with Buserelin.Approved
CanagliflozinCanagliflozin may increase the hypoglycemic activities of Glipizide.Approved
CapecitabineThe metabolism of Glipizide can be decreased when combined with Capecitabine.Approved, Investigational
CarbamazepineThe metabolism of Glipizide can be increased when combined with Carbamazepine.Approved, Investigational
Carbaspirin calciumCarbaspirin calcium may increase the hypoglycemic activities of Glipizide.Experimental, Investigational
CarbocisteineThe risk or severity of adverse effects can be increased when Glipizide is combined with Carbocisteine.Approved, Investigational
CarbutamideCarbutamide may increase the hypoglycemic activities of Glipizide.Experimental
CaroxazoneCaroxazone may increase the hypoglycemic activities of Glipizide.Withdrawn
CarteololCarteolol may increase the hypoglycemic activities of Glipizide.Approved
CarvedilolCarvedilol may increase the hypoglycemic activities of Glipizide.Approved, Investigational
CastanospermineCastanospermine may increase the hypoglycemic activities of Glipizide.Experimental
CeliprololCeliprolol may increase the hypoglycemic activities of Glipizide.Approved, Investigational
CeritinibThe serum concentration of Glipizide can be increased when it is combined with Ceritinib.Approved
ChloramphenicolThe metabolism of Glipizide can be decreased when combined with Chloramphenicol.Approved, Vet Approved
ChlorothiazideThe therapeutic efficacy of Glipizide can be decreased when used in combination with Chlorothiazide.Approved, Vet Approved
ChlorpropamideChlorpropamide may increase the hypoglycemic activities of Glipizide.Approved
ChlorthalidoneThe therapeutic efficacy of Glipizide can be decreased when used in combination with Chlorthalidone.Approved
CholecalciferolThe metabolism of Glipizide can be decreased when combined with Cholecalciferol.Approved, Nutraceutical
CiglitazoneCiglitazone may increase the hypoglycemic activities of Glipizide.Experimental
CimetidineThe serum concentration of Glipizide can be increased when it is combined with Cimetidine.Approved
CinoxacinCinoxacin may increase the hypoglycemic activities of Glipizide.Approved, Investigational, Withdrawn
CiprofibrateCiprofibrate may increase the hypoglycemic activities of Glipizide.Approved, Investigational
CitalopramCitalopram may increase the hypoglycemic activities of Glipizide.Approved
ClarithromycinThe serum concentration of Glipizide can be increased when it is combined with Clarithromycin.Approved
ClemastineThe metabolism of Glipizide can be decreased when combined with Clemastine.Approved
ClofibrateClofibrate may increase the hypoglycemic activities of Glipizide.Approved, Investigational
ClofibrideClofibride may increase the hypoglycemic activities of Glipizide.Experimental
CloranololCloranolol may increase the hypoglycemic activities of Glipizide.Experimental
ClorindioneGlipizide may increase the anticoagulant activities of Clorindione.Experimental
ClotrimazoleThe metabolism of Glipizide can be decreased when combined with Clotrimazole.Approved, Vet Approved
ClozapineThe therapeutic efficacy of Glipizide can be decreased when used in combination with Clozapine.Approved
CobicistatThe metabolism of Glipizide can be decreased when combined with Cobicistat.Approved
ColesevelamThe serum concentration of Glipizide can be decreased when it is combined with Colesevelam.Approved
ConivaptanThe serum concentration of Glipizide can be increased when it is combined with Conivaptan.Approved, Investigational
CorticotropinThe therapeutic efficacy of Glipizide can be decreased when used in combination with Corticotropin.Approved, Vet Approved
Cortisone acetateThe therapeutic efficacy of Glipizide can be decreased when used in combination with Cortisone acetate.Approved
CrisaboroleThe metabolism of Glipizide can be decreased when combined with Crisaborole.Approved
CrizotinibThe metabolism of Glipizide can be decreased when combined with Crizotinib.Approved
CyclopenthiazideThe therapeutic efficacy of Glipizide can be decreased when used in combination with Cyclopenthiazide.Experimental
CyclosporineThe metabolism of Glipizide can be decreased when combined with Cyclosporine.Approved, Investigational, Vet Approved
Cyproterone acetateThe therapeutic efficacy of Glipizide can be decreased when used in combination with Cyproterone acetate.Approved, Investigational
DabrafenibThe serum concentration of Glipizide can be decreased when it is combined with Dabrafenib.Approved
DanazolThe therapeutic efficacy of Glipizide can be decreased when used in combination with Danazol.Approved
DapoxetineDapoxetine may increase the hypoglycemic activities of Glipizide.Investigational
DarunavirThe metabolism of Glipizide can be decreased when combined with Darunavir.Approved
DasatinibThe serum concentration of Glipizide can be increased when it is combined with Dasatinib.Approved, Investigational
DeferasiroxThe serum concentration of Glipizide can be decreased when it is combined with Deferasirox.Approved, Investigational
DelavirdineThe metabolism of Glipizide can be decreased when combined with Delavirdine.Approved
DeoxyspergualinDeoxyspergualin may increase the hypoglycemic activities of Glipizide.Investigational
dersalazinedersalazine may increase the hypoglycemic activities of Glipizide.Investigational
DesogestrelThe therapeutic efficacy of Glipizide can be decreased when used in combination with Desogestrel.Approved
DesvenlafaxineDesvenlafaxine may increase the hypoglycemic activities of Glipizide.Approved
DexamethasoneThe therapeutic efficacy of Glipizide can be decreased when used in combination with Dexamethasone.Approved, Investigational, Vet Approved
DiazoxideThe therapeutic efficacy of Glipizide can be decreased when used in combination with Diazoxide.Approved
DicoumarolGlipizide may increase the anticoagulant activities of Dicoumarol.Approved
DienogestThe therapeutic efficacy of Glipizide can be decreased when used in combination with Dienogest.Approved
DiflunisalDiflunisal may increase the hypoglycemic activities of Glipizide.Approved
DihydroergotamineThe metabolism of Glipizide can be decreased when combined with Dihydroergotamine.Approved
DihydrotestosteroneDihydrotestosterone may increase the hypoglycemic activities of Glipizide.Illicit
