
Accession Number
DB01067  (APRD00436)
Small Molecule
Approved, Investigational

An oral hypoglycemic agent which is rapidly absorbed and completely metabolized.

  • 1-cyclohexyl-3-({p-[2-(5-methylpyrazinecarboxamido)ethyl]phenyl}sulfonyl)urea
  • Glipizida
  • Glipizide
  • Glipizidum
  • N-{4-[β-(5-methylpyrazine-2-carboxamido)ethyl]benzenesulphonyl}-N'-cyclohexylurea
External IDs
CP 28,720 / CP 28720 / CP-28,720 / CP-28720 / K 4024 / K-4024
Product Images
Prescription Products
NameDosageStrengthRouteLabellerMarketing StartMarketing End
GlipizideTablet, extended release5 mg/1OralAndrx Pharmaceuticals, Inc.1984-05-082011-07-01Us
GlipizideTablet, extended release5 mg/1OralRemedy Repack2011-12-082011-12-21Us
GlipizideTablet, extended release2.5 mg/1OralAndrx Pharmaceuticals, Inc.1984-05-082009-01-01Us
GlipizideTablet, extended release10 mg/1OralAndrx Pharmaceuticals, Inc.1984-05-082012-01-01Us
Glipizide ERTablet, extended release10 mg/1OralCardinal Health1994-04-262018-07-09Us55154 599220180907 15195 1vbs1y1
Glipizide XLTablet, extended release5 mg/1OralState of Florida DOH Central Pharmacy2009-07-01Not applicableUs
Glipizide XLTablet, extended release10 mg/1OralGreenstone LLC1994-04-262009-12-17Us59762 503320180907 15195 12nosvo
Glipizide XLTablet, extended release2.5 mg/1OralCardinal Health1994-04-262014-06-30Us
Glipizide XLTablet, extended release5 mg/1OralGreenstone LLC1994-04-262009-12-17Us
Glipizide XLTablet, extended release2.5 mg/1OralCardinal Health1994-04-26Not applicableUs55154 053920180913 8702 ammbcg
Generic Prescription Products
NameDosageStrengthRouteLabellerMarketing StartMarketing End
GlipizideTablet10 mg/1OralA-S Medication Solutions1995-02-27Not applicableUs50090 050320180913 8702 19lad55
GlipizideTablet10 mg/1OralRed Pharm Drug, Inc.2011-07-18Not applicableUs
GlipizideTablet, film coated, extended release5 mg/1OralRemedy Repack2018-03-13Not applicableUs
GlipizideTablet10 mg/1OralBlenheim Pharmacal, Inc.2013-09-30Not applicableUs
GlipizideTablet10 mg/1OralA-S Medication Solutions2011-07-18Not applicableUs50090 207520180913 8702 1kqn84n
GlipizideTablet5 mg/1OralMajor2002-09-25Not applicableUs
GlipizideTablet5 mg/1OralRebel Distributors1995-02-27Not applicableUs
GlipizideTablet10 mg/1OralRemedy Repack2010-03-082016-09-27Us00781 1453 01 nlmimage10 e220f167
GlipizideTablet5 mg/1OralRemedy Repack2016-06-07Not applicableUs
GlipizideTablet10 mg/1OralApotheca, Inc.2011-07-18Not applicableUs
Mixture Products
NameIngredientsDosageRouteLabellerMarketing StartMarketing End
Glipizide and Metformin HClGlipizide (5 mg/1) + Metformin Hydrochloride (500 mg/1)Tablet, film coatedOralA-S Medication Solutions2010-06-292017-04-30Us50090 108220180907 15195 1ig7fy5
Glipizide and Metformin HClGlipizide (2.5 mg/1) + Metformin Hydrochloride (500 mg/1)Tablet, film coatedOralHeritage2010-06-29Not applicableUs
Glipizide and Metformin HClGlipizide (5 mg/1) + Metformin Hydrochloride (500 mg/1)Tablet, film coatedOralRemedy Repack2013-10-312016-08-25Us23155 0117 01 nlmimage10 2c461610
Glipizide and Metformin HClGlipizide (2.5 mg/1) + Metformin Hydrochloride (250 mg/1)Tablet, film coatedOralHeritage2010-06-29Not applicableUs
Glipizide and Metformin HClGlipizide (2.5 mg/1) + Metformin Hydrochloride (250 mg/1)Tablet, film coatedOralLake Erie Medical Dba Quality Care Produts Llc2010-06-292014-12-31Us
Glipizide and Metformin HClGlipizide (2.5 mg/1) + Metformin Hydrochloride (500 mg/1)Tablet, film coatedOralRemedy Repack2013-10-312014-10-31Us23155 0116 01 nlmimage10 bd3b5e8a
Glipizide and Metformin HClGlipizide (5 mg/1) + Metformin Hydrochloride (500 mg/1)Tablet, film coatedOralHeritage2010-06-29Not applicableUs
Glipizide and Metformin HClGlipizide (5 mg/1) + Metformin Hydrochloride (500 mg/1)Tablet, film coatedOralREMEDYREPACK INC.2018-10-26Not applicableUs
Glipizide and Metformin HydrochlorideGlipizide (2.5 mg/1) + Metformin Hydrochloride (250 mg/1)Tablet, film coatedOralCadila Pharnmaceuticals2016-05-05Not applicableUs
Glipizide and Metformin HydrochlorideGlipizide (5 mg/1) + Metformin Hydrochloride (500 mg/1)Tablet, film coatedOralA-S Medication Solutions2016-05-05Not applicableUs
International/Other Brands
Aldiab / Digrin / Dipazide / Glibenese (Pfizer) / Glibénèse (Dexo) / Glibetin (Johnson) / Glican / Glidiab / Glipid / Glipin (Swiss Pharm) / Glix (YSP) / Gluco-Rite / Glucolip / Glucozide / Glupitel / Glupizide / Glyde / Glydiazinamide / Melizide / Mindiab (Pfizer) / Minidab / Minidiab (Pfizer) / Minodiab / Napizide / Ozidia / Sucrazide / Zitrol XR (Square)
CAS number
Average: 445.535
Monoisotopic: 445.178375067
Chemical Formula
InChI Key



