Accession NumberDB00222  (APRD00381)
TypeSmall Molecule

Glimepiride is the first III generation sulphonyl urea it is a very potent sulphonyl urea with long duration of action.

External IDs HOE 490 / HOE-490
Product Ingredients Not Available
Product Images
Approved Prescription Products
NameDosageStrengthRouteLabellerMarketing StartMarketing End
AmarylTablet1 mgOralSanofi Aventis2002-03-12Not applicableCanada
AmarylTablet4 mg/1OralSanofi Aventis2009-06-18Not applicableUs
AmarylTablet1 mg/1OralSanofi Aventis2009-06-18Not applicableUs
AmarylTablet2 mgOralSanofi Aventis2002-03-12Not applicableCanada
AmarylTablet2 mg/1OralSanofi Aventis2009-06-18Not applicableUs
AmarylTablet4 mgOralSanofi Aventis2002-03-12Not applicableCanada
Co GlimepirideTablet4 mgOralCobalt Laboratories2006-04-242012-08-02Canada
Co GlimepirideTablet1 mgOralCobalt Laboratories2006-04-242012-08-02Canada
Co GlimepirideTablet2 mgOralCobalt Laboratories2006-04-242012-08-02Canada
Novo-glimepirideTablet4 mgOralNovopharm Limited2006-03-082015-10-26Canada
Novo-glimepirideTablet2 mgOralNovopharm Limited2006-03-082015-10-26Canada
Novo-glimepirideTablet1 mgOralNovopharm Limited2006-03-082015-10-26Canada
PMS-glimepirideTablet4 mgOralPharmascience IncNot applicableNot applicableCanada
PMS-glimepirideTablet1 mgOralPharmascience Inc2006-08-152016-10-28Canada
PMS-glimepirideTablet2 mgOralPharmascience Inc2006-08-152016-10-28Canada
Ratio-glimepirideTablet2 mgOralTeva2005-11-222017-04-04Canada
Ratio-glimepirideTablet4 mgOralTeva2005-11-222017-04-04Canada
Ratio-glimepirideTablet1 mgOralTeva2005-11-222017-04-04Canada
Sandoz GlimepirideTablet1 mgOralSandoz Canada Incorporated2005-08-04Not applicableCanada
Sandoz GlimepirideTablet3 mgOralSandoz Canada IncorporatedNot applicableNot applicableCanada
Sandoz GlimepirideTablet2 mgOralSandoz Canada Incorporated2005-08-04Not applicableCanada
Sandoz GlimepirideTablet4 mgOralSandoz Canada Incorporated2005-08-04Not applicableCanada
Approved Generic Prescription Products
NameDosageStrengthRouteLabellerMarketing StartMarketing End
Apo-glimepirideTablet4 mgOralApotex Corporation2007-09-29Not applicableCanada
Apo-glimepirideTablet1 mgOralApotex Corporation2007-09-29Not applicableCanada
Apo-glimepirideTablet2 mgOralApotex Corporation2007-09-29Not applicableCanada
GlimepirideTablet1 mg/1OralVirtus Pharmaceuticals2015-07-14Not applicableUs
GlimepirideTablet2 mg/1OralMylan Pharmaceuticals2006-03-01Not applicableUs
GlimepirideTablet2 mg/1OralRemedy Repack2015-11-122016-10-13Us
GlimepirideTablet4 mg/1OralSt. Marys Medical Park Pharmacy2013-05-09Not applicableUs
GlimepirideTablet2 mg/1OralNorthwind Pharmaceuticals2015-02-04Not applicableUs
GlimepirideTablet2 mg/1OralAidarex Pharmaceuticals LLC2013-06-13Not applicableUs
GlimepirideTablet4 mg/1OralRemedy Repack2016-01-252017-03-03Us
GlimepirideTablet2 mg/1OralA S Medication Solutions2007-08-232017-06-20Us
GlimepirideTablet2 mg/1OralCitron Pharma LLC2012-06-29Not applicableUs
GlimepirideTablet1 mg/1OralDr Reddy's Laboratories2005-10-06Not applicableUs
GlimepirideTablet2 mg/1OralNorthwind Pharmaceuticals2017-02-24Not applicableUs
GlimepirideTablet1 mg/1OralRemedy Repack2015-06-04Not applicableUs
GlimepirideTablet1 mg/1OralAvera Mc Kennan Hospital2015-04-21Not applicableUs
GlimepirideTablet1 mg/1OralTeva2005-10-06Not applicableUs
GlimepirideTablet1 mg/1OralInternational Laboratories, Llc2009-02-06Not applicableUs
GlimepirideTablet4 mg/1OralA S Medication Solutions2010-10-142017-06-20Us
GlimepirideTablet1 mg/1OralQualitest2010-10-142018-09-22Us
GlimepirideTablet4 mg/1OralLake Erie Medical Dba Quality Care Produts Llc2005-10-06Not applicableUs
GlimepirideTablet4 mg/1OralMicro Labs Limited2013-06-13Not applicableUs
GlimepirideTablet2 mg/1OralSolco healthcare U.S., LLC2017-01-30Not applicableUs
GlimepirideTablet1 mg/1OralRemedy Repack2013-11-122016-12-24Us
GlimepirideTablet2 mg/1OralStat Rx USA2005-10-06Not applicableUs
GlimepirideTablet4 mg/1OralGolden State Medical Supply2009-08-17Not applicableUs
GlimepirideTablet4 mg/1Oralbryant ranch prepack2005-10-06Not applicableUs
GlimepirideTablet4 mg/1OralNcs Health Care Of Ky, Inc Dba Vangard Labs2005-10-06Not applicableUs
GlimepirideTablet4 mg/1OralA S Medication Solutions2007-08-232017-06-20Us
GlimepirideTablet1 mg/1OralCitron Pharma LLC2012-06-29Not applicableUs
GlimepirideTablet4 mg/1OralClinical Solutions Wholsesale2005-10-062017-06-27Us
GlimepirideTablet4 mg/1OralPd Rx Pharmaceuticals, Inc.2007-08-23Not applicableUs
GlimepirideTablet2 mg/1OralInternational Laboratories, Llc2009-02-06Not applicableUs
GlimepirideTablet2 mg/1OralPhysicians Total Care, Inc.2005-10-20Not applicableUs00093 7255 01 nlmimage10 682f3409
GlimepirideTablet1 mg/1OralPerrigo New York Inc.2005-10-062017-01-18Us
GlimepirideTablet1 mg/1OralNucare Pharmaceuticals, Inc.2015-10-01Not applicableUs
GlimepirideTablet2 mg/1OralBlenheim Pharmacal, Inc.2013-10-08Not applicableUs
GlimepirideTablet1 mg/1OralVirtus Pharmaceuticals2013-12-15Not applicableUs76439 0123 10 nlmimage10 6a3db50d
GlimepirideTablet2 mg/1OralAccord Healthcare Limited2007-08-23Not applicableUs
GlimepirideTablet4 mg/1OralProficient Rx LP2007-08-23Not applicableUs
GlimepirideTablet4 mg/1OralCarlsbad Technology, Inc.2012-01-01Not applicableUs
GlimepirideTablet4 mg/1OralRemedy Repack2013-05-142017-01-18Us
GlimepirideTablet4 mg/1OralStat Rx USA2005-10-06Not applicableUs
GlimepirideTablet4 mg/1OralLiberty Pharmaceuticals, Inc.2012-01-01Not applicableUs
GlimepirideTablet2 mg/1OralPreferreed Pharmaceuticals Inc.2016-06-10Not applicableUs
GlimepirideTablet2 mg/1OralRemedy Repack2016-11-04Not applicableUs
GlimepirideTablet1 mg/1OralMylan Pharmaceuticals2006-03-01Not applicableUs
GlimepirideTablet2 mg/1OralAidarex Pharmaceuticals LLC2007-08-23Not applicableUs
GlimepirideTablet1 mg/1OralNucare Pharmaceuticals, Inc.2007-08-23Not applicableUs
GlimepirideTablet4 mg/1OralAurobindo Pharma2012-06-29Not applicableUs
GlimepirideTablet4 mg/1OralBionpharma Inc.2015-10-01Not applicableUs
GlimepirideTablet4 mg/1OralA S Medication Solutions2012-01-012017-06-20Us
GlimepirideTablet1 mg/1OralNucare Pharmaceuticals, Inc.2015-07-14Not applicableUs
GlimepirideTablet4 mg/1OralUnit Dose Services2005-10-06Not applicableUs
GlimepirideTablet4 mg/1OralAmerincan Health Packaging2009-05-12Not applicableUs
GlimepirideTablet4 mg/1OralPd Rx Pharmaceuticals, Inc.2012-01-01Not applicableUs
GlimepirideTablet2 mg/1OralUnit Dose Services2007-08-23Not applicableUs
GlimepirideTablet4 mg/1OralBlue Point Laboratories2014-02-26Not applicableUs
GlimepirideTablet2 mg/1OralMicro Labs Limited2013-06-13Not applicableUs
GlimepirideTablet1 mg/1OralRemedy Repack2015-07-17Not applicableUs
GlimepirideTablet1 mg/1OralGolden State Medical Supply2009-08-17Not applicableUs
GlimepirideTablet4 mg/1OralPd Rx Pharmaceuticals, Inc.2005-10-06Not applicableUs
GlimepirideTablet1 mg/1OralSt. Marys Medical Park Pharmacy2014-05-23Not applicableUs
GlimepirideTablet2 mg/1OralMylan Institutional2006-03-27Not applicableUs
GlimepirideTablet4 mg/1OralRebel Distributors2005-10-06Not applicableUs
GlimepirideTablet2 mg/1OralVirtus Pharmaceuticals2015-07-14Not applicableUs
GlimepirideTablet4 mg/1OralMylan Pharmaceuticals2006-03-01Not applicableUs
GlimepirideTablet2 mg/1OralDirectrx2015-11-24Not applicableUs
GlimepirideTablet1 mg/1OralCarlsbad Technology, Inc.2012-01-01Not applicableUs
GlimepirideTablet4 mg/1OralNorthwind Pharmaceuticals2014-12-29Not applicableUs
GlimepirideTablet4 mg/1OralAidarex Pharmaceuticals LLC2005-10-06Not applicableUs
GlimepirideTablet1 mg/1OralLiberty Pharmaceuticals, Inc.2012-01-01Not applicableUs
GlimepirideTablet4 mg/1OralRemedy Repack2016-07-132017-02-15Us
GlimepirideTablet4 mg/1OralCitron Pharma LLC2012-06-29Not applicableUs
GlimepirideTablet2 mg/1OralProficient Rx LP2007-08-23Not applicableUs
GlimepirideTablet2 mg/1OralDr Reddy's Laboratories2005-10-06Not applicableUs
GlimepirideTablet4 mg/1OralRemedy Repack2017-03-08Not applicableUs
GlimepirideTablet1 mg/1OralAurobindo Pharma2012-06-29Not applicableUs
GlimepirideTablet1 mg/1OralBionpharma Inc.2015-10-01Not applicableUs
GlimepirideTablet2 mg/1OralTeva2005-10-06Not applicableUs
GlimepirideTablet4 mg/1OralAidarex Pharmaceuticals LLC2015-10-01Not applicableUs
GlimepirideTablet2 mg/1OralA S Medication Solutions2005-10-062017-06-20Us
GlimepirideTablet2 mg/1OralQualitest2010-10-142018-04-30Us
GlimepirideTablet4 mg/1OralPreferreed Pharmaceuticals Inc.2016-11-17Not applicableUs
GlimepirideTablet6 mg/1OralMicro Labs Limited2013-06-13Not applicableUs
GlimepirideTablet4 mg/1OralSolco healthcare U.S., LLC2017-01-30Not applicableUs
GlimepirideTablet1 mg/1OralPhysicians Total Care, Inc.2005-10-20Not applicableUs00093 7254 01 nlmimage10 310798fc
GlimepirideTablet2 mg/1OralPd Rx Pharmaceuticals, Inc.2005-10-06Not applicableUs
GlimepirideTablet4 mg/1Oralbryant ranch prepack2005-10-06Not applicableUs
GlimepirideTablet2 mg/1Oralbryant ranch prepack2005-10-06Not applicableUs
GlimepirideTablet2 mg/1OralNcs Health Care Of Ky, Inc Dba Vangard Labs2005-10-06Not applicableUs
GlimepirideTablet2 mg/1OralNucare Pharmaceuticals, Inc.2007-08-23Not applicableUs
GlimepirideTablet1 mg/1OralUnit Dose Services2005-10-06Not applicableUs
GlimepirideTablet2 mg/1OralA S Medication Solutions2012-01-012017-06-20Us
GlimepirideTablet1 mg/1Oralbryant ranch prepack2005-10-06Not applicableUs
GlimepirideTablet2 mg/1OralCardinal Health2007-08-232017-04-25Us
GlimepirideTablet2 mg/1OralPerrigo New York Inc.2005-10-062017-01-18Us
GlimepirideTablet4 mg/1OralBlenheim Pharmacal, Inc.2013-10-08Not applicableUs55111 0322 01 nlmimage10 37079bfc
GlimepirideTablet2 mg/1OralVirtus Pharmaceuticals2013-12-15Not applicableUs76439 0124 10 nlmimage10 ca406523
GlimepirideTablet4 mg/1OralAccord Healthcare Limited2007-08-23Not applicableUs
GlimepirideTablet2 mg/1OralMed Vantx, Inc.2012-04-19Not applicableUs
GlimepirideTablet1 mg/1OralPd Rx Pharmaceuticals, Inc.2012-01-01Not applicableUs
GlimepirideTablet4 mg/1OralPreferreed Pharmaceuticals Inc.2016-07-11Not applicableUs
GlimepirideTablet1 mg/1OralBlue Point Laboratories2014-02-26Not applicableUs
GlimepirideTablet2 mg/1OralRemedy Repack2015-03-162017-04-14Us
GlimepirideTablet1 mg/1OralAmerincan Health Packaging2014-07-30Not applicableUs
GlimepirideTablet4 mg/1OralA S Medication Solutions2005-10-062017-06-20Us
GlimepirideTablet4 mg/1OralA S Medication Solutions2007-08-232017-06-20Us
GlimepirideTablet1 mg/1Oralbryant ranch prepack2007-08-23Not applicableUs
GlimepirideTablet3 mg/1OralMicro Labs Limited2013-06-13Not applicableUs
GlimepirideTablet1 mg/1OralSolco healthcare U.S., LLC2017-01-30Not applicableUs
GlimepirideTablet2 mg/1OralGolden State Medical Supply2009-08-17Not applicableUs
GlimepirideTablet2 mg/1OralRed Pharm Drug, Inc.2007-08-23Not applicableUs
GlimepirideTablet2 mg/1OralSt. Marys Medical Park Pharmacy2013-05-09Not applicableUs
GlimepirideTablet4 mg/1OralMylan Institutional2006-03-27Not applicableUs
GlimepirideTablet1 mg/1OralRebel Distributors2005-10-06Not applicableUs
GlimepirideTablet2 mg/1OralClinical Solutions Wholsesale2005-10-062017-06-27Us
GlimepirideTablet8 mg/1OralMicro Labs Limited2013-06-13Not applicableUs
GlimepirideTablet4 mg/1OralInternational Laboratories, Llc2009-02-06Not applicableUs
GlimepirideTablet4 mg/1OralPhysicians Total Care, Inc.2005-10-19Not applicableUs00093 7256 01 nlmimage10 ea267553
GlimepirideTablet2 mg/1OralPd Rx Pharmaceuticals, Inc.2007-08-23Not applicableUs
GlimepirideTablet4 mg/1OralNucare Pharmaceuticals, Inc.2007-08-23Not applicableUs
GlimepirideTablet1 mg/1OralNcs Health Care Of Ky, Inc Dba Vangard Labs2005-10-06Not applicableUs
GlimepirideTablet4 mg/1OralVirtus Pharmaceuticals2015-07-14Not applicableUs
GlimepirideTablet1 mg/1OralAccord Healthcare Limited2007-08-23Not applicableUs16729 0001 01 nlmimage10 ac3b567a
GlimepirideTablet4 mg/1OralDirectrx2015-01-01Not applicableUs
GlimepirideTablet2 mg/1OralCarlsbad Technology, Inc.2012-01-01Not applicableUs
GlimepirideTablet2 mg/1OralRemedy Repack2013-05-152017-01-18Us55111 0321 01 nlmimage10 35079aac
GlimepirideTablet1 mg/1OralLake Erie Medical Dba Quality Care Produts Llc2005-10-06Not applicableUs55111 0320 01 nlmimage10 2f0797ac
GlimepirideTablet2 mg/1OralLiberty Pharmaceuticals, Inc.2012-01-01Not applicableUs
GlimepirideTablet1 mg/1OralProficient Rx LP2007-08-23Not applicableUs
GlimepirideTablet2 mg/1OralPreferreed Pharmaceuticals Inc.2016-11-03Not applicableUs
GlimepirideTablet4 mg/1OralDirectrx2016-02-04Not applicableUs
GlimepirideTablet4 mg/1OralDr Reddy's Laboratories2005-10-06Not applicableUs
GlimepirideTablet2 mg/1OralNucare Pharmaceuticals, Inc.2015-07-14Not applicableUs
GlimepirideTablet2 mg/1OralAurobindo Pharma2012-06-29Not applicableUs
GlimepirideTablet2 mg/1OralBionpharma Inc.2015-10-01Not applicableUs
GlimepirideTablet4 mg/1OralTeva2005-10-06Not applicableUs
GlimepirideTablet4 mg/1OralRed Pharm Drug, Inc.2007-08-23Not applicableUs
GlimepirideTablet2 mg/1OralA S Medication Solutions2007-08-232017-06-20Us
GlimepirideTablet4 mg/1OralQualitest2010-10-142018-09-22Us00603 3746 28 nlmimage10 a345d1ae
GlimepirideTablet2 mg/1OralPd Rx Pharmaceuticals, Inc.2012-01-01Not applicableUs
GlimepirideTablet4 mg/1OralUnit Dose Services2007-08-23Not applicableUs
GlimepirideTablet2 mg/1OralBlue Point Laboratories2014-02-26Not applicableUs
GlimepirideTablet1 mg/1OralMicro Labs Limited2013-06-13Not applicableUs
GlimepirideTablet2 mg/1OralCardinal Health2010-11-04Not applicableUs
GlimepirideTablet2 mg/1Oralbryant ranch prepack2005-10-06Not applicableUs
GlimepirideTablet1 mg/1OralPd Rx Pharmaceuticals, Inc.2005-10-06Not applicableUs
GlimepirideTablet4 mg/1OralCardinal Health2007-08-232017-04-25Us16729 0003 01 nlmimage10 ea407543
GlimepirideTablet4 mg/1OralPerrigo New York Inc.2005-10-062017-01-18Us
GlimepirideTablet2 mg/1OralRebel Distributors2005-10-06Not applicableUs
GlimepirideTablet4 mg/1OralVirtus Pharmaceuticals2013-12-15Not applicableUs76439 0125 10 nlmimage10 39409ce4
GlimepirideTablet2 mg/1OralUnit Dose Services2005-10-06Not applicableUs
GlimepirideTablet2 mg/1OralAmerincan Health Packaging2009-05-12Not applicableUs
Approved Over the Counter ProductsNot Available
Unapproved/Other Products Not Available
International Brands
GLIMPIDRanbaxy Laboratories
GLIMYDr.Reddy's Labs
Brand mixtures
AvaglimSmith Kline Beecham
AvandarylGlaxosmithkline Inc
Pioglitazone and GlimepiridePrasco, Laboratories
Pioglitazone Hydrochloride and GlimepirideSandoz
TandemactTakeda Pharma A/S
CAS number93479-97-1
WeightAverage: 490.62
Monoisotopic: 490.224991385
Chemical FormulaC24H34N4O5S
3-ethyl-4-methyl-2-oxo-N-(2-{4-[({[(1r,4r)-4-methylcyclohexyl]-C-hydroxycarbonimidoyl}amino)sulfonyl]phenyl}ethyl)-2,5-dihydro-1H-pyrrole-1-carboximidic acid

