
Accession Number
DB00222  (APRD00381)
Small Molecule

Glimepiride is the first III generation sulphonyl urea it is a very potent sulphonyl urea with long duration of action.

  • Glimepirida
  • Glimepiride
  • Glimépiride
  • Glimepiridum
External IDs
HOE 490 / HOE-490
Product Images
Prescription Products
NameDosageStrengthRouteLabellerMarketing StartMarketing End
AmarylTablet1 mgOralSanofi Aventis2002-03-12Not applicableCanada
AmarylTablet4 mg/1OralPhysicians Total Care, Inc.2000-11-212011-06-30Us
AmarylTablet4 mgOralSanofi Aventis2002-03-12Not applicableCanada
AmarylTablet2 mg/1Oralsanofi-aventis U.S. LLC2009-06-18Not applicableUs
AmarylTablet1 mg/1OralPhysicians Total Care, Inc.2000-11-242011-06-30Us
AmarylTablet2 mgOralSanofi Aventis2002-03-12Not applicableCanada
AmarylTablet1 mg/1Oralsanofi-aventis U.S. LLC2009-06-18Not applicableUs
AmarylTablet4 mg/1Oralsanofi-aventis U.S. LLC2009-06-18Not applicableUs
AmarylTablet2 mg/1OralPhysicians Total Care, Inc.2000-09-182011-06-30Us
Co GlimepirideTablet1 mgOralCobalt Laboratories2006-04-242012-08-02Canada
Generic Prescription Products
NameDosageStrengthRouteLabellerMarketing StartMarketing End
Apo-glimepirideTablet1 mgOralApotex Corporation2007-09-29Not applicableCanada
Apo-glimepirideTablet4 mgOralApotex Corporation2007-09-29Not applicableCanada
Apo-glimepirideTablet2 mgOralApotex Corporation2007-09-29Not applicableCanada
GlimepirideTablet2 mg/1OralRemedy Repack2013-10-312016-01-25Us55111 0321 01 nlmimage10 35079aac
GlimepirideTablet4 mg/1OralPerrigo New York Inc.2005-10-062015-12-01Us
GlimepirideTablet2 mg/1OralLiberty Pharmaceuticals, Inc.2012-01-01Not applicableUs
GlimepirideTablet2 mg/1OralBionpharma Inc.2015-10-01Not applicableUs
GlimepirideTablet1 mg/1OralPhysicians Total Care, Inc.2005-10-20Not applicableUs00093 7254 01 nlmimage10 310798fc
GlimepirideTablet1 mg/1OralSolco healthcare U.S., LLC2017-01-30Not applicableUs
GlimepirideTablet1 mg/1OralPD-Rx Pharmaceuticals, Inc.2005-10-06Not applicableUs
Mixture Products
NameIngredientsDosageRouteLabellerMarketing StartMarketing End
AvandarylGlimepiride (2 mg/1) + Rosiglitazone Maleate (8 mg/1)Tablet, film coatedOralGlaxosmithkline Inc2007-05-222011-11-18Us0007 314820180907 15195 1t0y0qt
AvandarylGlimepiride (1 mg) + Rosiglitazone (4 mg)TabletOralGlaxosmithkline Inc2006-05-042011-08-29Canada
AvandarylGlimepiride (2 mg/1) + Rosiglitazone Maleate (8 mg/1)Tablet, film coatedOralGlaxosmithkline Inc2011-05-242015-11-07Us
AvandarylGlimepiride (4 mg/1) + Rosiglitazone Maleate (4 mg/1)Tablet, film coatedOralPhysicians Total Care, Inc.2005-11-232010-06-30Us
AvandarylGlimepiride (4 mg) + Rosiglitazone (4 mg)TabletOralGlaxosmithkline Inc2006-05-042011-07-31Canada
AvandarylGlimepiride (2 mg/1) + Rosiglitazone Maleate (4 mg/1)Tablet, film coatedOralGlaxosmithkline Inc2006-01-052011-11-18Us
AvandarylGlimepiride (2 mg/1) + Rosiglitazone Maleate (4 mg/1)Tablet, film coatedOralGlaxosmithkline Inc2011-05-242015-11-07Us
AvandarylGlimepiride (2 mg) + Rosiglitazone (4 mg)TabletOralGlaxosmithkline Inc2006-05-042011-07-31Canada
AvandarylGlimepiride (4 mg/1) + Rosiglitazone Maleate (8 mg/1)Tablet, film coatedOralGlaxosmithkline Inc2011-05-242015-11-07Us
AvandarylGlimepiride (4 mg/1) + Rosiglitazone Maleate (8 mg/1)Tablet, film coatedOralGlaxosmithkline Inc2007-05-222011-11-18Us0007 314920180907 15195 w8896g
Unapproved/Other Products
NameIngredientsDosageRouteLabellerMarketing StartMarketing End
AvaglimGlimepiride (4 mg) + Rosiglitazone (4 mg)Tablet, film coatedOralSmith Kline Beecham2006-06-272011-08-12Eu
AvaglimGlimepiride (4 mg) + Rosiglitazone (8 mg)Tablet, film coatedOralSmith Kline Beecham2006-06-272011-08-12Eu
AvaglimGlimepiride (4 mg) + Rosiglitazone (4 mg)Tablet, film coatedOralSmith Kline Beecham2006-06-272011-08-12Eu
AvaglimGlimepiride (4 mg) + Rosiglitazone (4 mg)Tablet, film coatedOralSmith Kline Beecham2006-06-272011-08-12Eu
AvaglimGlimepiride (4 mg) + Rosiglitazone (8 mg)Tablet, film coatedOralSmith Kline Beecham2006-06-272011-08-12Eu
AvaglimGlimepiride (4 mg) + Rosiglitazone (4 mg)Tablet, film coatedOralSmith Kline Beecham2006-06-272011-08-12Eu
AvaglimGlimepiride (4 mg) + Rosiglitazone (8 mg)Tablet, film coatedOralSmith Kline Beecham2006-06-272011-08-12Eu
AvaglimGlimepiride (4 mg) + Rosiglitazone (4 mg)Tablet, film coatedOralSmith Kline Beecham2006-06-272011-08-12Eu
AvaglimGlimepiride (4 mg) + Rosiglitazone (8 mg)Tablet, film coatedOralSmith Kline Beecham2006-06-272011-08-12Eu
AvaglimGlimepiride (4 mg) + Rosiglitazone (8 mg)Tablet, film coatedOralSmith Kline Beecham2006-06-272011-08-12Eu
International/Other Brands
GLIMPID (Ranbaxy Laboratories) / GLIMY (Dr.Reddy's Labs)
CAS number
Average: 490.62
Monoisotopic: 490.224991385
Chemical Formula
InChI Key
3-ethyl-4-methyl-2-oxo-N-(2-{4-[({[(1r,4r)-4-methylcyclohexyl]-C-hydroxycarbonimidoyl}amino)sulfonyl]phenyl}ethyl)-2,5-dihydro-1H-pyrrole-1-carboximidic acid