DiltiazemThe metabolism of Glipizide can be decreased when combined with Diltiazem.Approved
DiphenadioneGlipizide may increase the anticoagulant activities of Diphenadione.Experimental
DisopyramideDisopyramide may increase the hypoglycemic activities of Glipizide.Approved
DosulepinThe metabolism of Glipizide can be decreased when combined with Dosulepin.Approved
DoxycyclineThe metabolism of Glipizide can be decreased when combined with Doxycycline.Approved, Investigational, Vet Approved
DronedaroneThe metabolism of Glipizide can be decreased when combined with Dronedarone.Approved
DrospirenoneThe therapeutic efficacy of Glipizide can be decreased when used in combination with Drospirenone.Approved
DulaglutideDulaglutide may increase the hypoglycemic activities of Glipizide.Approved
DuloxetineDuloxetine may increase the hypoglycemic activities of Glipizide.Approved
EfavirenzThe metabolism of Glipizide can be decreased when combined with Efavirenz.Approved, Investigational
EmpagliflozinEmpagliflozin may increase the hypoglycemic activities of Glipizide.Approved
EnoxacinEnoxacin may increase the hypoglycemic activities of Glipizide.Approved, Investigational
EnzalutamideThe serum concentration of Glipizide can be decreased when it is combined with Enzalutamide.Approved
EpanololEpanolol may increase the hypoglycemic activities of Glipizide.Experimental
EpinephrineThe therapeutic efficacy of Glipizide can be decreased when used in combination with Epinephrine.Approved, Vet Approved
ErythromycinThe metabolism of Glipizide can be decreased when combined with Erythromycin.Approved, Vet Approved
EscitalopramEscitalopram may increase the hypoglycemic activities of Glipizide.Approved, Investigational
EsmololEsmolol may increase the hypoglycemic activities of Glipizide.Approved
EstradiolThe therapeutic efficacy of Glipizide can be decreased when used in combination with Estradiol.Approved, Investigational, Vet Approved
Estrone sulfateThe therapeutic efficacy of Glipizide can be decreased when used in combination with Estrone sulfate.Approved
Etacrynic acidThe therapeutic efficacy of Glipizide can be decreased when used in combination with Etacrynic acid.Approved
EthanolThe risk or severity of adverse effects can be increased when Glipizide is combined with Ethanol.Approved
Ethinyl EstradiolThe therapeutic efficacy of Glipizide can be decreased when used in combination with Ethinyl Estradiol.Approved
Ethyl biscoumacetateGlipizide may increase the anticoagulant activities of Ethyl biscoumacetate.Withdrawn
Ethynodiol diacetateThe therapeutic efficacy of Glipizide can be decreased when used in combination with Ethynodiol diacetate.Approved
EtofibrateEtofibrate may increase the hypoglycemic activities of Glipizide.Approved
EtonogestrelThe therapeutic efficacy of Glipizide can be decreased when used in combination with Etonogestrel.Approved, Investigational
EtoperidoneEtoperidone may increase the hypoglycemic activities of Glipizide.Withdrawn
EtravirineThe metabolism of Glipizide can be decreased when combined with Etravirine.Approved
EverolimusThe therapeutic efficacy of Glipizide can be decreased when used in combination with Everolimus.Approved
ExenatideExenatide may increase the hypoglycemic activities of Glipizide.Approved, Investigational
FenofibrateFenofibrate may increase the hypoglycemic activities of Glipizide.Approved
Fenofibric acidFenofibric acid may increase the hypoglycemic activities of Glipizide.Approved
FleroxacinFleroxacin may increase the hypoglycemic activities of Glipizide.Approved
FloxuridineThe metabolism of Glipizide can be decreased when combined with Floxuridine.Approved
FluconazoleThe serum concentration of Glipizide can be increased when it is combined with Fluconazole.Approved
FludrocortisoneThe therapeutic efficacy of Glipizide can be decreased when used in combination with Fludrocortisone.Approved
FluindioneGlipizide may increase the anticoagulant activities of Fluindione.Investigational
FlumequineFlumequine may increase the hypoglycemic activities of Glipizide.Withdrawn
FluorouracilThe metabolism of Glipizide can be decreased when combined with Fluorouracil.Approved
FluoxetineFluoxetine may increase the hypoglycemic activities of Glipizide.Approved, Vet Approved
FluoxymesteroneFluoxymesterone may increase the hypoglycemic activities of Glipizide.Approved, Illicit
FluvastatinThe metabolism of Glipizide can be decreased when combined with Fluvastatin.Approved
FluvoxamineThe metabolism of Glipizide can be decreased when combined with Fluvoxamine.Approved, Investigational
FosamprenavirThe metabolism of Glipizide can be decreased when combined with Fosamprenavir.Approved
FosaprepitantThe serum concentration of Glipizide can be increased when it is combined with Fosaprepitant.Approved
FosphenytoinThe metabolism of Glipizide can be increased when combined with Fosphenytoin.Approved
FurazolidoneFurazolidone may increase the hypoglycemic activities of Glipizide.Approved, Investigational, Vet Approved
FurosemideThe therapeutic efficacy of Glipizide can be decreased when used in combination with Furosemide.Approved, Vet Approved
Fusidic AcidThe serum concentration of Glipizide can be increased when it is combined with Fusidic Acid.Approved
GarenoxacinGarenoxacin may increase the hypoglycemic activities of Glipizide.Investigational
GatifloxacinGatifloxacin may increase the hypoglycemic activities of Glipizide.Approved, Investigational
GemfibrozilThe metabolism of Glipizide can be decreased when combined with Gemfibrozil.Approved
GemifloxacinGemifloxacin may increase the hypoglycemic activities of Glipizide.Approved, Investigational
GlibornurideGlibornuride may increase the hypoglycemic activities of Glipizide.Investigational, Withdrawn
GliclazideGlipizide may increase the hypoglycemic activities of Gliclazide.Approved
GlimepirideGlimepiride may increase the hypoglycemic activities of Glipizide.Approved
GliquidoneGliquidone may increase the hypoglycemic activities of Glipizide.Approved, Investigational
GLPG-0492GLPG-0492 may increase the hypoglycemic activities of Glipizide.Investigational
GlyburideGlyburide may increase the hypoglycemic activities of Glipizide.Approved
GoserelinThe therapeutic efficacy of Glipizide can be decreased when used in combination with Goserelin.Approved