For concomitant use with insulin for the treatment of noninsulin-dependent (type 2) diabetes mellitus.

Structured Indications

Glimepiride, like glyburide and glipizide, is a "second-generation" sulfonylurea agents. Glimepiride is used with diet to lower blood glucose by increasing the secretion of insulin from pancreas and increasing the sensitivity of peripheral tissues to insulin.

Mechanism of action

The mechanism of action of glimepiride in lowering blood glucose appears to be dependent on stimulating the release of insulin from functioning pancreatic beta cells, and increasing sensitivity of peripheral tissues to insulin. Glimepiride likely binds to ATP-sensitive potassium channel receptors on the pancreatic cell surface, reducing potassium conductance and causing depolarization of the membrane. Membrane depolarization stimulates calcium ion influx through voltage-sensitive calcium channels. This increase in intracellular calcium ion concentration induces the secretion of insulin.

TargetKindPharmacological actionActionsOrganismUniProt ID
ATP-sensitive inward rectifier potassium channel 11Proteinyes
HumanQ14654 details
ATP-sensitive inward rectifier potassium channel 1Proteinyes
HumanP48048 details
ATP-binding cassette sub-family C member 8Proteinyes
HumanQ09428 details
Related Articles

Completely (100%) absorbed following oral administration.

Volume of distribution
  • 21.8 ± 13.9 L [Volunteers]
  • 19.8 ± 12.7 L [Patients with Type 2 diabetes, Single Dose]
  • 37.1 ± 18.2 L [Patients with Type 2 diabetes, Multiple Dose]
Protein binding

Over 99.5% bound to plasma protein.


Hepatic. Following either an intravenous or oral dose, glimepiride is completely metabolized by oxidative biotransformation to a major metabolite, cyclohexyl hydroxymethyl derivative (M1), via the hepatic cytochrome P450 II C9 subsystem. M1 is further metabolized to the carboxyl derivative (M2) by one or several cytosolic enzymes. M1, but not M2, possessed approximately one third of the pharmacologic activity of its parent in an animal model. However, whether the glucose-lowering effect of M1 is clinically significant is not clear.

Cyclohexyl hydroxymethyl glimepirideDetails
Cyclohexyl hydroxymethyl glimepiride
Cyclohexyl carboxyl glimepirideDetails
Route of eliminationNot Available
Half life

Approximately 5 hours following single dose.

  • 52.1 +/- 16.0 mL/min [Normal subjects with single oral dose]
  • 48.5 +/- 29.3 mL/min [Patients with Type 2 diabetes, with single oral dose]
  • 52.7 +/- 40.3 mL/min [Patients with Type 2 diabetes, with multiple oral dose]
  • 47.8 mL/min [healthy after intravenous (IV) dosing]

Severe hypoglycemic reactions with coma, seizure, or other neurological impairment.