For concomitant use with insulin for the treatment of noninsulin-dependent (type 2) diabetes mellitus.

Associated Conditions

Glimepiride, like glyburide and glipizide, is a "second-generation" sulfonylurea agents. Glimepiride is used with diet to lower blood glucose by increasing the secretion of insulin from pancreas and increasing the sensitivity of peripheral tissues to insulin.

Mechanism of action

The mechanism of action of glimepiride in lowering blood glucose appears to be dependent on stimulating the release of insulin from functioning pancreatic beta cells, and increasing sensitivity of peripheral tissues to insulin. Glimepiride likely binds to ATP-sensitive potassium channel receptors on the pancreatic cell surface, reducing potassium conductance and causing depolarization of the membrane. Membrane depolarization stimulates calcium ion influx through voltage-sensitive calcium channels. This increase in intracellular calcium ion concentration induces the secretion of insulin.

AATP-sensitive inward rectifier potassium channel 11
AATP-sensitive inward rectifier potassium channel 1
AATP-binding cassette sub-family C member 8

Completely (100%) absorbed following oral administration.

Volume of distribution
  • 21.8 ± 13.9 L [Volunteers]
  • 19.8 ± 12.7 L [Patients with Type 2 diabetes, Single Dose]
  • 37.1 ± 18.2 L [Patients with Type 2 diabetes, Multiple Dose]
Protein binding

Over 99.5% bound to plasma protein.


Hepatic. Following either an intravenous or oral dose, glimepiride is completely metabolized by oxidative biotransformation to a major metabolite, cyclohexyl hydroxymethyl derivative (M1), via the hepatic cytochrome P450 II C9 subsystem. M1 is further metabolized to the carboxyl derivative (M2) by one or several cytosolic enzymes. M1, but not M2, possessed approximately one third of the pharmacologic activity of its parent in an animal model. However, whether the glucose-lowering effect of M1 is clinically significant is not clear.

Route of elimination
Not Available
Half life

Approximately 5 hours following single dose.

  • 52.1 +/- 16.0 mL/min [Normal subjects with single oral dose]
  • 48.5 +/- 29.3 mL/min [Patients with Type 2 diabetes, with single oral dose]
  • 52.7 +/- 40.3 mL/min [Patients with Type 2 diabetes, with multiple oral dose]
  • 47.8 mL/min [healthy after intravenous (IV) dosing]

Severe hypoglycemic reactions with coma, seizure, or other neurological impairment.