GrepafloxacinGrepafloxacin may increase the hypoglycemic activities of Glipizide.Investigational, Withdrawn
GuacetisalGuacetisal may increase the hypoglycemic activities of Glipizide.Experimental
GusperimusGusperimus may increase the hypoglycemic activities of Glipizide.Investigational
HarmalineHarmaline may increase the hypoglycemic activities of Glipizide.Experimental
Hemoglobin crosfumarilHemoglobin crosfumaril may increase the hypoglycemic activities of Glipizide.Experimental
HistrelinThe therapeutic efficacy of Glipizide can be decreased when used in combination with Histrelin.Approved
HydracarbazineHydracarbazine may increase the hypoglycemic activities of Glipizide.Experimental
HydrochlorothiazideThe therapeutic efficacy of Glipizide can be decreased when used in combination with Hydrochlorothiazide.Approved, Vet Approved
HydrocortisoneThe therapeutic efficacy of Glipizide can be decreased when used in combination with Hydrocortisone.Approved, Vet Approved
HydroflumethiazideThe therapeutic efficacy of Glipizide can be decreased when used in combination with Hydroflumethiazide.Approved, Investigational
Hydroxyprogesterone caproateThe therapeutic efficacy of Glipizide can be decreased when used in combination with Hydroxyprogesterone caproate.Approved
IdelalisibThe serum concentration of Glipizide can be increased when it is combined with Idelalisib.Approved
IloperidoneThe therapeutic efficacy of Glipizide can be decreased when used in combination with Iloperidone.Approved
ImatinibThe metabolism of Glipizide can be decreased when combined with Imatinib.Approved
IndalpineIndalpine may increase the hypoglycemic activities of Glipizide.Investigational, Withdrawn
IndapamideThe therapeutic efficacy of Glipizide can be decreased when used in combination with Indapamide.Approved
IndenololIndenolol may increase the hypoglycemic activities of Glipizide.Withdrawn
IndinavirThe metabolism of Glipizide can be decreased when combined with Indinavir.Approved
Insulin AspartGlipizide may increase the hypoglycemic activities of Insulin Aspart.Approved
Insulin DetemirGlipizide may increase the hypoglycemic activities of Insulin Detemir.Approved
Insulin GlargineInsulin Glargine may increase the hypoglycemic activities of Glipizide.Approved
Insulin GlulisineGlipizide may increase the hypoglycemic activities of Insulin Glulisine.Approved
Insulin HumanInsulin Human may increase the hypoglycemic activities of Glipizide.Approved, Investigational
Insulin LisproInsulin Lispro may increase the hypoglycemic activities of Glipizide.Approved
Insulin PorkInsulin Pork may increase the hypoglycemic activities of Glipizide.Approved
IproclozideIproclozide may increase the hypoglycemic activities of Glipizide.Withdrawn
IproniazidIproniazid may increase the hypoglycemic activities of Glipizide.Withdrawn
IrbesartanThe metabolism of Glipizide can be decreased when combined with Irbesartan.Approved, Investigational
IsavuconazoniumThe metabolism of Glipizide can be decreased when combined with Isavuconazonium.Approved, Investigational
IsocarboxazidIsocarboxazid may increase the hypoglycemic activities of Glipizide.Approved
IsradipineThe metabolism of Glipizide can be decreased when combined with Isradipine.Approved
ItraconazoleThe metabolism of Glipizide can be decreased when combined with Itraconazole.Approved, Investigational
IvacaftorThe serum concentration of Glipizide can be increased when it is combined with Ivacaftor.Approved
KetoconazoleThe metabolism of Glipizide can be decreased when combined with Ketoconazole.Approved, Investigational
LabetalolLabetalol may increase the hypoglycemic activities of Glipizide.Approved
LandiololLandiolol may increase the hypoglycemic activities of Glipizide.Investigational
LanreotideGlipizide may increase the hypoglycemic activities of Lanreotide.Approved
LeflunomideThe metabolism of Glipizide can be decreased when combined with Leflunomide.Approved, Investigational
LeuprolideThe therapeutic efficacy of Glipizide can be decreased when used in combination with Leuprolide.Approved, Investigational
LevobunololLevobunolol may increase the hypoglycemic activities of Glipizide.Approved
LevofloxacinLevofloxacin may increase the hypoglycemic activities of Glipizide.Approved, Investigational
LevomilnacipranLevomilnacipran may increase the hypoglycemic activities of Glipizide.Approved
LevonorgestrelThe therapeutic efficacy of Glipizide can be decreased when used in combination with Levonorgestrel.Approved, Investigational
LinagliptinLinagliptin may increase the hypoglycemic activities of Glipizide.Approved
Lipoic AcidLipoic Acid may increase the hypoglycemic activities of Glipizide.Approved, Nutraceutical
LiraglutideLiraglutide may increase the hypoglycemic activities of Glipizide.Approved
LobeglitazoneThe metabolism of Glipizide can be decreased when combined with Lobeglitazone.Approved, Investigational
LopinavirThe metabolism of Glipizide can be decreased when combined with Lopinavir.Approved
LosartanThe metabolism of Glipizide can be decreased when combined with Losartan.Approved
LovastatinThe metabolism of Glipizide can be decreased when combined with Lovastatin.Approved, Investigational
LuliconazoleThe serum concentration of Glipizide can be increased when it is combined with Luliconazole.Approved
LumacaftorThe serum concentration of Glipizide can be decreased when it is combined with Lumacaftor.Approved
LurasidoneThe therapeutic efficacy of Glipizide can be decreased when used in combination with Lurasidone.Approved
ManidipineThe metabolism of Glipizide can be decreased when combined with Manidipine.Approved, Investigational
MebanazineMebanazine may increase the hypoglycemic activities of Glipizide.Withdrawn
MecaserminGlipizide may increase the hypoglycemic activities of Mecasermin.Approved, Investigational
Medroxyprogesterone acetateThe therapeutic efficacy of Glipizide can be decreased when used in combination with Medroxyprogesterone acetate.Approved, Investigational
Megestrol acetateThe therapeutic efficacy of Glipizide can be decreased when used in combination with Megestrol acetate.Approved, Vet Approved
MepindololMepindolol may increase the hypoglycemic activities of Glipizide.Experimental
