
Accession Number
DB01087  (APRD00604)
Small Molecule

An aminoquinoline that is given by mouth to produce a radical cure and prevent relapse of vivax and ovale malarias following treatment with a blood schizontocide. It has also been used to prevent transmission of falciparum malaria by those returning to areas where there is a potential for re-introduction of malaria. Adverse effects include anemias and GI disturbances. (From Martindale, The Extra Pharmacopeia, 30th ed, p404)

  • 6-Methoxy-8-(4-amino-1-methylbutylamino)quinoline
  • 8-((4-Amino-1-methylbutyl)amino)-6-methoxyquinoline
  • 8-(4-Amino-1-methylbutylamino)-6-methoxyquinoline
  • Neo-quipenyl
  • Primachin
  • Primachinum
  • Primaquin
  • Primaquina
  • Primaquinum
Product Ingredients
IngredientUNIICASInChI Key
Primaquine phosphateH0982HF78B63-45-6GJOHLWZHWQUKAU-UHFFFAOYSA-N
Prescription Products
NameDosageStrengthRouteLabellerMarketing StartMarketing End
PrimaquineTablet26.3 mgOralSanofi Aventis1945-12-31Not applicableCanada
Primaquine PhosphateTablet, film coated15 mg/1Oralbryant ranch prepack2011-04-152016-10-30Us
Primaquine PhosphateTablet, film coated15 mg/1OralPd Rx Pharmaceuticals, Inc.2011-04-15Not applicableUs
Primaquine PhosphateTablet, film coated15 mg/1OralSanofi Aventis2011-04-15Not applicableUs
Primaquine PhosphateTablet, film coated15 mg/1OralAvera McKennan Hospital2015-08-242018-07-05Us
Generic Prescription Products
NameDosageStrengthRouteLabellerMarketing StartMarketing End
Primaquine PhosphateTablet, film coated15 mg/1OralIngenus Pharmaceuticals, LLC2018-01-23Not applicableUs
Primaquine PhosphateTablet, film coated26.3 mg/1OralAlvogen, Inc.2011-12-08Not applicableUs
Primaquine PhosphateTablet15 mg/1OralAidarex Pharmaceuticals LLC2014-08-01Not applicableUs
Primaquine PhosphateTablet15 mg/1OralPD-Rx Pharmaceuticals, Inc.2014-08-01Not applicableUs
Primaquine PhosphateTablet, film coated15 mg/1OralIngenus Pharmaceuticals Nj, Llc2016-06-232016-06-23Us
Primaquine PhosphateTablet15 mg/1OralGolden State Medical Supply Inc.2014-02-25Not applicableUs
Primaquine PhosphateTablet15 mg/1OralLiberty Pharmaceuticals, Inc.2014-08-01Not applicableUs
Primaquine PhosphateTablet15 mg/1OralBayshore Pharmaceuticals, LLC2014-08-01Not applicableUs
Primaquine PhosphateTablet15 mg/1OralAidarex Pharmaceuticals LLC2014-08-012017-07-19Us
International/Other Brands
Neo-Quipenyl / Primachin
CAS number
Average: 259.3467
Monoisotopic: 259.168462309
Chemical Formula
InChI Key



For the treatment of malaria.

Associated Conditions

Primaquine is an antimalarial agent and is the essential co-drug with chloroquine in treating all cases of malaria. In the blood, malaria parasites break down a part of the red blood cells known as haemoglobin. When this happens haemoglobin is divided into two parts; haem and globin. Haem is toxic to the malaria parasite. To prevent it from being damaged, the malaria parasite produces an chemical which converts the toxic haem into a non-toxic product. Primaquine acts by interfering with a part of the parasite (mitochondria) that is responsible for supplying it with energy. Without energy the parasite dies. This stops the infection from continuing and allows the person to recover. Primaquine kills the intrahepatic form of Plasmodium vivax and Plasmodium ovale, and thereby prevents the development of the erythrocytic forms that are responsible for relapses (it also kills gametocytes). Primaquine is not used in the prevention of malaria, only in the treatment. It has insignificant activity against the asexual blood forms of the parasite and therefore it is always used in conjunction with a blood schizonticide and never as a single agent. Primaquine has gametocytocidal activity against all plasmodia, including P. falciparum.

Mechanism of action

Primaquine's mechanism of action is not well understood. It may be acting by generating reactive oxygen species or by interfering with the electron transport in the parasite. Also, although its mechanism of action is unclear, primaquine may bind to and alter the properties of protozoal DNA.

AFe(II)-protoporphyrin IX
Plasmodium falciparum
UKeratin, type II cytoskeletal 7
URibosyldihydronicotinamide dehydrogenase [quinone]
Not Available
Volume of distribution
Not Available
Protein binding
Not Available
Not Available
Route of elimination
Not Available
Half life