Affected organisms
  • Humans and other mammals
PathwaysNot Available
Pharmacogenomic Effects/ADRs
Interacting Gene/EnzymeAllele nameGenotype(s)Defining Change(s)Type(s)DescriptionDetails
Glucose-6-phosphate 1-dehydrogenaseVilleurbanneNot Available1000_1002delACCADR InferredIncreased risk of hemolytic anemia. Details
Glucose-6-phosphate 1-dehydrogenaseTorunNot Available1006A->GADR InferredIncreased risk of hemolytic anemia. Details
Glucose-6-phosphate 1-dehydrogenaseSunderlandNot Available105_107delCATADR InferredIncreased risk of hemolytic anemia. Details
Glucose-6-phosphate 1-dehydrogenaseIwatsukiNot Available1081G->AADR InferredIncreased risk of hemolytic anemia. Details
Glucose-6-phosphate 1-dehydrogenaseSerresNot Available1082C->TADR InferredIncreased risk of hemolytic anemia. Details
Glucose-6-phosphate 1-dehydrogenaseTondelaNot Available1084_1101delCTGAACGAGCGCAAGGCCADR InferredIncreased risk of hemolytic anemia. Details
Glucose-6-phosphate 1-dehydrogenaseLoma LindaNot Available1089C->AADR InferredIncreased risk of hemolytic anemia. Details
Glucose-6-phosphate 1-dehydrogenaseAachenNot Available1089C->GADR InferredIncreased risk of hemolytic anemia. Details
Glucose-6-phosphate 1-dehydrogenaseTenriNot Available1096A->GADR InferredIncreased risk of hemolytic anemia. Details
Glucose-6-phosphate 1-dehydrogenaseMontpellierNot Available1132G>AADR InferredIncreased risk of hemolytic anemia. Details
Glucose-6-phosphate 1-dehydrogenaseCalvo MackennaNot Available1138A->GADR InferredIncreased risk of hemolytic anemia. Details
Glucose-6-phosphate 1-dehydrogenaseRileyNot Available1139T->CADR InferredIncreased risk of hemolytic anemia. Details
Glucose-6-phosphate 1-dehydrogenaseOlomoucNot Available1141T->CADR InferredIncreased risk of hemolytic anemia. Details
Glucose-6-phosphate 1-dehydrogenaseTomahNot Available1153T->CADR InferredIncreased risk of hemolytic anemia. Details
Glucose-6-phosphate 1-dehydrogenaseLynwoodNot Available1154G->TADR InferredIncreased risk of hemolytic anemia. Details
Glucose-6-phosphate 1-dehydrogenaseMadridNot Available1155C->GADR InferredIncreased risk of hemolytic anemia. Details
Glucose-6-phosphate 1-dehydrogenaseIowa, Walter Reed, SpringfieldNot Available1156A->GADR InferredIncreased risk of hemolytic anemia. Details
Glucose-6-phosphate 1-dehydrogenaseBeverly Hills, Genova, Iwate, Niigata, YamaguchiNot Available1160G->AADR InferredIncreased risk of hemolytic anemia. Details
Glucose-6-phosphate 1-dehydrogenaseHartfordNot Available1162A->GADR InferredIncreased risk of hemolytic anemia. Details
Glucose-6-phosphate 1-dehydrogenasePrahaNot Available1166A->GADR InferredIncreased risk of hemolytic anemia. Details
Glucose-6-phosphate 1-dehydrogenaseKrakowNot Available1175T>CADR InferredIncreased risk of hemolytic anemia. Details
Glucose-6-phosphate 1-dehydrogenaseWisconsinNot Available1177C->GADR InferredIncreased risk of hemolytic anemia. Details
Glucose-6-phosphate 1-dehydrogenaseNashville, Anaheim, PorticiNot Available1178G->AADR InferredIncreased risk of hemolytic anemia. Details
Glucose-6-phosphate 1-dehydrogenaseAlhambraNot Available1180G->CADR InferredIncreased risk of hemolytic anemia. Details
Glucose-6-phosphate 1-dehydrogenaseBariNot Available1187C->TADR InferredIncreased risk of hemolytic anemia. Details
Glucose-6-phosphate 1-dehydrogenasePuerto LimonNot Available1192G->AADR InferredIncreased risk of hemolytic anemia. Details
Glucose-6-phosphate 1-dehydrogenaseCovao do LoboNot Available1205C>AADR InferredIncreased risk of hemolytic anemia. Details
Glucose-6-phosphate 1-dehydrogenaseClinicNot Available1215G->AADR InferredIncreased risk of hemolytic anemia. Details
Glucose-6-phosphate 1-dehydrogenaseUtrechtNot Available1225C->TADR InferredIncreased risk of hemolytic anemia. Details
Glucose-6-phosphate 1-dehydrogenaseSuwalkiNot Available1226C->GADR InferredIncreased risk of hemolytic anemia. Details
Glucose-6-phosphate 1-dehydrogenaseRiversideNot Available1228G->TADR InferredIncreased risk of hemolytic anemia. Details
Glucose-6-phosphate 1-dehydrogenaseJapan, ShinagawaNot Available1229G->AADR InferredIncreased risk of hemolytic anemia. Details
Glucose-6-phosphate 1-dehydrogenaseKawasakiNot Available1229G->CADR InferredIncreased risk of hemolytic anemia. Details
Glucose-6-phosphate 1-dehydrogenaseMunichNot Available1231A->GADR InferredIncreased risk of hemolytic anemia. Details
Glucose-6-phosphate 1-dehydrogenaseGeorgiaNot Available1284C->AADR InferredIncreased risk of hemolytic anemia. Details
Glucose-6-phosphate 1-dehydrogenaseSumareNot Available1292T->GADR InferredIncreased risk of hemolytic anemia. Details
Glucose-6-phosphate 1-dehydrogenaseTelti/KobeNot Available1318C->TADR InferredIncreased risk of hemolytic anemia. Details
Glucose-6-phosphate 1-dehydrogenaseSantiago de Cuba, MoriokaNot Available1339G->AADR InferredIncreased risk of hemolytic anemia. Details
Glucose-6-phosphate 1-dehydrogenaseHarimaNot Available1358T->AADR InferredIncreased risk of hemolytic anemia. Details
Glucose-6-phosphate 1-dehydrogenaseFiguera da FozNot Available1366G->CADR InferredIncreased risk of hemolytic anemia. Details
Glucose-6-phosphate 1-dehydrogenaseAmiensNot Available1367A>TADR InferredIncreased risk of hemolytic anemia. Details
Glucose-6-phosphate 1-dehydrogenaseBangkok NoiNot Available1376G->T, 1502T->GADR InferredIncreased risk of hemolytic anemia. Details
Glucose-6-phosphate 1-dehydrogenaseFukayaNot Available1462G->AADR InferredIncreased risk of hemolytic anemia. Details
Glucose-6-phosphate 1-dehydrogenaseCampinasNot Available1463G->TADR InferredIncreased risk of hemolytic anemia. Details
Glucose-6-phosphate 1-dehydrogenaseBuenos AiresNot Available1465C>TADR InferredIncreased risk of hemolytic anemia. Details
Glucose-6-phosphate 1-dehydrogenaseArakawaNot Available1466C->TADR InferredIncreased risk of hemolytic anemia. Details
Glucose-6-phosphate 1-dehydrogenaseBrightonNot Available1488_1490delGAAADR InferredIncreased risk of hemolytic anemia. Details
Glucose-6-phosphate 1-dehydrogenaseKozukataNot Available159G->CADR InferredIncreased risk of hemolytic anemia. Details
Glucose-6-phosphate 1-dehydrogenaseAmsterdamNot Available180_182delTCTADR InferredIncreased risk of hemolytic anemia. Details
Glucose-6-phosphate 1-dehydrogenaseNo nameNot Available202G->A, 376A->G, 1264C>GADR InferredIncreased risk of hemolytic anemia. Details
Glucose-6-phosphate 1-dehydrogenaseSwanseaNot Available224T->CADR InferredIncreased risk of hemolytic anemia. Details
Glucose-6-phosphate 1-dehydrogenaseUrayasuNot Available281_283delAGAADR InferredIncreased risk of hemolytic anemia. Details
Glucose-6-phosphate 1-dehydrogenaseVancouverNot Available317C->G544C->T592C->TADR InferredIncreased risk of hemolytic anemia. Details
Glucose-6-phosphate 1-dehydrogenaseMt SinaiNot Available376A->G, 1159C->TADR InferredIncreased risk of hemolytic anemia. Details
Glucose-6-phosphate 1-dehydrogenasePlymouthNot Available488G->AADR InferredIncreased risk of hemolytic anemia. Details
Glucose-6-phosphate 1-dehydrogenaseVolendamNot Available514C->TADR InferredIncreased risk of hemolytic anemia. Details
Glucose-6-phosphate 1-dehydrogenaseShinshuNot Available527A->GADR InferredIncreased risk of hemolytic anemia. Details
Glucose-6-phosphate 1-dehydrogenaseChikugoNot Available535A->TADR InferredIncreased risk of hemolytic anemia. Details
Glucose-6-phosphate 1-dehydrogenaseTsukuiNot Available561_563delCTCADR InferredIncreased risk of hemolytic anemia. Details
Glucose-6-phosphate 1-dehydrogenasePedoplis-CkaroNot Available573C>GADR InferredIncreased risk of hemolytic anemia. Details
Glucose-6-phosphate 1-dehydrogenaseSantiagoNot Available593G->CADR InferredIncreased risk of hemolytic anemia. Details
Glucose-6-phosphate 1-dehydrogenaseMinnesota, Marion, Gastonia, LeJeuneNot Available637G->TADR InferredIncreased risk of hemolytic anemia. Details
Glucose-6-phosphate 1-dehydrogenaseCincinnatiNot Available637G->T, 1037A->TADR InferredIncreased risk of hemolytic anemia. Details
Glucose-6-phosphate 1-dehydrogenaseHarilaouNot Available648T->GADR InferredIncreased risk of hemolytic anemia. Details
Glucose-6-phosphate 1-dehydrogenaseNorth DallasNot Available683_685delACAADR InferredIncreased risk of hemolytic anemia. Details
Glucose-6-phosphate 1-dehydrogenaseAsahikawaNot Available695G->AADR InferredIncreased risk of hemolytic anemia. Details
Glucose-6-phosphate 1-dehydrogenaseDurhamNot Available713A->GADR InferredIncreased risk of hemolytic anemia. Details
Glucose-6-phosphate 1-dehydrogenaseStonybrookNot Available724_729delGGCACTADR InferredIncreased risk of hemolytic anemia. Details
Glucose-6-phosphate 1-dehydrogenaseWayneNot Available769C->GADR InferredIncreased risk of hemolytic anemia. Details
Glucose-6-phosphate 1-dehydrogenaseAveiroNot Available806G->AADR InferredIncreased risk of hemolytic anemia. Details
Glucose-6-phosphate 1-dehydrogenaseCleveland CorumNot Available820G->AADR InferredIncreased risk of hemolytic anemia. Details
Glucose-6-phosphate 1-dehydrogenaseLilleNot Available821A>TADR InferredIncreased risk of hemolytic anemia. Details
Glucose-6-phosphate 1-dehydrogenaseBangkokNot Available825G>CADR InferredIncreased risk of hemolytic anemia. Details
Glucose-6-phosphate 1-dehydrogenaseSugaoNot Available826C->TADR InferredIncreased risk of hemolytic anemia. Details
Glucose-6-phosphate 1-dehydrogenaseLa JollaNot Available832T->CADR InferredIncreased risk of hemolytic anemia. Details
Glucose-6-phosphate 1-dehydrogenaseWexhamNot Available833C->TADR InferredIncreased risk of hemolytic anemia. Details
Glucose-6-phosphate 1-dehydrogenasePiotrkowNot Available851T>CADR InferredIncreased risk of hemolytic anemia. Details
Glucose-6-phosphate 1-dehydrogenaseWest VirginiaNot Available910G->TADR InferredIncreased risk of hemolytic anemia. Details
Glucose-6-phosphate 1-dehydrogenaseOmiyaNot Available921G->CADR InferredIncreased risk of hemolytic anemia. Details
Glucose-6-phosphate 1-dehydrogenaseNaraNot Available953_976delCCACCAAAGGGTACCTGGAC GACCADR InferredIncreased risk of hemolytic anemia. Details
Glucose-6-phosphate 1-dehydrogenaseManhattanNot Available962G->AADR InferredIncreased risk of hemolytic anemia. Details
Glucose-6-phosphate 1-dehydrogenaseRehevotNot Available964T->CADR InferredIncreased risk of hemolytic anemia. Details
Glucose-6-phosphate 1-dehydrogenaseHoniaraNot Available99A->G / 1360C->TADR InferredIncreased risk of hemolytic anemia. Details
Glucose-6-phosphate 1-dehydrogenaseTokyo, FukushimaNot Available1246G->AADR InferredIncreased risk of hemolytic anemia. Details
Glucose-6-phosphate 1-dehydrogenaseChathamNot Available1003G->AADR InferredIncreased risk of hemolytic anemia. Details
Glucose-6-phosphate 1-dehydrogenaseFushanNot Available1004C->AADR InferredIncreased risk of hemolytic anemia. Details
Glucose-6-phosphate 1-dehydrogenasePartenopeNot Available1052G->TADR InferredIncreased risk of hemolytic anemia. Details
Glucose-6-phosphate 1-dehydrogenaseIerapetraNot Available1057C->TADR InferredIncreased risk of hemolytic anemia. Details
Glucose-6-phosphate 1-dehydrogenaseAnadiaNot Available1193A->GADR InferredIncreased risk of hemolytic anemia. Details
Glucose-6-phosphate 1-dehydrogenaseAbenoNot Available1220A->CADR InferredIncreased risk of hemolytic anemia. Details
Glucose-6-phosphate 1-dehydrogenaseSurabayaNot Available1291G->AADR InferredIncreased risk of hemolytic anemia. Details
Glucose-6-phosphate 1-dehydrogenasePawneeNot Available1316G->CADR InferredIncreased risk of hemolytic anemia. Details
Glucose-6-phosphate 1-dehydrogenaseS. AntiocoNot Available1342A->GADR InferredIncreased risk of hemolytic anemia. Details
Glucose-6-phosphate 1-dehydrogenaseCassanoNot Available1347G->CADR InferredIncreased risk of hemolytic anemia. Details
Glucose-6-phosphate 1-dehydrogenaseHermoupolisNot Available1347G->C / 1360C->TADR InferredIncreased risk of hemolytic anemia. Details
Glucose-6-phosphate 1-dehydrogenaseUnion,Maewo, Chinese-2, KaloNot Available1360C->TADR InferredIncreased risk of hemolytic anemia. Details
Glucose-6-phosphate 1-dehydrogenaseAndalusNot Available1361G->AADR InferredIncreased risk of hemolytic anemia. Details
Glucose-6-phosphate 1-dehydrogenaseCosenzaNot Available1376G->CADR InferredIncreased risk of hemolytic anemia. Details
Glucose-6-phosphate 1-dehydrogenaseCanton, Taiwan- Hakka, Gifu-like, Agrigento-likeNot Available1376G->TADR InferredIncreased risk of hemolytic anemia. Details
Glucose-6-phosphate 1-dehydrogenaseFloresNot Available1387C->AADR InferredIncreased risk of hemolytic anemia. Details
Glucose-6-phosphate 1-dehydrogenaseKaiping, Anant, Dhon, Sapporo-like, WoseraNot Available1388G->AADR InferredIncreased risk of hemolytic anemia. Details
Glucose-6-phosphate 1-dehydrogenaseKamogawaNot Available169C->TADR InferredIncreased risk of hemolytic anemia. Details
Glucose-6-phosphate 1-dehydrogenaseCostanzoNot Available179T>CADR InferredIncreased risk of hemolytic anemia. Details
Glucose-6-phosphate 1-dehydrogenaseAmazoniaNot Available185C->AADR InferredIncreased risk of hemolytic anemia. Details
Glucose-6-phosphate 1-dehydrogenaseSongklanagarindNot Available196T->AADR InferredIncreased risk of hemolytic anemia. Details
Glucose-6-phosphate 1-dehydrogenaseHechiNot Available202G->A / 871G->AADR InferredIncreased risk of hemolytic anemia. Details
Glucose-6-phosphate 1-dehydrogenaseNamouruNot Available208T->CADR InferredIncreased risk of hemolytic anemia. Details
Glucose-6-phosphate 1-dehydrogenaseBao LocNot Available352T>CADR InferredIncreased risk of hemolytic anemia. Details
Glucose-6-phosphate 1-dehydrogenaseCrispimNot Available375G->T, 379G->T383T->C384C>TADR InferredIncreased risk of hemolytic anemia. Details
Glucose-6-phosphate 1-dehydrogenaseAcrokorinthosNot Available376A->G / 463C->GADR InferredIncreased risk of hemolytic anemia. Details
Glucose-6-phosphate 1-dehydrogenaseSanta MariaNot Available376A->G / 542A->TADR InferredIncreased risk of hemolytic anemia. Details
Glucose-6-phosphate 1-dehydrogenaseAnanindeuaNot Available376A->G / 871G->AADR InferredIncreased risk of hemolytic anemia. Details
Glucose-6-phosphate 1-dehydrogenaseVanua LavaNot Available383T->CADR InferredIncreased risk of hemolytic anemia. Details
Glucose-6-phosphate 1-dehydrogenaseValladolidNot Available406C->TADR InferredIncreased risk of hemolytic anemia. Details
Glucose-6-phosphate 1-dehydrogenaseBelemNot Available409C->TADR InferredIncreased risk of hemolytic anemia. Details
Glucose-6-phosphate 1-dehydrogenaseLiuzhouNot Available442G->AADR InferredIncreased risk of hemolytic anemia. Details
Glucose-6-phosphate 1-dehydrogenaseShenzenNot Available473G>AADR InferredIncreased risk of hemolytic anemia. Details
Glucose-6-phosphate 1-dehydrogenaseTaipei “Chinese- 3”Not Available493A->GADR InferredIncreased risk of hemolytic anemia. Details
Glucose-6-phosphate 1-dehydrogenaseToledoNot Available496C>TADR InferredIncreased risk of hemolytic anemia. Details
Glucose-6-phosphate 1-dehydrogenaseNaoneNot Available497G->AADR InferredIncreased risk of hemolytic anemia. Details
Glucose-6-phosphate 1-dehydrogenaseNankangNot Available517T->CADR InferredIncreased risk of hemolytic anemia. Details
Glucose-6-phosphate 1-dehydrogenaseMiaoliNot Available519C->GADR InferredIncreased risk of hemolytic anemia. Details
Glucose-6-phosphate 1-dehydrogenaseMediterranean, Dallas, Panama‚ Sassari, Cagliari, BirminghamNot Available563C->TADR InferredIncreased risk of hemolytic anemia. Details
Glucose-6-phosphate 1-dehydrogenaseCoimbra ShundeNot Available592C->TADR InferredIncreased risk of hemolytic anemia. Details
Glucose-6-phosphate 1-dehydrogenaseNilgiriNot Available593G>AADR InferredIncreased risk of hemolytic anemia. Details
Glucose-6-phosphate 1-dehydrogenaseRadlowoNot Available679C->TADR InferredIncreased risk of hemolytic anemia. Details
Glucose-6-phosphate 1-dehydrogenaseRoubaixNot Available811G>CADR InferredIncreased risk of hemolytic anemia. Details
Glucose-6-phosphate 1-dehydrogenaseHaikouNot Available835A->GADR InferredIncreased risk of hemolytic anemia. Details
Glucose-6-phosphate 1-dehydrogenaseChinese-1Not Available835A->TADR InferredIncreased risk of hemolytic anemia. Details
Glucose-6-phosphate 1-dehydrogenaseMizushimaNot Available848A>GADR InferredIncreased risk of hemolytic anemia. Details
Glucose-6-phosphate 1-dehydrogenaseOsakaNot Available853C->TADR InferredIncreased risk of hemolytic anemia. Details
Glucose-6-phosphate 1-dehydrogenaseViangchan, JammuNot Available871G->AADR InferredIncreased risk of hemolytic anemia. Details
Glucose-6-phosphate 1-dehydrogenaseSeoulNot Available916G->AADR InferredIncreased risk of hemolytic anemia. Details
Glucose-6-phosphate 1-dehydrogenaseLudhianaNot Available929G->AADR InferredIncreased risk of hemolytic anemia. Details
Glucose-6-phosphate 1-dehydrogenaseFarroupilhaNot Available977C->AADR InferredIncreased risk of hemolytic anemia. Details
Glucose-6-phosphate 1-dehydrogenaseChinese-5Not Available1024C->TADR InferredIncreased risk of hemolytic anemia. Details
Glucose-6-phosphate 1-dehydrogenaseRignanoNot Available130G>AADR InferredIncreased risk of hemolytic anemia. Details
Glucose-6-phosphate 1-dehydrogenaseOrissaNot Available131C->GADR InferredIncreased risk of hemolytic anemia. Details
Glucose-6-phosphate 1-dehydrogenaseG6PDNiceNot Available1380G>CADR InferredIncreased risk of hemolytic anemia. Details
Glucose-6-phosphate 1-dehydrogenaseKamiube, KeelungNot Available1387C->TADR InferredIncreased risk of hemolytic anemia. Details
Glucose-6-phosphate 1-dehydrogenaseNeapolisNot Available1400C->GADR InferredIncreased risk of hemolytic anemia. Details
Glucose-6-phosphate 1-dehydrogenaseAuresNot Available143T->CADR InferredIncreased risk of hemolytic anemia. Details
Glucose-6-phosphate 1-dehydrogenaseSplitNot Available1442C->GADR InferredIncreased risk of hemolytic anemia. Details
Glucose-6-phosphate 1-dehydrogenaseKambosNot Available148C->TADR InferredIncreased risk of hemolytic anemia. Details
Glucose-6-phosphate 1-dehydrogenasePalestrinaNot Available170G>AADR InferredIncreased risk of hemolytic anemia. Details
Glucose-6-phosphate 1-dehydrogenaseMetapontoNot Available172G->AADR InferredIncreased risk of hemolytic anemia. Details
Glucose-6-phosphate 1-dehydrogenaseMusashinoNot Available185C->TADR InferredIncreased risk of hemolytic anemia. Details
Glucose-6-phosphate 1-dehydrogenaseAsahiNot Available202G->AADR InferredIncreased risk of hemolytic anemia. Details
Glucose-6-phosphate 1-dehydrogenaseA- (202), Ferrara INot Available202G->A / 376A->GADR InferredIncreased risk of hemolytic anemia. Details
Glucose-6-phosphate 1-dehydrogenaseMurcia OristanoNot Available209A->GADR InferredIncreased risk of hemolytic anemia. Details
Glucose-6-phosphate 1-dehydrogenaseUbe KonanNot Available241C->TADR InferredIncreased risk of hemolytic anemia. Details
Glucose-6-phosphate 1-dehydrogenaseLagosantoNot Available242G->AADR InferredIncreased risk of hemolytic anemia. Details
Glucose-6-phosphate 1-dehydrogenaseGuangzhouNot Available274C->TADR InferredIncreased risk of hemolytic anemia. Details
