You are using an unsupported browser. Please upgrade your browser to a newer version to get the best experience on DrugBank.
Accession NumberDB01087  (APRD00604)
TypeSmall Molecule
DescriptionAn aminoquinoline that is given by mouth to produce a radical cure and prevent relapse of vivax and ovale malarias following treatment with a blood schizontocide. It has also been used to prevent transmission of falciparum malaria by those returning to areas where there is a potential for re-introduction of malaria. Adverse effects include anemias and GI disturbances. (From Martindale, The Extra Pharmacopeia, 30th ed, p404)
External IDs Not Available
Product Ingredients
IngredientUNIICASInChI KeyDetails
Primaquine phosphateH0982HF78B 63-45-6GJOHLWZHWQUKAU-UHFFFAOYSA-NDetails
Approved Prescription Products
NameDosageStrengthRouteLabellerMarketing StartMarketing End
PrimaquineTablet26.3 mgOralSanofi Aventis1945-12-31Not applicableCanada
Primaquine PhosphateTablet, film coated15 mg/1OralSanofi Aventis2011-04-15Not applicableUs
Primaquine PhosphateTablet, film coated15 mg/1Oralbryant ranch prepack2015-04-17Not applicableUs
Primaquine PhosphateTablet, film coated15 mg/1OralPd Rx Pharmaceuticals, Inc.2010-01-01Not applicableUs
Primaquine PhosphateTablet, film coated15 mg/1OralAvera Mc Kennan Hospital2015-08-24Not applicableUs
Approved Generic Prescription Products
NameDosageStrengthRouteLabellerMarketing StartMarketing End
Primaquine PhosphateTablet, film coated26.3 mg/1OralAlvogen, Inc.2011-12-08Not applicableUs
Primaquine PhosphateTablet, film coated15 mg/1OralGolden State Medical Supply2014-05-08Not applicableUs
Primaquine PhosphateTablet15 mg/1OralBayshore Pharmaceuticals, LLC2014-08-01Not applicableUs
Primaquine PhosphateTablet15 mg/1OralLiberty Pharmaceuticals, Inc.2014-08-01Not applicableUs
Primaquine PhosphateTablet, film coated15 mg/1OralIngenus Pharmaceuticals Nj, Llc2016-06-23Not applicableUs
Primaquine PhosphateTablet15 mg/1OralPd Rx Pharmaceuticals, Inc.2014-08-01Not applicableUs
Approved Over the Counter ProductsNot Available
Unapproved/Other Products Not Available
International Brands
Neo-QuipenylNot Available
PrimachinNot Available
Brand mixturesNot Available
CAS number90-34-6
WeightAverage: 259.3467
Monoisotopic: 259.168462309
Chemical FormulaC15H21N3O
IndicationFor the treatment of malaria.
Structured Indications
PharmacodynamicsPrimaquine is an antimalarial agent and is the essential co-drug with chloroquine in treating all cases of malaria. In the blood, malaria parasites break down a part of the red blood cells known as haemoglobin. When this happens haemoglobin is divided into two parts; haem and globin. Haem is toxic to the malaria parasite. To prevent it from being damaged, the malaria parasite produces an chemical which converts the toxic haem into a non-toxic product. Primaquine acts by interfering with a part of the parasite (mitochondria) that is responsible for supplying it with energy. Without energy the parasite dies. This stops the infection from continuing and allows the person to recover. Primaquine kills the intrahepatic form of Plasmodium vivax and Plasmodium ovale, and thereby prevents the development of the erythrocytic forms that are responsible for relapses (it also kills gametocytes). Primaquine is not used in the prevention of malaria, only in the treatment. It has insignificant activity against the asexual blood forms of the parasite and therefore it is always used in conjunction with a blood schizonticide and never as a single agent. Primaquine has gametocytocidal activity against all plasmodia, including P. falciparum.
Mechanism of actionPrimaquine's mechanism of action is not well understood. It may be acting by generating reactive oxygen species or by interfering with the electron transport in the parasite. Also, although its mechanism of action is unclear, primaquine may bind to and alter the properties of protozoal DNA.
TargetKindPharmacological actionActionsOrganismUniProt ID
Fe(II)-protoporphyrin IXSmall moleculeyes
Plasmodium falciparumnot applicabledetails
Keratin, type II cytoskeletal 7Proteinunknown
HumanP08729 details
Ribosyldihydronicotinamide dehydrogenase [quinone]Proteinunknown
HumanP16083 details
Related Articles
AbsorptionNot Available
Volume of distributionNot Available
Protein bindingNot Available
MetabolismNot Available
Route of eliminationNot Available
Half life3.7-7.4 hours
ClearanceNot Available
ToxicityNot Available
Affected organisms
  • Plasmodium
PathwaysNot Available
Pharmacogenomic Effects/ADRs
Interacting Gene/EnzymeSNP RS IDsAllele nameGenotypeDefining ChangeType(s)DescriptionDetails
Glucose-6-phosphate 1-dehydrogenaseNot AvailableVilleurbanne---1000_1002delACCADR InferredIncreased risk of potentially fatal hemolysis. Details
Glucose-6-phosphate 1-dehydrogenaseNot AvailableTorun---1006A->GADR InferredIncreased risk of potentially fatal hemolysis. Details
Glucose-6-phosphate 1-dehydrogenaseNot AvailableSunderland---105_107delCATADR InferredIncreased risk of potentially fatal hemolysis. Details
Glucose-6-phosphate 1-dehydrogenaseNot AvailableIwatsuki---1081G->AADR InferredIncreased risk of potentially fatal hemolysis. Details
Glucose-6-phosphate 1-dehydrogenaseNot AvailableSerres---1082C->TADR InferredIncreased risk of potentially fatal hemolysis. Details
Glucose-6-phosphate 1-dehydrogenaseNot AvailableTondela---1084_1101delCTGAACGAGCGCAAGGCCADR InferredIncreased risk of potentially fatal hemolysis. Details
Glucose-6-phosphate 1-dehydrogenaseNot AvailableLoma Linda---1089C->AADR InferredIncreased risk of potentially fatal hemolysis. Details
Glucose-6-phosphate 1-dehydrogenaseNot AvailableAachen---1089C->GADR InferredIncreased risk of potentially fatal hemolysis. Details
Glucose-6-phosphate 1-dehydrogenaseNot AvailableTenri---1096A->GADR InferredIncreased risk of potentially fatal hemolysis. Details
Glucose-6-phosphate 1-dehydrogenaseNot AvailableMontpellier---1132G>AADR InferredIncreased risk of potentially fatal hemolysis. Details
Glucose-6-phosphate 1-dehydrogenaseNot AvailableCalvo Mackenna---1138A->GADR InferredIncreased risk of potentially fatal hemolysis. Details
Glucose-6-phosphate 1-dehydrogenaseNot AvailableRiley---1139T->CADR InferredIncreased risk of potentially fatal hemolysis. Details
Glucose-6-phosphate 1-dehydrogenaseNot AvailableOlomouc---1141T->CADR InferredIncreased risk of potentially fatal hemolysis. Details
Glucose-6-phosphate 1-dehydrogenaseNot AvailableTomah---1153T->CADR InferredIncreased risk of potentially fatal hemolysis. Details
Glucose-6-phosphate 1-dehydrogenaseNot AvailableLynwood---1154G->TADR InferredIncreased risk of potentially fatal hemolysis. Details
Glucose-6-phosphate 1-dehydrogenaseNot AvailableMadrid---1155C->GADR InferredIncreased risk of potentially fatal hemolysis. Details
Glucose-6-phosphate 1-dehydrogenaseNot AvailableIowa, Walter Reed, Springfield---1156A->GADR InferredIncreased risk of potentially fatal hemolysis. Details
Glucose-6-phosphate 1-dehydrogenaseNot AvailableBeverly Hills, Genova, Iwate, Niigata, Yamaguchi---1160G->AADR InferredIncreased risk of potentially fatal hemolysis. Details
Glucose-6-phosphate 1-dehydrogenaseNot AvailableHartford---1162A->GADR InferredIncreased risk of potentially fatal hemolysis. Details
Glucose-6-phosphate 1-dehydrogenaseNot AvailablePraha---1166A->GADR InferredIncreased risk of potentially fatal hemolysis. Details
Glucose-6-phosphate 1-dehydrogenaseNot AvailableKrakow---1175T>CADR InferredIncreased risk of potentially fatal hemolysis. Details
Glucose-6-phosphate 1-dehydrogenaseNot AvailableWisconsin---1177C->GADR InferredIncreased risk of potentially fatal hemolysis. Details
Glucose-6-phosphate 1-dehydrogenaseNot AvailableNashville, Anaheim, Portici---1178G->AADR InferredIncreased risk of potentially fatal hemolysis. Details
Glucose-6-phosphate 1-dehydrogenaseNot AvailableAlhambra---1180G->CADR InferredIncreased risk of potentially fatal hemolysis. Details
Glucose-6-phosphate 1-dehydrogenaseNot AvailableBari---1187C->TADR InferredIncreased risk of potentially fatal hemolysis. Details
Glucose-6-phosphate 1-dehydrogenaseNot AvailablePuerto Limon---1192G->AADR InferredIncreased risk of potentially fatal hemolysis. Details
Glucose-6-phosphate 1-dehydrogenaseNot AvailableCovao do Lobo---1205C>AADR InferredIncreased risk of potentially fatal hemolysis. Details
Glucose-6-phosphate 1-dehydrogenaseNot AvailableClinic---1215G->AADR InferredIncreased risk of potentially fatal hemolysis. Details
Glucose-6-phosphate 1-dehydrogenaseNot AvailableUtrecht---1225C->TADR InferredIncreased risk of potentially fatal hemolysis. Details
Glucose-6-phosphate 1-dehydrogenaseNot AvailableSuwalki---1226C->GADR InferredIncreased risk of potentially fatal hemolysis. Details
Glucose-6-phosphate 1-dehydrogenaseNot AvailableRiverside---1228G->TADR InferredIncreased risk of potentially fatal hemolysis. Details
Glucose-6-phosphate 1-dehydrogenaseNot AvailableJapan, Shinagawa---1229G->AADR InferredIncreased risk of potentially fatal hemolysis. Details
Glucose-6-phosphate 1-dehydrogenaseNot AvailableKawasaki---1229G->CADR InferredIncreased risk of potentially fatal hemolysis. Details
Glucose-6-phosphate 1-dehydrogenaseNot AvailableMunich---1231A->GADR InferredIncreased risk of potentially fatal hemolysis. Details
Glucose-6-phosphate 1-dehydrogenaseNot AvailableGeorgia---1284C->AADR InferredIncreased risk of potentially fatal hemolysis. Details