Affected organisms
  • Humans and other mammals
Not Available
Pharmacogenomic Effects/ADRs
Interacting Gene/EnzymeAllele nameGenotype(s)Defining Change(s)Type(s)DescriptionDetails
Glucose-6-phosphate 1-dehydrogenaseVilleurbanneNot Available1000_1002delACCADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseTorunNot Available1006A->GADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseSunderlandNot Available105_107delCATADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseIwatsukiNot Available1081G->AADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseSerresNot Available1082C->TADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseTondelaNot Available1084_1101delCTGAACGAGCGCAAGGCCADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseLoma LindaNot Available1089C->AADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseAachenNot Available1089C->GADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseTenriNot Available1096A->GADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseMontpellierNot Available1132G>AADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseCalvo MackennaNot Available1138A->GADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseRileyNot Available1139T->CADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseOlomoucNot Available1141T->CADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseTomahNot Available1153T->CADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseLynwoodNot Available1154G->TADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseMadridNot Available1155C->GADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseIowa, Walter Reed, SpringfieldNot Available1156A->GADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseBeverly Hills, Genova, Iwate, Niigata, YamaguchiNot Available1160G->AADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseHartfordNot Available1162A->GADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenasePrahaNot Available1166A->GADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseKrakowNot Available1175T>CADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseWisconsinNot Available1177C->GADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseNashville, Anaheim, PorticiNot Available1178G->AADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseAlhambraNot Available1180G->CADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseBariNot Available1187C->TADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenasePuerto LimonNot Available1192G->AADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseCovao do LoboNot Available1205C>AADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseClinicNot Available1215G->AADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseUtrechtNot Available1225C->TADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseSuwalkiNot Available1226C->GADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseRiversideNot Available1228G->TADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseJapan, ShinagawaNot Available1229G->AADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseKawasakiNot Available1229G->CADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseMunichNot Available1231A->GADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseGeorgiaNot Available1284C->AADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseSumareNot Available1292T->GADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseTelti/KobeNot Available1318C->TADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseSantiago de Cuba, MoriokaNot Available1339G->AADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseHarimaNot Available1358T->AADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseFiguera da FozNot Available1366G->CADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseAmiensNot Available1367A>TADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseBangkok NoiNot Available1376G->T, 1502T->GADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseFukayaNot Available1462G->AADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseCampinasNot Available1463G->TADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseBuenos AiresNot Available1465C>TADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseArakawaNot Available1466C->TADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseBrightonNot Available1488_1490delGAAADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseKozukataNot Available159G->CADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseAmsterdamNot Available180_182delTCTADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseNo nameNot Available202G->A, 376A->G, 1264C>GADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseSwanseaNot Available224T->CADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseUrayasuNot Available281_283delAGAADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseVancouverNot Available317C->G544C->T592C->TADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseMt SinaiNot Available376A->G, 1159C->TADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenasePlymouthNot Available488G->AADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseVolendamNot Available514C->TADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseShinshuNot Available527A->GADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseChikugoNot Available535A->TADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseTsukuiNot Available561_563delCTCADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenasePedoplis-CkaroNot Available573C>GADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseSantiagoNot Available593G->CADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseMinnesota, Marion, Gastonia, LeJeuneNot Available637G->TADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseCincinnatiNot Available637G->T, 1037A->TADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseHarilaouNot Available648T->GADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseNorth DallasNot Available683_685delACAADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseAsahikawaNot Available695G->AADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseDurhamNot Available713A->GADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseStonybrookNot Available724_729delGGCACTADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseWayneNot Available769C->GADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseAveiroNot Available806G->AADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseCleveland CorumNot Available820G->AADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseLilleNot Available821A>TADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseBangkokNot Available825G>CADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseSugaoNot Available826C->TADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseLa JollaNot Available832T->CADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseWexhamNot Available833C->TADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenasePiotrkowNot Available851T>CADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseWest VirginiaNot Available910G->TADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseOmiyaNot Available921G->CADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseNaraNot Available953_976delCCACCAAAGGGTACCTGGAC GACCADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseManhattanNot Available962G->AADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseRehevotNot Available964T->CADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseHoniaraNot Available99A->G / 1360C->TADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseTokyo, FukushimaNot Available1246G->AADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseChathamNot Available1003G->AADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseFushanNot Available1004C->AADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenasePartenopeNot Available1052G->TADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseIerapetraNot Available1057C->TADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseAnadiaNot Available1193A->GADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseAbenoNot Available1220A->CADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseSurabayaNot Available1291G->AADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenasePawneeNot Available1316G->CADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseS. AntiocoNot Available1342A->GADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseCassanoNot Available1347G->CADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseHermoupolisNot Available1347G->C / 1360C->TADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseUnion,Maewo, Chinese-2, KaloNot Available1360C->TADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseAndalusNot Available1361G->AADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseCosenzaNot Available1376G->CADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseCanton, Taiwan- Hakka, Gifu-like, Agrigento-likeNot Available1376G->TADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseFloresNot Available1387C->AADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseKaiping, Anant, Dhon, Sapporo-like, WoseraNot Available1388G->AADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseKamogawaNot Available169C->TADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseCostanzoNot Available179T>CADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseAmazoniaNot Available185C->AADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseSongklanagarindNot Available196T->AADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseHechiNot Available202G->A / 871G->AADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseNamouruNot Available208T->CADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseBao LocNot Available352T>CADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseCrispimNot Available375G->T, 379G->T383T->C384C>TADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseAcrokorinthosNot Available376A->G / 463C->GADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseSanta MariaNot Available376A->G / 542A->TADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseAnanindeuaNot Available376A->G / 871G->AADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseVanua LavaNot Available383T->CADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseValladolidNot Available406C->TADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseBelemNot Available409C->TADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseLiuzhouNot Available442G->AADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseShenzenNot Available473G>AADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseTaipei “Chinese- 3”Not Available493A->GADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseToledoNot Available496C>TADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseNaoneNot Available497G->AADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseNankangNot Available517T->CADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseMiaoliNot Available519C->GADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseMediterranean, Dallas, Panama‚ Sassari, Cagliari, BirminghamNot Available563C->TADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseCoimbra ShundeNot Available592C->TADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseNilgiriNot Available593G>AADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseRadlowoNot Available679C->TADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseRoubaixNot Available811G>CADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseHaikouNot Available835A->GADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseChinese-1Not Available835A->TADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseMizushimaNot Available848A>GADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseOsakaNot Available853C->TADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseViangchan, JammuNot Available871G->AADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseSeoulNot Available916G->AADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseLudhianaNot Available929G->AADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseFarroupilhaNot Available977C->AADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseChinese-5Not Available1024C->TADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseRignanoNot Available130G>AADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseOrissaNot Available131C->GADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseG6PDNiceNot Available1380G>CADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseKamiube, KeelungNot Available1387C->TADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseNeapolisNot Available1400C->GADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseAuresNot Available143T->CADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseSplitNot Available1442C->GADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseKambosNot Available148C->TADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenasePalestrinaNot Available170G>AADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseMetapontoNot Available172G->AADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseMusashinoNot Available185C->TADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseAsahiNot Available202G->AADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseA- (202), Ferrara INot Available202G->A / 376A->GADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseMurcia OristanoNot Available209A->GADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseUbe KonanNot Available241C->TADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseLagosantoNot Available242G->AADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseGuangzhouNot Available274C->TADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseHammersmithNot Available323T->AADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseSinnaiNot Available34G->TADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseA- (680)Not Available376A->G / 680G->TADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseA- (968), Betica,Selma, GuantanamoNot Available376A->G / 968T->CADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseSalerno PyrgosNot Available383T>GADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseQuing YanNot Available392G->TADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseLagesNot Available40G->AADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseIleshaNot Available466G->AADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseMahidolNot Available487G->AADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseMalagaNot Available542A->TADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseSibariNot Available634A->GADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseMexico CityNot Available680G->AADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseNanningNot Available703C->TADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseSeattle, Lodi, Modena, Ferrara II, Athens-likeNot Available844G->CADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseBajo MaumereNot Available844G->TADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseMontalbanoNot Available854G->AADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseKalyan-Kerala, Jamnaga, RohiniNot Available949G->AADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseGaoheNot Available95A->GADR InferredIncreased risk of hemolytic anemia.Details