3.7-7.4 hours

Not Available
Not Available
Affected organisms
  • Plasmodium
Not Available
Pharmacogenomic Effects/ADRs
Interacting Gene/EnzymeAllele nameGenotype(s)Defining Change(s)Type(s)DescriptionDetails
NADH-cytochrome b5 reductase 3---Not AvailableExon 2 c.129C>A / Exon 2 c.149G>A  … show all ADR InferredRisk of methemglobinemia.Details
Glucose-6-phosphate 1-dehydrogenaseVilleurbanneNot Available1000_1002delACCADR InferredIncreased risk of potentially fatal hemolysis. Associated with leukopenia.Details
Glucose-6-phosphate 1-dehydrogenaseTorunNot Available1006A->GADR InferredIncreased risk of potentially fatal hemolysis. Associated with leukopenia.Details
Glucose-6-phosphate 1-dehydrogenaseSunderlandNot Available105_107delCATADR InferredIncreased risk of potentially fatal hemolysis. Associated with leukopenia.Details
Glucose-6-phosphate 1-dehydrogenaseIwatsukiNot Available1081G->AADR InferredIncreased risk of potentially fatal hemolysis. Associated with leukopenia.Details
Glucose-6-phosphate 1-dehydrogenaseSerresNot Available1082C->TADR InferredIncreased risk of potentially fatal hemolysis. Associated with leukopenia.Details
Glucose-6-phosphate 1-dehydrogenaseTondelaNot Available1084_1101delCTGAACGAGCGCAAGGCCADR InferredIncreased risk of potentially fatal hemolysis. Associated with leukopenia.Details
Glucose-6-phosphate 1-dehydrogenaseLoma LindaNot Available1089C->AADR InferredIncreased risk of potentially fatal hemolysis. Associated with leukopenia.Details
Glucose-6-phosphate 1-dehydrogenaseAachenNot Available1089C->GADR InferredIncreased risk of potentially fatal hemolysis. Associated with leukopenia.Details
Glucose-6-phosphate 1-dehydrogenaseTenriNot Available1096A->GADR InferredIncreased risk of potentially fatal hemolysis. Associated with leukopenia.Details
Glucose-6-phosphate 1-dehydrogenaseMontpellierNot Available1132G>AADR InferredIncreased risk of potentially fatal hemolysis. Associated with leukopenia.Details
Glucose-6-phosphate 1-dehydrogenaseCalvo MackennaNot Available1138A->GADR InferredIncreased risk of potentially fatal hemolysis. Associated with leukopenia.Details
Glucose-6-phosphate 1-dehydrogenaseRileyNot Available1139T->CADR InferredIncreased risk of potentially fatal hemolysis. Associated with leukopenia.Details
Glucose-6-phosphate 1-dehydrogenaseOlomoucNot Available1141T->CADR InferredIncreased risk of potentially fatal hemolysis. Associated with leukopenia.Details
Glucose-6-phosphate 1-dehydrogenaseTomahNot Available1153T->CADR InferredIncreased risk of potentially fatal hemolysis. Associated with leukopenia.Details
Glucose-6-phosphate 1-dehydrogenaseLynwoodNot Available1154G->TADR InferredIncreased risk of potentially fatal hemolysis. Associated with leukopenia.Details
Glucose-6-phosphate 1-dehydrogenaseMadridNot Available1155C->GADR InferredIncreased risk of potentially fatal hemolysis. Associated with leukopenia.Details
Glucose-6-phosphate 1-dehydrogenaseIowa, Walter Reed, SpringfieldNot Available1156A->GADR InferredIncreased risk of potentially fatal hemolysis. Associated with leukopenia.Details
Glucose-6-phosphate 1-dehydrogenaseBeverly Hills, Genova, Iwate, Niigata, YamaguchiNot Available1160G->AADR InferredIncreased risk of potentially fatal hemolysis. Associated with leukopenia.Details
Glucose-6-phosphate 1-dehydrogenaseHartfordNot Available1162A->GADR InferredIncreased risk of potentially fatal hemolysis. Associated with leukopenia.Details
Glucose-6-phosphate 1-dehydrogenasePrahaNot Available1166A->GADR InferredIncreased risk of potentially fatal hemolysis. Associated with leukopenia.Details
Glucose-6-phosphate 1-dehydrogenaseKrakowNot Available1175T>CADR InferredIncreased risk of potentially fatal hemolysis. Associated with leukopenia.Details
Glucose-6-phosphate 1-dehydrogenaseWisconsinNot Available1177C->GADR InferredIncreased risk of potentially fatal hemolysis. Associated with leukopenia.Details
Glucose-6-phosphate 1-dehydrogenaseNashville, Anaheim, PorticiNot Available1178G->AADR InferredIncreased risk of potentially fatal hemolysis. Associated with leukopenia.Details
Glucose-6-phosphate 1-dehydrogenaseAlhambraNot Available1180G->CADR InferredIncreased risk of potentially fatal hemolysis. Associated with leukopenia.Details
Glucose-6-phosphate 1-dehydrogenaseBariNot Available1187C->TADR InferredIncreased risk of potentially fatal hemolysis. Associated with leukopenia.Details
Glucose-6-phosphate 1-dehydrogenasePuerto LimonNot Available1192G->AADR InferredIncreased risk of potentially fatal hemolysis. Associated with leukopenia.Details
Glucose-6-phosphate 1-dehydrogenaseCovao do LoboNot Available1205C>AADR InferredIncreased risk of potentially fatal hemolysis. Associated with leukopenia.Details
Glucose-6-phosphate 1-dehydrogenaseClinicNot Available1215G->AADR InferredIncreased risk of potentially fatal hemolysis. Associated with leukopenia.Details
Glucose-6-phosphate 1-dehydrogenaseUtrechtNot Available1225C->TADR InferredIncreased risk of potentially fatal hemolysis. Associated with leukopenia.Details
Glucose-6-phosphate 1-dehydrogenaseSuwalkiNot Available1226C->GADR InferredIncreased risk of potentially fatal hemolysis. Associated with leukopenia.Details
Glucose-6-phosphate 1-dehydrogenaseRiversideNot Available1228G->TADR InferredIncreased risk of potentially fatal hemolysis. Associated with leukopenia.Details
Glucose-6-phosphate 1-dehydrogenaseJapan, ShinagawaNot Available1229G->AADR InferredIncreased risk of potentially fatal hemolysis. Associated with leukopenia.Details
Glucose-6-phosphate 1-dehydrogenaseKawasakiNot Available1229G->CADR InferredIncreased risk of potentially fatal hemolysis. Associated with leukopenia.Details
Glucose-6-phosphate 1-dehydrogenaseMunichNot Available1231A->GADR InferredIncreased risk of potentially fatal hemolysis. Associated with leukopenia.Details
Glucose-6-phosphate 1-dehydrogenaseGeorgiaNot Available1284C->AADR InferredIncreased risk of potentially fatal hemolysis. Associated with leukopenia.Details
Glucose-6-phosphate 1-dehydrogenaseSumareNot Available1292T->GADR InferredIncreased risk of potentially fatal hemolysis. Associated with leukopenia.Details
Glucose-6-phosphate 1-dehydrogenaseTelti/KobeNot Available1318C->TADR InferredIncreased risk of potentially fatal hemolysis. Associated with leukopenia.Details
Glucose-6-phosphate 1-dehydrogenaseSantiago de Cuba, MoriokaNot Available1339G->AADR InferredIncreased risk of potentially fatal hemolysis. Associated with leukopenia.Details
Glucose-6-phosphate 1-dehydrogenaseHarimaNot Available1358T->AADR InferredIncreased risk of potentially fatal hemolysis. Associated with leukopenia.Details
Glucose-6-phosphate 1-dehydrogenaseFiguera da FozNot Available1366G->CADR InferredIncreased risk of potentially fatal hemolysis. Associated with leukopenia.Details
Glucose-6-phosphate 1-dehydrogenaseAmiensNot Available1367A>TADR InferredIncreased risk of potentially fatal hemolysis. Associated with leukopenia.Details
Glucose-6-phosphate 1-dehydrogenaseBangkok NoiNot Available1376G->T, 1502T->GADR InferredIncreased risk of potentially fatal hemolysis. Associated with leukopenia.Details
Glucose-6-phosphate 1-dehydrogenaseFukayaNot Available1462G->AADR InferredIncreased risk of potentially fatal hemolysis. Associated with leukopenia.Details
Glucose-6-phosphate 1-dehydrogenaseCampinasNot Available1463G->TADR InferredIncreased risk of potentially fatal hemolysis. Associated with leukopenia.Details
Glucose-6-phosphate 1-dehydrogenaseBuenos AiresNot Available1465C>TADR InferredIncreased risk of potentially fatal hemolysis. Associated with leukopenia.Details
Glucose-6-phosphate 1-dehydrogenaseArakawaNot Available1466C->TADR InferredIncreased risk of potentially fatal hemolysis. Associated with leukopenia.Details
Glucose-6-phosphate 1-dehydrogenaseBrightonNot Available1488_1490delGAAADR InferredIncreased risk of potentially fatal hemolysis. Associated with leukopenia.Details
Glucose-6-phosphate 1-dehydrogenaseKozukataNot Available159G->CADR InferredIncreased risk of potentially fatal hemolysis. Associated with leukopenia.Details
Glucose-6-phosphate 1-dehydrogenaseAmsterdamNot Available180_182delTCTADR InferredIncreased risk of potentially fatal hemolysis. Associated with leukopenia.Details
Glucose-6-phosphate 1-dehydrogenaseNo nameNot Available202G->A, 376A->G, 1264C>GADR InferredIncreased risk of potentially fatal hemolysis. Associated with leukopenia.Details
Glucose-6-phosphate 1-dehydrogenaseSwanseaNot Available224T->CADR InferredIncreased risk of potentially fatal hemolysis. Associated with leukopenia.Details
Glucose-6-phosphate 1-dehydrogenaseUrayasuNot Available281_283delAGAADR InferredIncreased risk of potentially fatal hemolysis. Associated with leukopenia.Details
Glucose-6-phosphate 1-dehydrogenaseVancouverNot Available317C->G544C->T592C->TADR InferredIncreased risk of potentially fatal hemolysis. Associated with leukopenia.Details
Glucose-6-phosphate 1-dehydrogenaseMt SinaiNot Available376A->G, 1159C->TADR InferredIncreased risk of potentially fatal hemolysis. Associated with leukopenia.Details
Glucose-6-phosphate 1-dehydrogenasePlymouthNot Available488G->AADR InferredIncreased risk of potentially fatal hemolysis. Associated with leukopenia.Details