Glucose-6-phosphate 1-dehydrogenaseNot AvailableSumare---1292T->GADR InferredIncreased risk of potentially fatal hemolysis. Details
Glucose-6-phosphate 1-dehydrogenaseNot AvailableTelti/Kobe---1318C->TADR InferredIncreased risk of potentially fatal hemolysis. Details
Glucose-6-phosphate 1-dehydrogenaseNot AvailableSantiago de Cuba, Morioka---1339G->AADR InferredIncreased risk of potentially fatal hemolysis. Details
Glucose-6-phosphate 1-dehydrogenaseNot AvailableHarima---1358T->AADR InferredIncreased risk of potentially fatal hemolysis. Details
Glucose-6-phosphate 1-dehydrogenaseNot AvailableFiguera da Foz---1366G->CADR InferredIncreased risk of potentially fatal hemolysis. Details
Glucose-6-phosphate 1-dehydrogenaseNot AvailableAmiens---1367A>TADR InferredIncreased risk of potentially fatal hemolysis. Details
Glucose-6-phosphate 1-dehydrogenaseNot AvailableBangkok Noi---1376G->T, 1502T->GADR InferredIncreased risk of potentially fatal hemolysis. Details
Glucose-6-phosphate 1-dehydrogenaseNot AvailableFukaya---1462G->AADR InferredIncreased risk of potentially fatal hemolysis. Details
Glucose-6-phosphate 1-dehydrogenaseNot AvailableCampinas---1463G->TADR InferredIncreased risk of potentially fatal hemolysis. Details
Glucose-6-phosphate 1-dehydrogenaseNot AvailableBuenos Aires---1465C>TADR InferredIncreased risk of potentially fatal hemolysis. Details
Glucose-6-phosphate 1-dehydrogenaseNot AvailableArakawa---1466C->TADR InferredIncreased risk of potentially fatal hemolysis. Details
Glucose-6-phosphate 1-dehydrogenaseNot AvailableBrighton---1488_1490delGAAADR InferredIncreased risk of potentially fatal hemolysis. Details
Glucose-6-phosphate 1-dehydrogenaseNot AvailableKozukata---159G->CADR InferredIncreased risk of potentially fatal hemolysis. Details
Glucose-6-phosphate 1-dehydrogenaseNot AvailableAmsterdam---180_182delTCTADR InferredIncreased risk of potentially fatal hemolysis. Details
Glucose-6-phosphate 1-dehydrogenaseNot AvailableNo name---202G->A, 376A->G, 1264C>GADR InferredIncreased risk of potentially fatal hemolysis. Details
Glucose-6-phosphate 1-dehydrogenaseNot AvailableSwansea---224T->CADR InferredIncreased risk of potentially fatal hemolysis. Details
Glucose-6-phosphate 1-dehydrogenaseNot AvailableUrayasu---281_283delAGAADR InferredIncreased risk of potentially fatal hemolysis. Details
Glucose-6-phosphate 1-dehydrogenaseNot AvailableVancouver---317C->G544C->T592C->TADR InferredIncreased risk of potentially fatal hemolysis. Details
Glucose-6-phosphate 1-dehydrogenaseNot AvailableMt Sinai---376A->G, 1159C->TADR InferredIncreased risk of potentially fatal hemolysis. Details
Glucose-6-phosphate 1-dehydrogenaseNot AvailablePlymouth---488G->AADR InferredIncreased risk of potentially fatal hemolysis. Details
Glucose-6-phosphate 1-dehydrogenaseNot AvailableVolendam---514C->TADR InferredIncreased risk of potentially fatal hemolysis. Details
Glucose-6-phosphate 1-dehydrogenaseNot AvailableShinshu---527A->GADR InferredIncreased risk of potentially fatal hemolysis. Details
Glucose-6-phosphate 1-dehydrogenaseNot AvailableChikugo---535A->TADR InferredIncreased risk of potentially fatal hemolysis. Details
Glucose-6-phosphate 1-dehydrogenaseNot AvailableTsukui---561_563delCTCADR InferredIncreased risk of potentially fatal hemolysis. Details
Glucose-6-phosphate 1-dehydrogenaseNot AvailablePedoplis-Ckaro---573C>GADR InferredIncreased risk of potentially fatal hemolysis. Details
Glucose-6-phosphate 1-dehydrogenaseNot AvailableSantiago---593G->CADR InferredIncreased risk of potentially fatal hemolysis. Details
Glucose-6-phosphate 1-dehydrogenaseNot AvailableMinnesota, Marion, Gastonia, LeJeune---637G->TADR InferredIncreased risk of potentially fatal hemolysis. Details
Glucose-6-phosphate 1-dehydrogenaseNot AvailableCincinnati---637G->T, 1037A->TADR InferredIncreased risk of potentially fatal hemolysis. Details
Glucose-6-phosphate 1-dehydrogenaseNot AvailableHarilaou---648T->GADR InferredIncreased risk of potentially fatal hemolysis. Details
Glucose-6-phosphate 1-dehydrogenaseNot AvailableNorth Dallas---683_685delACAADR InferredIncreased risk of potentially fatal hemolysis. Details
Glucose-6-phosphate 1-dehydrogenaseNot AvailableAsahikawa---695G->AADR InferredIncreased risk of potentially fatal hemolysis. Details
Glucose-6-phosphate 1-dehydrogenaseNot AvailableDurham---713A->GADR InferredIncreased risk of potentially fatal hemolysis. Details
Glucose-6-phosphate 1-dehydrogenaseNot AvailableStonybrook---724_729delGGCACTADR InferredIncreased risk of potentially fatal hemolysis. Details
Glucose-6-phosphate 1-dehydrogenaseNot AvailableWayne---769C->GADR InferredIncreased risk of potentially fatal hemolysis. Details
Glucose-6-phosphate 1-dehydrogenaseNot AvailableAveiro---806G->AADR InferredIncreased risk of potentially fatal hemolysis. Details
Glucose-6-phosphate 1-dehydrogenaseNot AvailableCleveland Corum---820G->AADR InferredIncreased risk of potentially fatal hemolysis. Details
Glucose-6-phosphate 1-dehydrogenaseNot AvailableLille---821A>TADR InferredIncreased risk of potentially fatal hemolysis. Details
Glucose-6-phosphate 1-dehydrogenaseNot AvailableBangkok---825G>CADR InferredIncreased risk of potentially fatal hemolysis. Details
Glucose-6-phosphate 1-dehydrogenaseNot AvailableSugao---826C->TADR InferredIncreased risk of potentially fatal hemolysis. Details
Glucose-6-phosphate 1-dehydrogenaseNot AvailableLa Jolla---832T->CADR InferredIncreased risk of potentially fatal hemolysis. Details
Glucose-6-phosphate 1-dehydrogenaseNot AvailableWexham---833C->TADR InferredIncreased risk of potentially fatal hemolysis. Details
Glucose-6-phosphate 1-dehydrogenaseNot AvailablePiotrkow---851T>CADR InferredIncreased risk of potentially fatal hemolysis. Details
Glucose-6-phosphate 1-dehydrogenaseNot AvailableWest Virginia---910G->TADR InferredIncreased risk of potentially fatal hemolysis. Details
Glucose-6-phosphate 1-dehydrogenaseNot AvailableOmiya---921G->CADR InferredIncreased risk of potentially fatal hemolysis. Details
Glucose-6-phosphate 1-dehydrogenaseNot AvailableNara---953_976delCCACCAAAGGGTACCTGGAC GACCADR InferredIncreased risk of potentially fatal hemolysis. Details
Glucose-6-phosphate 1-dehydrogenaseNot AvailableManhattan---962G->AADR InferredIncreased risk of potentially fatal hemolysis. Details
Glucose-6-phosphate 1-dehydrogenaseNot AvailableRehevot---964T->CADR InferredIncreased risk of potentially fatal hemolysis. Details
Glucose-6-phosphate 1-dehydrogenaseNot AvailableHoniara---99A->G, 1360C->TADR InferredIncreased risk of potentially fatal hemolysis. Details
Glucose-6-phosphate 1-dehydrogenaseNot AvailableTokyo, Fukushima---1246G->AADR InferredIncreased risk of potentially fatal hemolysis. Details
Glucose-6-phosphate 1-dehydrogenaseNot AvailableChatham---1003G->AADR InferredIncreased risk of potentially fatal hemolysis. Details
Glucose-6-phosphate 1-dehydrogenaseNot AvailableFushan---1004C->AADR InferredIncreased risk of potentially fatal hemolysis. Details
Glucose-6-phosphate 1-dehydrogenaseNot AvailablePartenope---1052G->TADR InferredIncreased risk of potentially fatal hemolysis. Details
Glucose-6-phosphate 1-dehydrogenaseNot AvailableIerapetra---1057C->TADR InferredIncreased risk of potentially fatal hemolysis. Details
Glucose-6-phosphate 1-dehydrogenaseNot AvailableAnadia---1193A->GADR InferredIncreased risk of potentially fatal hemolysis. Details
Glucose-6-phosphate 1-dehydrogenaseNot AvailableAbeno---1220A->CADR InferredIncreased risk of potentially fatal hemolysis. Details
Glucose-6-phosphate 1-dehydrogenaseNot AvailableSurabaya---1291G->AADR InferredIncreased risk of potentially fatal hemolysis. Details
Glucose-6-phosphate 1-dehydrogenaseNot AvailablePawnee---1316G->CADR InferredIncreased risk of potentially fatal hemolysis. Details
Glucose-6-phosphate 1-dehydrogenaseNot AvailableS. Antioco---1342A->GADR InferredIncreased risk of potentially fatal hemolysis. Details
Glucose-6-phosphate 1-dehydrogenaseNot AvailableCassano---1347G->CADR InferredIncreased risk of potentially fatal hemolysis. Details
Glucose-6-phosphate 1-dehydrogenaseNot AvailableHermoupolis---1347G->C, 1360C->TADR InferredIncreased risk of potentially fatal hemolysis. Details
Glucose-6-phosphate 1-dehydrogenaseNot AvailableUnion,Maewo, Chinese-2, Kalo---1360C->TADR InferredIncreased risk of potentially fatal hemolysis. Details
Glucose-6-phosphate 1-dehydrogenaseNot AvailableAndalus---1361G->AADR InferredIncreased risk of potentially fatal hemolysis. Details
Glucose-6-phosphate 1-dehydrogenaseNot AvailableCosenza---1376G->CADR InferredIncreased risk of potentially fatal hemolysis. Details
Glucose-6-phosphate 1-dehydrogenaseNot AvailableCanton, Taiwan- Hakka, Gifu-like, Agrigento-like---1376G->TADR InferredIncreased risk of potentially fatal hemolysis. Details
Glucose-6-phosphate 1-dehydrogenaseNot AvailableFlores---1387C->AADR InferredIncreased risk of potentially fatal hemolysis. Details
Glucose-6-phosphate 1-dehydrogenaseNot AvailableKaiping, Anant, Dhon, Sapporo-like, Wosera---1388G->AADR InferredIncreased risk of potentially fatal hemolysis. Details
Glucose-6-phosphate 1-dehydrogenaseNot AvailableKamogawa---169C->TADR InferredIncreased risk of potentially fatal hemolysis. Details
Glucose-6-phosphate 1-dehydrogenaseNot AvailableCostanzo---179T>CADR InferredIncreased risk of potentially fatal hemolysis. Details
Glucose-6-phosphate 1-dehydrogenaseNot AvailableAmazonia---185C->AADR InferredIncreased risk of potentially fatal hemolysis. Details