For use as an adjunct to diet for the control of hyperglycemia and its associated symptomatology in patients with non-insulin-dependent diabetes mellitus (NIDDM; type II), formerly known as maturity-onset diabetes, after an adequate trial of dietary therapy has proved unsatisfactory.

Associated Conditions

Glipizide, a second-generation sulfonylurea, is used with diet to lower blood glucose in patients with diabetes mellitus type II. The primary mode of action of glipizide in experimental animals appears to be the stimulation of insulin secretion from the beta cells of pancreatic islet tissue and is thus dependent on functioning beta cells in the pancreatic islets. In humans glipizide appears to lower the blood glucose acutely by stimulating the release of insulin from the pancreas, an effect dependent upon functioning beta cells in the pancreatic islets. In man, stimulation of insulin secretion by glipizide in response to a meal is undoubtedly of major importance. Fasting insulin levels are not elevated even on long-term glipizide administration, but the postprandial insulin response continues to be enhanced after at least 6 months of treatment. Some patients fail to respond initially, or gradually lose their responsiveness to sulfonylurea drugs, including glipizide.

Mechanism of action

Sulfonylureas likely bind to ATP-sensitive potassium-channel receptors on the pancreatic cell surface, reducing potassium conductance and causing depolarization of the membrane. Depolarization stimulates calcium ion influx through voltage-sensitive calcium channels, raising intracellular concentrations of calcium ions, which induces the secretion, or exocytosis, of insulin.

AATP-binding cassette sub-family C member 8
UPeroxisome proliferator-activated receptor gamma

Gastrointestinal absorption is uniform, rapid, and essentially complete.

Volume of distribution
  • 11 L
Protein binding

98-99%, primarily to albumin.


Hepatic. The major metabolites of glipizide are products of aromatic hydroxylation and have no hypoglycemic activity. A minor metabolite which accounts for less than 2% of a dose, an acetylaminoethyl benzine derivatives, is reported to have 1/10 to 1/3 as much hypoglycemic activity as the parent compound.

Route of elimination

The primary metabolites are inactive hydroxylation products and polar conjugates and are excreted mainly in the urine.

Half life

2-5 hours

Not Available

The acute oral toxicity was extremely low in all species tested (LD50 greater than 4 g/kg). Overdosage of sulfonylureas including glipizide can produce hypoglycemia.