Glucose-6-phosphate 1-dehydrogenaseHammersmithNot Available323T->AADR InferredIncreased risk of hemolytic anemia. Details
Glucose-6-phosphate 1-dehydrogenaseSinnaiNot Available34G->TADR InferredIncreased risk of hemolytic anemia. Details
Glucose-6-phosphate 1-dehydrogenaseA- (680)Not Available376A->G / 680G->TADR InferredIncreased risk of hemolytic anemia. Details
Glucose-6-phosphate 1-dehydrogenaseA- (968), Betica,Selma, GuantanamoNot Available376A->G / 968T->CADR InferredIncreased risk of hemolytic anemia. Details
Glucose-6-phosphate 1-dehydrogenaseSalerno PyrgosNot Available383T>GADR InferredIncreased risk of hemolytic anemia. Details
Glucose-6-phosphate 1-dehydrogenaseQuing YanNot Available392G->TADR InferredIncreased risk of hemolytic anemia. Details
Glucose-6-phosphate 1-dehydrogenaseLagesNot Available40G->AADR InferredIncreased risk of hemolytic anemia. Details
Glucose-6-phosphate 1-dehydrogenaseIleshaNot Available466G->AADR InferredIncreased risk of hemolytic anemia. Details
Glucose-6-phosphate 1-dehydrogenaseMahidolNot Available487G->AADR InferredIncreased risk of hemolytic anemia. Details
Glucose-6-phosphate 1-dehydrogenaseMalagaNot Available542A->TADR InferredIncreased risk of hemolytic anemia. Details
Glucose-6-phosphate 1-dehydrogenaseSibariNot Available634A->GADR InferredIncreased risk of hemolytic anemia. Details
Glucose-6-phosphate 1-dehydrogenaseMexico CityNot Available680G->AADR InferredIncreased risk of hemolytic anemia. Details
Glucose-6-phosphate 1-dehydrogenaseNanningNot Available703C->TADR InferredIncreased risk of hemolytic anemia. Details
Glucose-6-phosphate 1-dehydrogenaseSeattle, Lodi, Modena, Ferrara II, Athens-likeNot Available844G->CADR InferredIncreased risk of hemolytic anemia. Details
Glucose-6-phosphate 1-dehydrogenaseBajo MaumereNot Available844G->TADR InferredIncreased risk of hemolytic anemia. Details
Glucose-6-phosphate 1-dehydrogenaseMontalbanoNot Available854G->AADR InferredIncreased risk of hemolytic anemia. Details
Glucose-6-phosphate 1-dehydrogenaseKalyan-Kerala, Jamnaga, RohiniNot Available949G->AADR InferredIncreased risk of hemolytic anemia. Details
Glucose-6-phosphate 1-dehydrogenaseGaoheNot Available95A->GADR InferredIncreased risk of hemolytic anemia. Details
Drug Interactions
DrugInteractionDrug group
2,4-thiazolidinedioneThiazolidinedione may increase the hypoglycemic activities of Glimepiride.Investigational
7,8-Dichloro-1,2,3,4-tetrahydroisoquinoline7,8-DICHLORO-1,2,3,4-TETRAHYDROISOQUINOLINE may increase the hypoglycemic activities of Glimepiride.Experimental
AbirateroneThe metabolism of Glimepiride can be decreased when combined with Abiraterone.Approved
AcarboseAcarbose may increase the hypoglycemic activities of Glimepiride.Approved, Investigational
AcebutololAcebutolol may increase the hypoglycemic activities of Glimepiride.Approved
AcenocoumarolGlimepiride may increase the anticoagulant activities of Acenocoumarol.Approved
AcetohexamideAcetohexamide may increase the hypoglycemic activities of Glimepiride.Withdrawn
Acetylsalicylic acidAcetylsalicylic acid may increase the hypoglycemic activities of Glimepiride.Approved, Vet Approved
AICA ribonucleotideAicar may increase the hypoglycemic activities of Glimepiride.Experimental
AlbiglutideAlbiglutide may increase the hypoglycemic activities of Glimepiride.Approved
AlogliptinAlogliptin may increase the hypoglycemic activities of Glimepiride.Approved
AlprenololAlprenolol may increase the hypoglycemic activities of Glimepiride.Approved, Withdrawn
Aminosalicylic AcidAminosalicylic Acid may increase the hypoglycemic activities of Glimepiride.Approved
AmiodaroneThe metabolism of Glimepiride can be decreased when combined with Amiodarone.Approved, Investigational
AprepitantThe metabolism of Glimepiride can be increased when combined with Aprepitant.Approved, Investigational
AripiprazoleThe therapeutic efficacy of Glimepiride can be decreased when used in combination with Aripiprazole.Approved, Investigational
ArotinololArotinolol may increase the hypoglycemic activities of Glimepiride.Approved
Arsenic trioxideThe therapeutic efficacy of Glimepiride can be decreased when used in combination with Arsenic trioxide.Approved, Investigational
ArticaineThe therapeutic efficacy of Glimepiride can be decreased when used in combination with Articaine.Approved
AsenapineThe therapeutic efficacy of Glimepiride can be decreased when used in combination with Asenapine.Approved
AtazanavirThe therapeutic efficacy of Glimepiride can be decreased when used in combination with Atazanavir.Approved, Investigational
AtenololAtenolol may increase the hypoglycemic activities of Glimepiride.Approved
AtorvastatinAtorvastatin may increase the hypoglycemic activities of Glimepiride.Approved
BalaglitazoneBalaglitazone may increase the hypoglycemic activities of Glimepiride.Investigational
BalsalazideBalsalazide may increase the hypoglycemic activities of Glimepiride.Approved, Investigational
BCG vaccineThe therapeutic efficacy of Bcg can be decreased when used in combination with Glimepiride.Investigational
BefunololBefunolol may increase the hypoglycemic activities of Glimepiride.Experimental
BendroflumethiazideThe therapeutic efficacy of Glimepiride can be decreased when used in combination with Bendroflumethiazide.Approved
BenmoxinBenmoxin may increase the hypoglycemic activities of Glimepiride.Withdrawn
BetamethasoneThe therapeutic efficacy of Glimepiride can be decreased when used in combination with Betamethasone.Approved, Vet Approved
BetaxololBetaxolol may increase the hypoglycemic activities of Glimepiride.Approved
BevantololBevantolol may increase the hypoglycemic activities of Glimepiride.Approved
BezafibrateBezafibrate may increase the hypoglycemic activities of Glimepiride.Approved
BisoprololBisoprolol may increase the hypoglycemic activities of Glimepiride.Approved
BopindololBopindolol may increase the hypoglycemic activities of Glimepiride.Approved
BrexpiprazoleThe therapeutic efficacy of Glimepiride can be decreased when used in combination with Brexpiprazole.Approved
BucindololBucindolol may increase the hypoglycemic activities of Glimepiride.Investigational
BuforminBuformin may increase the hypoglycemic activities of Glimepiride.Withdrawn
BufuralolBufuralol may increase the hypoglycemic activities of Glimepiride.Experimental, Investigational
BumetanideThe therapeutic efficacy of Glimepiride can be decreased when used in combination with Bumetanide.Approved
BupranololBupranolol may increase the hypoglycemic activities of Glimepiride.Approved
BuserelinThe therapeutic efficacy of Glimepiride can be decreased when used in combination with Buserelin.Approved
CanagliflozinCanagliflozin may increase the hypoglycemic activities of Glimepiride.Approved
CapecitabineThe metabolism of Glimepiride can be decreased when combined with Capecitabine.Approved, Investigational
CarbamazepineThe metabolism of Glimepiride can be increased when combined with Carbamazepine.Approved, Investigational
CarbocisteineThe risk or severity of adverse effects can be increased when Glimepiride is combined with Carbocisteine.Approved
CaroxazoneCaroxazone may increase the hypoglycemic activities of Glimepiride.Withdrawn
CarteololCarteolol may increase the hypoglycemic activities of Glimepiride.Approved
CarvedilolCarvedilol may increase the hypoglycemic activities of Glimepiride.Approved, Investigational
CastanospermineCastanospermine may increase the hypoglycemic activities of Glimepiride.Experimental
CeliprololCeliprolol may increase the hypoglycemic activities of Glimepiride.Approved, Investigational
CeritinibThe serum concentration of Glimepiride can be increased when it is combined with Ceritinib.Approved
ChloramphenicolThe metabolism of Glimepiride can be decreased when combined with Chloramphenicol.Approved, Vet Approved
ChlorothiazideThe therapeutic efficacy of Glimepiride can be decreased when used in combination with Chlorothiazide.Approved, Vet Approved
ChlorpropamideGlimepiride may increase the hypoglycemic activities of Chlorpropamide.Approved
ChlorthalidoneThe therapeutic efficacy of Glimepiride can be decreased when used in combination with Chlorthalidone.Approved
CholecalciferolThe metabolism of Glimepiride can be decreased when combined with Cholecalciferol.Approved, Nutraceutical
CiglitazoneCiglitazone may increase the hypoglycemic activities of Glimepiride.Experimental
CimetidineThe serum concentration of Glimepiride can be increased when it is combined with Cimetidine.Approved
CinoxacinCinoxacin may increase the hypoglycemic activities of Glimepiride.Approved, Withdrawn
CiprofloxacinCiprofloxacin may increase the hypoglycemic activities of Glimepiride.Approved, Investigational
CitalopramCitalopram may increase the hypoglycemic activities of Glimepiride.Approved
ClofibrateClofibrate may increase the hypoglycemic activities of Glimepiride.Approved
ClotrimazoleThe metabolism of Glimepiride can be decreased when combined with Clotrimazole.Approved, Vet Approved
ClozapineThe therapeutic efficacy of Glimepiride can be decreased when used in combination with Clozapine.Approved
ColesevelamThe serum concentration of Glimepiride can be decreased when it is combined with Colesevelam.Approved
CorticotropinThe therapeutic efficacy of Glimepiride can be decreased when used in combination with Corticotropin.Approved, Vet Approved
Cortisone acetateThe therapeutic efficacy of Glimepiride can be decreased when used in combination with Cortisone acetate.Approved
CyclosporineThe metabolism of Glimepiride can be decreased when combined with Cyclosporine.Approved, Investigational, Vet Approved
Cyproterone acetateThe therapeutic efficacy of Glimepiride can be decreased when used in combination with Cyproterone acetate.Approved, Investigational
DabrafenibThe serum concentration of Glimepiride can be decreased when it is combined with Dabrafenib.Approved
DanazolThe therapeutic efficacy of Glimepiride can be decreased when used in combination with Danazol.Approved
DapoxetineDapoxetine may increase the hypoglycemic activities of Glimepiride.Investigational
DarunavirThe therapeutic efficacy of Glimepiride can be decreased when used in combination with Darunavir.Approved
DelavirdineThe metabolism of Glimepiride can be decreased when combined with Delavirdine.Approved
DenosumabThe risk or severity of adverse effects can be increased when Denosumab is combined with Glimepiride.Approved
DeoxyspergualinDeoxyspergualin may increase the hypoglycemic activities of Glimepiride.Investigational
DesogestrelThe therapeutic efficacy of Glimepiride can be decreased when used in combination with Desogestrel.Approved
DesvenlafaxineDesvenlafaxine may increase the hypoglycemic activities of Glimepiride.Approved
DexamethasoneThe therapeutic efficacy of Glimepiride can be decreased when used in combination with Dexamethasone.Approved, Investigational, Vet Approved
DiazoxideThe therapeutic efficacy of Glimepiride can be decreased when used in combination with Diazoxide.Approved
DicoumarolGlimepiride may increase the anticoagulant activities of Dicoumarol.Approved
DienogestThe therapeutic efficacy of Glimepiride can be decreased when used in combination with Dienogest.Approved
DiflunisalDiflunisal may increase the hypoglycemic activities of Glimepiride.Approved
DihydrotestosteroneDihydrotestosterone may increase the hypoglycemic activities of Glimepiride.Illicit
DisopyramideGlimepiride may increase the hypoglycemic activities of Disopyramide.Approved
DrospirenoneThe therapeutic efficacy of Glimepiride can be decreased when used in combination with Drospirenone.Approved
DulaglutideDulaglutide may increase the hypoglycemic activities of Glimepiride.Approved
DuloxetineDuloxetine may increase the hypoglycemic activities of Glimepiride.Approved
EfavirenzThe metabolism of Glimepiride can be decreased when combined with Efavirenz.Approved, Investigational
EmpagliflozinEmpagliflozin may increase the hypoglycemic activities of Glimepiride.Approved
EnoxacinEnoxacin may increase the hypoglycemic activities of Glimepiride.Approved
EpinephrineThe therapeutic efficacy of Glimepiride can be decreased when used in combination with Epinephrine.Approved, Vet Approved
EscitalopramEscitalopram may increase the hypoglycemic activities of Glimepiride.Approved, Investigational
EsmololEsmolol may increase the hypoglycemic activities of Glimepiride.Approved
EstradiolThe therapeutic efficacy of Glimepiride can be decreased when used in combination with Estradiol.Approved, Investigational, Vet Approved
Estrone sulfateThe therapeutic efficacy of Glimepiride can be decreased when used in combination with Estrone sulfate.Approved
Etacrynic acidThe therapeutic efficacy of Glimepiride can be decreased when used in combination with Etacrynic acid.Approved
EthanolThe risk or severity of adverse effects can be increased when Glimepiride is combined with Ethanol.Approved
Ethinyl EstradiolThe therapeutic efficacy of Glimepiride can be decreased when used in combination with Ethinyl Estradiol.Approved
Ethyl biscoumacetateGlimepiride may increase the anticoagulant activities of Ethyl biscoumacetate.Withdrawn
Ethynodiol diacetateThe therapeutic efficacy of Glimepiride can be decreased when used in combination with Ethynodiol diacetate.Approved
EtofibrateEtofibrate may increase the hypoglycemic activities of Glimepiride.Approved
EtonogestrelThe therapeutic efficacy of Glimepiride can be decreased when used in combination with Etonogestrel.Approved, Investigational
EtoperidoneEtoperidone may increase the hypoglycemic activities of Glimepiride.Approved
EtravirineThe metabolism of Glimepiride can be decreased when combined with Etravirine.Approved
EverolimusThe therapeutic efficacy of Glimepiride can be decreased when used in combination with Everolimus.Approved
ExenatideExenatide may increase the hypoglycemic activities of Glimepiride.Approved, Investigational
FenofibrateFenofibrate may increase the hypoglycemic activities of Glimepiride.Approved
FingolimodGlimepiride may increase the immunosuppressive activities of Fingolimod.Approved, Investigational
FleroxacinFleroxacin may increase the hypoglycemic activities of Glimepiride.Approved
FloxuridineThe metabolism of Glimepiride can be decreased when combined with Floxuridine.Approved
FluconazoleThe serum concentration of Glimepiride can be increased when it is combined with Fluconazole.Approved
FludrocortisoneThe therapeutic efficacy of Glimepiride can be decreased when used in combination with Fludrocortisone.Approved
FluindioneGlimepiride may increase the anticoagulant activities of Fluindione.Investigational
FlumequineFlumequine may increase the hypoglycemic activities of Glimepiride.Withdrawn
FluorouracilThe metabolism of Glimepiride can be decreased when combined with Fluorouracil.Approved
FluoxetineFluoxetine may increase the hypoglycemic activities of Glimepiride.Approved, Vet Approved
FluoxymesteroneFluoxymesterone may increase the hypoglycemic activities of Glimepiride.Approved, Illicit
FluvastatinThe metabolism of Glimepiride can be decreased when combined with Fluvastatin.Approved
FluvoxamineThe metabolism of Glimepiride can be decreased when combined with Fluvoxamine.Approved, Investigational
FosamprenavirThe therapeutic efficacy of Glimepiride can be decreased when used in combination with Fosamprenavir.Approved
FosphenytoinThe metabolism of Glimepiride can be increased when combined with Fosphenytoin.Approved
FurazolidoneFurazolidone may increase the hypoglycemic activities of Glimepiride.Approved, Vet Approved
FurosemideThe therapeutic efficacy of Glimepiride can be decreased when used in combination with Furosemide.Approved, Vet Approved
G17DTThe risk or severity of adverse effects can be increased when Glimepiride is combined with G17DT.Investigational
GatifloxacinGatifloxacin may increase the hypoglycemic activities of Glimepiride.Approved, Investigational
GemfibrozilThe metabolism of Glimepiride can be decreased when combined with Gemfibrozil.Approved
GemifloxacinGemifloxacin may increase the hypoglycemic activities of Glimepiride.Approved, Investigational
GlibornurideGlibornuride may increase the hypoglycemic activities of Glimepiride.Withdrawn
GliclazideGlimepiride may increase the hypoglycemic activities of Gliclazide.Approved
GlipizideGlimepiride may increase the hypoglycemic activities of Glipizide.Approved
GliquidoneGliquidone may increase the hypoglycemic activities of Glimepiride.Approved
GlyburideGlimepiride may increase the hypoglycemic activities of Glyburide.Approved
GoserelinThe therapeutic efficacy of Glimepiride can be decreased when used in combination with Goserelin.Approved
GrepafloxacinGrepafloxacin may increase the hypoglycemic activities of Glimepiride.Withdrawn
GusperimusGusperimus may increase the hypoglycemic activities of Glimepiride.Investigational
HistrelinThe therapeutic efficacy of Glimepiride can be decreased when used in combination with Histrelin.Approved
HydracarbazineHydracarbazine may increase the hypoglycemic activities of Glimepiride.Experimental
HydrochlorothiazideThe therapeutic efficacy of Glimepiride can be decreased when used in combination with Hydrochlorothiazide.Approved, Vet Approved
HydrocortisoneThe therapeutic efficacy of Glimepiride can be decreased when used in combination with Hydrocortisone.Approved, Vet Approved
HydroflumethiazideThe therapeutic efficacy of Glimepiride can be decreased when used in combination with Hydroflumethiazide.Approved
Hydroxyprogesterone caproateThe therapeutic efficacy of Glimepiride can be decreased when used in combination with Hydroxyprogesterone caproate.Approved
IloperidoneThe therapeutic efficacy of Glimepiride can be decreased when used in combination with Iloperidone.Approved
IndalpineIndalpine may increase the hypoglycemic activities of Glimepiride.Investigational, Withdrawn
IndapamideThe therapeutic efficacy of Glimepiride can be decreased when used in combination with Indapamide.Approved
IndenololIndenolol may increase the hypoglycemic activities of Glimepiride.Withdrawn
IndinavirThe metabolism of Glimepiride can be decreased when combined with Indinavir.Approved
INGN 201The risk or severity of adverse effects can be increased when Glimepiride is combined with INGN 201.Investigational
INGN 225The risk or severity of adverse effects can be increased when Glimepiride is combined with INGN 225.Investigational
Insulin AspartGlimepiride may increase the hypoglycemic activities of Insulin Aspart.Approved
Insulin DetemirGlimepiride may increase the hypoglycemic activities of Insulin Detemir.Approved
Insulin GlargineInsulin Glargine may increase the hypoglycemic activities of Glimepiride.Approved
Insulin GlulisineGlimepiride may increase the hypoglycemic activities of Insulin Glulisine.Approved
Insulin HumanInsulin Human may increase the hypoglycemic activities of Glimepiride.Approved, Investigational
Insulin LisproInsulin Lispro may increase the hypoglycemic activities of Glimepiride.Approved