Glucose-6-phosphate 1-dehydrogenaseNot AvailableSongklanagarind---196T->AADR InferredIncreased risk of potentially fatal hemolysis. Details
Glucose-6-phosphate 1-dehydrogenaseNot AvailableHechi---202G->A, 871G->AADR InferredIncreased risk of potentially fatal hemolysis. Details
Glucose-6-phosphate 1-dehydrogenaseNot AvailableNamouru---208T->CADR InferredIncreased risk of potentially fatal hemolysis. Details
Glucose-6-phosphate 1-dehydrogenaseNot AvailableBao Loc---352T>CADR InferredIncreased risk of potentially fatal hemolysis. Details
Glucose-6-phosphate 1-dehydrogenaseNot AvailableCrispim---375G->T, 379G->T383T->C384C>TADR InferredIncreased risk of potentially fatal hemolysis. Details
Glucose-6-phosphate 1-dehydrogenaseNot AvailableAcrokorinthos---376A->G, 463C->GADR InferredIncreased risk of potentially fatal hemolysis. Details
Glucose-6-phosphate 1-dehydrogenaseNot AvailableSanta Maria---376A->G, 542A->TADR InferredIncreased risk of potentially fatal hemolysis. Details
Glucose-6-phosphate 1-dehydrogenaseNot AvailableAnanindeua---376A->G, 871G->AADR InferredIncreased risk of potentially fatal hemolysis. Details
Glucose-6-phosphate 1-dehydrogenaseNot AvailableVanua Lava---383T->CADR InferredIncreased risk of potentially fatal hemolysis. Details
Glucose-6-phosphate 1-dehydrogenaseNot AvailableValladolid---406C->TADR InferredIncreased risk of potentially fatal hemolysis. Details
Glucose-6-phosphate 1-dehydrogenaseNot AvailableBelem---409C->TADR InferredIncreased risk of potentially fatal hemolysis. Details
Glucose-6-phosphate 1-dehydrogenaseNot AvailableLiuzhou---442G->AADR InferredIncreased risk of potentially fatal hemolysis. Details
Glucose-6-phosphate 1-dehydrogenaseNot AvailableShenzen---473G>AADR InferredIncreased risk of potentially fatal hemolysis. Details
Glucose-6-phosphate 1-dehydrogenaseNot AvailableTaipei “Chinese- 3”---493A->GADR InferredIncreased risk of potentially fatal hemolysis. Details
Glucose-6-phosphate 1-dehydrogenaseNot AvailableToledo---496C>TADR InferredIncreased risk of potentially fatal hemolysis. Details
Glucose-6-phosphate 1-dehydrogenaseNot AvailableNaone---497G->AADR InferredIncreased risk of potentially fatal hemolysis. Details
Glucose-6-phosphate 1-dehydrogenaseNot AvailableNankang---517T->CADR InferredIncreased risk of potentially fatal hemolysis. Details
Glucose-6-phosphate 1-dehydrogenaseNot AvailableMiaoli---519C->GADR InferredIncreased risk of potentially fatal hemolysis. Details
Glucose-6-phosphate 1-dehydrogenaseNot AvailableMediterranean, Dallas, Panama‚ Sassari, Cagliari, Birmingham---563C->TADR InferredIncreased risk of potentially fatal hemolysis. Details
Glucose-6-phosphate 1-dehydrogenaseNot AvailableCoimbra Shunde---592C->TADR InferredIncreased risk of potentially fatal hemolysis. Details
Glucose-6-phosphate 1-dehydrogenaseNot AvailableNilgiri---593G>AADR InferredIncreased risk of potentially fatal hemolysis. Details
Glucose-6-phosphate 1-dehydrogenaseNot AvailableRadlowo---679C->TADR InferredIncreased risk of potentially fatal hemolysis. Details
Glucose-6-phosphate 1-dehydrogenaseNot AvailableRoubaix---811G>CADR InferredIncreased risk of potentially fatal hemolysis. Details
Glucose-6-phosphate 1-dehydrogenaseNot AvailableHaikou---835A->GADR InferredIncreased risk of potentially fatal hemolysis. Details
Glucose-6-phosphate 1-dehydrogenaseNot AvailableChinese-1---835A->TADR InferredIncreased risk of potentially fatal hemolysis. Details
Glucose-6-phosphate 1-dehydrogenaseNot AvailableMizushima---848A>GADR InferredIncreased risk of potentially fatal hemolysis. Details
Glucose-6-phosphate 1-dehydrogenaseNot AvailableOsaka---853C->TADR InferredIncreased risk of potentially fatal hemolysis. Details
Glucose-6-phosphate 1-dehydrogenaseNot AvailableViangchan, Jammu---871G->AADR InferredIncreased risk of potentially fatal hemolysis. Details
Glucose-6-phosphate 1-dehydrogenaseNot AvailableSeoul---916G->AADR InferredIncreased risk of potentially fatal hemolysis. Details
Glucose-6-phosphate 1-dehydrogenaseNot AvailableLudhiana---929G->AADR InferredIncreased risk of potentially fatal hemolysis. Details
Glucose-6-phosphate 1-dehydrogenaseNot AvailableFarroupilha---977C->AADR InferredIncreased risk of potentially fatal hemolysis. Details
Glucose-6-phosphate 1-dehydrogenaseNot AvailableChinese-5---1024C->TADR InferredIncreased risk of potentially fatal hemolysis. Details
Glucose-6-phosphate 1-dehydrogenaseNot AvailableRignano---130G>AADR InferredIncreased risk of potentially fatal hemolysis. Details
Glucose-6-phosphate 1-dehydrogenaseNot AvailableOrissa---131C->GADR InferredIncreased risk of potentially fatal hemolysis. Details
Glucose-6-phosphate 1-dehydrogenaseNot AvailableG6PDNice---1380G>CADR InferredIncreased risk of potentially fatal hemolysis. Details
Glucose-6-phosphate 1-dehydrogenaseNot AvailableKamiube, Keelung---1387C->TADR InferredIncreased risk of potentially fatal hemolysis. Details
Glucose-6-phosphate 1-dehydrogenaseNot AvailableNeapolis---1400C->GADR InferredIncreased risk of potentially fatal hemolysis. Details
Glucose-6-phosphate 1-dehydrogenaseNot AvailableAures---143T->CADR InferredIncreased risk of potentially fatal hemolysis. Details
Glucose-6-phosphate 1-dehydrogenaseNot AvailableSplit---1442C->GADR InferredIncreased risk of potentially fatal hemolysis. Details
Glucose-6-phosphate 1-dehydrogenaseNot AvailableKambos---148C->TADR InferredIncreased risk of potentially fatal hemolysis. Details
Glucose-6-phosphate 1-dehydrogenaseNot AvailablePalestrina---170G>AADR InferredIncreased risk of potentially fatal hemolysis. Details
Glucose-6-phosphate 1-dehydrogenaseNot AvailableMetaponto---172G->AADR InferredIncreased risk of potentially fatal hemolysis. Details
Glucose-6-phosphate 1-dehydrogenaseNot AvailableMusashino---185C->TADR InferredIncreased risk of potentially fatal hemolysis. Details
Glucose-6-phosphate 1-dehydrogenaseNot AvailableAsahi---202G->AADR InferredIncreased risk of potentially fatal hemolysis. Details
Glucose-6-phosphate 1-dehydrogenaseNot AvailableA- (202), Ferrara I---202G->A, 376A->GADR InferredIncreased risk of potentially fatal hemolysis. Details
Glucose-6-phosphate 1-dehydrogenaseNot AvailableMurcia Oristano---209A->GADR InferredIncreased risk of potentially fatal hemolysis. Details
Glucose-6-phosphate 1-dehydrogenaseNot AvailableUbe Konan---241C->TADR InferredIncreased risk of potentially fatal hemolysis. Details
Glucose-6-phosphate 1-dehydrogenaseNot AvailableLagosanto---242G->AADR InferredIncreased risk of potentially fatal hemolysis. Details
Glucose-6-phosphate 1-dehydrogenaseNot AvailableGuangzhou---274C->TADR InferredIncreased risk of potentially fatal hemolysis. Details
Glucose-6-phosphate 1-dehydrogenaseNot AvailableHammersmith---323T->AADR InferredIncreased risk of potentially fatal hemolysis. Details
Glucose-6-phosphate 1-dehydrogenaseNot AvailableSinnai---34G->TADR InferredIncreased risk of potentially fatal hemolysis. Details
Glucose-6-phosphate 1-dehydrogenaseNot AvailableA- (680)---376A->G, 680G->TADR InferredIncreased risk of potentially fatal hemolysis. Details
Glucose-6-phosphate 1-dehydrogenaseNot AvailableA- (968), Betica,Selma, Guantanamo---376A->G, 968T->CADR InferredIncreased risk of potentially fatal hemolysis. Details
Glucose-6-phosphate 1-dehydrogenaseNot AvailableSalerno Pyrgos---383T>GADR InferredIncreased risk of potentially fatal hemolysis. Details
Glucose-6-phosphate 1-dehydrogenaseNot AvailableQuing Yan---392G->TADR InferredIncreased risk of potentially fatal hemolysis. Details
Glucose-6-phosphate 1-dehydrogenaseNot AvailableLages---40G->AADR InferredIncreased risk of potentially fatal hemolysis. Details
Glucose-6-phosphate 1-dehydrogenaseNot AvailableIlesha---466G->AADR InferredIncreased risk of potentially fatal hemolysis. Details
Glucose-6-phosphate 1-dehydrogenaseNot AvailableMahidol---487G->AADR InferredIncreased risk of potentially fatal hemolysis. Details
Glucose-6-phosphate 1-dehydrogenaseNot AvailableMalaga---542A->TADR InferredIncreased risk of potentially fatal hemolysis. Details
Glucose-6-phosphate 1-dehydrogenaseNot AvailableSibari---634A->GADR InferredIncreased risk of potentially fatal hemolysis. Details
Glucose-6-phosphate 1-dehydrogenaseNot AvailableMexico City---680G->AADR InferredIncreased risk of potentially fatal hemolysis. Details
Glucose-6-phosphate 1-dehydrogenaseNot AvailableNanning---703C->TADR InferredIncreased risk of potentially fatal hemolysis. Details
Glucose-6-phosphate 1-dehydrogenaseNot AvailableSeattle, Lodi, Modena, Ferrara II, Athens-like---844G->CADR InferredIncreased risk of potentially fatal hemolysis. Details
Glucose-6-phosphate 1-dehydrogenaseNot AvailableBajo Maumere---844G->TADR InferredIncreased risk of potentially fatal hemolysis. Details
Glucose-6-phosphate 1-dehydrogenaseNot AvailableMontalbano---854G->AADR InferredIncreased risk of potentially fatal hemolysis. Details
Glucose-6-phosphate 1-dehydrogenaseNot AvailableKalyan-Kerala, Jamnaga, Rohini---949G->AADR InferredIncreased risk of potentially fatal hemolysis. Details
Glucose-6-phosphate 1-dehydrogenaseNot AvailableGaohe---95A->GADR InferredIncreased risk of potentially fatal hemolysis. Details
Drug Interactions
DrugInteractionDrug group
AbirateroneThe serum concentration of Primaquine can be increased when it is combined with Abiraterone.Approved
AcebutololThe metabolism of Acebutolol can be decreased when combined with Primaquine.Approved
AcepromazineThe serum concentration of Acepromazine can be increased when it is combined with Primaquine.Approved, Vet Approved
