
Accession Number
DB00750  (APRD00180)
Small Molecule

A local anesthetic that is similar pharmacologically to lidocaine. Currently, it is used most often for infiltration anesthesia in dentistry. (From AMA Drug Evaluations Annual, 1992, p165)

  • 2-(Propylamino)-O-propionotoluidide
  • 2-Methyl-alpha-propylaminopropionanilide
  • alpha-N-Propylamino-2-methylpropionanilide
  • N-(2-Methylphenyl)-2-(propylamino)propanamide
  • O-Methyl-2-propylaminopropionanilide
  • O-Methyl-alpha-propylaminopropionanilide
  • Prilocain
  • Prilocaina
  • Prilocaïne
  • Prilocaine base
  • Prilocainum
  • Propitocaine
External IDs
Astra 1512 / L 67
Product Ingredients
IngredientUNIICASInChI Key
Prilocaine HydrochlorideMJW015BAPH 1786-81-8BJPJNTKRKALCPP-UHFFFAOYSA-N
Prescription Products
NameDosageStrengthRouteLabellerMarketing StartMarketing End
4% Citanest Plain DentalSolution40 mgInfiltrationDentsply Pharmaceutical2015-12-23Not applicableCanada
AgonEazeKitTopicalAlvix Laboratories2016-01-12Not applicableUs
Dentsply 4% Prilocaine Hydrochloride Dental InjectionSolution40 mgInfiltrationDentsply Pharmaceutical1964-12-312016-06-03Canada
Generic Prescription Products
NameDosageStrengthRouteLabellerMarketing StartMarketing End
Citanest PlainInjection, solution40 mg/mLDentalDentsply Pharmaceutical1965-11-18Not applicableUs
Prilocaine HydrochlorideInjection, solution40 mg/mLSubcutaneousSeptodont2011-01-01Not applicableUs
International/Other Brands
Citanest (AstraZeneca) / Prilotekal (Goldshield) / Takipril (Meduna) / Xylonest (AstraZeneca)
Mixture Products
NameIngredientsDosageRouteLabellerMarketing StartMarketing End
4% Citanest Forte Dental With Epinephrine 1:200,000Prilocaine Hydrochloride (40 mg) + Epinephrine (5 mcg)LiquidInfiltrationDentsply Pharmaceutical2011-01-18Not applicableCanada
Anodyne LPTPrilocaine + LidocaineKitTopicalFortus Pharma, Llc2017-03-22Not applicableUs
Cadira Compliant Blood StatPrilocaine (25 mg/g) + Lidocaine (25 mg/g)CreamTopicalAsclemed Usa, Inc.2003-08-27Not applicableUs
Citanest FortePrilocaine Hydrochloride (40 mg/mL) + Epinephrine bitartrate (.005 mg/mL)Injection, solutionDentalDentsply Pharmaceutical1965-11-18Not applicableUs
Dentsply 4% Prilocaine and Epinephrine Injection 1:200,000Prilocaine Hydrochloride (40 mg) + Epinephrine (5 mcg)SolutionInfiltrationDentsply Pharmaceutical1968-12-312012-07-19Canada
DermacinRx Cinlone-I CPIPrilocaine + LidocaineKitPure Tek Corporation2016-05-17Not applicableUs
DermacinRx Cinlone-II CPIPrilocaine + LidocaineKitPure Tek Corporation2016-06-24Not applicableUs
DermacinRx EmpricainePrilocaine + LidocaineKitPure Tek Corporation2016-08-02Not applicableUs
DermacinRx PrikaanPrilocaine + LidocaineKitShoreline Pharmaceuticals, Inc.2016-07-01Not applicableUs
DermacinRx PrizopakPrilocaine + LidocaineKitPure Tek Corporation2016-05-19Not applicableUs
CAS number
Average: 220.3107
Monoisotopic: 220.157563272
Chemical Formula
InChI Key



Used as a local anaesthetic and is often used in dentistry.

Structured Indications
Not Available

Prilocaine binds to the intracellular surface of sodium channels which blocks the subsequent influx of sodium into the cell. Action potential propagation and never function is, therefore, prevented. This block is reversible and when the drug diffuses away from the cell, sodium channel function is restored and nerve propagation returns.