MesalazineMesalazine may increase the hypoglycemic activities of Glipizide.Approved
MesteroloneMesterolone may increase the hypoglycemic activities of Glipizide.Experimental
MestranolThe therapeutic efficacy of Glipizide can be decreased when used in combination with Mestranol.Approved
MetforminMetformin may increase the hypoglycemic activities of Glipizide.Approved
MethotrimeprazineThe therapeutic efficacy of Glipizide can be decreased when used in combination with Methotrimeprazine.Approved
MethyclothiazideThe therapeutic efficacy of Glipizide can be decreased when used in combination with Methyclothiazide.Approved
Methyl salicylateMethyl salicylate may increase the hypoglycemic activities of Glipizide.Approved, Vet Approved
Methylene blueMethylene blue may increase the hypoglycemic activities of Glipizide.Approved, Investigational
MethylprednisoloneThe therapeutic efficacy of Glipizide can be decreased when used in combination with Methylprednisolone.Approved, Vet Approved
MethyltestosteroneMethyltestosterone may increase the hypoglycemic activities of Glipizide.Approved
MetipranololMetipranolol may increase the hypoglycemic activities of Glipizide.Approved
MetolazoneThe therapeutic efficacy of Glipizide can be decreased when used in combination with Metolazone.Approved
MetoprololMetoprolol may increase the hypoglycemic activities of Glipizide.Approved, Investigational
MetreleptinMetreleptin may increase the hypoglycemic activities of Glipizide.Approved
MiconazoleMiconazole may increase the hypoglycemic activities of Glipizide.Approved, Investigational, Vet Approved
MidostaurinThe metabolism of Glipizide can be decreased when combined with Midostaurin.Approved
MifepristoneThe serum concentration of Glipizide can be increased when it is combined with Mifepristone.Approved, Investigational
MiglitolMiglitol may increase the hypoglycemic activities of Glipizide.Approved
MiglustatMiglustat may increase the hypoglycemic activities of Glipizide.Approved
MilnacipranMilnacipran may increase the hypoglycemic activities of Glipizide.Approved
MinaprineMinaprine may increase the hypoglycemic activities of Glipizide.Approved
MitiglinideMitiglinide may increase the hypoglycemic activities of Glipizide.Approved, Investigational
MitotaneThe serum concentration of Glipizide can be decreased when it is combined with Mitotane.Approved
MoclobemideMoclobemide may increase the hypoglycemic activities of Glipizide.Approved
NadololNadolol may increase the hypoglycemic activities of Glipizide.Approved
Nalidixic AcidNalidixic Acid may increase the hypoglycemic activities of Glipizide.Approved, Investigational
NandroloneNandrolone may increase the hypoglycemic activities of Glipizide.Experimental, Investigational
Nandrolone decanoateNandrolone decanoate may increase the hypoglycemic activities of Glipizide.Approved, Illicit
NateglinideNateglinide may increase the hypoglycemic activities of Glipizide.Approved, Investigational
NebivololNebivolol may increase the hypoglycemic activities of Glipizide.Approved, Investigational
NefazodoneThe metabolism of Glipizide can be decreased when combined with Nefazodone.Approved, Withdrawn
NelfinavirThe metabolism of Glipizide can be decreased when combined with Nelfinavir.Approved
NemonoxacinNemonoxacin may increase the hypoglycemic activities of Glipizide.Investigational
NetupitantThe serum concentration of Glipizide can be increased when it is combined with Netupitant.Approved
NevirapineThe metabolism of Glipizide can be increased when combined with Nevirapine.Approved
NiacinThe therapeutic efficacy of Glipizide can be decreased when used in combination with Niacin.Approved, Investigational, Nutraceutical
NialamideNialamide may increase the hypoglycemic activities of Glipizide.Withdrawn
NicardipineThe metabolism of Glipizide can be decreased when combined with Nicardipine.Approved
NilotinibThe metabolism of Glipizide can be decreased when combined with Nilotinib.Approved, Investigational
NitroaspirinNitroaspirin may increase the hypoglycemic activities of Glipizide.Investigational
NorethisteroneThe therapeutic efficacy of Glipizide can be decreased when used in combination with Norethisterone.Approved
NorfloxacinNorfloxacin may increase the hypoglycemic activities of Glipizide.Approved
NorgestimateThe therapeutic efficacy of Glipizide can be decreased when used in combination with Norgestimate.Approved
OctamoxinOctamoxin may increase the hypoglycemic activities of Glipizide.Withdrawn
OctreotideOctreotide may increase the hypoglycemic activities of Glipizide.Approved, Investigational
OlanzapineThe therapeutic efficacy of Glipizide can be decreased when used in combination with Olanzapine.Approved, Investigational
OlaparibThe metabolism of Glipizide can be decreased when combined with Olaparib.Approved
OlsalazineOlsalazine may increase the hypoglycemic activities of Glipizide.Approved
OmeprazoleThe metabolism of Glipizide can be decreased when combined with Omeprazole.Approved, Investigational, Vet Approved
OsimertinibThe serum concentration of Glipizide can be increased when it is combined with Osimertinib.Approved
OxandroloneOxandrolone may increase the hypoglycemic activities of Glipizide.Approved, Investigational
Oxolinic acidOxolinic acid may increase the hypoglycemic activities of Glipizide.Experimental
OxprenololOxprenolol may increase the hypoglycemic activities of Glipizide.Approved
OxymetholoneOxymetholone may increase the hypoglycemic activities of Glipizide.Approved, Illicit
PalbociclibThe serum concentration of Glipizide can be increased when it is combined with Palbociclib.Approved
PaliperidoneThe therapeutic efficacy of Glipizide can be decreased when used in combination with Paliperidone.Approved
PargylinePargyline may increase the hypoglycemic activities of Glipizide.Approved
ParoxetineParoxetine may increase the hypoglycemic activities of Glipizide.Approved, Investigational
PasireotideGlipizide may increase the hypoglycemic activities of Pasireotide.Approved
PazufloxacinPazufloxacin may increase the hypoglycemic activities of Glipizide.Investigational
PefloxacinPefloxacin may increase the hypoglycemic activities of Glipizide.Approved
PegvisomantPegvisomant may increase the hypoglycemic activities of Glipizide.Approved