Affected organisms
  • Humans and other mammals
Not Available
Pharmacogenomic Effects/ADRs
Interacting Gene/EnzymeAllele nameGenotype(s)Defining Change(s)Type(s)DescriptionDetails
Cytochrome P450 2C9CYP2C9*3(C;C) / (A;C)C AlleleEffect Directly StudiedPatients with this genotype have reduced metabolism of glipizide.Details
Glucose-6-phosphate 1-dehydrogenaseVilleurbanneNot Available1000_1002delACCADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseTorunNot Available1006A->GADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseSunderlandNot Available105_107delCATADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseIwatsukiNot Available1081G->AADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseSerresNot Available1082C->TADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseTondelaNot Available1084_1101delCTGAACGAGCGCAAGGCCADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseLoma LindaNot Available1089C->AADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseAachenNot Available1089C->GADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseTenriNot Available1096A->GADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseMontpellierNot Available1132G>AADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseCalvo MackennaNot Available1138A->GADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseRileyNot Available1139T->CADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseOlomoucNot Available1141T->CADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseTomahNot Available1153T->CADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseLynwoodNot Available1154G->TADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseMadridNot Available1155C->GADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseIowa, Walter Reed, SpringfieldNot Available1156A->GADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseBeverly Hills, Genova, Iwate, Niigata, YamaguchiNot Available1160G->AADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseHartfordNot Available1162A->GADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenasePrahaNot Available1166A->GADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseKrakowNot Available1175T>CADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseWisconsinNot Available1177C->GADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseNashville, Anaheim, PorticiNot Available1178G->AADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseAlhambraNot Available1180G->CADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseBariNot Available1187C->TADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenasePuerto LimonNot Available1192G->AADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseCovao do LoboNot Available1205C>AADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseClinicNot Available1215G->AADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseUtrechtNot Available1225C->TADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseSuwalkiNot Available1226C->GADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseRiversideNot Available1228G->TADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseJapan, ShinagawaNot Available1229G->AADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseKawasakiNot Available1229G->CADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseMunichNot Available1231A->GADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseGeorgiaNot Available1284C->AADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseSumareNot Available1292T->GADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseTelti/KobeNot Available1318C->TADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseSantiago de Cuba, MoriokaNot Available1339G->AADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseHarimaNot Available1358T->AADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseFiguera da FozNot Available1366G->CADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseAmiensNot Available1367A>TADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseBangkok NoiNot Available1376G->T, 1502T->GADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseFukayaNot Available1462G->AADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseCampinasNot Available1463G->TADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseBuenos AiresNot Available1465C>TADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseArakawaNot Available1466C->TADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseBrightonNot Available1488_1490delGAAADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseKozukataNot Available159G->CADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseAmsterdamNot Available180_182delTCTADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseNo nameNot Available202G->A, 376A->G, 1264C>GADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseSwanseaNot Available224T->CADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseUrayasuNot Available281_283delAGAADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseVancouverNot Available317C->G544C->T592C->TADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseMt SinaiNot Available376A->G, 1159C->TADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenasePlymouthNot Available488G->AADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseVolendamNot Available514C->TADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseShinshuNot Available527A->GADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseChikugoNot Available535A->TADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseTsukuiNot Available561_563delCTCADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenasePedoplis-CkaroNot Available573C>GADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseSantiagoNot Available593G->CADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseMinnesota, Marion, Gastonia, LeJeuneNot Available637G->TADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseCincinnatiNot Available637G->T, 1037A->TADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseHarilaouNot Available648T->GADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseNorth DallasNot Available683_685delACAADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseAsahikawaNot Available695G->AADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseDurhamNot Available713A->GADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseStonybrookNot Available724_729delGGCACTADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseWayneNot Available769C->GADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseAveiroNot Available806G->AADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseCleveland CorumNot Available820G->AADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseLilleNot Available821A>TADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseBangkokNot Available825G>CADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseSugaoNot Available826C->TADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseLa JollaNot Available832T->CADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseWexhamNot Available833C->TADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenasePiotrkowNot Available851T>CADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseWest VirginiaNot Available910G->TADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseOmiyaNot Available921G->CADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseNaraNot Available953_976delCCACCAAAGGGTACCTGGAC GACCADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseManhattanNot Available962G->AADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseRehevotNot Available964T->CADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseHoniaraNot Available99A->G / 1360C->TADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseTokyo, FukushimaNot Available1246G->AADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseChathamNot Available1003G->AADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseFushanNot Available1004C->AADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenasePartenopeNot Available1052G->TADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseIerapetraNot Available1057C->TADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseAnadiaNot Available1193A->GADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseAbenoNot Available1220A->CADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseSurabayaNot Available1291G->AADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenasePawneeNot Available1316G->CADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseS. AntiocoNot Available1342A->GADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseCassanoNot Available1347G->CADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseHermoupolisNot Available1347G->C / 1360C->TADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseUnion,Maewo, Chinese-2, KaloNot Available1360C->TADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseAndalusNot Available1361G->AADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseCosenzaNot Available1376G->CADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseCanton, Taiwan- Hakka, Gifu-like, Agrigento-likeNot Available1376G->TADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseFloresNot Available1387C->AADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseKaiping, Anant, Dhon, Sapporo-like, WoseraNot Available1388G->AADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseKamogawaNot Available169C->TADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseCostanzoNot Available179T>CADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseAmazoniaNot Available185C->AADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseSongklanagarindNot Available196T->AADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseHechiNot Available202G->A / 871G->AADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseNamouruNot Available208T->CADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseBao LocNot Available352T>CADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseCrispimNot Available375G->T, 379G->T383T->C384C>TADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseAcrokorinthosNot Available376A->G / 463C->GADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseSanta MariaNot Available376A->G / 542A->TADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseAnanindeuaNot Available376A->G / 871G->AADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseVanua LavaNot Available383T->CADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseValladolidNot Available406C->TADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseBelemNot Available409C->TADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseLiuzhouNot Available442G->AADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseShenzenNot Available473G>AADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseTaipei “Chinese- 3”Not Available493A->GADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseToledoNot Available496C>TADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseNaoneNot Available497G->AADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseNankangNot Available517T->CADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseMiaoliNot Available519C->GADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseMediterranean, Dallas, Panama‚ Sassari, Cagliari, BirminghamNot Available563C->TADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseCoimbra ShundeNot Available592C->TADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseNilgiriNot Available593G>AADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseRadlowoNot Available679C->TADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseRoubaixNot Available811G>CADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseHaikouNot Available835A->GADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseChinese-1Not Available835A->TADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseMizushimaNot Available848A>GADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseOsakaNot Available853C->TADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseViangchan, JammuNot Available871G->AADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseSeoulNot Available916G->AADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseLudhianaNot Available929G->AADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseFarroupilhaNot Available977C->AADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseChinese-5Not Available1024C->TADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseRignanoNot Available130G>AADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseOrissaNot Available131C->GADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseG6PDNiceNot Available1380G>CADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseKamiube, KeelungNot Available1387C->TADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseNeapolisNot Available1400C->GADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseAuresNot Available143T->CADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseSplitNot Available1442C->GADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseKambosNot Available148C->TADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenasePalestrinaNot Available170G>AADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseMetapontoNot Available172G->AADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseMusashinoNot Available185C->TADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseAsahiNot Available202G->AADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseA- (202), Ferrara INot Available202G->A / 376A->GADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseMurcia OristanoNot Available209A->GADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseUbe KonanNot Available241C->TADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseLagosantoNot Available242G->AADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseGuangzhouNot Available274C->TADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseHammersmithNot Available323T->AADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseSinnaiNot Available34G->TADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseA- (680)Not Available376A->G / 680G->TADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseA- (968), Betica,Selma, GuantanamoNot Available376A->G / 968T->CADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseSalerno PyrgosNot Available383T>GADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseQuing YanNot Available392G->TADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseLagesNot Available40G->AADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseIleshaNot Available466G->AADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseMahidolNot Available487G->AADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseMalagaNot Available542A->TADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseSibariNot Available634A->GADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseMexico CityNot Available680G->AADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseNanningNot Available703C->TADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseSeattle, Lodi, Modena, Ferrara II, Athens-likeNot Available844G->CADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseBajo MaumereNot Available844G->TADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseMontalbanoNot Available854G->AADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseKalyan-Kerala, Jamnaga, RohiniNot Available949G->AADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseGaoheNot Available95A->GADR InferredIncreased risk of hemolytic anemia.Details
Cytochrome P450 2C9CYP2C9*6Not Available818delAEffect InferredPoor drug metabolizer, lower dose requirementsDetails
Cytochrome P450 2C9CYP2C9*15Not Available485C>AEffect InferredPoor drug metabolizer, lower dose requirementsDetails
Cytochrome P450 2C9CYP2C9*25Not Available353_362delAGAAATGGAAEffect InferredPoor drug metabolizer, lower dose requirementsDetails
Cytochrome P450 2C9CYP2C9*35Not Available374G>T / 430C>TEffect InferredPoor drug metabolizer, lower dose requirementsDetails
Cytochrome P450 2C9CYP2C9*2Not Available430C>TEffect InferredPoor drug metabolizer, lower dose requirementsDetails
Cytochrome P450 2C9CYP2C9*4Not Available1076T>CEffect InferredPoor drug metabolizer, lower dose requirementsDetails
Cytochrome P450 2C9CYP2C9*5Not Available1080C>GEffect InferredPoor drug metabolizer, lower dose requirementsDetails
Cytochrome P450 2C9CYP2C9*8Not Available449G>AEffect InferredPoor drug metabolizer, lower dose requirementsDetails
Cytochrome P450 2C9CYP2C9*11Not Available1003C>TEffect InferredPoor drug metabolizer, lower dose requirementsDetails
Cytochrome P450 2C9CYP2C9*12Not Available1465C>TEffect InferredPoor drug metabolizer, lower dose requirementsDetails
Cytochrome P450 2C9CYP2C9*13Not Available269T>CEffect InferredPoor drug metabolizer, lower dose requirementsDetails
Cytochrome P450 2C9CYP2C9*14Not Available374G>AEffect InferredPoor drug metabolizer, lower dose requirementsDetails
Cytochrome P450 2C9CYP2C9*16Not Available895A>GEffect InferredPoor drug metabolizer, lower dose requirementsDetails
Cytochrome P450 2C9CYP2C9*18Not Available1075A>C / 1190A>C  … show all Effect InferredPoor drug metabolizer, lower dose requirementsDetails
Cytochrome P450 2C9CYP2C9*26Not Available389C>GEffect InferredPoor drug metabolizer, lower dose requirementsDetails
Cytochrome P450 2C9CYP2C9*28Not Available641A>TEffect InferredPoor drug metabolizer, lower dose requirementsDetails
Cytochrome P450 2C9CYP2C9*30Not Available1429G>AEffect InferredPoor drug metabolizer, lower dose requirementsDetails
Cytochrome P450 2C9CYP2C9*33Not Available395G>AEffect InferredPoor drug metabolizer, lower dose requirementsDetails