Drug Interactions
(R)-warfarinGlimepiride may increase the anticoagulant activities of (R)-warfarin.
(S)-WarfarinGlimepiride may increase the anticoagulant activities of (S)-Warfarin.
2,4-thiazolidinedioneThe risk or severity of hypoglycemia can be increased when Glimepiride is combined with 2,4-thiazolidinedione.
4-hydroxycoumarinGlimepiride may increase the anticoagulant activities of 4-hydroxycoumarin.
5-(2-methylpiperazine-1-sulfonyl)isoquinolineThe therapeutic efficacy of Glimepiride can be increased when used in combination with 5-(2-methylpiperazine-1-sulfonyl)isoquinoline.
AbataceptThe metabolism of Glimepiride can be increased when combined with Abatacept.
AbirateroneThe metabolism of Glimepiride can be decreased when combined with Abiraterone.
AcarboseThe risk or severity of hypoglycemia can be increased when Glimepiride is combined with Acarbose.
AcebutololAcebutolol may increase the hypoglycemic activities of Glimepiride.
AcenocoumarolThe metabolism of Acenocoumarol can be decreased when combined with Glimepiride.
Food Interactions
  • Avoid alcohol.
  • Even though food reduces product absorption, the manufacturer recommends taking the product with the first meal of the day.


Synthesis Reference

Suresh Kadam, Venkatasubramanian Tarur, Sanjay Naik, Sachin Gavhane, "Process for preparation of substantially pure glimepiride." U.S. Patent US20070082943, issued April 12, 2007.