Insulin PorkInsulin Pork may increase the hypoglycemic activities of Glimepiride.Approved
IproclozideIproclozide may increase the hypoglycemic activities of Glimepiride.Withdrawn
IproniazidIproniazid may increase the hypoglycemic activities of Glimepiride.Withdrawn
IrbesartanThe metabolism of Glimepiride can be decreased when combined with Irbesartan.Approved, Investigational
IsocarboxazidIsocarboxazid may increase the hypoglycemic activities of Glimepiride.Approved
KetoconazoleThe metabolism of Glimepiride can be decreased when combined with Ketoconazole.Approved, Investigational
LabetalolLabetalol may increase the hypoglycemic activities of Glimepiride.Approved
LandiololAop200704 may increase the hypoglycemic activities of Glimepiride.Investigational
LanreotideGlimepiride may increase the hypoglycemic activities of Lanreotide.Approved
LeflunomideThe risk or severity of adverse effects can be increased when Glimepiride is combined with Leflunomide.Approved, Investigational
LeuprolideThe therapeutic efficacy of Glimepiride can be decreased when used in combination with Leuprolide.Approved, Investigational
LevobunololLevobunolol may increase the hypoglycemic activities of Glimepiride.Approved
LevofloxacinLevofloxacin may increase the hypoglycemic activities of Glimepiride.Approved, Investigational
LevomilnacipranLevomilnacipran may increase the hypoglycemic activities of Glimepiride.Approved
LevonorgestrelThe therapeutic efficacy of Glimepiride can be decreased when used in combination with Levonorgestrel.Approved, Investigational
LinagliptinLinagliptin may increase the hypoglycemic activities of Glimepiride.Approved
Lipoic AcidLipoic Acid may increase the hypoglycemic activities of Glimepiride.Approved, Nutraceutical
LiraglutideLiraglutide may increase the hypoglycemic activities of Glimepiride.Approved
LomefloxacinLomefloxacin may increase the hypoglycemic activities of Glimepiride.Approved
LopinavirThe therapeutic efficacy of Glimepiride can be decreased when used in combination with Lopinavir.Approved
LosartanThe metabolism of Glimepiride can be decreased when combined with Losartan.Approved
LovastatinThe metabolism of Glimepiride can be decreased when combined with Lovastatin.Approved, Investigational
LumacaftorThe serum concentration of Glimepiride can be decreased when it is combined with Lumacaftor.Approved
LurasidoneThe therapeutic efficacy of Glimepiride can be decreased when used in combination with Lurasidone.Approved
MebanazineMebanazine may increase the hypoglycemic activities of Glimepiride.Withdrawn
MecaserminGlimepiride may increase the hypoglycemic activities of Mecasermin.Approved, Investigational
Medroxyprogesterone acetateThe therapeutic efficacy of Glimepiride can be decreased when used in combination with Medroxyprogesterone acetate.Approved, Investigational
Megestrol acetateThe therapeutic efficacy of Glimepiride can be decreased when used in combination with Megestrol acetate.Approved, Vet Approved
MesalazineMesalazine may increase the hypoglycemic activities of Glimepiride.Approved
MestranolThe therapeutic efficacy of Glimepiride can be decreased when used in combination with Mestranol.Approved
MetforminMetformin may increase the hypoglycemic activities of Glimepiride.Approved
MethotrimeprazineThe therapeutic efficacy of Glimepiride can be decreased when used in combination with Methotrimeprazine.Approved
MethyclothiazideThe therapeutic efficacy of Glimepiride can be decreased when used in combination with Methyclothiazide.Approved
Methylene blueMethylene blue may increase the hypoglycemic activities of Glimepiride.Investigational
MethylprednisoloneThe therapeutic efficacy of Glimepiride can be decreased when used in combination with Methylprednisolone.Approved, Vet Approved
MethyltestosteroneMethyltestosterone may increase the hypoglycemic activities of Glimepiride.Approved
MetipranololMetipranolol may increase the hypoglycemic activities of Glimepiride.Approved
MetolazoneThe therapeutic efficacy of Glimepiride can be decreased when used in combination with Metolazone.Approved
MetoprololMetoprolol may increase the hypoglycemic activities of Glimepiride.Approved, Investigational
MetreleptinMetreleptin may increase the hypoglycemic activities of Glimepiride.Approved
MiconazoleMiconazole may increase the hypoglycemic activities of Glimepiride.Approved, Investigational, Vet Approved
MifepristoneThe serum concentration of Glimepiride can be increased when it is combined with Mifepristone.Approved, Investigational
MiglitolMiglitol may increase the hypoglycemic activities of Glimepiride.Approved
MiglustatMiglustat may increase the hypoglycemic activities of Glimepiride.Approved
MilnacipranMilnacipran may increase the hypoglycemic activities of Glimepiride.Approved
MinaprineMinaprine may increase the hypoglycemic activities of Glimepiride.Approved
MitiglinideMitiglinide may increase the hypoglycemic activities of Glimepiride.Approved, Investigational
MoclobemideMoclobemide may increase the hypoglycemic activities of Glimepiride.Approved
MoxifloxacinMoxifloxacin may increase the hypoglycemic activities of Glimepiride.Approved, Investigational
NadololNadolol may increase the hypoglycemic activities of Glimepiride.Approved
Nalidixic AcidNalidixic Acid may increase the hypoglycemic activities of Glimepiride.Approved
NatalizumabThe risk or severity of adverse effects can be increased when Glimepiride is combined with Natalizumab.Approved, Investigational
NateglinideGlimepiride may increase the hypoglycemic activities of Nateglinide.Approved, Investigational
NCX 4016NCX 4016 may increase the hypoglycemic activities of Glimepiride.Investigational
NefazodoneNefazodone may increase the hypoglycemic activities of Glimepiride.Approved, Withdrawn
NelfinavirThe therapeutic efficacy of Glimepiride can be decreased when used in combination with Nelfinavir.Approved
NiacinThe therapeutic efficacy of Glimepiride can be decreased when used in combination with Niacin.Approved, Investigational, Nutraceutical
NialamideNialamide may increase the hypoglycemic activities of Glimepiride.Withdrawn
NicardipineThe metabolism of Glimepiride can be decreased when combined with Nicardipine.Approved
NilotinibThe therapeutic efficacy of Glimepiride can be decreased when used in combination with Nilotinib.Approved, Investigational
NitroaspirinNitroaspirin may increase the hypoglycemic activities of Glimepiride.Investigational
NorethisteroneThe therapeutic efficacy of Glimepiride can be decreased when used in combination with Norethisterone.Approved
NorfloxacinNorfloxacin may increase the hypoglycemic activities of Glimepiride.Approved
NorgestimateThe therapeutic efficacy of Glimepiride can be decreased when used in combination with Norgestimate.Approved
OctamoxinOctamoxin may increase the hypoglycemic activities of Glimepiride.Withdrawn
OctreotideOctreotide may increase the hypoglycemic activities of Glimepiride.Approved, Investigational
OfloxacinOfloxacin may increase the hypoglycemic activities of Glimepiride.Approved
OlanzapineThe therapeutic efficacy of Glimepiride can be decreased when used in combination with Olanzapine.Approved, Investigational
OlsalazineOlsalazine may increase the hypoglycemic activities of Glimepiride.Approved
OmeprazoleThe metabolism of Glimepiride can be decreased when combined with Omeprazole.Approved, Investigational, Vet Approved
OxandroloneOxandrolone may increase the hypoglycemic activities of Glimepiride.Approved, Investigational
OxprenololOxprenolol may increase the hypoglycemic activities of Glimepiride.Approved
OxymetholoneOxymetholone may increase the hypoglycemic activities of Glimepiride.Approved, Illicit
PaliperidoneThe therapeutic efficacy of Glimepiride can be decreased when used in combination with Paliperidone.Approved
PargylinePargyline may increase the hypoglycemic activities of Glimepiride.Approved
ParoxetineParoxetine may increase the hypoglycemic activities of Glimepiride.Approved, Investigational
PasireotideGlimepiride may increase the hypoglycemic activities of Pasireotide.Approved
PazufloxacinPazufloxacin may increase the hypoglycemic activities of Glimepiride.Investigational
PefloxacinPefloxacin may increase the hypoglycemic activities of Glimepiride.Approved
PegvisomantPegvisomant may increase the hypoglycemic activities of Glimepiride.Approved
PenbutololPenbutolol may increase the hypoglycemic activities of Glimepiride.Approved, Investigational
PentamidineGlimepiride may increase the hypoglycemic activities of Pentamidine.Approved
PhenelzinePhenelzine may increase the hypoglycemic activities of Glimepiride.Approved
PhenforminPhenformin may increase the hypoglycemic activities of Glimepiride.Approved, Withdrawn
PhenindioneGlimepiride may increase the anticoagulant activities of Phenindione.Approved
PheniprazinePheniprazine may increase the hypoglycemic activities of Glimepiride.Withdrawn
PhenobarbitalThe metabolism of Glimepiride can be increased when combined with Phenobarbital.Approved
PhenoxypropazinePhenoxypropazine may increase the hypoglycemic activities of Glimepiride.Withdrawn
PhenprocoumonGlimepiride may increase the anticoagulant activities of Phenprocoumon.Approved
PhenytoinThe metabolism of Glimepiride can be increased when combined with Phenytoin.Approved, Vet Approved
PimecrolimusThe risk or severity of adverse effects can be increased when Pimecrolimus is combined with Glimepiride.Approved, Investigational
PindololPindolol may increase the hypoglycemic activities of Glimepiride.Approved
PioglitazonePioglitazone may increase the hypoglycemic activities of Glimepiride.Approved, Investigational
PiperazineThe therapeutic efficacy of Glimepiride can be decreased when used in combination with Piperazine.Approved, Vet Approved
PipotiazineThe therapeutic efficacy of Glimepiride can be decreased when used in combination with Pipotiazine.Approved
PirlindolePirlindole may increase the hypoglycemic activities of Glimepiride.Approved
PivhydrazinePivhydrazine may increase the hypoglycemic activities of Glimepiride.Withdrawn
PolythiazideThe therapeutic efficacy of Glimepiride can be decreased when used in combination with Polythiazide.Approved
PractololPractolol may increase the hypoglycemic activities of Glimepiride.Approved
PramlintidePramlintide may increase the hypoglycemic activities of Glimepiride.Approved, Investigational
PrednisoloneThe therapeutic efficacy of Glimepiride can be decreased when used in combination with Prednisolone.Approved, Vet Approved
PrednisoneThe therapeutic efficacy of Glimepiride can be decreased when used in combination with Prednisone.Approved, Vet Approved
PrimidoneThe metabolism of Glimepiride can be increased when combined with Primidone.Approved, Vet Approved
ProbenecidThe protein binding of Glimepiride can be decreased when combined with Probenecid.Approved
ProgesteroneThe therapeutic efficacy of Glimepiride can be decreased when used in combination with Progesterone.Approved, Vet Approved
PropranololPropranolol may increase the hypoglycemic activities of Glimepiride.Approved, Investigational
PrulifloxacinPrulifloxacin may increase the hypoglycemic activities of Glimepiride.Investigational
PyrimethamineThe metabolism of Glimepiride can be decreased when combined with Pyrimethamine.Approved, Vet Approved
QuetiapineThe therapeutic efficacy of Glimepiride can be decreased when used in combination with Quetiapine.Approved
QuinethazoneThe therapeutic efficacy of Glimepiride can be decreased when used in combination with Quinethazone.Approved
QuinineGlimepiride may increase the hypoglycemic activities of Quinine.Approved
RanitidineThe serum concentration of Glimepiride can be increased when it is combined with Ranitidine.Approved
RasagilineRasagiline may increase the hypoglycemic activities of Glimepiride.Approved
RepaglinideGlimepiride may increase the hypoglycemic activities of Repaglinide.Approved, Investigational
RifampicinThe serum concentration of Glimepiride can be decreased when it is combined with Rifampicin.Approved
RifapentineThe metabolism of Glimepiride can be increased when combined with Rifapentine.Approved
RindopepimutThe risk or severity of adverse effects can be increased when Glimepiride is combined with CDX-110.Investigational
RisperidoneThe therapeutic efficacy of Glimepiride can be decreased when used in combination with Risperidone.Approved, Investigational
RitonavirThe therapeutic efficacy of Glimepiride can be decreased when used in combination with Ritonavir.Approved, Investigational
RoflumilastRoflumilast may increase the immunosuppressive activities of Glimepiride.Approved
RosiglitazoneRosiglitazone may increase the hypoglycemic activities of Glimepiride.Approved, Investigational
RosoxacinRosoxacin may increase the hypoglycemic activities of Glimepiride.Approved
SafrazineSafrazine may increase the hypoglycemic activities of Glimepiride.Withdrawn
Salicylic acidSalicylic acid may increase the hypoglycemic activities of Glimepiride.Approved, Vet Approved
SaquinavirThe therapeutic efficacy of Glimepiride can be decreased when used in combination with Saquinavir.Approved, Investigational
SaxagliptinSaxagliptin may increase the hypoglycemic activities of Glimepiride.Approved
SecobarbitalThe metabolism of Glimepiride can be increased when combined with Secobarbital.Approved, Vet Approved
SelegilineSelegiline may increase the hypoglycemic activities of Glimepiride.Approved, Investigational, Vet Approved
SertralineSertraline may increase the hypoglycemic activities of Glimepiride.Approved
SildenafilThe metabolism of Glimepiride can be decreased when combined with Sildenafil.Approved, Investigational
Sipuleucel-TThe therapeutic efficacy of Sipuleucel-T can be decreased when used in combination with Glimepiride.Approved
SirolimusThe therapeutic efficacy of Glimepiride can be decreased when used in combination with Sirolimus.Approved, Investigational
SitagliptinSitagliptin may increase the hypoglycemic activities of Glimepiride.Approved, Investigational
SorafenibThe metabolism of Glimepiride can be decreased when combined with Sorafenib.Approved, Investigational
SotalolSotalol may increase the hypoglycemic activities of Glimepiride.Approved
SparfloxacinSparfloxacin may increase the hypoglycemic activities of Glimepiride.Approved
SRP 299The risk or severity of adverse effects can be increased when Glimepiride is combined with SRP 299.Investigational
StanozololStanozolol may increase the hypoglycemic activities of Glimepiride.Approved, Vet Approved
SulfadiazineThe metabolism of Glimepiride can be decreased when combined with Sulfadiazine.Approved, Vet Approved
SulfamethoxazoleGlimepiride may increase the hypoglycemic activities of Sulfamethoxazole.Approved
SulfisoxazoleThe metabolism of Glimepiride can be decreased when combined with Sulfisoxazole.Approved, Vet Approved
SulodexideSulodexide may increase the hypoglycemic activities of Glimepiride.Approved, Investigational
SunitinibGlimepiride may increase the hypoglycemic activities of Sunitinib.Approved, Investigational
TacrolimusThe risk or severity of adverse effects can be increased when Tacrolimus is combined with Glimepiride.Approved, Investigational
TacrolimusThe therapeutic efficacy of Glimepiride can be decreased when used in combination with Tacrolimus.Approved, Investigational
TemafloxacinTemafloxacin may increase the hypoglycemic activities of Glimepiride.Withdrawn
TemsirolimusThe therapeutic efficacy of Glimepiride can be decreased when used in combination with Temsirolimus.Approved
TestosteroneTestosterone may increase the hypoglycemic activities of Glimepiride.Approved, Investigational
TicagrelorThe metabolism of Glimepiride can be decreased when combined with Ticagrelor.Approved
TiclopidineThe metabolism of Glimepiride can be decreased when combined with Ticlopidine.Approved
TimololTimolol may increase the hypoglycemic activities of Glimepiride.Approved
TipranavirThe therapeutic efficacy of Glimepiride can be decreased when used in combination with Tipranavir.Approved, Investigational
TofacitinibGlimepiride may increase the immunosuppressive activities of Tofacitinib.Approved, Investigational
TolazamideGlimepiride may increase the hypoglycemic activities of Tolazamide.Approved
TolbutamideThe metabolism of Glimepiride can be decreased when combined with Tolbutamide.Approved
ToloxatoneToloxatone may increase the hypoglycemic activities of Glimepiride.Approved
TorasemideThe therapeutic efficacy of Glimepiride can be decreased when used in combination with Torasemide.Approved
Trans-2-PhenylcyclopropylamineTrans-2-Phenylcyclopropylamine may increase the hypoglycemic activities of Glimepiride.Experimental
TranylcypromineTranylcypromine may increase the hypoglycemic activities of Glimepiride.Approved
TrastuzumabTrastuzumab may increase the neutropenic activities of Glimepiride.Approved, Investigational
TriamcinoloneThe therapeutic efficacy of Glimepiride can be decreased when used in combination with Triamcinolone.Approved, Vet Approved
TrichlormethiazideThe therapeutic efficacy of Glimepiride can be decreased when used in combination with Trichlormethiazide.Approved, Vet Approved
TrimethoprimThe metabolism of Glimepiride can be decreased when combined with Trimethoprim.Approved, Vet Approved
TriptorelinThe therapeutic efficacy of Glimepiride can be decreased when used in combination with Triptorelin.Approved, Vet Approved
TroglitazoneTroglitazone may increase the hypoglycemic activities of Glimepiride.Withdrawn
TrovafloxacinTrovafloxacin may increase the hypoglycemic activities of Glimepiride.Approved, Withdrawn
Valproic AcidThe metabolism of Glimepiride can be decreased when combined with Valproic Acid.Approved, Investigational
ValsartanThe metabolism of Glimepiride can be decreased when combined with Valsartan.Approved, Investigational
VenlafaxineVenlafaxine may increase the hypoglycemic activities of Glimepiride.Approved
VildagliptinVildagliptin may increase the hypoglycemic activities of Glimepiride.Approved, Investigational
VogliboseVoglibose may increase the hypoglycemic activities of Glimepiride.Approved, Investigational
VoriconazoleThe serum concentration of Glimepiride can be increased when it is combined with Voriconazole.Approved, Investigational
VorinostatThe therapeutic efficacy of Glimepiride can be decreased when used in combination with Vorinostat.Approved, Investigational
WarfarinGlimepiride may increase the anticoagulant activities of Warfarin.Approved
ZafirlukastThe metabolism of Glimepiride can be decreased when combined with Zafirlukast.Approved, Investigational
ZimelidineZimelidine may increase the hypoglycemic activities of Glimepiride.Withdrawn
ZiprasidoneThe therapeutic efficacy of Glimepiride can be decreased when used in combination with Ziprasidone.Approved
Food Interactions
  • Avoid alcohol.
  • Even though food reduces product absorption, the manufacturer recommends taking the product with the first meal of the day.
Synthesis Reference