Glucose-6-phosphate 1-dehydrogenaseVolendamNot Available514C->TADR InferredIncreased risk of potentially fatal hemolysis. Associated with leukopenia.Details
Glucose-6-phosphate 1-dehydrogenaseShinshuNot Available527A->GADR InferredIncreased risk of potentially fatal hemolysis. Associated with leukopenia.Details
Glucose-6-phosphate 1-dehydrogenaseChikugoNot Available535A->TADR InferredIncreased risk of potentially fatal hemolysis. Associated with leukopenia.Details
Glucose-6-phosphate 1-dehydrogenaseTsukuiNot Available561_563delCTCADR InferredIncreased risk of potentially fatal hemolysis. Associated with leukopenia.Details
Glucose-6-phosphate 1-dehydrogenasePedoplis-CkaroNot Available573C>GADR InferredIncreased risk of potentially fatal hemolysis. Associated with leukopenia.Details
Glucose-6-phosphate 1-dehydrogenaseSantiagoNot Available593G->CADR InferredIncreased risk of potentially fatal hemolysis. Associated with leukopenia.Details
Glucose-6-phosphate 1-dehydrogenaseMinnesota, Marion, Gastonia, LeJeuneNot Available637G->TADR InferredIncreased risk of potentially fatal hemolysis. Associated with leukopenia.Details
Glucose-6-phosphate 1-dehydrogenaseCincinnatiNot Available637G->T, 1037A->TADR InferredIncreased risk of potentially fatal hemolysis. Associated with leukopenia.Details
Glucose-6-phosphate 1-dehydrogenaseHarilaouNot Available648T->GADR InferredIncreased risk of potentially fatal hemolysis. Associated with leukopenia.Details
Glucose-6-phosphate 1-dehydrogenaseNorth DallasNot Available683_685delACAADR InferredIncreased risk of potentially fatal hemolysis. Associated with leukopenia.Details
Glucose-6-phosphate 1-dehydrogenaseAsahikawaNot Available695G->AADR InferredIncreased risk of potentially fatal hemolysis. Associated with leukopenia.Details
Glucose-6-phosphate 1-dehydrogenaseDurhamNot Available713A->GADR InferredIncreased risk of potentially fatal hemolysis. Associated with leukopenia.Details
Glucose-6-phosphate 1-dehydrogenaseStonybrookNot Available724_729delGGCACTADR InferredIncreased risk of potentially fatal hemolysis. Associated with leukopenia.Details
Glucose-6-phosphate 1-dehydrogenaseWayneNot Available769C->GADR InferredIncreased risk of potentially fatal hemolysis. Associated with leukopenia.Details
Glucose-6-phosphate 1-dehydrogenaseAveiroNot Available806G->AADR InferredIncreased risk of potentially fatal hemolysis. Associated with leukopenia.Details
Glucose-6-phosphate 1-dehydrogenaseCleveland CorumNot Available820G->AADR InferredIncreased risk of potentially fatal hemolysis. Associated with leukopenia.Details
Glucose-6-phosphate 1-dehydrogenaseLilleNot Available821A>TADR InferredIncreased risk of potentially fatal hemolysis. Associated with leukopenia.Details
Glucose-6-phosphate 1-dehydrogenaseBangkokNot Available825G>CADR InferredIncreased risk of potentially fatal hemolysis. Associated with leukopenia.Details
Glucose-6-phosphate 1-dehydrogenaseSugaoNot Available826C->TADR InferredIncreased risk of potentially fatal hemolysis. Associated with leukopenia.Details
Glucose-6-phosphate 1-dehydrogenaseLa JollaNot Available832T->CADR InferredIncreased risk of potentially fatal hemolysis. Associated with leukopenia.Details
Glucose-6-phosphate 1-dehydrogenaseWexhamNot Available833C->TADR InferredIncreased risk of potentially fatal hemolysis. Associated with leukopenia.Details
Glucose-6-phosphate 1-dehydrogenasePiotrkowNot Available851T>CADR InferredIncreased risk of potentially fatal hemolysis. Associated with leukopenia.Details
Glucose-6-phosphate 1-dehydrogenaseWest VirginiaNot Available910G->TADR InferredIncreased risk of potentially fatal hemolysis. Associated with leukopenia.Details
Glucose-6-phosphate 1-dehydrogenaseOmiyaNot Available921G->CADR InferredIncreased risk of potentially fatal hemolysis. Associated with leukopenia.Details
Glucose-6-phosphate 1-dehydrogenaseNaraNot Available953_976delCCACCAAAGGGTACCTGGAC GACCADR InferredIncreased risk of potentially fatal hemolysis. Associated with leukopenia.Details
Glucose-6-phosphate 1-dehydrogenaseManhattanNot Available962G->AADR InferredIncreased risk of potentially fatal hemolysis. Associated with leukopenia.Details
Glucose-6-phosphate 1-dehydrogenaseRehevotNot Available964T->CADR InferredIncreased risk of potentially fatal hemolysis. Associated with leukopenia.Details
Glucose-6-phosphate 1-dehydrogenaseHoniaraNot Available99A->G / 1360C->TADR InferredIncreased risk of potentially fatal hemolysis. Associated with leukopenia.Details
Glucose-6-phosphate 1-dehydrogenaseTokyo, FukushimaNot Available1246G->AADR InferredIncreased risk of potentially fatal hemolysis. Associated with leukopenia.Details
Glucose-6-phosphate 1-dehydrogenaseChathamNot Available1003G->AADR InferredIncreased risk of potentially fatal hemolysis. Associated with leukopenia.Details
Glucose-6-phosphate 1-dehydrogenaseFushanNot Available1004C->AADR InferredIncreased risk of potentially fatal hemolysis. Associated with leukopenia.Details
Glucose-6-phosphate 1-dehydrogenasePartenopeNot Available1052G->TADR InferredIncreased risk of potentially fatal hemolysis. Associated with leukopenia.Details
Glucose-6-phosphate 1-dehydrogenaseIerapetraNot Available1057C->TADR InferredIncreased risk of potentially fatal hemolysis. Associated with leukopenia.Details
Glucose-6-phosphate 1-dehydrogenaseAnadiaNot Available1193A->GADR InferredIncreased risk of potentially fatal hemolysis. Associated with leukopenia.Details
Glucose-6-phosphate 1-dehydrogenaseAbenoNot Available1220A->CADR InferredIncreased risk of potentially fatal hemolysis. Associated with leukopenia.Details
Glucose-6-phosphate 1-dehydrogenaseSurabayaNot Available1291G->AADR InferredIncreased risk of potentially fatal hemolysis. Associated with leukopenia.Details
Glucose-6-phosphate 1-dehydrogenasePawneeNot Available1316G->CADR InferredIncreased risk of potentially fatal hemolysis. Associated with leukopenia.Details
Glucose-6-phosphate 1-dehydrogenaseS. AntiocoNot Available1342A->GADR InferredIncreased risk of potentially fatal hemolysis. Associated with leukopenia.Details
Glucose-6-phosphate 1-dehydrogenaseCassanoNot Available1347G->CADR InferredIncreased risk of potentially fatal hemolysis. Associated with leukopenia.Details
Glucose-6-phosphate 1-dehydrogenaseHermoupolisNot Available1347G->C / 1360C->TADR InferredIncreased risk of potentially fatal hemolysis. Associated with leukopenia.Details
Glucose-6-phosphate 1-dehydrogenaseUnion,Maewo, Chinese-2, KaloNot Available1360C->TADR InferredIncreased risk of potentially fatal hemolysis. Associated with leukopenia.Details
Glucose-6-phosphate 1-dehydrogenaseAndalusNot Available1361G->AADR InferredIncreased risk of potentially fatal hemolysis. Associated with leukopenia.Details
Glucose-6-phosphate 1-dehydrogenaseCosenzaNot Available1376G->CADR InferredIncreased risk of potentially fatal hemolysis. Associated with leukopenia.Details
Glucose-6-phosphate 1-dehydrogenaseCanton, Taiwan- Hakka, Gifu-like, Agrigento-likeNot Available1376G->TADR InferredIncreased risk of potentially fatal hemolysis. Associated with leukopenia.Details
Glucose-6-phosphate 1-dehydrogenaseFloresNot Available1387C->AADR InferredIncreased risk of potentially fatal hemolysis. Associated with leukopenia.Details
Glucose-6-phosphate 1-dehydrogenaseKaiping, Anant, Dhon, Sapporo-like, WoseraNot Available1388G->AADR InferredIncreased risk of potentially fatal hemolysis. Associated with leukopenia.Details
Glucose-6-phosphate 1-dehydrogenaseKamogawaNot Available169C->TADR InferredIncreased risk of potentially fatal hemolysis. Associated with leukopenia.Details
Glucose-6-phosphate 1-dehydrogenaseCostanzoNot Available179T>CADR InferredIncreased risk of potentially fatal hemolysis. Associated with leukopenia.Details
Glucose-6-phosphate 1-dehydrogenaseAmazoniaNot Available185C->AADR InferredIncreased risk of potentially fatal hemolysis. Associated with leukopenia.Details
Glucose-6-phosphate 1-dehydrogenaseSongklanagarindNot Available196T->AADR InferredIncreased risk of potentially fatal hemolysis. Associated with leukopenia.Details
Glucose-6-phosphate 1-dehydrogenaseHechiNot Available202G->A / 871G->AADR InferredIncreased risk of potentially fatal hemolysis. Associated with leukopenia.Details
Glucose-6-phosphate 1-dehydrogenaseNamouruNot Available208T->CADR InferredIncreased risk of potentially fatal hemolysis. Associated with leukopenia.Details
Glucose-6-phosphate 1-dehydrogenaseBao LocNot Available352T>CADR InferredIncreased risk of potentially fatal hemolysis. Associated with leukopenia.Details
Glucose-6-phosphate 1-dehydrogenaseCrispimNot Available375G->T, 379G->T383T->C384C>TADR InferredIncreased risk of potentially fatal hemolysis. Associated with leukopenia.Details
Glucose-6-phosphate 1-dehydrogenaseAcrokorinthosNot Available376A->G / 463C->GADR InferredIncreased risk of potentially fatal hemolysis. Associated with leukopenia.Details
Glucose-6-phosphate 1-dehydrogenaseSanta MariaNot Available376A->G / 542A->TADR InferredIncreased risk of potentially fatal hemolysis. Associated with leukopenia.Details
Glucose-6-phosphate 1-dehydrogenaseAnanindeuaNot Available376A->G / 871G->AADR InferredIncreased risk of potentially fatal hemolysis. Associated with leukopenia.Details
Glucose-6-phosphate 1-dehydrogenaseVanua LavaNot Available383T->CADR InferredIncreased risk of potentially fatal hemolysis. Associated with leukopenia.Details