AceprometazineThe serum concentration of Aceprometazine can be increased when it is combined with Primaquine.Approved
AcetyldigitoxinThe serum concentration of Acetyldigitoxin can be increased when it is combined with Primaquine.Approved
AlbendazoleThe serum concentration of Albendazole can be decreased when it is combined with Primaquine.Approved, Vet Approved
AlfuzosinAlfuzosin may increase the QTc-prolonging activities of Primaquine.Approved, Investigational
AlimemazineThe serum concentration of Alimemazine can be increased when it is combined with Primaquine.Approved, Vet Approved
AlprenololThe metabolism of Alprenolol can be decreased when combined with Primaquine.Approved, Withdrawn
AmantadineAmantadine may increase the QTc-prolonging activities of Primaquine.Approved
AmiodaronePrimaquine may increase the QTc-prolonging activities of Amiodarone.Approved, Investigational
AmitriptylineAmitriptyline may increase the QTc-prolonging activities of Primaquine.Approved
AmoxapineAmoxapine may increase the QTc-prolonging activities of Primaquine.Approved
AnagrelidePrimaquine may increase the QTc-prolonging activities of Anagrelide.Approved
AOP200704The metabolism of Aop200704 can be decreased when combined with Primaquine.Investigational
ApomorphineApomorphine may increase the QTc-prolonging activities of Primaquine.Approved, Investigational
AprepitantThe serum concentration of Primaquine can be increased when it is combined with Aprepitant.Approved, Investigational
ArformoterolArformoterol may increase the QTc-prolonging activities of Primaquine.Approved, Investigational
AripiprazoleThe serum concentration of Aripiprazole can be increased when it is combined with Primaquine.Approved, Investigational
ArotinololThe metabolism of Arotinolol can be decreased when combined with Primaquine.Approved
ArsenamideThe serum concentration of Arsenamide can be decreased when it is combined with Primaquine.Vet Approved
Arsenic trioxidePrimaquine may increase the QTc-prolonging activities of Arsenic trioxide.Approved, Investigational
ArtemetherThe risk or severity of adverse effects can be increased when Artemether is combined with Primaquine.Approved
AsenapinePrimaquine may increase the QTc-prolonging activities of Asenapine.Approved
AtazanavirThe metabolism of Primaquine can be decreased when combined with Atazanavir.Approved, Investigational
AtenololThe metabolism of Atenolol can be decreased when combined with Primaquine.Approved
AtomoxetineAtomoxetine may increase the QTc-prolonging activities of Primaquine.Approved
AzithromycinAzithromycin may increase the QTc-prolonging activities of Primaquine.Approved
BedaquilinePrimaquine may increase the QTc-prolonging activities of Bedaquiline.Approved
BefunololThe metabolism of Befunolol can be decreased when combined with Primaquine.Experimental
BenzimidazoleThe serum concentration of Benzimidazole can be decreased when it is combined with Primaquine.Experimental
BetaxololThe metabolism of Betaxolol can be decreased when combined with Primaquine.Approved
BevantololThe metabolism of Bevantolol can be decreased when combined with Primaquine.Approved
BexaroteneThe serum concentration of Primaquine can be decreased when it is combined with Bexarotene.Approved, Investigational
BisoprololThe metabolism of Bisoprolol can be decreased when combined with Primaquine.Approved
BithionolThe serum concentration of Bithionol can be decreased when it is combined with Primaquine.Withdrawn
BL-1020The serum concentration of BL-1020 can be increased when it is combined with Primaquine.Investigational
BoceprevirThe metabolism of Primaquine can be decreased when combined with Boceprevir.Approved
BopindololThe metabolism of Bopindolol can be decreased when combined with Primaquine.Approved
BortezomibBortezomib may increase the QTc-prolonging activities of Primaquine.Approved, Investigational
BosentanThe serum concentration of Primaquine can be decreased when it is combined with Bosentan.Approved, Investigational
BucindololThe metabolism of Bucindolol can be decreased when combined with Primaquine.Investigational
BufuralolThe metabolism of Bufuralol can be decreased when combined with Primaquine.Experimental, Investigational
BunamidineThe serum concentration of Bunamidine can be decreased when it is combined with Primaquine.Vet Approved
BupranololThe metabolism of Bupranolol can be decreased when combined with Primaquine.Approved
BuserelinBuserelin may increase the QTc-prolonging activities of Primaquine.Approved
CaffeineThe metabolism of Primaquine can be decreased when combined with Caffeine.Approved
CambendazoleThe serum concentration of Cambendazole can be decreased when it is combined with Primaquine.Vet Approved
CarbamazepineThe metabolism of Primaquine can be increased when combined with Carbamazepine.Approved, Investigational
CarteololThe metabolism of Carteolol can be decreased when combined with Primaquine.Approved
CarvedilolThe metabolism of Carvedilol can be decreased when combined with Primaquine.Approved, Investigational
CeliprololThe metabolism of Celiprolol can be decreased when combined with Primaquine.Approved, Investigational
CeritinibThe serum concentration of Primaquine can be increased when it is combined with Ceritinib.Approved
ChloroquineChloroquine may increase the QTc-prolonging activities of Primaquine.Approved, Vet Approved
ChloroxylenolThe serum concentration of Chloroxylenol can be decreased when it is combined with Primaquine.Approved
ChlorpromazineChlorpromazine may increase the QTc-prolonging activities of Primaquine.Approved, Vet Approved
CiprofloxacinCiprofloxacin may increase the QTc-prolonging activities of Primaquine.Approved, Investigational
CisapridePrimaquine may increase the QTc-prolonging activities of Cisapride.Approved, Investigational, Withdrawn
CitalopramPrimaquine may increase the QTc-prolonging activities of Citalopram.Approved
ClarithromycinPrimaquine may increase the QTc-prolonging activities of Clarithromycin.Approved
ClemastineThe metabolism of Primaquine can be decreased when combined with Clemastine.Approved
ClomipramineClomipramine may increase the QTc-prolonging activities of Primaquine.Approved, Vet Approved
ClorsulonThe serum concentration of Clorsulon can be decreased when it is combined with Primaquine.Vet Approved
ClotrimazoleThe metabolism of Primaquine can be decreased when combined with Clotrimazole.Approved, Vet Approved
ClozapineClozapine may increase the QTc-prolonging activities of Primaquine.Approved
CobicistatThe metabolism of Primaquine can be decreased when combined with Cobicistat.Approved
ConivaptanThe serum concentration of Primaquine can be increased when it is combined with Conivaptan.Approved, Investigational
CoumaphosThe serum concentration of Coumaphos can be decreased when it is combined with Primaquine.Vet Approved
CrizotinibPrimaquine may increase the QTc-prolonging activities of Crizotinib.Approved
CyclosporineThe metabolism of Primaquine can be decreased when combined with Cyclosporine.Approved, Investigational, Vet Approved
Cyproterone acetateThe serum concentration of Primaquine can be decreased when it is combined with Cyproterone acetate.Approved, Investigational
DabrafenibThe serum concentration of Primaquine can be decreased when it is combined with Dabrafenib.Approved
DapsoneThe risk or severity of adverse effects can be increased when Primaquine is combined with Dapsone.Approved, Investigational
DarunavirThe metabolism of Primaquine can be decreased when combined with Darunavir.Approved
DasatinibThe serum concentration of Primaquine can be increased when it is combined with Dasatinib.Approved, Investigational
DeferasiroxThe serum concentration of Primaquine can be decreased when it is combined with Deferasirox.Approved, Investigational
DegarelixDegarelix may increase the QTc-prolonging activities of Primaquine.Approved
DelavirdineThe metabolism of Primaquine can be decreased when combined with Delavirdine.Approved
DesfluraneDesflurane may increase the QTc-prolonging activities of Primaquine.Approved
DesipramineDesipramine may increase the QTc-prolonging activities of Primaquine.Approved
DeslanosideThe serum concentration of Deslanoside can be increased when it is combined with Primaquine.Approved
DexamethasoneThe serum concentration of Primaquine can be decreased when it is combined with Dexamethasone.Approved, Investigational, Vet Approved
DichlorvosThe serum concentration of Dichlorvos can be decreased when it is combined with Primaquine.Vet Approved
DiethylcarbamazineThe serum concentration of Diethylcarbamazine can be decreased when it is combined with Primaquine.Approved, Vet Approved
DigitoxinThe serum concentration of Digitoxin can be increased when it is combined with Primaquine.Approved
DigoxinThe serum concentration of Digoxin can be increased when it is combined with Primaquine.Approved
DihydroergotamineThe metabolism of Primaquine can be decreased when combined with Dihydroergotamine.Approved
DiltiazemThe metabolism of Primaquine can be decreased when combined with Diltiazem.Approved
DiphenhydramineDiphenhydramine may increase the QTc-prolonging activities of Primaquine.Approved
DisopyramidePrimaquine may increase the QTc-prolonging activities of Disopyramide.Approved
DithiazanineThe serum concentration of Dithiazanine can be decreased when it is combined with Primaquine.Vet Approved
DofetilidePrimaquine may increase the QTc-prolonging activities of Dofetilide.Approved