Drug Interactions
(R)-warfarinGlipizide may increase the anticoagulant activities of (R)-warfarin.
(S)-WarfarinGlipizide may increase the anticoagulant activities of (S)-Warfarin.
2,4-thiazolidinedioneThe risk or severity of hypoglycemia can be increased when Glipizide is combined with 2,4-thiazolidinedione.
3,5-diiodothyropropionic acidThe metabolism of 3,5-diiodothyropropionic acid can be decreased when combined with Glipizide.
4-hydroxycoumarinThe metabolism of 4-hydroxycoumarin can be decreased when combined with Glipizide.
5-(2-methylpiperazine-1-sulfonyl)isoquinolineThe therapeutic efficacy of Glipizide can be increased when used in combination with 5-(2-methylpiperazine-1-sulfonyl)isoquinoline.
5-androstenedioneThe metabolism of 5-androstenedione can be decreased when combined with Glipizide.
6-Deoxyerythronolide BThe metabolism of Glipizide can be decreased when combined with 6-Deoxyerythronolide B.
6-O-benzylguanineThe metabolism of 6-O-benzylguanine can be decreased when combined with Glipizide.
AbacavirAbacavir may decrease the excretion rate of Glipizide which could result in a higher serum level.
Food Interactions
  • Avoid alcohol.
  • Avoid sugar and sugary food.
  • Take 30-60 minutes before breakfast.