PenbutololPenbutolol may increase the hypoglycemic activities of Glipizide.Approved, Investigational
PentamidinePentamidine may increase the hypoglycemic activities of Glipizide.Approved
PentobarbitalThe metabolism of Glipizide can be increased when combined with Pentobarbital.Approved, Vet Approved
PhenelzinePhenelzine may increase the hypoglycemic activities of Glipizide.Approved
PhenforminPhenformin may increase the hypoglycemic activities of Glipizide.Approved, Investigational, Withdrawn
PhenindioneGlipizide may increase the anticoagulant activities of Phenindione.Approved, Investigational
PheniprazinePheniprazine may increase the hypoglycemic activities of Glipizide.Withdrawn
PhenobarbitalThe metabolism of Glipizide can be increased when combined with Phenobarbital.Approved
PhenoxypropazinePhenoxypropazine may increase the hypoglycemic activities of Glipizide.Withdrawn
PhenprocoumonGlipizide may increase the anticoagulant activities of Phenprocoumon.Approved, Investigational
PhenytoinThe metabolism of Glipizide can be increased when combined with Phenytoin.Approved, Vet Approved
PindololPindolol may increase the hypoglycemic activities of Glipizide.Approved
PioglitazonePioglitazone may increase the hypoglycemic activities of Glipizide.Approved, Investigational
Pipemidic acidPipemidic acid may increase the hypoglycemic activities of Glipizide.Experimental
PiperazineThe therapeutic efficacy of Glipizide can be decreased when used in combination with Piperazine.Approved, Vet Approved
PipotiazineThe therapeutic efficacy of Glipizide can be decreased when used in combination with Pipotiazine.Approved, Investigational
PirlindolePirlindole may increase the hypoglycemic activities of Glipizide.Approved
Piromidic acidPiromidic acid may increase the hypoglycemic activities of Glipizide.Experimental
PivhydrazinePivhydrazine may increase the hypoglycemic activities of Glipizide.Withdrawn
Platelet Activating FactorPlatelet Activating Factor may increase the hypoglycemic activities of Glipizide.Experimental
PolythiazideThe therapeutic efficacy of Glipizide can be decreased when used in combination with Polythiazide.Approved
PosaconazolePosaconazole may increase the hypoglycemic activities of Glipizide.Approved, Investigational, Vet Approved
PractololPractolol may increase the hypoglycemic activities of Glipizide.Approved
PramlintidePramlintide may increase the hypoglycemic activities of Glipizide.Approved, Investigational
PrednisoloneThe therapeutic efficacy of Glipizide can be decreased when used in combination with Prednisolone.Approved, Vet Approved
PrednisoneThe therapeutic efficacy of Glipizide can be decreased when used in combination with Prednisone.Approved, Vet Approved
PrimidoneThe metabolism of Glipizide can be increased when combined with Primidone.Approved, Vet Approved
ProbenecidThe protein binding of Glipizide can be decreased when combined with Probenecid.Approved
ProcarbazineProcarbazine may increase the hypoglycemic activities of Glipizide.Approved
ProgesteroneThe therapeutic efficacy of Glipizide can be decreased when used in combination with Progesterone.Approved, Vet Approved
PropranololPropranolol may increase the hypoglycemic activities of Glipizide.Approved, Investigational
PrulifloxacinPrulifloxacin may increase the hypoglycemic activities of Glipizide.Investigational
PyrimethamineThe metabolism of Glipizide can be decreased when combined with Pyrimethamine.Approved, Vet Approved
QuetiapineThe therapeutic efficacy of Glipizide can be decreased when used in combination with Quetiapine.Approved
QuinethazoneThe therapeutic efficacy of Glipizide can be decreased when used in combination with Quinethazone.Approved
QuinineQuinine may increase the hypoglycemic activities of Glipizide.Approved
RanitidineThe serum concentration of Glipizide can be increased when it is combined with Ranitidine.Approved
RanolazineThe metabolism of Glipizide can be decreased when combined with Ranolazine.Approved, Investigational
RasagilineRasagiline may increase the hypoglycemic activities of Glipizide.Approved
RepaglinideRepaglinide may increase the hypoglycemic activities of Glipizide.Approved, Investigational
RifabutinThe metabolism of Glipizide can be increased when combined with Rifabutin.Approved
RifampicinThe serum concentration of Glipizide can be decreased when it is combined with Rifampicin.Approved
RifapentineThe metabolism of Glipizide can be increased when combined with Rifapentine.Approved
RisperidoneThe therapeutic efficacy of Glipizide can be decreased when used in combination with Risperidone.Approved, Investigational
RitonavirThe therapeutic efficacy of Glipizide can be decreased when used in combination with Ritonavir.Approved, Investigational
RonifibrateRonifibrate may increase the hypoglycemic activities of Glipizide.Experimental
RosiglitazoneRosiglitazone may increase the hypoglycemic activities of Glipizide.Approved, Investigational
RosoxacinRosoxacin may increase the hypoglycemic activities of Glipizide.Approved, Investigational
RufloxacinRufloxacin may increase the hypoglycemic activities of Glipizide.Experimental
SafrazineSafrazine may increase the hypoglycemic activities of Glipizide.Withdrawn
Salicylic acidSalicylic acid may increase the hypoglycemic activities of Glipizide.Approved, Vet Approved
SaquinavirThe metabolism of Glipizide can be decreased when combined with Saquinavir.Approved, Investigational
SaxagliptinSaxagliptin may increase the hypoglycemic activities of Glipizide.Approved
SecobarbitalThe metabolism of Glipizide can be increased when combined with Secobarbital.Approved, Vet Approved
SelegilineSelegiline may increase the hypoglycemic activities of Glipizide.Approved, Investigational, Vet Approved
SertralineSertraline may increase the hypoglycemic activities of Glipizide.Approved
SildenafilThe metabolism of Glipizide can be decreased when combined with Sildenafil.Approved, Investigational
SiltuximabThe serum concentration of Glipizide can be decreased when it is combined with Siltuximab.Approved
SimeprevirThe serum concentration of Glipizide can be increased when it is combined with Simeprevir.Approved
SimfibrateSimfibrate may increase the hypoglycemic activities of Glipizide.Experimental