DolasetronDolasetron may increase the QTc-prolonging activities of Primaquine.Approved
DomperidonePrimaquine may increase the QTc-prolonging activities of Domperidone.Approved, Investigational, Vet Approved
DoramectinThe serum concentration of Doramectin can be decreased when it is combined with Primaquine.Vet Approved
DoxepinDoxepin may increase the QTc-prolonging activities of Primaquine.Approved
DoxycyclineThe metabolism of Primaquine can be decreased when combined with Doxycycline.Approved, Investigational, Vet Approved
DronedaronePrimaquine may increase the QTc-prolonging activities of Dronedarone.Approved
DroperidolDroperidol may increase the QTc-prolonging activities of Primaquine.Approved, Vet Approved
EfavirenzThe serum concentration of Primaquine can be decreased when it is combined with Efavirenz.Approved, Investigational
EliglustatPrimaquine may increase the QTc-prolonging activities of Eliglustat.Approved
EnzalutamideThe serum concentration of Primaquine can be decreased when it is combined with Enzalutamide.Approved
EprinomectinThe serum concentration of Eprinomectin can be decreased when it is combined with Primaquine.Vet Approved
EribulinEribulin may increase the QTc-prolonging activities of Primaquine.Approved, Investigational
ErythromycinErythromycin may increase the QTc-prolonging activities of Primaquine.Approved, Vet Approved
EscitalopramPrimaquine may increase the QTc-prolonging activities of Escitalopram.Approved, Investigational
Eslicarbazepine acetateThe serum concentration of Primaquine can be decreased when it is combined with Eslicarbazepine acetate.Approved
EsmololThe metabolism of Esmolol can be decreased when combined with Primaquine.Approved
EtravirineThe serum concentration of Primaquine can be decreased when it is combined with Etravirine.Approved
EzogabineEzogabine may increase the QTc-prolonging activities of Primaquine.Approved
FamotidineFamotidine may increase the QTc-prolonging activities of Primaquine.Approved
FebantelThe serum concentration of Febantel can be decreased when it is combined with Primaquine.Vet Approved
FelbamateFelbamate may increase the QTc-prolonging activities of Primaquine.Approved
FenbendazoleThe serum concentration of Fenbendazole can be decreased when it is combined with Primaquine.Vet Approved
FesoterodineThe serum concentration of the active metabolites of Fesoterodine can be increased when Fesoterodine is used in combination with Primaquine.Approved
FingolimodFingolimod may increase the QTc-prolonging activities of Primaquine.Approved, Investigational
FlecainidePrimaquine may increase the QTc-prolonging activities of Flecainide.Approved, Withdrawn
FlubendazoleThe serum concentration of Flubendazole can be decreased when it is combined with Primaquine.Approved, Withdrawn
FluconazoleFluconazole may increase the QTc-prolonging activities of Primaquine.Approved
FluoxetinePrimaquine may increase the QTc-prolonging activities of Fluoxetine.Approved, Vet Approved
FlupentixolPrimaquine may increase the QTc-prolonging activities of Flupentixol.Approved, Withdrawn
FluphenazineThe serum concentration of Fluphenazine can be increased when it is combined with Primaquine.Approved
FluvoxamineThe metabolism of Primaquine can be decreased when combined with Fluvoxamine.Approved, Investigational
FormoterolFormoterol may increase the QTc-prolonging activities of Primaquine.Approved, Investigational
FosamprenavirThe metabolism of Primaquine can be decreased when combined with Fosamprenavir.Approved
FosaprepitantThe serum concentration of Primaquine can be increased when it is combined with Fosaprepitant.Approved
FoscarnetFoscarnet may increase the QTc-prolonging activities of Primaquine.Approved
FosphenytoinThe metabolism of Primaquine can be increased when combined with Fosphenytoin.Approved
Fusidic AcidThe serum concentration of Primaquine can be increased when it is combined with Fusidic Acid.Approved
Gadobenic acidGadobenic acid may increase the QTc-prolonging activities of Primaquine.Approved
GalantamineGalantamine may increase the QTc-prolonging activities of Primaquine.Approved
GemifloxacinPrimaquine may increase the QTc-prolonging activities of Gemifloxacin.Approved, Investigational
GoserelinGoserelin may increase the QTc-prolonging activities of Primaquine.Approved
GranisetronGranisetron may increase the QTc-prolonging activities of Primaquine.Approved, Investigational
HaloperidolHaloperidol may increase the QTc-prolonging activities of Primaquine.Approved
HexylresorcinolThe serum concentration of Hexylresorcinol can be decreased when it is combined with Primaquine.Approved
HistrelinHistrelin may increase the QTc-prolonging activities of Primaquine.Approved
HydroxyzineHydroxyzine may increase the QTc-prolonging activities of Primaquine.Approved
Hygromycin BThe serum concentration of Hygromycin B can be decreased when it is combined with Primaquine.Vet Approved
IbandronateIbandronate may increase the QTc-prolonging activities of Primaquine.Approved, Investigational
IbutilidePrimaquine may increase the QTc-prolonging activities of Ibutilide.Approved
IdelalisibThe serum concentration of Primaquine can be increased when it is combined with Idelalisib.Approved
IloperidonePrimaquine may increase the QTc-prolonging activities of Iloperidone.Approved
ImatinibThe metabolism of Primaquine can be decreased when combined with Imatinib.Approved
ImipramineImipramine may increase the QTc-prolonging activities of Primaquine.Approved
IndacaterolIndacaterol may increase the QTc-prolonging activities of Primaquine.Approved
IndapamideIndapamide may increase the QTc-prolonging activities of Primaquine.Approved
IndenololThe metabolism of Indenolol can be decreased when combined with Primaquine.Withdrawn
IndinavirThe metabolism of Primaquine can be decreased when combined with Indinavir.Approved
IsavuconazoniumThe metabolism of Primaquine can be decreased when combined with Isavuconazonium.Approved, Investigational
IsofluraneIsoflurane may increase the QTc-prolonging activities of Primaquine.Approved, Vet Approved
IsradipineIsradipine may increase the QTc-prolonging activities of Primaquine.Approved
ItraconazoleThe metabolism of Primaquine can be decreased when combined with Itraconazole.Approved, Investigational
IvabradineIvabradine may increase the QTc-prolonging activities of Primaquine.Approved
IvacaftorThe serum concentration of Primaquine can be increased when it is combined with Ivacaftor.Approved
IvermectinThe serum concentration of Ivermectin can be decreased when it is combined with Primaquine.Approved, Vet Approved
KetoconazoleThe metabolism of Primaquine can be decreased when combined with Ketoconazole.Approved, Investigational
LabetalolThe metabolism of Labetalol can be decreased when combined with Primaquine.Approved
LapatinibLapatinib may increase the QTc-prolonging activities of Primaquine.Approved, Investigational
LenvatinibPrimaquine may increase the QTc-prolonging activities of Lenvatinib.Approved
LeuprolideLeuprolide may increase the QTc-prolonging activities of Primaquine.Approved, Investigational
LevamisoleThe serum concentration of Levamisole can be decreased when it is combined with Primaquine.Vet Approved, Withdrawn
LevobunololThe metabolism of Levobunolol can be decreased when combined with Primaquine.Approved
LevofloxacinPrimaquine may increase the QTc-prolonging activities of Levofloxacin.Approved, Investigational
LidocaineThe metabolism of Primaquine can be decreased when combined with Lidocaine.Approved, Vet Approved
LithiumLithium may increase the QTc-prolonging activities of Primaquine.Approved
LopinavirPrimaquine may increase the QTc-prolonging activities of Lopinavir.Approved
LovastatinThe metabolism of Primaquine can be decreased when combined with Lovastatin.Approved, Investigational
LucanthoneThe serum concentration of Lucanthone can be decreased when it is combined with Primaquine.Approved, Investigational
LuliconazoleThe serum concentration of Primaquine can be increased when it is combined with Luliconazole.Approved
LumacaftorThe metabolism of Primaquine can be increased when combined with Lumacaftor.Approved
LumefantrineThe risk or severity of adverse effects can be increased when Primaquine is combined with Lumefantrine.Approved
MaprotilineMaprotiline may increase the QTc-prolonging activities of Primaquine.Approved
MebendazoleThe serum concentration of Mebendazole can be decreased when it is combined with Primaquine.Approved, Vet Approved
MefloquineThe risk or severity of adverse effects can be increased when Primaquine is combined with Mefloquine.Approved
MesoridazineThe serum concentration of Mesoridazine can be increased when it is combined with Primaquine.Approved
MethadoneMethadone may increase the QTc-prolonging activities of Primaquine.Approved
MethotrimeprazineThe serum concentration of Methotrimeprazine can be increased when it is combined with Primaquine.Approved
Methylene blueThe serum concentration of Methylene blue can be increased when it is combined with Primaquine.Investigational
MetipranololThe metabolism of Metipranolol can be decreased when combined with Primaquine.Approved
MetoclopramideMetoclopramide may increase the QTc-prolonging activities of Primaquine.Approved, Investigational
MetoprololThe serum concentration of Metoprolol can be increased when it is combined with Primaquine.Approved, Investigational
MetronidazoleMetronidazole may increase the QTc-prolonging activities of Primaquine.Approved