Glucose-6-phosphate 1-dehydrogenaseValladolidNot Available406C->TADR InferredIncreased risk of potentially fatal hemolysis. Associated with leukopenia.Details
Glucose-6-phosphate 1-dehydrogenaseBelemNot Available409C->TADR InferredIncreased risk of potentially fatal hemolysis. Associated with leukopenia.Details
Glucose-6-phosphate 1-dehydrogenaseLiuzhouNot Available442G->AADR InferredIncreased risk of potentially fatal hemolysis. Associated with leukopenia.Details
Glucose-6-phosphate 1-dehydrogenaseShenzenNot Available473G>AADR InferredIncreased risk of potentially fatal hemolysis. Associated with leukopenia.Details
Glucose-6-phosphate 1-dehydrogenaseTaipei “Chinese- 3”Not Available493A->GADR InferredIncreased risk of potentially fatal hemolysis. Associated with leukopenia.Details
Glucose-6-phosphate 1-dehydrogenaseToledoNot Available496C>TADR InferredIncreased risk of potentially fatal hemolysis. Associated with leukopenia.Details
Glucose-6-phosphate 1-dehydrogenaseNaoneNot Available497G->AADR InferredIncreased risk of potentially fatal hemolysis. Associated with leukopenia.Details
Glucose-6-phosphate 1-dehydrogenaseNankangNot Available517T->CADR InferredIncreased risk of potentially fatal hemolysis. Associated with leukopenia.Details
Glucose-6-phosphate 1-dehydrogenaseMiaoliNot Available519C->GADR InferredIncreased risk of potentially fatal hemolysis. Associated with leukopenia.Details
Glucose-6-phosphate 1-dehydrogenaseMediterranean, Dallas, Panama‚ Sassari, Cagliari, BirminghamNot Available563C->TADR InferredIncreased risk of potentially fatal hemolysis. Associated with leukopenia.Details
Glucose-6-phosphate 1-dehydrogenaseCoimbra ShundeNot Available592C->TADR InferredIncreased risk of potentially fatal hemolysis. Associated with leukopenia.Details
Glucose-6-phosphate 1-dehydrogenaseNilgiriNot Available593G>AADR InferredIncreased risk of potentially fatal hemolysis. Associated with leukopenia.Details
Glucose-6-phosphate 1-dehydrogenaseRadlowoNot Available679C->TADR InferredIncreased risk of potentially fatal hemolysis. Associated with leukopenia.Details
Glucose-6-phosphate 1-dehydrogenaseRoubaixNot Available811G>CADR InferredIncreased risk of potentially fatal hemolysis. Associated with leukopenia.Details
Glucose-6-phosphate 1-dehydrogenaseHaikouNot Available835A->GADR InferredIncreased risk of potentially fatal hemolysis. Associated with leukopenia.Details
Glucose-6-phosphate 1-dehydrogenaseChinese-1Not Available835A->TADR InferredIncreased risk of potentially fatal hemolysis. Associated with leukopenia.Details
Glucose-6-phosphate 1-dehydrogenaseMizushimaNot Available848A>GADR InferredIncreased risk of potentially fatal hemolysis. Associated with leukopenia.Details
Glucose-6-phosphate 1-dehydrogenaseOsakaNot Available853C->TADR InferredIncreased risk of potentially fatal hemolysis. Associated with leukopenia.Details
Glucose-6-phosphate 1-dehydrogenaseViangchan, JammuNot Available871G->AADR InferredIncreased risk of potentially fatal hemolysis. Associated with leukopenia.Details
Glucose-6-phosphate 1-dehydrogenaseSeoulNot Available916G->AADR InferredIncreased risk of potentially fatal hemolysis. Associated with leukopenia.Details
Glucose-6-phosphate 1-dehydrogenaseLudhianaNot Available929G->AADR InferredIncreased risk of potentially fatal hemolysis. Associated with leukopenia.Details
Glucose-6-phosphate 1-dehydrogenaseFarroupilhaNot Available977C->AADR InferredIncreased risk of potentially fatal hemolysis. Associated with leukopenia.Details
Glucose-6-phosphate 1-dehydrogenaseChinese-5Not Available1024C->TADR InferredIncreased risk of potentially fatal hemolysis. Associated with leukopenia.Details
Glucose-6-phosphate 1-dehydrogenaseRignanoNot Available130G>AADR InferredIncreased risk of potentially fatal hemolysis. Associated with leukopenia.Details
Glucose-6-phosphate 1-dehydrogenaseOrissaNot Available131C->GADR InferredIncreased risk of potentially fatal hemolysis. Associated with leukopenia.Details
Glucose-6-phosphate 1-dehydrogenaseG6PDNiceNot Available1380G>CADR InferredIncreased risk of potentially fatal hemolysis. Associated with leukopenia.Details
Glucose-6-phosphate 1-dehydrogenaseKamiube, KeelungNot Available1387C->TADR InferredIncreased risk of potentially fatal hemolysis. Associated with leukopenia.Details
Glucose-6-phosphate 1-dehydrogenaseNeapolisNot Available1400C->GADR InferredIncreased risk of potentially fatal hemolysis. Associated with leukopenia.Details
Glucose-6-phosphate 1-dehydrogenaseAuresNot Available143T->CADR InferredIncreased risk of potentially fatal hemolysis. Associated with leukopenia.Details
Glucose-6-phosphate 1-dehydrogenaseSplitNot Available1442C->GADR InferredIncreased risk of potentially fatal hemolysis. Associated with leukopenia.Details
Glucose-6-phosphate 1-dehydrogenaseKambosNot Available148C->TADR InferredIncreased risk of potentially fatal hemolysis. Associated with leukopenia.Details
Glucose-6-phosphate 1-dehydrogenasePalestrinaNot Available170G>AADR InferredIncreased risk of potentially fatal hemolysis. Associated with leukopenia.Details
Glucose-6-phosphate 1-dehydrogenaseMetapontoNot Available172G->AADR InferredIncreased risk of potentially fatal hemolysis. Associated with leukopenia.Details
Glucose-6-phosphate 1-dehydrogenaseMusashinoNot Available185C->TADR InferredIncreased risk of potentially fatal hemolysis. Associated with leukopenia.Details
Glucose-6-phosphate 1-dehydrogenaseAsahiNot Available202G->AADR InferredIncreased risk of potentially fatal hemolysis. Associated with leukopenia.Details
Glucose-6-phosphate 1-dehydrogenaseA- (202), Ferrara INot Available202G->A / 376A->GADR InferredIncreased risk of potentially fatal hemolysis. Associated with leukopenia.Details
Glucose-6-phosphate 1-dehydrogenaseMurcia OristanoNot Available209A->GADR InferredIncreased risk of potentially fatal hemolysis. Associated with leukopenia.Details
Glucose-6-phosphate 1-dehydrogenaseUbe KonanNot Available241C->TADR InferredIncreased risk of potentially fatal hemolysis. Associated with leukopenia.Details
Glucose-6-phosphate 1-dehydrogenaseLagosantoNot Available242G->AADR InferredIncreased risk of potentially fatal hemolysis. Associated with leukopenia.Details
Glucose-6-phosphate 1-dehydrogenaseGuangzhouNot Available274C->TADR InferredIncreased risk of potentially fatal hemolysis. Associated with leukopenia.Details
Glucose-6-phosphate 1-dehydrogenaseHammersmithNot Available323T->AADR InferredIncreased risk of potentially fatal hemolysis. Associated with leukopenia.Details
Glucose-6-phosphate 1-dehydrogenaseSinnaiNot Available34G->TADR InferredIncreased risk of potentially fatal hemolysis. Associated with leukopenia.Details
Glucose-6-phosphate 1-dehydrogenaseA- (680)Not Available376A->G / 680G->TADR InferredIncreased risk of potentially fatal hemolysis. Associated with leukopenia.Details
Glucose-6-phosphate 1-dehydrogenaseA- (968), Betica,Selma, GuantanamoNot Available376A->G / 968T->CADR InferredIncreased risk of potentially fatal hemolysis. Associated with leukopenia.Details
Glucose-6-phosphate 1-dehydrogenaseSalerno PyrgosNot Available383T>GADR InferredIncreased risk of potentially fatal hemolysis. Associated with leukopenia.Details
Glucose-6-phosphate 1-dehydrogenaseQuing YanNot Available392G->TADR InferredIncreased risk of potentially fatal hemolysis. Associated with leukopenia.Details
Glucose-6-phosphate 1-dehydrogenaseLagesNot Available40G->AADR InferredIncreased risk of potentially fatal hemolysis. Associated with leukopenia.Details
Glucose-6-phosphate 1-dehydrogenaseIleshaNot Available466G->AADR InferredIncreased risk of potentially fatal hemolysis. Associated with leukopenia.Details
Glucose-6-phosphate 1-dehydrogenaseMahidolNot Available487G->AADR InferredIncreased risk of potentially fatal hemolysis. Associated with leukopenia.Details
Glucose-6-phosphate 1-dehydrogenaseMalagaNot Available542A->TADR InferredIncreased risk of potentially fatal hemolysis. Associated with leukopenia.Details
Glucose-6-phosphate 1-dehydrogenaseSibariNot Available634A->GADR InferredIncreased risk of potentially fatal hemolysis. Associated with leukopenia.Details
Glucose-6-phosphate 1-dehydrogenaseMexico CityNot Available680G->AADR InferredIncreased risk of potentially fatal hemolysis. Associated with leukopenia.Details
Glucose-6-phosphate 1-dehydrogenaseNanningNot Available703C->TADR InferredIncreased risk of potentially fatal hemolysis. Associated with leukopenia.Details
Glucose-6-phosphate 1-dehydrogenaseSeattle, Lodi, Modena, Ferrara II, Athens-likeNot Available844G->CADR InferredIncreased risk of potentially fatal hemolysis. Associated with leukopenia.Details
Glucose-6-phosphate 1-dehydrogenaseBajo MaumereNot Available844G->TADR InferredIncreased risk of potentially fatal hemolysis. Associated with leukopenia.Details
Glucose-6-phosphate 1-dehydrogenaseMontalbanoNot Available854G->AADR InferredIncreased risk of potentially fatal hemolysis. Associated with leukopenia.Details
Glucose-6-phosphate 1-dehydrogenaseKalyan-Kerala, Jamnaga, RohiniNot Available949G->AADR InferredIncreased risk of potentially fatal hemolysis. Associated with leukopenia.Details
Glucose-6-phosphate 1-dehydrogenaseGaoheNot Available95A->GADR InferredIncreased risk of potentially fatal hemolysis. Associated with leukopenia.Details