SirolimusThe therapeutic efficacy of Glipizide can be decreased when used in combination with Sirolimus.Approved, Investigational
SitafloxacinSitafloxacin may increase the hypoglycemic activities of Glipizide.Experimental, Investigational
SitagliptinSitagliptin may increase the hypoglycemic activities of Glipizide.Approved, Investigational
SorafenibThe metabolism of Glipizide can be decreased when combined with Sorafenib.Approved, Investigational
SotagliflozinSotagliflozin may increase the hypoglycemic activities of Glipizide.Investigational
SotalolSotalol may increase the hypoglycemic activities of Glipizide.Approved
SparfloxacinSparfloxacin may increase the hypoglycemic activities of Glipizide.Approved, Investigational
St. John's WortThe serum concentration of Glipizide can be decreased when it is combined with St. John's Wort.Investigational, Nutraceutical
StanozololStanozolol may increase the hypoglycemic activities of Glipizide.Approved, Vet Approved
StiripentolThe serum concentration of Glipizide can be increased when it is combined with Stiripentol.Approved
SulfadiazineThe metabolism of Glipizide can be decreased when combined with Sulfadiazine.Approved, Vet Approved
SulfamethoxazoleSulfamethoxazole may increase the hypoglycemic activities of Glipizide.Approved
SulfisoxazoleThe metabolism of Glipizide can be decreased when combined with Sulfisoxazole.Approved, Vet Approved
SulodexideSulodexide may increase the hypoglycemic activities of Glipizide.Approved, Investigational
SunitinibGlipizide may increase the hypoglycemic activities of Sunitinib.Approved, Investigational
TacrolimusThe therapeutic efficacy of Glipizide can be decreased when used in combination with Tacrolimus.Approved, Investigational
TalinololTalinolol may increase the hypoglycemic activities of Glipizide.Investigational
TelaprevirThe metabolism of Glipizide can be decreased when combined with Telaprevir.Approved, Withdrawn
TelithromycinThe metabolism of Glipizide can be decreased when combined with Telithromycin.Approved
TemafloxacinTemafloxacin may increase the hypoglycemic activities of Glipizide.Withdrawn
TemsirolimusThe therapeutic efficacy of Glipizide can be decreased when used in combination with Temsirolimus.Approved
TertatololTertatolol may increase the hypoglycemic activities of Glipizide.Experimental
TestosteroneTestosterone may increase the hypoglycemic activities of Glipizide.Approved, Investigational
Testosterone PropionateTestosterone Propionate may increase the hypoglycemic activities of Glipizide.Approved, Vet Approved
TicagrelorThe metabolism of Glipizide can be decreased when combined with Ticagrelor.Approved
TiclopidineThe metabolism of Glipizide can be decreased when combined with Ticlopidine.Approved
TimololTimolol may increase the hypoglycemic activities of Glipizide.Approved
TioclomarolGlipizide may increase the anticoagulant activities of Tioclomarol.Experimental
TipranavirThe therapeutic efficacy of Glipizide can be decreased when used in combination with Tipranavir.Approved, Investigational
TocilizumabThe serum concentration of Glipizide can be decreased when it is combined with Tocilizumab.Approved
TolazamideTolazamide may increase the hypoglycemic activities of Glipizide.Approved
TolbutamideThe metabolism of Glipizide can be decreased when combined with Tolbutamide.Approved
ToloxatoneToloxatone may increase the hypoglycemic activities of Glipizide.Approved
TopiroxostatThe metabolism of Glipizide can be decreased when combined with Topiroxostat.Approved, Investigational
TorasemideThe therapeutic efficacy of Glipizide can be decreased when used in combination with Torasemide.Approved
Trans-2-PhenylcyclopropylamineTrans-2-Phenylcyclopropylamine may increase the hypoglycemic activities of Glipizide.Experimental
TranylcypromineTranylcypromine may increase the hypoglycemic activities of Glipizide.Approved
TriamcinoloneThe therapeutic efficacy of Glipizide can be decreased when used in combination with Triamcinolone.Approved, Vet Approved
TrichlormethiazideThe therapeutic efficacy of Glipizide can be decreased when used in combination with Trichlormethiazide.Approved, Vet Approved
TrimethoprimThe metabolism of Glipizide can be decreased when combined with Trimethoprim.Approved, Vet Approved
TriptorelinThe therapeutic efficacy of Glipizide can be decreased when used in combination with Triptorelin.Approved, Vet Approved
TroglitazoneTroglitazone may increase the hypoglycemic activities of Glipizide.Investigational, Withdrawn
Trolamine salicylateTrolamine salicylate may increase the hypoglycemic activities of Glipizide.Approved
TrovafloxacinTrovafloxacin may increase the hypoglycemic activities of Glipizide.Approved, Investigational, Withdrawn
Valproic AcidThe metabolism of Glipizide can be decreased when combined with Valproic Acid.Approved, Investigational
ValsartanThe metabolism of Glipizide can be decreased when combined with Valsartan.Approved, Investigational
VenlafaxineThe metabolism of Glipizide can be decreased when combined with Venlafaxine.Approved
VerapamilThe metabolism of Glipizide can be decreased when combined with Verapamil.Approved
VildagliptinVildagliptin may increase the hypoglycemic activities of Glipizide.Approved, Investigational
VogliboseVoglibose may increase the hypoglycemic activities of Glipizide.Approved, Investigational
VoriconazoleThe serum concentration of Glipizide can be increased when it is combined with Voriconazole.Approved, Investigational
VorinostatThe therapeutic efficacy of Glipizide can be decreased when used in combination with Vorinostat.Approved, Investigational
WarfarinGlipizide may increase the anticoagulant activities of Warfarin.Approved
ZafirlukastThe metabolism of Glipizide can be decreased when combined with Zafirlukast.Approved, Investigational
ZimelidineZimelidine may increase the hypoglycemic activities of Glipizide.Withdrawn
ZiprasidoneThe metabolism of Glipizide can be decreased when combined with Ziprasidone.Approved
Food Interactions
  • Avoid alcohol.
  • Avoid sugar and sugary food.
  • Take 30-60 minutes before breakfast.


Synthesis Reference

Suresh Kumar Gidwani, Purushottam Singnurkar, Prashant Kumar Tewari, "Sustained release pharmaceutical composition containing glipizide and method for producing same." U.S. Patent US6270797, issued February, 2000.