MexiletineThe metabolism of Primaquine can be decreased when combined with Mexiletine.Approved
MifepristoneMifepristone may increase the QTc-prolonging activities of Primaquine.Approved, Investigational
Milbemycin oximeThe serum concentration of Milbemycin oxime can be decreased when it is combined with Primaquine.Vet Approved
MirabegronMirabegron may increase the QTc-prolonging activities of Primaquine.Approved
MirtazapineMirtazapine may increase the QTc-prolonging activities of Primaquine.Approved
MitotaneThe serum concentration of Primaquine can be decreased when it is combined with Mitotane.Approved
ModafinilThe serum concentration of Primaquine can be decreased when it is combined with Modafinil.Approved, Investigational
MoexiprilMoexipril may increase the QTc-prolonging activities of Primaquine.Approved
MorantelThe serum concentration of Morantel can be decreased when it is combined with Primaquine.Vet Approved
MoricizineThe serum concentration of Moricizine can be increased when it is combined with Primaquine.Approved, Withdrawn
MoxidectinThe serum concentration of Moxidectin can be decreased when it is combined with Primaquine.Vet Approved
MoxifloxacinMoxifloxacin may increase the QTc-prolonging activities of Primaquine.Approved, Investigational
NadololThe metabolism of Nadolol can be decreased when combined with Primaquine.Approved
NafcillinThe serum concentration of Primaquine can be decreased when it is combined with Nafcillin.Approved
NefazodoneThe metabolism of Primaquine can be decreased when combined with Nefazodone.Approved, Withdrawn
NelfinavirThe metabolism of Primaquine can be decreased when combined with Nelfinavir.Approved
NetupitantThe serum concentration of Primaquine can be increased when it is combined with Netupitant.Approved
NevirapineThe metabolism of Primaquine can be increased when combined with Nevirapine.Approved
NicardipineNicardipine may increase the QTc-prolonging activities of Primaquine.Approved
NiclosamideThe serum concentration of Niclosamide can be decreased when it is combined with Primaquine.Approved, Vet Approved
NilotinibPrimaquine may increase the QTc-prolonging activities of Nilotinib.Approved, Investigational
Nitric OxideThe risk or severity of adverse effects can be increased when Nitric Oxide is combined with Primaquine.Approved
NorfloxacinNorfloxacin may increase the QTc-prolonging activities of Primaquine.Approved
NortriptylineNortriptyline may increase the QTc-prolonging activities of Primaquine.Approved
OctreotideOctreotide may increase the QTc-prolonging activities of Primaquine.Approved, Investigational
OfloxacinPrimaquine may increase the QTc-prolonging activities of Ofloxacin.Approved
OlanzapineOlanzapine may increase the QTc-prolonging activities of Primaquine.Approved, Investigational
OlaparibThe metabolism of Primaquine can be decreased when combined with Olaparib.Approved
OleandrinThe serum concentration of Anvirzel can be increased when it is combined with Primaquine.Experimental
OlodaterolOlodaterol may increase the QTc-prolonging activities of Primaquine.Approved
OndansetronOndansetron may increase the QTc-prolonging activities of Primaquine.Approved
OsimertinibThe serum concentration of Primaquine can be increased when it is combined with Osimertinib.Approved
OuabainThe serum concentration of Ouabain can be increased when it is combined with Primaquine.Approved
OxamniquineThe serum concentration of Oxamniquine can be decreased when it is combined with Primaquine.Approved
OxfendazoleThe serum concentration of Oxfendazole can be decreased when it is combined with Primaquine.Vet Approved
OxibendazoleThe serum concentration of Oxibendazole can be decreased when it is combined with Primaquine.Investigational, Vet Approved
OxprenololThe metabolism of Oxprenolol can be decreased when combined with Primaquine.Approved
OxytocinOxytocin may increase the QTc-prolonging activities of Primaquine.Approved, Vet Approved
PalbociclibThe serum concentration of Primaquine can be increased when it is combined with Palbociclib.Approved
PaliperidonePrimaquine may increase the QTc-prolonging activities of Paliperidone.Approved
PanobinostatPrimaquine may increase the QTc-prolonging activities of Panobinostat.Approved, Investigational
ParoxetineParoxetine may increase the QTc-prolonging activities of Primaquine.Approved, Investigational
PasireotidePasireotide may increase the QTc-prolonging activities of Primaquine.Approved
PazopanibPrimaquine may increase the QTc-prolonging activities of Pazopanib.Approved
Peginterferon alfa-2bThe serum concentration of Primaquine can be increased when it is combined with Peginterferon alfa-2b.Approved
PenbutololThe metabolism of Penbutolol can be decreased when combined with Primaquine.Approved, Investigational
PentamidinePentamidine may increase the QTc-prolonging activities of Primaquine.Approved
PentobarbitalThe metabolism of Primaquine can be increased when combined with Pentobarbital.Approved, Vet Approved
PerazineThe serum concentration of Perazine can be increased when it is combined with Primaquine.Investigational
PerflutrenPerflutren may increase the QTc-prolonging activities of Primaquine.Approved
PerphenazineThe serum concentration of Perphenazine can be increased when it is combined with Primaquine.Approved
PhenobarbitalThe metabolism of Primaquine can be increased when combined with Phenobarbital.Approved
PhenytoinThe metabolism of Primaquine can be increased when combined with Phenytoin.Approved, Vet Approved
PimozidePrimaquine may increase the QTc-prolonging activities of Pimozide.Approved
PindololThe metabolism of Pindolol can be decreased when combined with Primaquine.Approved
PiperazineThe serum concentration of Piperazine can be decreased when it is combined with Primaquine.Approved, Vet Approved
PosaconazoleThe metabolism of Primaquine can be decreased when combined with Posaconazole.Approved, Investigational, Vet Approved
PractololThe metabolism of Practolol can be decreased when combined with Primaquine.Approved
PraziquantelThe serum concentration of Praziquantel can be decreased when it is combined with Primaquine.Approved, Vet Approved
PrilocaineThe risk or severity of adverse effects can be increased when Primaquine is combined with Prilocaine.Approved
PrimidoneThe metabolism of Primaquine can be increased when combined with Primidone.Approved, Vet Approved
ProcainamidePrimaquine may increase the QTc-prolonging activities of Procainamide.Approved
ProchlorperazineThe serum concentration of Prochlorperazine can be increased when it is combined with Primaquine.Approved, Vet Approved
PromazinePromazine may increase the QTc-prolonging activities of Primaquine.Approved, Vet Approved
PromethazineThe serum concentration of Promethazine can be increased when it is combined with Primaquine.Approved
PropafenonePrimaquine may increase the QTc-prolonging activities of Propafenone.Approved
PropiopromazineThe serum concentration of Propiopromazine can be increased when it is combined with Primaquine.Vet Approved
PropofolPropofol may increase the QTc-prolonging activities of Primaquine.Approved, Investigational, Vet Approved
PropranololThe metabolism of Propranolol can be decreased when combined with Primaquine.Approved, Investigational
ProtriptylineProtriptyline may increase the QTc-prolonging activities of Primaquine.Approved
PyrantelThe serum concentration of Pyrantel can be decreased when it is combined with Primaquine.Approved, Vet Approved
PyrviniumThe serum concentration of Pyrvinium can be decreased when it is combined with Primaquine.Approved
QuetiapinePrimaquine may increase the QTc-prolonging activities of Quetiapine.Approved
QuinacrineThe serum concentration of Quinacrine can be decreased when it is combined with Primaquine.Approved
QuinidinePrimaquine may increase the QTc-prolonging activities of Quinidine.Approved
QuininePrimaquine may increase the QTc-prolonging activities of Quinine.Approved
RanolazineRanolazine may increase the QTc-prolonging activities of Primaquine.Approved, Investigational
RifabutinThe metabolism of Primaquine can be increased when combined with Rifabutin.Approved
RifampicinThe metabolism of Primaquine can be increased when combined with Rifampicin.Approved
RifapentineThe metabolism of Primaquine can be increased when combined with Rifapentine.Approved
RilpivirineRilpivirine may increase the QTc-prolonging activities of Primaquine.Approved
RisperidoneRisperidone may increase the QTc-prolonging activities of Primaquine.Approved, Investigational
RitonavirThe metabolism of Primaquine can be decreased when combined with Ritonavir.Approved, Investigational
RopiniroleThe metabolism of Primaquine can be decreased when combined with Ropinirole.Approved, Investigational
SalbutamolSalbutamol may increase the QTc-prolonging activities of Primaquine.Approved, Vet Approved
SalmeterolSalmeterol may increase the QTc-prolonging activities of Primaquine.Approved
SaquinavirPrimaquine may increase the QTc-prolonging activities of Saquinavir.Approved, Investigational
SertralineSertraline may increase the QTc-prolonging activities of Primaquine.Approved
SevofluraneSevoflurane may increase the QTc-prolonging activities of Primaquine.Approved, Vet Approved
SildenafilThe metabolism of Primaquine can be decreased when combined with Sildenafil.Approved, Investigational
SiltuximabThe serum concentration of Primaquine can be decreased when it is combined with Siltuximab.Approved