Drug Interactions
(R)-warfarinThe metabolism of (R)-warfarin can be decreased when combined with Primaquine.
(S)-WarfarinThe metabolism of (S)-Warfarin can be decreased when combined with Primaquine.
3-isobutyl-1-methyl-7H-xanthineThe serum concentration of 3-isobutyl-1-methyl-7H-xanthine can be increased when it is combined with Primaquine.
3,5-diiodothyropropionic acidThe metabolism of 3,5-diiodothyropropionic acid can be decreased when combined with Primaquine.
4-hydroxycoumarinThe metabolism of 4-hydroxycoumarin can be decreased when combined with Primaquine.
4-MethoxyamphetamineThe metabolism of 4-Methoxyamphetamine can be decreased when combined with Primaquine.
5-androstenedioneThe metabolism of 5-androstenedione can be decreased when combined with Primaquine.
6-Deoxyerythronolide BThe metabolism of Primaquine can be decreased when combined with 6-Deoxyerythronolide B.
6-O-benzylguanineThe serum concentration of 6-O-benzylguanine can be increased when it is combined with Primaquine.
7-DeazaguanineThe serum concentration of 7-Deazaguanine can be increased when it is combined with Primaquine.
Food Interactions
  • Take with food to decrease dyspepsia.


General References
  1. Mihaly GW, Ward SA, Edwards G, Nicholl DD, Orme ML, Breckenridge AM: Pharmacokinetics of primaquine in man. I. Studies of the absolute bioavailability and effects of dose size. Br J Clin Pharmacol. 1985 Jun;19(6):745-50. [PubMed:4027117]
  2. ALVING AS, ARNOLD J, HOCKWALD RS, CLAYMAN CB, DERN RJ, BEUTLER E, FLANAGAN CL: Potentiation of the curative action of primaquine in vivax malaria by quinine and chloroquine. J Lab Clin Med. 1955 Aug;46(2):301-6. [PubMed:13242948]
  3. Hill DR, Baird JK, Parise ME, Lewis LS, Ryan ET, Magill AJ: Primaquine: report from CDC expert meeting on malaria chemoprophylaxis I. Am J Trop Med Hyg. 2006 Sep;75(3):402-15. [PubMed:16968913]
  4. Cohen RJ, Sachs JR, Wicker DJ, Conrad ME: Methemoglobinemia provoked by malarial chemoprophylaxis in Vietnam. N Engl J Med. 1968 Nov 21;279(21):1127-31. [PubMed:5686480]
  5. Coleman MD, Coleman NA: Drug-induced methaemoglobinaemia. Treatment issues. Drug Saf. 1996 Jun;14(6):394-405. [PubMed:8828017]
  6. Taavitsainen P, Juvonen R, Pelkonen O: In vitro inhibition of cytochrome P450 enzymes in human liver microsomes by a potent CYP2A6 inhibitor, trans-2-phenylcyclopropylamine (tranylcypromine), and its nonamine analog, cyclopropylbenzene. Drug Metab Dispos. 2001 Mar;29(3):217-22. [PubMed:11181487]
  7. Bapiro TE, Andersson TB, Otter C, Hasler JA, Masimirembwa CM: Cytochrome P450 1A1/2 induction by antiparasitic drugs: dose-dependent increase in ethoxyresorufin O-deethylase activity and mRNA caused by quinine, primaquine and albendazole in HepG2 cells. Eur J Clin Pharmacol. 2002 Nov;58(8):537-42. Epub 2002 Oct 2. [PubMed:12451431]
  8. CYP1A2 CTEP document [File]
External Links
Human Metabolome Database
KEGG Compound
PubChem Compound
PubChem Substance
Therapeutic Targets Database
PA451103 Drug Page
ATC Codes
P01BA03 — Primaquine
AHFS Codes
  • 08:30.08 — Antimalarials
FDA label
Download (105 KB)