Suresh Kadam, Venkatasubramanian Tarur, Sanjay Naik, Sachin Gavhane, "Process for preparation of substantially pure glimepiride." U.S. Patent US20070082943, issued April 12, 2007.

General ReferencesNot Available
External Links
ATC CodesA10BB12 — GlimepirideA10BD06 — Glimepiride and pioglitazoneA10BD04 — Glimepiride and rosiglitazone
AHFS Codes
  • 68:20.20
PDB EntriesNot Available
FDA labelDownload (176 KB)
MSDSNot Available
Clinical Trials
Clinical Trials
1CompletedNot AvailableHealthy Volunteers3
1CompletedNot AvailablePharmacokinetics1
1CompletedNot AvailableType 2 Diabetes Mellitus1
1CompletedBasic ScienceHealthy Volunteers2
1CompletedTreatmentDiabetes / Type 2 Diabetes Mellitus1
1CompletedTreatmentHealthy Volunteers5
1CompletedTreatmentType 2 Diabetes Mellitus3
1CompletedTreatmentType2 Diabetes Mellitus1
1Not Yet RecruitingHealth Services ResearchType2 Diabetes1
1Not Yet RecruitingTreatmentDiabetes Mellitus (DM)1
1TerminatedTreatmentType 2 Diabetes Mellitus1
2CompletedNot AvailableDiabetes / Type 2 Diabetes Mellitus1
2CompletedTreatmentCongestive Heart Failure (CHF) / Type 2 Diabetes Mellitus1
2CompletedTreatmentDiabetes / Type 2 Diabetes Mellitus1
2CompletedTreatmentImpaired Glucose Tolerance (IGT) / Type 2 Diabetes Mellitus1
2CompletedTreatmentType 2 Diabetes Mellitus5
2WithdrawnTreatmentType 2 Diabetes Mellitus1
2, 3CompletedTreatmentMaturity-Onset Diabetes of the Young1
2, 3CompletedTreatmentType 2 Diabetes Mellitus2
3Active Not RecruitingTreatmentDiabetes1
3Active Not RecruitingTreatmentType 2 Diabetes Mellitus3
3CompletedPreventionAtherosclerosis / Cardiovascular Disease (CVD) / Coronary Heart Disease (CHD) / Diabetes Mellitus (DM) / Hypercholesterolaemia / Hypertensive / Type 2 Diabetes Mellitus1
3CompletedTreatmentDiabetes Mellitus (DM)3
3CompletedTreatmentDiabetes Mellitus (DM) / Dyslipidemias1
3CompletedTreatmentDiabetes Mellitus, Non-Insulin-Dependent1
3CompletedTreatmentDiabetes Mellitus, Non-Insulin-Dependent / Type 2 Diabetes Mellitus, Non Insulin Dependent1
3CompletedTreatmentDiabetes / Type 2 Diabetes Mellitus5
3CompletedTreatmentDiabetics Patients1
3CompletedTreatmentType 2 Diabetes Mellitus43
3Not Yet RecruitingHealth Services ResearchDiabetes Mellitus (DM)1
3Not Yet RecruitingTreatmentType 2 Diabetes Mellitus1
3RecruitingTreatmentComparative Effectiveness of Glycemia-lowering Medications / Type 2 Diabetes Mellitus1
3RecruitingTreatmentType 2 Diabetes Mellitus2
3TerminatedTreatmentDiabetes / Type 2 Diabetes Mellitus4
3TerminatedTreatmentType 2 Diabetes Mellitus7
3WithdrawnTreatmentType 2 Diabetes Mellitus2
4Active Not RecruitingTreatmentType 2 Diabetes Mellitus3
4CompletedTreatmentDiabetes Mellitus (DM)2
4CompletedTreatmentDiabetes Mellitus (DM) / Endothelial Dysfunction1
4CompletedTreatmentDiabetes Mellitus, Non-Insulin-Dependent1
4CompletedTreatmentDiabetes / Type 2 Diabetes Mellitus3
4CompletedTreatmentGlucotoxicity / Pancreatic Beta Cell Function / Type 2 Diabetes Mellitus1
4CompletedTreatmentHypoglycemia / Type 2 Diabetes Mellitus1
4CompletedTreatmentInadequate Glycaemic Control / Type 2 Diabetes Mellitus / Type2 Diabetes Mellitus1
4CompletedTreatmentInsulin Resistance / Type 2 Diabetes Mellitus1
4CompletedTreatmentType 2 Diabetes Mellitus22
4Enrolling by InvitationTreatmentMicroalbuminuria / Microalbuminuria /Creatinine Ratios ACR1
4Not Yet RecruitingTreatmentType 2 Diabetes Mellitus1
4RecruitingTreatmentCardiovascular Disease (CVD) / Type2 Diabetes1
4RecruitingTreatmentEffects of the DPP-4 Inhibitors or SGLT2 Inhibitors on the Protective Actions for Diabetic Complications1
4RecruitingTreatmentNon-Alcoholic Fatty Liver Disease (NAFLD)1
4RecruitingTreatmentType 2 Diabetes Mellitus8
4TerminatedTreatmentType 2 Diabetes Mellitus4
4Unknown StatusNot AvailableType 2 Diabetes Mellitus1
4Unknown StatusBasic ScienceType 2 Diabetes Mellitus1
4Unknown StatusTreatmentType 2 Diabetes Mellitus3
4WithdrawnNot AvailableType 2 Diabetes Mellitus1
Not AvailableCompletedNot AvailableHealthy Volunteers2
Not AvailableCompletedNot AvailableType 2 Diabetes Mellitus6
Not AvailableCompletedTreatmentAtherosclerosis / Impaired Glucose Tolerance (IGT) / Type 2 Diabetes Mellitus1
Not AvailableCompletedTreatmentPre-Diabetic / Type 2 Diabetes Mellitus1
Not AvailableCompletedTreatmentType 2 Diabetes Mellitus4
Not AvailableNot Yet RecruitingNot AvailableType 2 Diabetes Mellitus1
Not AvailableNot Yet RecruitingTreatmentType 2 Diabetes Mellitus1
Not AvailableRecruitingNot AvailableCardiovascular Disease (CVD) / Type 2 Diabetes Mellitus1
Not AvailableRecruitingBasic ScienceMaturity-Onset Diabetes of the Young, Type 31
Not AvailableRecruitingPreventionCoronary Heart Disease (CHD)1
Not AvailableRecruitingTreatmentDiabetes1
Not AvailableRecruitingTreatmentType2 Diabetes Mellitus1
Not AvailableUnknown StatusNot AvailableType 2 Diabetes Mellitus1
  • Sanofi aventis us llc
  • Accord healthcare inc
  • Carlsbad technology inc
  • Corepharma llc
  • Dr reddys laboratories ltd
  • Genpharm inc
  • Invagen pharmaceuticals inc
  • Mylan pharmaceuticals inc
  • Ranbaxy laboratories ltd
  • Teva pharmaceuticals usa inc
  • Vintage pharmaceuticals llc
  • Watson laboratories inc
  • Watson laboratories inc florida
Dosage forms
TabletOral1 mg
TabletOral2 mg
TabletOral4 mg
Tablet, film coatedOral
TabletOral1 mg/1
TabletOral2 mg/1
TabletOral3 mg/1
TabletOral4 mg/1
TabletOral6 mg/1
TabletOral8 mg/1
TabletOral3 mg
Unit descriptionCostUnit
Amaryl 4 mg tablet2.11USD tablet
Amaryl 2 mg tablet1.25USD tablet
Glimepiride 4 mg tablet1.25USD tablet
Amaryl 1 mg tablet0.88USD tablet
Glimepiride 2 mg tablet0.67USD tablet
Glimepiride 1 mg tablet0.42USD tablet
DrugBank does not sell nor buy drugs. Pricing information is supplied for informational purposes only.
Patent NumberPediatric ExtensionApprovedExpires (estimated)
US6150383 No1996-06-192016-06-19Us
US6211205 No1996-06-192016-06-19Us
US6303640 No1996-08-092016-08-09Us
US6329404 No1996-06-192016-06-19Us
US7358366 Yes2000-10-192020-10-19Us
US7538125 No1996-06-192016-06-19Us
US7700128 No2007-01-302027-01-30Us
US8071130 No2008-06-082028-06-08Us
Experimental Properties
melting point (°C)207 °CNot Available
water solubilityInsolubleNot Available
logP3.5Not Available
Predicted Properties
Water Solubility0.0347 mg/mLALOGPS
pKa (Strongest Acidic)2.23ChemAxon
pKa (Strongest Basic)-0.36ChemAxon
Physiological Charge0ChemAxon
Hydrogen Acceptor Count7ChemAxon
Hydrogen Donor Count3ChemAxon
Polar Surface Area131.66 Å2ChemAxon
Rotatable Bond Count6ChemAxon
Refractivity130.85 m3·mol-1ChemAxon
Polarizability53.31 Å3ChemAxon
Number of Rings3ChemAxon
Rule of FiveYesChemAxon
Ghose FilterNoChemAxon
Veber's RuleNoChemAxon
MDDR-like RuleYesChemAxon
Predicted ADMET features
Human Intestinal Absorption+0.986
Blood Brain Barrier+0.7322
Caco-2 permeable-0.6809
P-glycoprotein substrateSubstrate0.7501
P-glycoprotein inhibitor INon-inhibitor0.6556
P-glycoprotein inhibitor IIInhibitor0.6124
Renal organic cation transporterNon-inhibitor0.8241
CYP450 2C9 substrateSubstrate0.5661
CYP450 2D6 substrateNon-substrate0.9116
CYP450 3A4 substrateNon-substrate0.5978
CYP450 1A2 substrateNon-inhibitor0.9045
CYP450 2C9 inhibitorInhibitor0.8949
CYP450 2D6 inhibitorNon-inhibitor0.9231
CYP450 2C19 inhibitorNon-inhibitor0.9025
CYP450 3A4 inhibitorNon-inhibitor0.8309
CYP450 inhibitory promiscuityLow CYP Inhibitory Promiscuity0.8599
Ames testNon AMES toxic0.6392
BiodegradationNot ready biodegradable0.68
Rat acute toxicity2.4158 LD50, mol/kg Not applicable
hERG inhibition (predictor I)Weak inhibitor0.7714
hERG inhibition (predictor II)Non-inhibitor0.8263
ADMET data is predicted using admetSAR, a free tool for evaluating chemical ADMET properties. (23092397 )
Mass Spec (NIST)Not Available
Spectrum TypeDescriptionSplash Key
LC-MS/MSLC-MS/MS Spectrum - , positivesplash10-03di-0012290000-966a50af984de12b0ba8View in MoNA
LC-MS/MSLC-MS/MS Spectrum - , positivesplash10-0udi-2629000000-29b987358cc85159c5b8View in MoNA
LC-MS/MSLC-MS/MS Spectrum - , positivesplash10-03di-0002190000-0aaefa2e07605da97f81View in MoNA
LC-MS/MSLC-MS/MS Spectrum - , positivesplash10-0udi-0409000000-91b493608ac508427593View in MoNA
LC-MS/MSLC-MS/MS Spectrum - , positivesplash10-004i-3911000000-78c0f40c965f78bfa591View in MoNA
LC-MS/MSLC-MS/MS Spectrum - LC-ESI-qTof , PositiveNot Available
Predicted LC-MS/MSPredicted LC-MS/MS Spectrum - 10V, PositiveNot Available
Predicted LC-MS/MSPredicted LC-MS/MS Spectrum - 20V, PositiveNot Available
Predicted LC-MS/MSPredicted LC-MS/MS Spectrum - 40V, PositiveNot Available
Predicted LC-MS/MSPredicted LC-MS/MS Spectrum - 10V, NegativeNot Available
Predicted LC-MS/MSPredicted LC-MS/MS Spectrum - 20V, NegativeNot Available
Predicted LC-MS/MSPredicted LC-MS/MS Spectrum - 40V, NegativeNot Available
DescriptionThis compound belongs to the class of organic compounds known as benzenesulfonamides. These are organic compounds containing a sulfonamide group that is S-linked to a benzene ring.
KingdomOrganic compounds
Super ClassBenzenoids
ClassBenzene and substituted derivatives
Sub ClassBenzenesulfonamides
Direct ParentBenzenesulfonamides
Alternative ParentsBenzenesulfonyl compounds / Pyrroline carboxylic acids and derivatives / Ureides / Sulfonylureas / Organosulfonic acids and derivatives / Dicarboximides / Aminosulfonyl compounds / Azacyclic compounds / Organic oxides / Hydrocarbon derivatives
SubstituentsBenzenesulfonamide / Benzenesulfonyl group / Pyrroline carboxylic acid or derivatives / Ureide / Sulfonylurea / Dicarboximide / Pyrroline / Organic sulfonic acid or derivatives / Organosulfonic acid or derivatives / Aminosulfonyl compound
Molecular FrameworkAromatic heteromonocyclic compounds
External Descriptorssulfonamide, N-sulfonylurea, N-acylurea (CHEBI:5383 )