General References
Not Available
External Links
KEGG Compound
PubChem Compound
PubChem Substance
Therapeutic Targets Database
RxList Drug Page Drug Page
ATC Codes
A10BB12 — GlimepirideA10BD06 — Glimepiride and pioglitazoneA10BD04 — Glimepiride and rosiglitazone
AHFS Codes
  • 68:20.20 — Sulfonylureas
FDA label
Download (176 KB)

Clinical Trials

Clinical Trials
1CompletedNot AvailableHealthy Volunteers3
1CompletedNot AvailablePharmacokinetics1
1CompletedNot AvailableType 2 Diabetes Mellitus1
1CompletedBasic ScienceHealthy Volunteers2
1CompletedTreatmentDiabetes Mellitus (DM)1
1CompletedTreatmentDiabetes Mellitus (DM) / Type 2 Diabetes Mellitus1
1CompletedTreatmentHealthy Volunteers5
1CompletedTreatmentType 2 Diabetes Mellitus3
1CompletedTreatmentType2 Diabetes Mellitus1
1Not Yet RecruitingHealth Services ResearchType2 Diabetes1
1TerminatedTreatmentType 2 Diabetes Mellitus1
1, 2RecruitingTreatmentHemangioma Liver1
2CompletedNot AvailableDiabetes Mellitus (DM) / Type 2 Diabetes Mellitus1
2CompletedTreatmentCongestive Heart Failure (CHF) / Type 2 Diabetes Mellitus1
2CompletedTreatmentDiabetes Mellitus (DM) / Type 2 Diabetes Mellitus1
2CompletedTreatmentImpaired Glucose Tolerance (IGT) / Type 2 Diabetes Mellitus1
2CompletedTreatmentType 2 Diabetes Mellitus5
2WithdrawnTreatmentType 2 Diabetes Mellitus1
2, 3CompletedTreatmentMaturity-Onset Diabetes of the Young1
2, 3CompletedTreatmentType 2 Diabetes Mellitus2
3Active Not RecruitingTreatmentComparative Effectiveness of Glycemia-lowering Medications / Type 2 Diabetes Mellitus1
3Active Not RecruitingTreatmentDiabetes Mellitus (DM)1
3Active Not RecruitingTreatmentType 2 Diabetes Mellitus2
3CompletedPreventionAtherosclerosis / Cardiovascular Disease (CVD) / Coronary Heart Disease (CHD) / Diabetes Mellitus (DM) / High Blood Pressure (Hypertension) / High Cholesterol / Type 2 Diabetes Mellitus1
3CompletedTreatmentDiabetes Mellitus (DM)3
3CompletedTreatmentDiabetes Mellitus (DM) / Dyslipidemias1
3CompletedTreatmentDiabetes Mellitus (DM) / Type 2 Diabetes Mellitus5
3CompletedTreatmentDiabetes Mellitus, Non-Insulin-Dependent1
3CompletedTreatmentDiabetes Mellitus, Non-Insulin-Dependent / Type 2 Diabetes Mellitus, Non Insulin Dependent1
3CompletedTreatmentDiabetics Patients1
3CompletedTreatmentType 2 Diabetes Mellitus47
3Not Yet RecruitingTreatmentType 2 Diabetes Mellitus1
3TerminatedTreatmentDiabetes Mellitus (DM) / Type 2 Diabetes Mellitus4
3TerminatedTreatmentType 2 Diabetes Mellitus8
3WithdrawnHealth Services ResearchDiabetes Mellitus (DM)1
3WithdrawnTreatmentType 2 Diabetes Mellitus2
4Active Not RecruitingTreatmentCoronary Artery Disease / Type 2 Diabetes Mellitus1
4Active Not RecruitingTreatmentType 2 Diabetes Mellitus2
4CompletedTreatmentDiabetes Mellitus (DM)3
4CompletedTreatmentDiabetes Mellitus (DM) / Endothelial Dysfunction1
4CompletedTreatmentDiabetes Mellitus (DM) / Type 2 Diabetes Mellitus3
4CompletedTreatmentDiabetes Mellitus, Non-Insulin-Dependent1
4CompletedTreatmentGlucotoxicity / Pancreatic Beta Cell Function / Type 2 Diabetes Mellitus1
4CompletedTreatmentHypoglycemia / Type 2 Diabetes Mellitus1
4CompletedTreatmentInadequate Glycaemic Control / Type 2 Diabetes Mellitus / Type2 Diabetes Mellitus1
4CompletedTreatmentInsulin Resistance / Type 2 Diabetes Mellitus1
4CompletedTreatmentType 2 Diabetes Mellitus25
4Enrolling by InvitationTreatmentMicroalbuminuria / Microalbuminuria /Creatinine Ratios ACR1
4Not Yet RecruitingTreatmentType 2 Diabetes Mellitus1
4RecruitingTreatmentCardiovascular Disease (CVD) / Type2 Diabetes1
4RecruitingTreatmentEffects of the DPP-4 Inhibitors or SGLT2 Inhibitors on the Protective Actions for Diabetic Complications1
4RecruitingTreatmentNon-Alcoholic Fatty Liver Disease (NAFLD)1
4RecruitingTreatmentType 2 Diabetes Mellitus6
4TerminatedTreatmentType 2 Diabetes Mellitus5
4Unknown StatusNot AvailableType 2 Diabetes Mellitus1
4Unknown StatusBasic ScienceType 2 Diabetes Mellitus1
4Unknown StatusTreatmentType 2 Diabetes Mellitus3
4WithdrawnNot AvailableType 2 Diabetes Mellitus1
Not AvailableActive Not RecruitingPreventionCoronary Heart Disease (CHD)1
Not AvailableCompletedNot AvailableHealthy Volunteers2
Not AvailableCompletedNot AvailableType 2 Diabetes Mellitus6
Not AvailableCompletedBasic ScienceMaturity-Onset Diabetes of the Young, Type 31
Not AvailableCompletedOtherCardiovascular Disease (CVD) / Type 2 Diabetes Mellitus1
Not AvailableCompletedTreatmentAtherosclerosis / Impaired Glucose Tolerance (IGT) / Type 2 Diabetes Mellitus1
Not AvailableCompletedTreatmentPre-Diabetic / Type 2 Diabetes Mellitus1
Not AvailableCompletedTreatmentType 2 Diabetes Mellitus4
Not AvailableNot Yet RecruitingNot AvailableType 2 Diabetes Mellitus1
Not AvailableNot Yet RecruitingTreatmentType 2 Diabetes Mellitus1
Not AvailableRecruitingNot AvailableType2 Diabetes1
Not AvailableRecruitingTreatmentDiabetes Mellitus (DM)1
Not AvailableRecruitingTreatmentType2 Diabetes Mellitus1