Clinical Trials

Clinical Trials
1Active Not RecruitingHealth Services ResearchPharmacologic Actions1
1CompletedNot AvailableObese1
1CompletedBasic SciencePlasmodium Infections2
1CompletedPreventionPlasmodium Infections1
1CompletedTreatmentG6PD Deficient / G6PD Normal / Healthy Volunteers1
1CompletedTreatmentHealthy Volunteers1
1CompletedTreatmentMalaria caused by plasmodium vivax1
1, 2CompletedTreatmentPlasmodium Infections2
1, 2RecruitingTreatmentDrug Combination / Healthy Volunteers / Pharmacokinetics1
2CompletedTreatmentMalaria caused by Plasmodium falciparum1
2CompletedTreatmentMalaria caused by plasmodium vivax1
2CompletedTreatmentPlasmodium Infections2
2CompletedTreatmentUncomplicated Falciparum Malaria1
2Not Yet RecruitingTreatmentMalaria caused by plasmodium vivax1
2RecruitingTreatmentGlucose-6-Phosphate Dehydrogenase Deficiency / Malaria caused by plasmodium vivax1
2TerminatedTreatmentPlasmodium Infections / Plasmodium Vivax1
2, 3CompletedTreatmentMalaria caused by plasmodium vivax1
3CompletedPreventionMalaria caused by Plasmodium falciparum1
3CompletedTreatmentAsymptomatic Malaria / Plasmodium Falciparum / Plasmodium Infections1
3CompletedTreatmentHuman Immunodeficiency Virus (HIV) Infections / Pneumonia, Pneumocystis Carinii1
3CompletedTreatmentMalaria caused by Plasmodium falciparum / Malaria caused by plasmodium vivax / Plasmodium Infections1
3CompletedTreatmentMalaria caused by plasmodium vivax3
3CompletedTreatmentMalaria caused by plasmodium vivax / Plasmodium Infections1
3CompletedTreatmentPlasmodium Infections1
3CompletedTreatmentUncomplicated Plasmodium Knowlesi Malaria1
3RecruitingTreatmentMalaria caused by plasmodium vivax1
3RecruitingTreatmentPlasmodium Vivax Malaria Without Complication1
4CompletedBasic SciencePlasmodium Falciparum Clinical Episode / Plasmodium Falciparum Infection / Plasmodium Vivax Clinical Episode / Plasmodium Vivax Infection1
4CompletedPreventionPlasmodium Falciparum1
4CompletedPreventionPlasmodium Infections1
4CompletedTreatmentGlucose-6-Phosphate Dehydrogenase Deficiency / Malaria caused by Plasmodium falciparum1
4CompletedTreatmentPlasmodium Infections3
4CompletedTreatmentPlasmodium Vivax Infection1
4Not Yet RecruitingPreventionPlasmodium Infections1
4RecruitingPreventionParasitic Diseases / Plasmodium Infections1
4RecruitingTreatmentGlucose-6-Phosphate Dehydrogenase Deficiency / Malaria caused by plasmodium vivax1
4RecruitingTreatmentMalaria caused by Plasmodium falciparum1
4RecruitingTreatmentPlasmodium Vivax1
4Unknown StatusTreatmentMalaria caused by plasmodium vivax1
4WithdrawnTreatmentPneumonia, Pneumocystis Carinii1
Not AvailableCompletedNot AvailableMalaria caused by plasmodium vivax1
Not AvailableCompletedPreventionFavism / Glucosephosphate Dehydrogenase Deficiency1
Not AvailableCompletedPreventionMalaria caused by plasmodium vivax1
Not AvailableCompletedTreatmentHuman Immunodeficiency Virus (HIV) Infections / Pneumonia, Pneumocystis Carinii1
Not AvailableCompletedTreatmentPlasmodium Infections1
Not AvailableCompletedTreatmentUncomplicated Vivax Malaria1
Not AvailableRecruitingTreatmentMalaria caused by plasmodium vivax / P Vivax1
Not AvailableSuspendedTreatmentUncomplicated Plasmodium Falciparum Malaria1
Not AvailableUnknown StatusNot AvailableParasitemia1
Not AvailableUnknown StatusTreatmentPlasmodium Infections1


Not Available
  • Bayer Healthcare
  • Dispensing Solutions
  • Gallipot
  • Kaiser Foundation Hospital
  • Sanofi-Aventis Inc.
Dosage forms
TabletOral26.3 mg
TabletOral15 mg/1
Tablet, film coatedOral15 mg/1
Tablet, film coatedOral26.3 mg/1
Unit descriptionCostUnit
Primaquin phosphate powder18.2USD g
Primaquine 26.3 mg tablet1.51USD tablet
Primaquine Phosphate 15 mg Tablet0.43USD tablet
DrugBank does not sell nor buy drugs. Pricing information is supplied for informational purposes only.
Not Available


Experimental Properties
melting point (°C)< 25 °CPhysProp
boiling point (°C)177 °C at 2.00E-01 mm HgPhysProp
logP2.1Not Available
Predicted Properties
Water Solubility0.0564 mg/mLALOGPS
pKa (Strongest Acidic)17.11ChemAxon
pKa (Strongest Basic)10.2ChemAxon
Physiological Charge1ChemAxon
Hydrogen Acceptor Count4ChemAxon
Hydrogen Donor Count2ChemAxon
Polar Surface Area60.17 Å2ChemAxon
Rotatable Bond Count6ChemAxon
Refractivity78.51 m3·mol-1ChemAxon
Polarizability29.92 Å3ChemAxon
Number of Rings2ChemAxon
Rule of FiveYesChemAxon
Ghose FilterYesChemAxon
Veber's RuleNoChemAxon
MDDR-like RuleNoChemAxon
Predicted ADMET features
Human Intestinal Absorption+0.9776
Blood Brain Barrier+0.9787
Caco-2 permeable-0.5622
P-glycoprotein substrateSubstrate0.8018
P-glycoprotein inhibitor INon-inhibitor0.8782
P-glycoprotein inhibitor IINon-inhibitor0.7681
Renal organic cation transporterInhibitor0.5501
CYP450 2C9 substrateNon-substrate0.8703
CYP450 2D6 substrateSubstrate0.8918
CYP450 3A4 substrateSubstrate0.5723
CYP450 1A2 substrateInhibitor0.9107
CYP450 2C9 inhibitorNon-inhibitor0.93
CYP450 2D6 inhibitorInhibitor0.8932
CYP450 2C19 inhibitorInhibitor0.8994
CYP450 3A4 inhibitorNon-inhibitor0.831
CYP450 inhibitory promiscuityLow CYP Inhibitory Promiscuity0.5057
Ames testAMES toxic0.9106
BiodegradationNot ready biodegradable1.0
Rat acute toxicity2.4474 LD50, mol/kg Not applicable
hERG inhibition (predictor I)Weak inhibitor0.7858
hERG inhibition (predictor II)Inhibitor0.8162
ADMET data is predicted using admetSAR, a free tool for evaluating chemical ADMET properties. (23092397)