Pharmacological action
General Function:
Voltage-gated potassium channel activity
Specific Function:
This receptor is controlled by G proteins. Inward rectifier potassium channels are characterized by a greater tendency to allow potassium to flow into the cell rather than out of it. Their voltage dependence is regulated by the concentration of extracellular potassium; as external potassium is raised, the voltage range of the channel opening shifts to more positive voltages. The inward rectific...
Gene Name:
Uniprot ID:
Molecular Weight:
43540.375 Da
  1. Song DK, Ashcroft FM: Glimepiride block of cloned beta-cell, cardiac and smooth muscle K(ATP) channels. Br J Pharmacol. 2001 May;133(1):193-9. [PubMed:11325810 ]
  2. Lawrence CL, Rainbow RD, Davies NW, Standen NB: Effect of metabolic inhibition on glimepiride block of native and cloned cardiac sarcolemmal K(ATP) channels. Br J Pharmacol. 2002 Jul;136(5):746-52. [PubMed:12086984 ]
  3. Bataille D: [Molecular mechanisms of insulin secretion]. Diabetes Metab. 2002 Dec;28(6 Suppl):4S7-13. [PubMed:12703060 ]
Pharmacological action
General Function:
Phosphatidylinositol-4,5-bisphosphate binding
Specific Function:
In the kidney, probably plays a major role in potassium homeostasis. Inward rectifier potassium channels are characterized by a greater tendency to allow potassium to flow into the cell rather than out of it. Their voltage dependence is regulated by the concentration of extracellular potassium; as external potassium is raised, the voltage range of the channel opening shifts to more positive vol...
Gene Name:
Uniprot ID:
Molecular Weight:
44794.6 Da
  1. Overington JP, Al-Lazikani B, Hopkins AL: How many drug targets are there? Nat Rev Drug Discov. 2006 Dec;5(12):993-6. [PubMed:17139284 ]
  2. Imming P, Sinning C, Meyer A: Drugs, their targets and the nature and number of drug targets. Nat Rev Drug Discov. 2006 Oct;5(10):821-34. [PubMed:17016423 ]
  3. Proks P, Reimann F, Green N, Gribble F, Ashcroft F: Sulfonylurea stimulation of insulin secretion. Diabetes. 2002 Dec;51 Suppl 3:S368-76. [PubMed:12475777 ]
  4. Bataille D: [Molecular mechanisms of insulin secretion]. Diabetes Metab. 2002 Dec;28(6 Suppl):4S7-13. [PubMed:12703060 ]
Pharmacological action
General Function:
Sulfonylurea receptor activity
Specific Function:
Subunit of the beta-cell ATP-sensitive potassium channel (KATP). Regulator of ATP-sensitive K(+) channels and insulin release.
Gene Name:
Uniprot ID:
Molecular Weight:
176990.36 Da
  1. Muller G, Hartz D, Punter J, Okonomopulos R, Kramer W: Differential interaction of glimepiride and glibenclamide with the beta-cell sulfonylurea receptor. I. Binding characteristics. Biochim Biophys Acta. 1994 May 11;1191(2):267-77. [PubMed:8172912 ]
  2. Kramer W, Muller G, Geisen K: Characterization of the molecular mode of action of the sulfonylurea, glimepiride, at beta-cells. Horm Metab Res. 1996 Sep;28(9):464-8. [PubMed:8911984 ]
  3. Kramer W, Muller G, Girbig F, Gutjahr U, Kowalewski S, Hartz D, Summ HD: The molecular interaction of sulfonylureas with beta-cell ATP-sensitive K(+)-channels. Diabetes Res Clin Pract. 1995 Aug;28 Suppl:S67-80. [PubMed:8529521 ]