Synthesis Reference

Suresh Kumar Gidwani, Purushottam Singnurkar, Prashant Kumar Tewari, "Sustained release pharmaceutical composition containing glipizide and method for producing same." U.S. Patent US6270797, issued February, 2000.

General References
Not Available
External Links
Human Metabolome Database
PubChem Compound
PubChem Substance
Therapeutic Targets Database
RxList Drug Page Drug Page
PDRhealth Drug Page
ATC Codes
A10BB07 — Glipizide
FDA label
Download (48.8 KB)
Download (73.6 KB)

Clinical Trials

Clinical Trials
1Active Not RecruitingBasic ScienceType 2 Diabetes Mellitus1
1Active Not RecruitingOtherHealthy Volunteers1
1CompletedNot AvailableHealthy Volunteers1
1CompletedBasic ScienceHealthy Volunteers1
1CompletedTreatmentType 2 Diabetes Mellitus1
2CompletedTreatmentImpaired Glucose Tolerance (IGT) / Type 2 Diabetes Mellitus1
2CompletedTreatmentType 2 Diabetes Mellitus1
3CompletedTreatmentAtherosclerosis / Cardiovascular Disease (CVD) / Type 2 Diabetes Mellitus1
3CompletedTreatmentDiabetes Mellitus (DM)1
3CompletedTreatmentEnd-Stage Kidney Disease / Type 2 Diabetes Mellitus1
3CompletedTreatmentRenal Insufficiency,Chronic / Type 2 Diabetes Mellitus2
3CompletedTreatmentType 2 Diabetes Mellitus7
4CompletedTreatmentCoronary Artery Disease / Type 2 Diabetes Mellitus1
4CompletedTreatmentType 2 Diabetes Mellitus3
4Unknown StatusBasic ScienceType 2 Diabetes Mellitus1
4Unknown StatusTreatmentSevere Hyperglycemia - Blood Glucose Level >300mg/dl / Type 2 Diabetes Mellitus1
Not AvailableCompletedNot AvailableType 2 Diabetes Mellitus3
Not AvailableCompletedHealth Services ResearchGenotyping / Pharmacokinetics1
Not AvailableCompletedTreatmentChronic Kidney Disease (CKD) / Type 2 Diabetes Mellitus1