SimeprevirThe serum concentration of Primaquine can be increased when it is combined with Simeprevir.Approved
Sodium NitriteThe risk or severity of adverse effects can be increased when Primaquine is combined with Sodium Nitrite.Approved
Sodium stibogluconateThe serum concentration of Sodium stibogluconate can be decreased when it is combined with Primaquine.Approved, Investigational
SolifenacinSolifenacin may increase the QTc-prolonging activities of Primaquine.Approved
SorafenibSorafenib may increase the QTc-prolonging activities of Primaquine.Approved, Investigational
SotalolPrimaquine may increase the QTc-prolonging activities of Sotalol.Approved
St. John's WortThe serum concentration of Primaquine can be decreased when it is combined with St. John's Wort.Nutraceutical
StiripentolThe serum concentration of Primaquine can be increased when it is combined with Stiripentol.Approved
SulfamethoxazoleSulfamethoxazole may increase the QTc-prolonging activities of Primaquine.Approved
SulfisoxazoleSulfisoxazole may increase the QTc-prolonging activities of Primaquine.Approved, Vet Approved
SunitinibSunitinib may increase the QTc-prolonging activities of Primaquine.Approved, Investigational
SuraminThe serum concentration of Suramin can be decreased when it is combined with Primaquine.Approved
TamoxifenTamoxifen may increase the QTc-prolonging activities of Primaquine.Approved
TelaprevirThe metabolism of Primaquine can be decreased when combined with Telaprevir.Approved
TelavancinPrimaquine may increase the QTc-prolonging activities of Telavancin.Approved
TelithromycinTelithromycin may increase the QTc-prolonging activities of Primaquine.Approved
TenofovirThe metabolism of Primaquine can be decreased when combined with Tenofovir.Approved, Investigational
TerbutalineTerbutaline may increase the QTc-prolonging activities of Primaquine.Approved
TeriflunomideThe serum concentration of Primaquine can be decreased when it is combined with Teriflunomide.Approved
TetrabenazinePrimaquine may increase the QTc-prolonging activities of Tetrabenazine.Approved
TheophyllineThe metabolism of Primaquine can be decreased when combined with Theophylline.Approved
ThiabendazoleThe serum concentration of Thiabendazole can be decreased when it is combined with Primaquine.Approved, Vet Approved
ThiethylperazineThe serum concentration of Thiethylperazine can be increased when it is combined with Primaquine.Withdrawn
ThioridazineThe serum concentration of Thioridazine can be increased when it is combined with Primaquine.Approved
ThiothixeneThiothixene may increase the QTc-prolonging activities of Primaquine.Approved
TiclopidineThe metabolism of Primaquine can be decreased when combined with Ticlopidine.Approved
TimololThe metabolism of Timolol can be decreased when combined with Primaquine.Approved
TizanidineTizanidine may increase the QTc-prolonging activities of Primaquine.Approved
TocilizumabThe serum concentration of Primaquine can be decreased when it is combined with Tocilizumab.Approved
TolterodineTolterodine may increase the QTc-prolonging activities of Primaquine.Approved, Investigational
ToremifenePrimaquine may increase the QTc-prolonging activities of Toremifene.Approved, Investigational
TrazodoneTrazodone may increase the QTc-prolonging activities of Primaquine.Approved, Investigational
TreprostinilTreprostinil may increase the QTc-prolonging activities of Primaquine.Approved, Investigational
TrichlorfonThe serum concentration of Trichlorfon can be decreased when it is combined with Primaquine.Vet Approved
TriclabendazoleThe serum concentration of Triclabendazole can be decreased when it is combined with Primaquine.Investigational
TrifluoperazineThe serum concentration of Trifluoperazine can be increased when it is combined with Primaquine.Approved
TriflupromazineThe serum concentration of Triflupromazine can be increased when it is combined with Primaquine.Approved, Vet Approved
TrimethoprimTrimethoprim may increase the QTc-prolonging activities of Primaquine.Approved, Vet Approved
TrimipramineTrimipramine may increase the QTc-prolonging activities of Primaquine.Approved
TriptorelinTriptorelin may increase the QTc-prolonging activities of Primaquine.Approved, Vet Approved
VandetanibPrimaquine may increase the QTc-prolonging activities of Vandetanib.Approved
VardenafilVardenafil may increase the QTc-prolonging activities of Primaquine.Approved
VemurafenibThe serum concentration of Primaquine can be increased when it is combined with Vemurafenib.Approved
VenlafaxineVenlafaxine may increase the QTc-prolonging activities of Primaquine.Approved
VerapamilThe metabolism of Primaquine can be decreased when combined with Verapamil.Approved
VilanterolVilanterol may increase the QTc-prolonging activities of Primaquine.Approved
VoriconazoleThe metabolism of Primaquine can be decreased when combined with Voriconazole.Approved, Investigational
VorinostatVorinostat may increase the QTc-prolonging activities of Primaquine.Approved, Investigational
ZiprasidonePrimaquine may increase the QTc-prolonging activities of Ziprasidone.Approved
ZuclopenthixolPrimaquine may increase the QTc-prolonging activities of Zuclopenthixol.Approved, Investigational
Food Interactions
  • Take with food to decrease dyspepsia.
Synthesis ReferenceNot Available
General References
  1. Mihaly GW, Ward SA, Edwards G, Nicholl DD, Orme ML, Breckenridge AM: Pharmacokinetics of primaquine in man. I. Studies of the absolute bioavailability and effects of dose size. Br J Clin Pharmacol. 1985 Jun;19(6):745-50. [PubMed:4027117 ]
  2. ALVING AS, ARNOLD J, HOCKWALD RS, CLAYMAN CB, DERN RJ, BEUTLER E, FLANAGAN CL: Potentiation of the curative action of primaquine in vivax malaria by quinine and chloroquine. J Lab Clin Med. 1955 Aug;46(2):301-6. [PubMed:13242948 ]
  3. Hill DR, Baird JK, Parise ME, Lewis LS, Ryan ET, Magill AJ: Primaquine: report from CDC expert meeting on malaria chemoprophylaxis I. Am J Trop Med Hyg. 2006 Sep;75(3):402-15. [PubMed:16968913 ]
  4. Cohen RJ, Sachs JR, Wicker DJ, Conrad ME: Methemoglobinemia provoked by malarial chemoprophylaxis in Vietnam. N Engl J Med. 1968 Nov 21;279(21):1127-31. [PubMed:5686480 ]
  5. Coleman MD, Coleman NA: Drug-induced methaemoglobinaemia. Treatment issues. Drug Saf. 1996 Jun;14(6):394-405. [PubMed:8828017 ]
External Links
ATC CodesP01BA03
AHFS Codes
  • 08:30.08
PDB Entries
FDA labelDownload (105 KB)
MSDSNot Available
Clinical Trials
Clinical Trials
1CompletedNot AvailableObese1
1CompletedBasic ScienceMalaria1
1CompletedTreatmentG6PD Deficient / G6PD Normal / Healthy Volunteers1
1CompletedTreatmentHealthy Volunteers1
1CompletedTreatmentMalaria caused by plasmodium vivax1
1Not Yet RecruitingBasic ScienceMalaria1
1RecruitingHealth Services ResearchPharmacologic Actions1
1, 2Active Not RecruitingTreatmentMalaria1
1, 2CompletedTreatmentMalaria1
1, 2RecruitingTreatmentDrug Combination / Healthy Volunteers / Pharmacokinetics1
2CompletedTreatmentMalaria caused by plasmodium vivax1
2CompletedTreatmentMalaria / Plasmodium Vivax1
2CompletedTreatmentUncomplicated Falciparum Malaria1
2Not Yet RecruitingTreatmentMalaria caused by plasmodium vivax1
2RecruitingTreatmentMalaria caused by Plasmodium falciparum1
2, 3CompletedTreatmentMalaria caused by plasmodium vivax1
3CompletedPreventionMalaria caused by Plasmodium falciparum1
3CompletedTreatmentAsymptomatic Malaria / Malaria / Plasmodium Falciparum1
3CompletedTreatmentHuman Immunodeficiency Virus (HIV) Infections / Pneumonia, Pneumocystis Carinii1
3CompletedTreatmentMalaria caused by plasmodium vivax3
3CompletedTreatmentMalaria / Malaria caused by Plasmodium falciparum / Malaria caused by plasmodium vivax1
3CompletedTreatmentMalaria / Malaria caused by plasmodium vivax1
3CompletedTreatmentUncomplicated Plasmodium Knowlesi Malaria1
3Not Yet RecruitingTreatmentMalaria caused by plasmodium vivax1
3RecruitingTreatmentPlasmodium Vivax Malaria Without Complication1
4CompletedBasic SciencePlasmodium Falciparum Clinical Episode / Plasmodium Falciparum Infection / Plasmodium Vivax Clinical Episode / Plasmodium Vivax Infection1
4CompletedPreventionPlasmodium Falciparum1
4CompletedTreatmentG6PD Deficiency / Malaria caused by Plasmodium falciparum1
4CompletedTreatmentPlasmodium Vivax Infection1
4RecruitingPreventionMalaria / Parasitic Diseases1
4RecruitingTreatmentPlasmodium Vivax1
4Unknown StatusTreatmentMalaria caused by plasmodium vivax1
4WithdrawnTreatmentPneumonia, Pneumocystis Carinii1
Not AvailableCompletedNot AvailableMalaria caused by plasmodium vivax1
Not AvailableCompletedPreventionFavism / Glucosephosphate Dehydrogenase Deficiency1
Not AvailableCompletedTreatmentHuman Immunodeficiency Virus (HIV) Infections / Pneumonia, Pneumocystis Carinii1
Not AvailableCompletedTreatmentMalaria1
Not AvailableRecruitingTreatmentUncomplicated Vivax Malaria1
Not AvailableSuspendedTreatmentUncomplicated Plasmodium Falciparum Malaria1
Not AvailableUnknown StatusNot AvailableParasitemia1
Not AvailableUnknown StatusPreventionMalaria caused by plasmodium vivax1
Not AvailableUnknown StatusTreatmentMalaria1
ManufacturersNot Available
Dosage forms
TabletOral26.3 mg
TabletOral15 mg/1
Tablet, film coatedOral15 mg/1
Tablet, film coatedOral26.3 mg/1
Unit descriptionCostUnit
Primaquin phosphate powder18.2USD g
Primaquine 26.3 mg tablet1.51USD tablet
Primaquine Phosphate 15 mg Tablet0.43USD tablet
DrugBank does not sell nor buy drugs. Pricing information is supplied for informational purposes only.