  • Sanofi aventis us llc
  • Accord healthcare inc
  • Carlsbad technology inc
  • Corepharma llc
  • Dr reddys laboratories ltd
  • Genpharm inc
  • Invagen pharmaceuticals inc
  • Mylan pharmaceuticals inc
  • Ranbaxy laboratories ltd
  • Teva pharmaceuticals usa inc
  • Vintage pharmaceuticals llc
  • Watson laboratories inc
  • Watson laboratories inc florida
  • Accord Healthcare
  • Advanced Pharmaceutical Services Inc.
  • Amerisource Health Services Corp.
  • A-S Medication Solutions LLC
  • Bryant Ranch Prepack
  • Cardinal Health
  • Carlsbad Technology Inc.
  • Cobalt Pharmaceuticals Inc.
  • Corepharma LLC
  • Dispensing Solutions
  • Diversified Healthcare Services Inc.
  • Doctor Reddys Laboratories Ltd.
  • Heartland Repack Services LLC
  • Intas Pharmaceuticals Ltd.
  • International Laboratories Inc.
  • InvaGen Pharmaceuticals Inc.
  • Ivax Pharmaceuticals
  • Lake Erie Medical and Surgical Supply
  • Murfreesboro Pharmaceutical Nursing Supply
  • Mylan
  • Nucare Pharmaceuticals Inc.
  • PD-Rx Pharmaceuticals Inc.
  • Perrigo Co.
  • Pharmacy Service Center
  • Physicians Total Care Inc.
  • Prasco Labs
  • Prepak Systems Inc.
  • Ranbaxy Laboratories
  • Rebel Distributors Corp.
  • Resource Optimization and Innovation LLC
  • Sandoz
  • Sanofi-Aventis Inc.
  • Southwood Pharmaceuticals
  • Stat Scripts LLC
  • Teva Pharmaceutical Industries Ltd.
  • UDL Laboratories
  • Vangard Labs Inc.
Dosage forms
TabletOral1 mg
TabletOral2 mg
TabletOral4 mg
Tablet, film coatedOral
TabletOral1 mg/1
TabletOral2 mg/1
TabletOral3 mg/1
TabletOral4 mg/1
TabletOral6 mg/1
TabletOral8 mg/1
TabletOral3 mg
Unit descriptionCostUnit
Amaryl 4 mg tablet2.11USD tablet
Amaryl 2 mg tablet1.25USD tablet
Glimepiride 4 mg tablet1.25USD tablet
Amaryl 1 mg tablet0.88USD tablet
Glimepiride 2 mg tablet0.67USD tablet
Glimepiride 1 mg tablet0.42USD tablet
DrugBank does not sell nor buy drugs. Pricing information is supplied for informational purposes only.
Patent NumberPediatric ExtensionApprovedExpires (estimated)