Not Available
  • Actavis Group
  • Advanced Pharmaceutical Services Inc.
  • Alphapharm Party Ltd.
  • Amerisource Health Services Corp.
  • Apotex Inc.
  • Apotheca Inc.
  • AQ Pharmaceuticals Inc.
  • A-S Medication Solutions LLC
  • Atlantic Biologicals Corporation
  • Bristol-Myers Squibb Co.
  • Bryant Ranch Prepack
  • Caraco Pharmaceutical Labs
  • Cardinal Health
  • Coupler Enterprises Inc.
  • Dept Health Central Pharmacy
  • Direct Dispensing Inc.
  • Dispensing Solutions
  • Diversified Healthcare Services Inc.
  • Duramed
  • Goldline Laboratories Inc.
  • Greenstone LLC
  • Heartland Repack Services LLC
  • Ivax Pharmaceuticals
  • Kaiser Foundation Hospital
  • Lake Erie Medical and Surgical Supply
  • Legacy Pharmaceuticals Packaging LLC
  • Liberty Pharmaceuticals
  • Major Pharmaceuticals
  • Mckesson Corp.
  • Medisca Inc.
  • Medvantx Inc.
  • Murfreesboro Pharmaceutical Nursing Supply
  • Mylan
  • Novopharm Ltd.
  • Nucare Pharmaceuticals Inc.
  • Palmetto Pharmaceuticals Inc.
  • Patheon Inc.
  • PD-Rx Pharmaceuticals Inc.
  • Pfizer Inc.
  • Pharmaceutical Utilization Management Program VA Inc.
  • Pharmacy Service Center
  • Pharmedix
  • Physicians Total Care Inc.
  • Pratt Pharmaceuticals
  • Preferred Pharmaceuticals Inc.
  • Prepackage Specialists
  • Prepak Systems Inc.
  • Qualitest
  • Rebel Distributors Corp.
  • Remedy Repack
  • Resource Optimization and Innovation LLC
  • Sandhills Packaging Inc.
  • Sandoz
  • Southwood Pharmaceuticals
  • Stat Rx Usa
  • Stat Scripts LLC
  • Teva Pharmaceutical Industries Ltd.
  • Torpharm Inc.
  • UDL Laboratories
  • United Research Laboratories Inc.
  • US Pharmaceutical Group
  • Va Cmop Dallas
  • Vangard Labs Inc.
  • Watson Pharmaceuticals
Dosage forms
TabletOral10 mg/1
TabletOral5 mg/1
Tablet, film coated, extended releaseOral10 mg/1
Tablet, film coated, extended releaseOral2.5 mg/1
Tablet, film coated, extended releaseOral5 mg/1
Tablet, coatedOral
Tablet, extended releaseOral10 mg/1
Tablet, extended releaseOral5 mg/1
Tablet, extended releaseOral2.5 mg/1
Tablet, film coatedOral
Unit descriptionCostUnit
Glipizide powder36.11USD g
Glucotrol XL 10 mg 24 Hour tablet1.53USD tablet
Glucotrol xl 10 mg tablet1.37USD tablet
Metaglip 5-500 mg tablet1.33USD tablet
Metaglip 2.5-500 mg tablet1.32USD tablet
Metaglip 2.5-250 mg tablet1.2USD tablet
Glucotrol 10 mg tablet1.19USD tablet
Glucotrol XL 2.5 mg 24 Hour tablet0.99USD tablet
Glucotrol XL 5 mg 24 Hour tablet0.99USD tablet
GlipiZIDE XL 10 mg 24 Hour tablet0.84USD tablet
Glucotrol 5 mg tablet0.69USD tablet
Glucotrol xl 2.5 mg tablet0.69USD tablet
Glucotrol xl 5 mg tablet0.69USD tablet
Glipizide 10 mg tablet0.67USD tablet
GlipiZIDE XL 2.5 mg 24 Hour tablet0.63USD tablet
GlipiZIDE XL 5 mg 24 Hour tablet0.5USD tablet
Glipizide 5 mg tablet0.36USD tablet
DrugBank does not sell nor buy drugs. Pricing information is supplied for informational purposes only.
Patent NumberPediatric ExtensionApprovedExpires (estimated)


Experimental Properties
melting point (°C)200-203U.S. Patent 3,669,966.
water solubility37.2 mg/LNot Available
logP1.91HANSCH,C ET AL. (1995)
pKa5.9PANTEN,U ET AL. (1989)
Predicted Properties
Water Solubility0.0164 mg/mLALOGPS
pKa (Strongest Acidic)4.32ChemAxon
pKa (Strongest Basic)0.059ChemAxon
Physiological Charge-1ChemAxon
Hydrogen Acceptor Count6ChemAxon
Hydrogen Donor Count3ChemAxon
Polar Surface Area130.15 Å2ChemAxon
Rotatable Bond Count6ChemAxon
Refractivity115.62 m3·mol-1ChemAxon
Polarizability47.64 Å3ChemAxon
Number of Rings3ChemAxon
Rule of FiveYesChemAxon
Ghose FilterYesChemAxon
Veber's RuleNoChemAxon
MDDR-like RuleYesChemAxon
Predicted ADMET features
Human Intestinal Absorption+0.9262
Blood Brain Barrier+0.5599
Caco-2 permeable-0.7025
P-glycoprotein substrateSubstrate0.5326
P-glycoprotein inhibitor INon-inhibitor0.7469
P-glycoprotein inhibitor IINon-inhibitor0.9302
Renal organic cation transporterNon-inhibitor0.8322
CYP450 2C9 substrateSubstrate0.5731
CYP450 2D6 substrateNon-substrate0.9116
CYP450 3A4 substrateNon-substrate0.719
CYP450 1A2 substrateNon-inhibitor0.9501
CYP450 2C9 inhibitorInhibitor0.8949
CYP450 2D6 inhibitorNon-inhibitor0.9231
CYP450 2C19 inhibitorNon-inhibitor0.9025
CYP450 3A4 inhibitorNon-inhibitor0.8309
CYP450 inhibitory promiscuityLow CYP Inhibitory Promiscuity0.8682
Ames testNon AMES toxic0.7745
BiodegradationNot ready biodegradable0.9703
Rat acute toxicity2.1662 LD50, mol/kg Not applicable
hERG inhibition (predictor I)Weak inhibitor0.9118
hERG inhibition (predictor II)Non-inhibitor0.8539
ADMET data is predicted using admetSAR, a free tool for evaluating chemical ADMET properties. (23092397)