General References
Not Available
External Links
Human Metabolome Database
PubChem Compound
PubChem Substance
Therapeutic Targets Database
RxList Drug Page Drug Page
PDRhealth Drug Page
ATC Codes
A10BB07 — Glipizide
FDA label
Download (48.8 KB)
Download (73.6 KB)

Clinical Trials

Clinical Trials
1Active Not RecruitingBasic ScienceType 2 Diabetes Mellitus1
1CompletedNot AvailableHealthy Volunteers1
1CompletedBasic ScienceHealthy Volunteers1
1CompletedTreatmentType 2 Diabetes Mellitus1
2CompletedTreatmentImpaired Glucose Tolerance (IGT) / Type 2 Diabetes Mellitus1
2CompletedTreatmentType 2 Diabetes Mellitus1
3CompletedTreatmentAtherosclerosis / Cardiovascular Disease (CVD) / Type 2 Diabetes Mellitus1
3CompletedTreatmentChronic Renal Insufficiency / Type 2 Diabetes Mellitus1
3CompletedTreatmentDiabetes Mellitus (DM)1
3CompletedTreatmentEnd-Stage Kidney Disease / Type 2 Diabetes Mellitus1
3CompletedTreatmentRenal Insufficiency,Chronic / Type 2 Diabetes Mellitus1
3CompletedTreatmentType 2 Diabetes Mellitus7
4CompletedTreatmentCoronary Artery Disease / Type 2 Diabetes Mellitus1
4CompletedTreatmentType 2 Diabetes Mellitus3
4Unknown StatusBasic ScienceType 2 Diabetes Mellitus1
4Unknown StatusTreatmentSevere Hyperglycemia - Blood Glucose Level >300mg/dl / Type 2 Diabetes Mellitus1
Not AvailableCompletedNot AvailableType 2 Diabetes Mellitus3
Not AvailableCompletedHealth Services ResearchGenotyping / Pharmacokinetics1
Not AvailableRecruitingTreatmentChronic Kidney Disease (CKD) / Type 2 Diabetes Mellitus1


Not Available
Dosage forms
TabletOral10 mg/1
TabletOral5 mg/1
Tablet, film coatedOral
Tablet, film coated, extended releaseOral10 mg/1
Tablet, film coated, extended releaseOral2.5 mg/1
Tablet, film coated, extended releaseOral5 mg/1
Tablet, extended releaseOral10 mg/1
Tablet, extended releaseOral2.5 mg/1
Tablet, extended releaseOral5 mg/1
Unit descriptionCostUnit
Glipizide powder36.11USD g
Glucotrol XL 10 mg 24 Hour tablet1.53USD tablet
Glucotrol xl 10 mg tablet1.37USD tablet
Metaglip 5-500 mg tablet1.33USD tablet
Metaglip 2.5-500 mg tablet1.32USD tablet
Metaglip 2.5-250 mg tablet1.2USD tablet
Glucotrol 10 mg tablet1.19USD tablet
Glucotrol XL 2.5 mg 24 Hour tablet0.99USD tablet
Glucotrol XL 5 mg 24 Hour tablet0.99USD tablet
GlipiZIDE XL 10 mg 24 Hour tablet0.84USD tablet
Glucotrol 5 mg tablet0.69USD tablet
Glucotrol xl 2.5 mg tablet0.69USD tablet
Glucotrol xl 5 mg tablet0.69USD tablet
Glipizide 10 mg tablet0.67USD tablet
GlipiZIDE XL 2.5 mg 24 Hour tablet0.63USD tablet
GlipiZIDE XL 5 mg 24 Hour tablet0.5USD tablet
Glipizide 5 mg tablet0.36USD tablet
DrugBank does not sell nor buy drugs. Pricing information is supplied for informational purposes only.
Patent NumberPediatric ExtensionApprovedExpires (estimated)


Experimental Properties
melting point (°C)200-203U.S. Patent 3,669,966.
water solubility37.2 mg/LNot Available
logP1.91HANSCH,C ET AL. (1995)
pKa5.9PANTEN,U ET AL. (1989)
Predicted Properties
Water Solubility0.0164 mg/mLALOGPS
pKa (Strongest Acidic)4.32ChemAxon
pKa (Strongest Basic)0.059ChemAxon
Physiological Charge-1ChemAxon
Hydrogen Acceptor Count6ChemAxon
Hydrogen Donor Count3ChemAxon
Polar Surface Area130.15 Å2ChemAxon
Rotatable Bond Count6ChemAxon
Refractivity115.62 m3·mol-1ChemAxon
Polarizability47.64 Å3ChemAxon
Number of Rings3ChemAxon
Rule of FiveYesChemAxon
Ghose FilterYesChemAxon
Veber's RuleNoChemAxon
MDDR-like RuleYesChemAxon
Predicted ADMET features
Human Intestinal Absorption+0.9262
Blood Brain Barrier+0.5599
Caco-2 permeable-0.7025
P-glycoprotein substrateSubstrate0.5326
P-glycoprotein inhibitor INon-inhibitor0.7469
P-glycoprotein inhibitor IINon-inhibitor0.9302
Renal organic cation transporterNon-inhibitor0.8322
CYP450 2C9 substrateSubstrate0.5731
CYP450 2D6 substrateNon-substrate0.9116
CYP450 3A4 substrateNon-substrate0.719
CYP450 1A2 substrateNon-inhibitor0.9501
CYP450 2C9 inhibitorInhibitor0.8949
CYP450 2D6 inhibitorNon-inhibitor0.9231
CYP450 2C19 inhibitorNon-inhibitor0.9025
CYP450 3A4 inhibitorNon-inhibitor0.8309
CYP450 inhibitory promiscuityLow CYP Inhibitory Promiscuity0.8682
Ames testNon AMES toxic0.7745
BiodegradationNot ready biodegradable0.9703
Rat acute toxicity2.1662 LD50, mol/kg Not applicable
hERG inhibition (predictor I)Weak inhibitor0.9118
hERG inhibition (predictor II)Non-inhibitor0.8539
ADMET data is predicted using admetSAR, a free tool for evaluating chemical ADMET properties. (23092397)


Mass Spec (NIST)
Not Available
SpectrumSpectrum TypeSplash Key
Predicted GC-MS Spectrum - GC-MSPredicted GC-MSNot Available
Predicted MS/MS Spectrum - 10V, Positive (Annotated)Predicted LC-MS/MSNot Available
Predicted MS/MS Spectrum - 20V, Positive (Annotated)Predicted LC-MS/MSNot Available
Predicted MS/MS Spectrum - 40V, Positive (Annotated)Predicted LC-MS/MSNot Available
Predicted MS/MS Spectrum - 10V, Negative (Annotated)Predicted LC-MS/MSNot Available
Predicted MS/MS Spectrum - 20V, Negative (Annotated)Predicted LC-MS/MSNot Available
Predicted MS/MS Spectrum - 40V, Negative (Annotated)Predicted LC-MS/MSNot Available
LC-MS/MS Spectrum - LC-ESI-qTof , PositiveLC-MS/MSNot Available
LC-MS/MS Spectrum - LC-ESI-qTof , PositiveLC-MS/MSNot Available
LC-MS/MS Spectrum - LC-ESI-qTof , PositiveLC-MS/MSNot Available
MS/MS Spectrum - , positiveLC-MS/MSsplash10-014i-0009600000-3a2ab7e8e725ab4b2090
MS/MS Spectrum - , positiveLC-MS/MSsplash10-00di-0329000000-a6f7044e9dfe397cfcdd
MS/MS Spectrum - , positiveLC-MS/MSsplash10-014i-0119600000-895a0f8ef34678f1200d
MS/MS Spectrum - , positiveLC-MS/MSsplash10-00di-1429000000-60bdb648d5355af7a75b
MS/MS Spectrum - , positiveLC-MS/MSsplash10-0v4i-3941000000-57ab7532afaad5f9a2ac


This compound belongs to the class of organic compounds known as benzenesulfonamides. These are organic compounds containing a sulfonamide group that is S-linked to a benzene ring.