Experimental Properties
melting point (°C)207 °CNot Available
water solubilityInsolubleNot Available
logP3.5Not Available
Predicted Properties
Water Solubility0.0347 mg/mLALOGPS
pKa (Strongest Acidic)2.23ChemAxon
pKa (Strongest Basic)-0.36ChemAxon
Physiological Charge0ChemAxon
Hydrogen Acceptor Count7ChemAxon
Hydrogen Donor Count3ChemAxon
Polar Surface Area131.66 Å2ChemAxon
Rotatable Bond Count6ChemAxon
Refractivity130.85 m3·mol-1ChemAxon
Polarizability53.31 Å3ChemAxon
Number of Rings3ChemAxon
Rule of FiveYesChemAxon
Ghose FilterNoChemAxon
Veber's RuleNoChemAxon
MDDR-like RuleYesChemAxon
Predicted ADMET features
Human Intestinal Absorption+0.986
Blood Brain Barrier+0.7322
Caco-2 permeable-0.6809
P-glycoprotein substrateSubstrate0.7501
P-glycoprotein inhibitor INon-inhibitor0.6556
P-glycoprotein inhibitor IIInhibitor0.6124
Renal organic cation transporterNon-inhibitor0.8241
CYP450 2C9 substrateSubstrate0.5661
CYP450 2D6 substrateNon-substrate0.9116
CYP450 3A4 substrateNon-substrate0.5978
CYP450 1A2 substrateNon-inhibitor0.9045
CYP450 2C9 inhibitorInhibitor0.8949
CYP450 2D6 inhibitorNon-inhibitor0.9231
CYP450 2C19 inhibitorNon-inhibitor0.9025
CYP450 3A4 inhibitorNon-inhibitor0.8309
CYP450 inhibitory promiscuityLow CYP Inhibitory Promiscuity0.8599
Ames testNon AMES toxic0.6392
BiodegradationNot ready biodegradable0.68
Rat acute toxicity2.4158 LD50, mol/kg Not applicable
hERG inhibition (predictor I)Weak inhibitor0.7714
hERG inhibition (predictor II)Non-inhibitor0.8263
ADMET data is predicted using admetSAR, a free tool for evaluating chemical ADMET properties. (23092397)


Mass Spec (NIST)
Not Available
SpectrumSpectrum TypeSplash Key
Predicted MS/MS Spectrum - 10V, Positive (Annotated)Predicted LC-MS/MSNot Available
Predicted MS/MS Spectrum - 20V, Positive (Annotated)Predicted LC-MS/MSNot Available
Predicted MS/MS Spectrum - 40V, Positive (Annotated)Predicted LC-MS/MSNot Available
Predicted MS/MS Spectrum - 10V, Negative (Annotated)Predicted LC-MS/MSNot Available
Predicted MS/MS Spectrum - 20V, Negative (Annotated)Predicted LC-MS/MSNot Available
Predicted MS/MS Spectrum - 40V, Negative (Annotated)Predicted LC-MS/MSNot Available
LC-MS/MS Spectrum - LC-ESI-qTof , PositiveLC-MS/MSNot Available
LC-MS/MS Spectrum - LC-ESI-qTof , PositiveLC-MS/MSNot Available
LC-MS/MS Spectrum - LC-ESI-qTof , PositiveLC-MS/MSNot Available
MS/MS Spectrum - , positiveLC-MS/MSsplash10-03di-0012290000-966a50af984de12b0ba8
MS/MS Spectrum - , positiveLC-MS/MSsplash10-0udi-2629000000-29b987358cc85159c5b8
MS/MS Spectrum - , positiveLC-MS/MSsplash10-03di-0002190000-0aaefa2e07605da97f81
MS/MS Spectrum - , positiveLC-MS/MSsplash10-0udi-0409000000-91b493608ac508427593
MS/MS Spectrum - , positiveLC-MS/MSsplash10-004i-3911000000-78c0f40c965f78bfa591


This compound belongs to the class of organic compounds known as benzenesulfonamides. These are organic compounds containing a sulfonamide group that is S-linked to a benzene ring.
Organic compounds
Super Class
Benzene and substituted derivatives
Sub Class
Direct Parent
Alternative Parents
Benzenesulfonyl compounds / Pyrroline carboxylic acids and derivatives / Sulfonylureas / N-acyl ureas / Organosulfonic acids and derivatives / Dicarboximides / Aminosulfonyl compounds / Azacyclic compounds / Organopnictogen compounds / Organic oxides
show 2 more
Benzenesulfonamide / Benzenesulfonyl group / Pyrroline carboxylic acid or derivatives / N-acyl urea / Ureide / Sulfonylurea / Dicarboximide / Pyrroline / Organic sulfonic acid or derivatives / Organosulfonic acid or derivatives
show 17 more
Molecular Framework
Aromatic heteromonocyclic compounds
External Descriptors
sulfonamide, N-sulfonylurea, N-acylurea (CHEBI:5383)