Mass Spec (NIST)
Not Available
SpectrumSpectrum TypeSplash Key
Predicted GC-MS Spectrum - GC-MSPredicted GC-MSNot Available
Predicted MS/MS Spectrum - 10V, Positive (Annotated)Predicted LC-MS/MSNot Available
Predicted MS/MS Spectrum - 20V, Positive (Annotated)Predicted LC-MS/MSNot Available
Predicted MS/MS Spectrum - 40V, Positive (Annotated)Predicted LC-MS/MSNot Available
Predicted MS/MS Spectrum - 10V, Negative (Annotated)Predicted LC-MS/MSNot Available
Predicted MS/MS Spectrum - 20V, Negative (Annotated)Predicted LC-MS/MSNot Available
Predicted MS/MS Spectrum - 40V, Negative (Annotated)Predicted LC-MS/MSNot Available
LC-MS/MS Spectrum - LC-ESI-qTof , PositiveLC-MS/MSNot Available
LC-MS/MS Spectrum - LC-ESI-qTof , PositiveLC-MS/MSNot Available
LC-MS/MS Spectrum - LC-ESI-qTof , PositiveLC-MS/MSNot Available
MS/MS Spectrum - , positiveLC-MS/MSsplash10-014i-0009600000-3a2ab7e8e725ab4b2090
MS/MS Spectrum - , positiveLC-MS/MSsplash10-00di-0329000000-a6f7044e9dfe397cfcdd
MS/MS Spectrum - , positiveLC-MS/MSsplash10-014i-0119600000-895a0f8ef34678f1200d
MS/MS Spectrum - , positiveLC-MS/MSsplash10-00di-1429000000-60bdb648d5355af7a75b
MS/MS Spectrum - , positiveLC-MS/MSsplash10-0v4i-3941000000-57ab7532afaad5f9a2ac


This compound belongs to the class of organic compounds known as benzenesulfonamides. These are organic compounds containing a sulfonamide group that is S-linked to a benzene ring.
Organic compounds
Super Class
Benzene and substituted derivatives
Sub Class
Direct Parent
Alternative Parents
Benzenesulfonyl compounds / Sulfonylureas / Pyrazines / Organosulfonic acids and derivatives / Heteroaromatic compounds / Aminosulfonyl compounds / Propargyl-type 1,3-dipolar organic compounds / Carboximidic acids / Azacyclic compounds / Organopnictogen compounds
show 3 more
Benzenesulfonamide / Benzenesulfonyl group / Sulfonylurea / Pyrazine / Organic sulfonic acid or derivatives / Heteroaromatic compound / Aminosulfonyl compound / Sulfonyl / Organosulfonic acid or derivatives / Carboximidic acid
show 14 more
Molecular Framework
Aromatic heteromonocyclic compounds
External Descriptors
pyrazines, monocarboxylic acid amide, aromatic amide, N-sulfonylurea (CHEBI:5384)