Pharmacological action
General Function:
Steroid hydroxylase activity
Specific Function:
Cytochromes P450 are a group of heme-thiolate monooxygenases. In liver microsomes, this enzyme is involved in an NADPH-dependent electron transport pathway. It oxidizes a variety of structurally unrelated compounds, including steroids, fatty acids, and xenobiotics. This enzyme contributes to the wide pharmacokinetics variability of the metabolism of drugs such as S-warfarin, diclofenac, phenyto...
Gene Name:
Uniprot ID:
Molecular Weight:
55627.365 Da
  1. Zhou SF, Zhou ZW, Yang LP, Cai JP: Substrates, inducers, inhibitors and structure-activity relationships of human Cytochrome P450 2C9 and implications in drug development. Curr Med Chem. 2009;16(27):3480-675. Epub 2009 Sep 1. [PubMed:19515014 ]
  2. Preissner S, Kroll K, Dunkel M, Senger C, Goldsobel G, Kuzman D, Guenther S, Winnenburg R, Schroeder M, Preissner R: SuperCYP: a comprehensive database on Cytochrome P450 enzymes including a tool for analysis of CYP-drug interactions. Nucleic Acids Res. 2010 Jan;38(Database issue):D237-43. doi: 10.1093/nar/gkp970. Epub 2009 Nov 24. [PubMed:19934256 ]
  3. Drug Interactions: Cytochrome P450 Drug Interaction Table [Link]
Drug created on June 13, 2005 07:24 / Updated on July 21, 2017 17:44