Pharmacological action
General Function
Voltage-gated potassium channel activity
Specific Function
This receptor is controlled by G proteins. Inward rectifier potassium channels are characterized by a greater tendency to allow potassium to flow into the cell rather than out of it. Their voltage ...
Gene Name
Uniprot ID
Uniprot Name
ATP-sensitive inward rectifier potassium channel 11
Molecular Weight
43540.375 Da
  1. Song DK, Ashcroft FM: Glimepiride block of cloned beta-cell, cardiac and smooth muscle K(ATP) channels. Br J Pharmacol. 2001 May;133(1):193-9. [PubMed:11325810]
  2. Lawrence CL, Rainbow RD, Davies NW, Standen NB: Effect of metabolic inhibition on glimepiride block of native and cloned cardiac sarcolemmal K(ATP) channels. Br J Pharmacol. 2002 Jul;136(5):746-52. [PubMed:12086984]
  3. Bataille D: [Molecular mechanisms of insulin secretion]. Diabetes Metab. 2002 Dec;28(6 Suppl):4S7-13. [PubMed:12703060]
Pharmacological action
General Function
Phosphatidylinositol-4,5-bisphosphate binding
Specific Function
In the kidney, probably plays a major role in potassium homeostasis. Inward rectifier potassium channels are characterized by a greater tendency to allow potassium to flow into the cell rather than...
Gene Name
Uniprot ID
Uniprot Name
ATP-sensitive inward rectifier potassium channel 1
Molecular Weight
44794.6 Da
  1. Overington JP, Al-Lazikani B, Hopkins AL: How many drug targets are there? Nat Rev Drug Discov. 2006 Dec;5(12):993-6. [PubMed:17139284]
  2. Imming P, Sinning C, Meyer A: Drugs, their targets and the nature and number of drug targets. Nat Rev Drug Discov. 2006 Oct;5(10):821-34. [PubMed:17016423]
  3. Proks P, Reimann F, Green N, Gribble F, Ashcroft F: Sulfonylurea stimulation of insulin secretion. Diabetes. 2002 Dec;51 Suppl 3:S368-76. [PubMed:12475777]
  4. Bataille D: [Molecular mechanisms of insulin secretion]. Diabetes Metab. 2002 Dec;28(6 Suppl):4S7-13. [PubMed:12703060]
Pharmacological action
General Function
Sulfonylurea receptor activity
Specific Function
Subunit of the beta-cell ATP-sensitive potassium channel (KATP). Regulator of ATP-sensitive K(+) channels and insulin release.
Gene Name
Uniprot ID
Uniprot Name
ATP-binding cassette sub-family C member 8
Molecular Weight
176990.36 Da
  1. Muller G, Hartz D, Punter J, Okonomopulos R, Kramer W: Differential interaction of glimepiride and glibenclamide with the beta-cell sulfonylurea receptor. I. Binding characteristics. Biochim Biophys Acta. 1994 May 11;1191(2):267-77. [PubMed:8172912]
  2. Kramer W, Muller G, Geisen K: Characterization of the molecular mode of action of the sulfonylurea, glimepiride, at beta-cells. Horm Metab Res. 1996 Sep;28(9):464-8. [PubMed:8911984]
  3. Kramer W, Muller G, Girbig F, Gutjahr U, Kowalewski S, Hartz D, Summ HD: The molecular interaction of sulfonylureas with beta-cell ATP-sensitive K(+)-channels. Diabetes Res Clin Pract. 1995 Aug;28 Suppl:S67-80. [PubMed:8529521]


Pharmacological action
General Function
Steroid hydroxylase activity
Specific Function
Cytochromes P450 are a group of heme-thiolate monooxygenases. In liver microsomes, this enzyme is involved in an NADPH-dependent electron transport pathway. It oxidizes a variety of structurally un...
Gene Name
Uniprot ID
Uniprot Name
Cytochrome P450 2C9
Molecular Weight
55627.365 Da
  1. Zhou SF, Zhou ZW, Yang LP, Cai JP: Substrates, inducers, inhibitors and structure-activity relationships of human Cytochrome P450 2C9 and implications in drug development. Curr Med Chem. 2009;16(27):3480-675. Epub 2009 Sep 1. [PubMed:19515014]
  2. Preissner S, Kroll K, Dunkel M, Senger C, Goldsobel G, Kuzman D, Guenther S, Winnenburg R, Schroeder M, Preissner R: SuperCYP: a comprehensive database on Cytochrome P450 enzymes including a tool for analysis of CYP-drug interactions. Nucleic Acids Res. 2010 Jan;38(Database issue):D237-43. doi: 10.1093/nar/gkp970. Epub 2009 Nov 24. [PubMed:19934256]
  3. Drug Interactions: Cytochrome P450 Drug Interaction Table [Link]


Pharmacological action
General Function
Transporter activity
Specific Function
Involved in the ATP-dependent secretion of bile salts into the canaliculus of hepatocytes.
Gene Name
Uniprot ID
Uniprot Name
Bile salt export pump
Molecular Weight
146405.83 Da
  1. Pedersen JM, Matsson P, Bergstrom CA, Hoogstraate J, Noren A, LeCluyse EL, Artursson P: Early identification of clinically relevant drug interactions with the human bile salt export pump (BSEP/ABCB11). Toxicol Sci. 2013 Dec;136(2):328-43. doi: 10.1093/toxsci/kft197. Epub 2013 Sep 6. [PubMed:24014644]

Drug created on June 13, 2005 07:24 / Updated on December 16, 2018 23:30