Pharmacological action
General Function
Sulfonylurea receptor activity
Specific Function
Subunit of the beta-cell ATP-sensitive potassium channel (KATP). Regulator of ATP-sensitive K(+) channels and insulin release.
Gene Name
Uniprot ID
Uniprot Name
ATP-binding cassette sub-family C member 8
Molecular Weight
176990.36 Da
  1. Gribble FM, Ashcroft FM: Sulfonylurea sensitivity of adenosine triphosphate-sensitive potassium channels from beta cells and extrapancreatic tissues. Metabolism. 2000 Oct;49(10 Suppl 2):3-6. [PubMed:11078468]
  2. Harrower A: Gliclazide modified release: from once-daily administration to 24-hour blood glucose control. Metabolism. 2000 Oct;49(10 Suppl 2):7-11. [PubMed:11078469]
  3. Lawrence CL, Proks P, Rodrigo GC, Jones P, Hayabuchi Y, Standen NB, Ashcroft FM: Gliclazide produces high-affinity block of KATP channels in mouse isolated pancreatic beta cells but not rat heart or arterial smooth muscle cells. Diabetologia. 2001 Aug;44(8):1019-25. [PubMed:11484080]
  4. Reimann F, Ashcroft FM, Gribble FM: Structural basis for the interference between nicorandil and sulfonylurea action. Diabetes. 2001 Oct;50(10):2253-9. [PubMed:11574406]
  5. Proks P, Reimann F, Green N, Gribble F, Ashcroft F: Sulfonylurea stimulation of insulin secretion. Diabetes. 2002 Dec;51 Suppl 3:S368-76. [PubMed:12475777]
Pharmacological action
General Function
Zinc ion binding
Specific Function
Nuclear receptor that binds peroxisome proliferators such as hypolipidemic drugs and fatty acids. Once activated by a ligand, the nuclear receptor binds to DNA specific PPAR response elements (PPRE...
Gene Name
Uniprot ID
Uniprot Name
Peroxisome proliferator-activated receptor gamma
Molecular Weight
57619.58 Da
  1. Scarsi M, Podvinec M, Roth A, Hug H, Kersten S, Albrecht H, Schwede T, Meyer UA, Rucker C: Sulfonylureas and glinides exhibit peroxisome proliferator-activated receptor gamma activity: a combined virtual screening and biological assay approach. Mol Pharmacol. 2007 Feb;71(2):398-406. Epub 2006 Nov 2. [PubMed:17082235]


Pharmacological action
General Function
Steroid hydroxylase activity
Specific Function
Cytochromes P450 are a group of heme-thiolate monooxygenases. In liver microsomes, this enzyme is involved in an NADPH-dependent electron transport pathway. It oxidizes a variety of structurally un...
Gene Name
Uniprot ID
Uniprot Name
Cytochrome P450 2C9
Molecular Weight
55627.365 Da
  1. Zhou SF, Zhou ZW, Yang LP, Cai JP: Substrates, inducers, inhibitors and structure-activity relationships of human Cytochrome P450 2C9 and implications in drug development. Curr Med Chem. 2009;16(27):3480-675. Epub 2009 Sep 1. [PubMed:19515014]
  2. Drug Interactions: Cytochrome P450 Drug Interaction Table [Link]
2. Cytochrome P450 3A4
Pharmacological action
General Function
Vitamin d3 25-hydroxylase activity
Specific Function
Cytochromes P450 are a group of heme-thiolate monooxygenases. In liver microsomes, this enzyme is involved in an NADPH-dependent electron transport pathway. It performs a variety of oxidation react...
Gene Name
Uniprot ID
Uniprot Name
Cytochrome P450 3A4
Molecular Weight
57342.67 Da
  1. Preissner S, Kroll K, Dunkel M, Senger C, Goldsobel G, Kuzman D, Guenther S, Winnenburg R, Schroeder M, Preissner R: SuperCYP: a comprehensive database on Cytochrome P450 enzymes including a tool for analysis of CYP-drug interactions. Nucleic Acids Res. 2010 Jan;38(Database issue):D237-43. doi: 10.1093/nar/gkp970. Epub 2009 Nov 24. [PubMed:19934256]
Pharmacological action
General Function
Steroid binding
Specific Function
UDPGT is of major importance in the conjugation and subsequent elimination of potentially toxic xenobiotics and endogenous compounds. This isoform glucuronidates bilirubin IX-alpha to form both the...
Gene Name
Uniprot ID
Uniprot Name
UDP-glucuronosyltransferase 1-1
Molecular Weight
59590.91 Da
  1. Williams JA, Hyland R, Jones BC, Smith DA, Hurst S, Goosen TC, Peterkin V, Koup JR, Ball SE: Drug-drug interactions for UDP-glucuronosyltransferase substrates: a pharmacokinetic explanation for typically observed low exposure (AUCi/AUC) ratios. Drug Metab Dispos. 2004 Nov;32(11):1201-8. doi: 10.1124/dmd.104.000794. Epub 2004 Aug 10. [PubMed:15304429]


Pharmacological action
General Function
Transporter activity
Specific Function
Involved in the ATP-dependent secretion of bile salts into the canaliculus of hepatocytes.
Gene Name
Uniprot ID
Uniprot Name
Bile salt export pump
Molecular Weight
146405.83 Da
  1. Pedersen JM, Matsson P, Bergstrom CA, Hoogstraate J, Noren A, LeCluyse EL, Artursson P: Early identification of clinically relevant drug interactions with the human bile salt export pump (BSEP/ABCB11). Toxicol Sci. 2013 Dec;136(2):328-43. doi: 10.1093/toxsci/kft197. Epub 2013 Sep 6. [PubMed:24014644]

Drug created on June 13, 2005 07:24 / Updated on November 02, 2018 04:55