PatentsNot Available
Experimental Properties
melting point< 25 °CPhysProp
boiling point177 °C at 2.00E-01 mm HgPhysProp
logP2.1Not Available
Predicted Properties
Water Solubility0.0564 mg/mLALOGPS
pKa (Strongest Acidic)17.11ChemAxon
pKa (Strongest Basic)10.2ChemAxon
Physiological Charge1ChemAxon
Hydrogen Acceptor Count4ChemAxon
Hydrogen Donor Count2ChemAxon
Polar Surface Area60.17 Å2ChemAxon
Rotatable Bond Count6ChemAxon
Refractivity78.51 m3·mol-1ChemAxon
Polarizability29.92 Å3ChemAxon
Number of Rings2ChemAxon
Rule of FiveYesChemAxon
Ghose FilterYesChemAxon
Veber's RuleYesChemAxon
MDDR-like RuleYesChemAxon
Predicted ADMET features
Human Intestinal Absorption+0.9776
Blood Brain Barrier+0.9787
Caco-2 permeable-0.5622
P-glycoprotein substrateSubstrate0.8018
P-glycoprotein inhibitor INon-inhibitor0.8782
P-glycoprotein inhibitor IINon-inhibitor0.7681
Renal organic cation transporterInhibitor0.5501
CYP450 2C9 substrateNon-substrate0.8703
CYP450 2D6 substrateSubstrate0.8918
CYP450 3A4 substrateSubstrate0.5723
CYP450 1A2 substrateInhibitor0.9107
CYP450 2C9 inhibitorNon-inhibitor0.93
CYP450 2D6 inhibitorInhibitor0.8932
CYP450 2C19 inhibitorInhibitor0.8994
CYP450 3A4 inhibitorNon-inhibitor0.831
CYP450 inhibitory promiscuityLow CYP Inhibitory Promiscuity0.5057
Ames testAMES toxic0.9106
BiodegradationNot ready biodegradable1.0
Rat acute toxicity2.4474 LD50, mol/kg Not applicable
hERG inhibition (predictor I)Weak inhibitor0.7858
hERG inhibition (predictor II)Inhibitor0.8162
ADMET data is predicted using admetSAR, a free tool for evaluating chemical ADMET properties. (23092397 )
Mass Spec (NIST)Not Available
Spectrum TypeDescriptionSplash Key
Predicted LC-MS/MSPredicted LC-MS/MS Spectrum - 10V, PositiveNot Available
Predicted LC-MS/MSPredicted LC-MS/MS Spectrum - 20V, PositiveNot Available
Predicted LC-MS/MSPredicted LC-MS/MS Spectrum - 40V, PositiveNot Available
Predicted LC-MS/MSPredicted LC-MS/MS Spectrum - 10V, NegativeNot Available
Predicted LC-MS/MSPredicted LC-MS/MS Spectrum - 20V, NegativeNot Available
Predicted LC-MS/MSPredicted LC-MS/MS Spectrum - 40V, NegativeNot Available
DescriptionThis compound belongs to the class of chemical entities known as aminoquinolines and derivatives. These are organic compounds containing an amino group attached to a quinoline ring system.
KingdomChemical entities
Super ClassOrganic compounds
ClassOrganoheterocyclic compounds
Sub ClassQuinolines and derivatives
Direct ParentAminoquinolines and derivatives
Alternative Parents
  • Aminoquinoline
  • Methoxyaniline
  • Anisole
  • Alkyl aryl ether
  • Secondary aliphatic/aromatic amine
  • Pyridine
  • Benzenoid
  • Heteroaromatic compound
  • Ether
  • Azacycle
  • Secondary amine
  • Primary amine
  • Organooxygen compound
  • Organonitrogen compound
  • Primary aliphatic amine
  • Organic nitrogen compound
  • Organopnictogen compound
  • Hydrocarbon derivative
  • Amine
  • Organic oxygen compound
  • Aromatic heteropolycyclic compound
Molecular FrameworkAromatic heteropolycyclic compounds
External Descriptors


1. Fe(II)-protoporphyrin IX
Small molecule
Plasmodium falciparum
Pharmacological action
  1. Dorn A, Vippagunta SR, Matile H, Jaquet C, Vennerstrom JL, Ridley RG: An assessment of drug-haematin binding as a mechanism for inhibition of haematin polymerisation by quinoline antimalarials. Biochem Pharmacol. 1998 Mar 15;55(6):727-36. [PubMed:9586944 ]
  2. Fitch CD: Ferriprotoporphyrin IX, phospholipids, and the antimalarial actions of quinoline drugs. Life Sci. 2004 Mar 5;74(16):1957-72. [PubMed:14967191 ]
Pharmacological action
General Function:
Structural molecule activity
Specific Function:
Blocks interferon-dependent interphase and stimulates DNA synthesis in cells. Involved in the translational regulation of the human papillomavirus type 16 E7 mRNA (HPV16 E7).
Gene Name:
Uniprot ID:
Molecular Weight:
51385.11 Da
  1. Heard CM, Monk BV, Modley AJ: Binding of primaquine to epidermal membranes and keratin. Int J Pharm. 2003 May 12;257(1-2):237-44. [PubMed:12711178 ]
  2. Basso LG, Rodrigues RZ, Naal RM, Costa-Filho AJ: Effects of the antimalarial drug primaquine on the dynamic structure of lipid model membranes. Biochim Biophys Acta. 2011 Jan;1808(1):55-64. doi: 10.1016/j.bbamem.2010.08.009. Epub 2010 Aug 14. [PubMed:20713019 ]
Pharmacological action
General Function:
Nadph dehydrogenase (quinone) activity
Specific Function:
The enzyme apparently serves as a quinone reductase in connection with conjugation reactions of hydroquinones involved in detoxification pathways as well as in biosynthetic processes such as the vitamin K-dependent gamma-carboxylation of glutamate residues in prothrombin synthesis.
Gene Name:
Uniprot ID:
Molecular Weight:
25918.4 Da
  1. Graves PR, Kwiek JJ, Fadden P, Ray R, Hardeman K, Coley AM, Foley M, Haystead TA: Discovery of novel targets of quinoline drugs in the human purine binding proteome. Mol Pharmacol. 2002 Dec;62(6):1364-72. [PubMed:12435804 ]


Pharmacological action
General Function:
Vitamin d3 25-hydroxylase activity
Specific Function:
Cytochromes P450 are a group of heme-thiolate monooxygenases. In liver microsomes, this enzyme is involved in an NADPH-dependent electron transport pathway. It performs a variety of oxidation reactions (e.g. caffeine 8-oxidation, omeprazole sulphoxidation, midazolam 1'-hydroxylation and midazolam 4-hydroxylation) of structurally unrelated compounds, including steroids, fatty acids, and xenobiot...
Gene Name:
Uniprot ID:
Molecular Weight:
57342.67 Da
  1. Preissner S, Kroll K, Dunkel M, Senger C, Goldsobel G, Kuzman D, Guenther S, Winnenburg R, Schroeder M, Preissner R: SuperCYP: a comprehensive database on Cytochrome P450 enzymes including a tool for analysis of CYP-drug interactions. Nucleic Acids Res. 2010 Jan;38(Database issue):D237-43. doi: 10.1093/nar/gkp970. Epub 2009 Nov 24. [PubMed:19934256 ]
Pharmacological action
General Function:
Oxidoreductase activity, acting on paired donors, with incorporation or reduction of molecular oxygen, reduced flavin or flavoprotein as one donor, and incorporation of one atom of oxygen
Specific Function:
Cytochromes P450 are a group of heme-thiolate monooxygenases. In liver microsomes, this enzyme is involved in an NADPH-dependent electron transport pathway. It oxidizes a variety of structurally unrelated compounds, including steroids, fatty acids, and xenobiotics. Most active in catalyzing 2-hydroxylation. Caffeine is metabolized primarily by cytochrome CYP1A2 in the liver through an initial N...
Gene Name:
Uniprot ID:
Molecular Weight:
58293.76 Da
  1. Preissner S, Kroll K, Dunkel M, Senger C, Goldsobel G, Kuzman D, Guenther S, Winnenburg R, Schroeder M, Preissner R: SuperCYP: a comprehensive database on Cytochrome P450 enzymes including a tool for analysis of CYP-drug interactions. Nucleic Acids Res. 2010 Jan;38(Database issue):D237-43. doi: 10.1093/nar/gkp970. Epub 2009 Nov 24. [PubMed:19934256 ]
Pharmacological action
General Function:
Steroid hydroxylase activity
Specific Function:
Responsible for the metabolism of many drugs and environmental chemicals that it oxidizes. It is involved in the metabolism of drugs such as antiarrhythmics, adrenoceptor antagonists, and tricyclic antidepressants.
Gene Name:
Uniprot ID:
Molecular Weight:
55768.94 Da
  1. Preissner S, Kroll K, Dunkel M, Senger C, Goldsobel G, Kuzman D, Guenther S, Winnenburg R, Schroeder M, Preissner R: SuperCYP: a comprehensive database on Cytochrome P450 enzymes including a tool for analysis of CYP-drug interactions. Nucleic Acids Res. 2010 Jan;38(Database issue):D237-43. doi: 10.1093/nar/gkp970. Epub 2009 Nov 24. [PubMed:19934256 ]
Pharmacological action
General Function:
Vitamin d 24-hydroxylase activity
Specific Function:
Cytochromes P450 are a group of heme-thiolate monooxygenases. In liver microsomes, this enzyme is involved in an NADPH-dependent electron transport pathway. It oxidizes a variety of structurally unrelated compounds, including steroids, fatty acids, and xenobiotics.
Gene Name:
Uniprot ID:
Molecular Weight:
58164.815 Da
  1. Preissner S, Kroll K, Dunkel M, Senger C, Goldsobel G, Kuzman D, Guenther S, Winnenburg R, Schroeder M, Preissner R: SuperCYP: a comprehensive database on Cytochrome P450 enzymes including a tool for analysis of CYP-drug interactions. Nucleic Acids Res. 2010 Jan;38(Database issue):D237-43. doi: 10.1093/nar/gkp970. Epub 2009 Nov 24. [PubMed:19934256 ]
Pharmacological action
General Function:
Oxygen binding
Specific Function:
Cytochromes P450 are a group of heme-thiolate monooxygenases. In liver microsomes, this enzyme is involved in an NADPH-dependent electron transport pathway. It oxidizes a variety of structurally unrelated compounds, including steroids, fatty acids, retinoid and xenobiotics. Preferentially oxidizes 17beta-estradiol to the carcinogenic 4-hydroxy derivative, and a variety of procarcinogenic compou...
Gene Name:
Uniprot ID:
Molecular Weight:
60845.33 Da
  1. Preissner S, Kroll K, Dunkel M, Senger C, Goldsobel G, Kuzman D, Guenther S, Winnenburg R, Schroeder M, Preissner R: SuperCYP: a comprehensive database on Cytochrome P450 enzymes including a tool for analysis of CYP-drug interactions. Nucleic Acids Res. 2010 Jan;38(Database issue):D237-43. doi: 10.1093/nar/gkp970. Epub 2009 Nov 24. [PubMed:19934256 ]
comments powered by Disqus
Drug created on June 13, 2005 07:24 / Updated on April 21, 2017 10:58