Mass Spec (NIST)
Not Available
SpectrumSpectrum TypeSplash Key
Predicted GC-MS Spectrum - GC-MSPredicted GC-MSNot Available
Predicted MS/MS Spectrum - 10V, Positive (Annotated)Predicted LC-MS/MSNot Available
Predicted MS/MS Spectrum - 20V, Positive (Annotated)Predicted LC-MS/MSNot Available
Predicted MS/MS Spectrum - 40V, Positive (Annotated)Predicted LC-MS/MSNot Available
Predicted MS/MS Spectrum - 10V, Negative (Annotated)Predicted LC-MS/MSNot Available
Predicted MS/MS Spectrum - 20V, Negative (Annotated)Predicted LC-MS/MSNot Available
Predicted MS/MS Spectrum - 40V, Negative (Annotated)Predicted LC-MS/MSNot Available
LC-MS/MS Spectrum - LC-ESI-qTof , PositiveLC-MS/MSNot Available
LC-MS/MS Spectrum - LC-ESI-QFT , positiveLC-MS/MSsplash10-01p6-4290000000-d5f33ea098bbcd333ccf
LC-MS/MS Spectrum - LC-ESI-QFT , positiveLC-MS/MSsplash10-000l-9360000000-9f32d7ddbda48f0e2dc5
LC-MS/MS Spectrum - LC-ESI-QFT , positiveLC-MS/MSsplash10-002r-9530000000-5c70a8800c55df1915e7
LC-MS/MS Spectrum - LC-ESI-QFT , positiveLC-MS/MSsplash10-002r-9810000000-89e3b0e2b3cb4d1e9293
LC-MS/MS Spectrum - LC-ESI-QFT , positiveLC-MS/MSsplash10-00n0-5900000000-cbe196964f610f8bf1ff
LC-MS/MS Spectrum - LC-ESI-QFT , positiveLC-MS/MSsplash10-00o9-3900000000-6209d7be74ea608e7fc2
LC-MS/MS Spectrum - LC-ESI-QTOF , positiveLC-MS/MSsplash10-03di-0190000000-32ab0ba382901a73b1c0
LC-MS/MS Spectrum - LC-ESI-QTOF , positiveLC-MS/MSsplash10-002f-1690000000-82416f4c3f338eece150
LC-MS/MS Spectrum - LC-ESI-QTOF , positiveLC-MS/MSsplash10-004i-0920000000-65f7b4135f0db6eee15e
LC-MS/MS Spectrum - LC-ESI-QTOF , positiveLC-MS/MSsplash10-004i-0900000000-17b7474db1209213f689
LC-MS/MS Spectrum - LC-ESI-QTOF , positiveLC-MS/MSsplash10-001i-0900000000-b2c7e131a6a25d115853
MS/MS Spectrum - , positiveLC-MS/MSsplash10-01r6-0970000000-a3b1021cda642a6141b8
LC-MS/MS Spectrum - LC-ESI-QFT , positiveLC-MS/MSsplash10-001i-2900000000-d3dfd1b72d458ffd07d7
LC-MS/MS Spectrum - LC-ESI-QFT , positiveLC-MS/MSsplash10-01p6-4290000000-314f515d08e6730a1df9
LC-MS/MS Spectrum - LC-ESI-QFT , positiveLC-MS/MSsplash10-000l-9360000000-3933ab4d9c2c3918ecce
LC-MS/MS Spectrum - LC-ESI-QFT , positiveLC-MS/MSsplash10-002r-9530000000-65625d68f98ae8f36ea0
LC-MS/MS Spectrum - LC-ESI-QFT , positiveLC-MS/MSsplash10-002r-7910000000-6c3e274b81107c5e98eb


This compound belongs to the class of organic compounds known as aminoquinolines and derivatives. These are organic compounds containing an amino group attached to a quinoline ring system.
Organic compounds
Super Class
Organoheterocyclic compounds
Quinolines and derivatives
Sub Class
Aminoquinolines and derivatives
Direct Parent
Aminoquinolines and derivatives
Alternative Parents
Methoxyanilines / Anisoles / Secondary alkylarylamines / Alkyl aryl ethers / Pyridines and derivatives / Heteroaromatic compounds / Azacyclic compounds / Organopnictogen compounds / Monoalkylamines / Hydrocarbon derivatives
Aminoquinoline / Methoxyaniline / Anisole / Alkyl aryl ether / Secondary aliphatic/aromatic amine / Pyridine / Benzenoid / Heteroaromatic compound / Ether / Azacycle
Molecular Framework
Aromatic heteropolycyclic compounds
External Descriptors
aromatic ether, N-substituted diamine, aminoquinoline (CHEBI:8405)


1. Fe(II)-protoporphyrin IX
Small molecule
Plasmodium falciparum
Pharmacological action
  1. Dorn A, Vippagunta SR, Matile H, Jaquet C, Vennerstrom JL, Ridley RG: An assessment of drug-haematin binding as a mechanism for inhibition of haematin polymerisation by quinoline antimalarials. Biochem Pharmacol. 1998 Mar 15;55(6):727-36. [PubMed:9586944]
  2. Fitch CD: Ferriprotoporphyrin IX, phospholipids, and the antimalarial actions of quinoline drugs. Life Sci. 2004 Mar 5;74(16):1957-72. [PubMed:14967191]
Pharmacological action
General Function
Structural molecule activity
Specific Function
Blocks interferon-dependent interphase and stimulates DNA synthesis in cells. Involved in the translational regulation of the human papillomavirus type 16 E7 mRNA (HPV16 E7).
Gene Name
Uniprot ID
Uniprot Name
Keratin, type II cytoskeletal 7
Molecular Weight
51385.11 Da
  1. Heard CM, Monk BV, Modley AJ: Binding of primaquine to epidermal membranes and keratin. Int J Pharm. 2003 May 12;257(1-2):237-44. [PubMed:12711178]
  2. Basso LG, Rodrigues RZ, Naal RM, Costa-Filho AJ: Effects of the antimalarial drug primaquine on the dynamic structure of lipid model membranes. Biochim Biophys Acta. 2011 Jan;1808(1):55-64. doi: 10.1016/j.bbamem.2010.08.009. Epub 2010 Aug 14. [PubMed:20713019]
Pharmacological action
General Function
Nadph dehydrogenase (quinone) activity
Specific Function
The enzyme apparently serves as a quinone reductase in connection with conjugation reactions of hydroquinones involved in detoxification pathways as well as in biosynthetic processes such as the vi...
Gene Name
Uniprot ID
Uniprot Name
Ribosyldihydronicotinamide dehydrogenase [quinone]
Molecular Weight
25918.4 Da
  1. Graves PR, Kwiek JJ, Fadden P, Ray R, Hardeman K, Coley AM, Foley M, Haystead TA: Discovery of novel targets of quinoline drugs in the human purine binding proteome. Mol Pharmacol. 2002 Dec;62(6):1364-72. [PubMed:12435804]