Organic compounds
Super Class
Benzene and substituted derivatives
Sub Class
Direct Parent
Alternative Parents
Benzenesulfonyl compounds / Sulfonylureas / Pyrazines / Organosulfonic acids and derivatives / Heteroaromatic compounds / Aminosulfonyl compounds / Propargyl-type 1,3-dipolar organic compounds / Carboximidic acids / Azacyclic compounds / Organopnictogen compounds
show 3 more
Benzenesulfonamide / Benzenesulfonyl group / Sulfonylurea / Pyrazine / Organic sulfonic acid or derivatives / Heteroaromatic compound / Aminosulfonyl compound / Sulfonyl / Organosulfonic acid or derivatives / Carboximidic acid
show 14 more
Molecular Framework
Aromatic heteromonocyclic compounds
External Descriptors
pyrazines, monocarboxylic acid amide, aromatic amide, N-sulfonylurea (CHEBI:5384)


Pharmacological action
General Function
Sulfonylurea receptor activity
Specific Function
Subunit of the beta-cell ATP-sensitive potassium channel (KATP). Regulator of ATP-sensitive K(+) channels and insulin release.
Gene Name
Uniprot ID
Uniprot Name
ATP-binding cassette sub-family C member 8
Molecular Weight
176990.36 Da
  1. Gribble FM, Ashcroft FM: Sulfonylurea sensitivity of adenosine triphosphate-sensitive potassium channels from beta cells and extrapancreatic tissues. Metabolism. 2000 Oct;49(10 Suppl 2):3-6. [PubMed:11078468]
  2. Harrower A: Gliclazide modified release: from once-daily administration to 24-hour blood glucose control. Metabolism. 2000 Oct;49(10 Suppl 2):7-11. [PubMed:11078469]
  3. Lawrence CL, Proks P, Rodrigo GC, Jones P, Hayabuchi Y, Standen NB, Ashcroft FM: Gliclazide produces high-affinity block of KATP channels in mouse isolated pancreatic beta cells but not rat heart or arterial smooth muscle cells. Diabetologia. 2001 Aug;44(8):1019-25. [PubMed:11484080]
  4. Reimann F, Ashcroft FM, Gribble FM: Structural basis for the interference between nicorandil and sulfonylurea action. Diabetes. 2001 Oct;50(10):2253-9. [PubMed:11574406]
  5. Proks P, Reimann F, Green N, Gribble F, Ashcroft F: Sulfonylurea stimulation of insulin secretion. Diabetes. 2002 Dec;51 Suppl 3:S368-76. [PubMed:12475777]
Pharmacological action
General Function
Zinc ion binding
Specific Function
Nuclear receptor that binds peroxisome proliferators such as hypolipidemic drugs and fatty acids. Once activated by a ligand, the nuclear receptor binds to DNA specific PPAR response elements (PPRE...
Gene Name
Uniprot ID
Uniprot Name
Peroxisome proliferator-activated receptor gamma
Molecular Weight
57619.58 Da
  1. Scarsi M, Podvinec M, Roth A, Hug H, Kersten S, Albrecht H, Schwede T, Meyer UA, Rucker C: Sulfonylureas and glinides exhibit peroxisome proliferator-activated receptor gamma activity: a combined virtual screening and biological assay approach. Mol Pharmacol. 2007 Feb;71(2):398-406. Epub 2006 Nov 2. [PubMed:17082235]


Pharmacological action
General Function
Steroid hydroxylase activity
Specific Function
Cytochromes P450 are a group of heme-thiolate monooxygenases. In liver microsomes, this enzyme is involved in an NADPH-dependent electron transport pathway. It oxidizes a variety of structurally un...
Gene Name
Uniprot ID
Uniprot Name
Cytochrome P450 2C9
Molecular Weight
55627.365 Da
  1. Zhou SF, Zhou ZW, Yang LP, Cai JP: Substrates, inducers, inhibitors and structure-activity relationships of human Cytochrome P450 2C9 and implications in drug development. Curr Med Chem. 2009;16(27):3480-675. Epub 2009 Sep 1. [PubMed:19515014]
  2. Drug Interactions: Cytochrome P450 Drug Interaction Table [Link]
2. Cytochrome P450 3A4
Pharmacological action
General Function
Vitamin d3 25-hydroxylase activity
Specific Function
Cytochromes P450 are a group of heme-thiolate monooxygenases. In liver microsomes, this enzyme is involved in an NADPH-dependent electron transport pathway. It performs a variety of oxidation react...
Gene Name
Uniprot ID
Uniprot Name
Cytochrome P450 3A4
Molecular Weight
57342.67 Da
  1. Preissner S, Kroll K, Dunkel M, Senger C, Goldsobel G, Kuzman D, Guenther S, Winnenburg R, Schroeder M, Preissner R: SuperCYP: a comprehensive database on Cytochrome P450 enzymes including a tool for analysis of CYP-drug interactions. Nucleic Acids Res. 2010 Jan;38(Database issue):D237-43. doi: 10.1093/nar/gkp970. Epub 2009 Nov 24. [PubMed:19934256]

Drug created on June 13, 2005 07:24 / Updated on November 07, 2017 01:46