Pharmacological action
General Function
Vitamin d3 25-hydroxylase activity
Specific Function
Cytochromes P450 are a group of heme-thiolate monooxygenases. In liver microsomes, this enzyme is involved in an NADPH-dependent electron transport pathway. It performs a variety of oxidation react...
Gene Name
Uniprot ID
Uniprot Name
Cytochrome P450 3A4
Molecular Weight
57342.67 Da
  1. Preissner S, Kroll K, Dunkel M, Senger C, Goldsobel G, Kuzman D, Guenther S, Winnenburg R, Schroeder M, Preissner R: SuperCYP: a comprehensive database on Cytochrome P450 enzymes including a tool for analysis of CYP-drug interactions. Nucleic Acids Res. 2010 Jan;38(Database issue):D237-43. doi: 10.1093/nar/gkp970. Epub 2009 Nov 24. [PubMed:19934256]
  2. Zhao XJ, Ishizaki T: Metabolic interactions of selected antimalarial and non-antimalarial drugs with the major pathway (3-hydroxylation) of quinine in human liver microsomes. Br J Clin Pharmacol. 1997 Nov;44(5):505-11. [PubMed:9384469]
  3. Bangchang KN, Karbwang J, Back DJ: Primaquine metabolism by human liver microsomes: effect of other antimalarial drugs. Biochem Pharmacol. 1992 Aug 4;44(3):587-90. [PubMed:1510705]
Pharmacological action
General Function
Oxidoreductase activity, acting on paired donors, with incorporation or reduction of molecular oxygen, reduced flavin or flavoprotein as one donor, and incorporation of one atom of oxygen
Specific Function
Cytochromes P450 are a group of heme-thiolate monooxygenases. In liver microsomes, this enzyme is involved in an NADPH-dependent electron transport pathway. It oxidizes a variety of structurally un...
Gene Name
Uniprot ID
Uniprot Name
Cytochrome P450 1A2
Molecular Weight
58293.76 Da
  1. Preissner S, Kroll K, Dunkel M, Senger C, Goldsobel G, Kuzman D, Guenther S, Winnenburg R, Schroeder M, Preissner R: SuperCYP: a comprehensive database on Cytochrome P450 enzymes including a tool for analysis of CYP-drug interactions. Nucleic Acids Res. 2010 Jan;38(Database issue):D237-43. doi: 10.1093/nar/gkp970. Epub 2009 Nov 24. [PubMed:19934256]
  2. Shoda T, Mitsumori K, Onodera H, Toyoda K, Uneyama C, Takada K, Hirose M: Liver tumor-promoting effect of beta-naphthoflavone, a strong CYP 1A1/2 inducer, and the relationship between CYP 1A1/2 induction and Cx32 decrease in its hepatocarcinogenesis in the rat. Toxicol Pathol. 2000 Jul-Aug;28(4):540-7. doi: 10.1177/019262330002800406. [PubMed:10930040]
  3. Li XQ, Bjorkman A, Andersson TB, Gustafsson LL, Masimirembwa CM: Identification of human cytochrome P(450)s that metabolise anti-parasitic drugs and predictions of in vivo drug hepatic clearance from in vitro data. Eur J Clin Pharmacol. 2003 Sep;59(5-6):429-42. Epub 2003 Aug 12. [PubMed:12920490]
  4. Bapiro TE, Egnell AC, Hasler JA, Masimirembwa CM: Application of higher throughput screening (HTS) inhibition assays to evaluate the interaction of antiparasitic drugs with cytochrome P450s. Drug Metab Dispos. 2001 Jan;29(1):30-5. [PubMed:11124226]
  5. Bapiro TE, Andersson TB, Otter C, Hasler JA, Masimirembwa CM: Cytochrome P450 1A1/2 induction by antiparasitic drugs: dose-dependent increase in ethoxyresorufin O-deethylase activity and mRNA caused by quinine, primaquine and albendazole in HepG2 cells. Eur J Clin Pharmacol. 2002 Nov;58(8):537-42. Epub 2002 Oct 2. [PubMed:12451431]
  6. Krusekopf S, Roots I, Hildebrandt AG, Kleeberg U: Time-dependent transcriptional induction of CYP1A1, CYP1A2 and CYP1B1 mRNAs by H+/K+ -ATPase inhibitors and other xenobiotics. Xenobiotica. 2003 Feb;33(2):107-18. [PubMed:12623754]
Pharmacological action
General Function
Steroid hydroxylase activity
Specific Function
Responsible for the metabolism of many drugs and environmental chemicals that it oxidizes. It is involved in the metabolism of drugs such as antiarrhythmics, adrenoceptor antagonists, and tricyclic...
Gene Name
Uniprot ID
Uniprot Name
Cytochrome P450 2D6
Molecular Weight
55768.94 Da
  1. Preissner S, Kroll K, Dunkel M, Senger C, Goldsobel G, Kuzman D, Guenther S, Winnenburg R, Schroeder M, Preissner R: SuperCYP: a comprehensive database on Cytochrome P450 enzymes including a tool for analysis of CYP-drug interactions. Nucleic Acids Res. 2010 Jan;38(Database issue):D237-43. doi: 10.1093/nar/gkp970. Epub 2009 Nov 24. [PubMed:19934256]
Pharmacological action
General Function
Vitamin d 24-hydroxylase activity
Specific Function
Cytochromes P450 are a group of heme-thiolate monooxygenases. In liver microsomes, this enzyme is involved in an NADPH-dependent electron transport pathway. It oxidizes a variety of structurally un...
Gene Name
Uniprot ID
Uniprot Name
Cytochrome P450 1A1
Molecular Weight
58164.815 Da
  1. Preissner S, Kroll K, Dunkel M, Senger C, Goldsobel G, Kuzman D, Guenther S, Winnenburg R, Schroeder M, Preissner R: SuperCYP: a comprehensive database on Cytochrome P450 enzymes including a tool for analysis of CYP-drug interactions. Nucleic Acids Res. 2010 Jan;38(Database issue):D237-43. doi: 10.1093/nar/gkp970. Epub 2009 Nov 24. [PubMed:19934256]
Pharmacological action
General Function
Oxygen binding
Specific Function
Cytochromes P450 are a group of heme-thiolate monooxygenases. In liver microsomes, this enzyme is involved in an NADPH-dependent electron transport pathway. It oxidizes a variety of structurally un...
Gene Name
Uniprot ID
Uniprot Name
Cytochrome P450 1B1
Molecular Weight
60845.33 Da
  1. Preissner S, Kroll K, Dunkel M, Senger C, Goldsobel G, Kuzman D, Guenther S, Winnenburg R, Schroeder M, Preissner R: SuperCYP: a comprehensive database on Cytochrome P450 enzymes including a tool for analysis of CYP-drug interactions. Nucleic Acids Res. 2010 Jan;38(Database issue):D237-43. doi: 10.1093/nar/gkp970. Epub 2009 Nov 24. [PubMed:19934256]


Pharmacological action
General Function
Xenobiotic-transporting atpase activity
Specific Function
Energy-dependent efflux pump responsible for decreased drug accumulation in multidrug-resistant cells.
Gene Name
Uniprot ID
Uniprot Name
Multidrug resistance protein 1
Molecular Weight
141477.255 Da
  1. Kim JH, Choi AR, Kim YK, Yoon S: Co-treatment with the anti-malarial drugs mefloquine and primaquine highly sensitizes drug-resistant cancer cells by increasing P-gp inhibition. Biochem Biophys Res Commun. 2013 Nov 22;441(3):655-60. doi: 10.1016/j.bbrc.2013.10.095. Epub 2013 Oct 26. [PubMed:24284282]
  2. Choi AR, Kim JH, Woo YH, Kim HS, Yoon S: Anti-malarial Drugs Primaquine and Chloroquine Have Different Sensitization Effects with Anti-mitotic Drugs in Resistant Cancer Cells. Anticancer Res. 2016 Apr;36(4):1641-8. [PubMed:27069141]

Drug created on June 13, 2005 07:24 / Updated on December 09, 2018 01:10