Mechanism of action

Prilocaine acts on sodium channels on the neuronal cell membrane, limiting the spread of seizure activity and reducing seizure propagation. The antiarrhythmic actions are mediated through effects on sodium channels in Purkinje fibers.

ASodium channel protein type 5 subunit alpha
Not Available
Volume of distribution
Not Available
Protein binding


Not Available
Route of elimination

Prilocaine is metabolized in both the liver and the kidney and excreted via the kidney.

Half life
Not Available
Not Available
Not Available
Affected organisms
  • Humans and other mammals
Prilocaine Action PathwayDrug action
Pharmacogenomic Effects/ADRs
Interacting Gene/EnzymeAllele nameGenotype(s)Defining Change(s)Type(s)DescriptionDetails
Glucose-6-phosphate 1-dehydrogenaseVilleurbanneNot Available1000_1002delACCADR InferredIncreased risk of Methemoglobinemia.Details
Glucose-6-phosphate 1-dehydrogenaseTorunNot Available1006A->GADR InferredIncreased risk of Methemoglobinemia.Details
Glucose-6-phosphate 1-dehydrogenaseSunderlandNot Available105_107delCATADR InferredIncreased risk of Methemoglobinemia.Details
Glucose-6-phosphate 1-dehydrogenaseIwatsukiNot Available1081G->AADR InferredIncreased risk of Methemoglobinemia.Details
Glucose-6-phosphate 1-dehydrogenaseSerresNot Available1082C->TADR InferredIncreased risk of Methemoglobinemia.Details
Glucose-6-phosphate 1-dehydrogenaseTondelaNot Available1084_1101delCTGAACGAGCGCAAGGCCADR InferredIncreased risk of Methemoglobinemia.Details
Glucose-6-phosphate 1-dehydrogenaseLoma LindaNot Available1089C->AADR InferredIncreased risk of Methemoglobinemia.Details
Glucose-6-phosphate 1-dehydrogenaseAachenNot Available1089C->GADR InferredIncreased risk of Methemoglobinemia.Details
Glucose-6-phosphate 1-dehydrogenaseTenriNot Available1096A->GADR InferredIncreased risk of Methemoglobinemia.Details
Glucose-6-phosphate 1-dehydrogenaseMontpellierNot Available1132G>AADR InferredIncreased risk of Methemoglobinemia.Details
Glucose-6-phosphate 1-dehydrogenaseCalvo MackennaNot Available1138A->GADR InferredIncreased risk of Methemoglobinemia.Details
Glucose-6-phosphate 1-dehydrogenaseRileyNot Available1139T->CADR InferredIncreased risk of Methemoglobinemia.Details
Glucose-6-phosphate 1-dehydrogenaseOlomoucNot Available1141T->CADR InferredIncreased risk of Methemoglobinemia.Details
Glucose-6-phosphate 1-dehydrogenaseTomahNot Available1153T->CADR InferredIncreased risk of Methemoglobinemia.Details
Glucose-6-phosphate 1-dehydrogenaseLynwoodNot Available1154G->TADR InferredIncreased risk of Methemoglobinemia.Details
Glucose-6-phosphate 1-dehydrogenaseMadridNot Available1155C->GADR InferredIncreased risk of Methemoglobinemia.Details
Glucose-6-phosphate 1-dehydrogenaseIowa, Walter Reed, SpringfieldNot Available1156A->GADR InferredIncreased risk of Methemoglobinemia.Details
Glucose-6-phosphate 1-dehydrogenaseBeverly Hills, Genova, Iwate, Niigata, YamaguchiNot Available1160G->AADR InferredIncreased risk of Methemoglobinemia.Details
Glucose-6-phosphate 1-dehydrogenaseHartfordNot Available1162A->GADR InferredIncreased risk of Methemoglobinemia.Details
Glucose-6-phosphate 1-dehydrogenasePrahaNot Available1166A->GADR InferredIncreased risk of Methemoglobinemia.Details
Glucose-6-phosphate 1-dehydrogenaseKrakowNot Available1175T>CADR InferredIncreased risk of Methemoglobinemia.Details
Glucose-6-phosphate 1-dehydrogenaseWisconsinNot Available1177C->GADR InferredIncreased risk of Methemoglobinemia.Details
Glucose-6-phosphate 1-dehydrogenaseNashville, Anaheim, PorticiNot Available1178G->AADR InferredIncreased risk of Methemoglobinemia.Details
Glucose-6-phosphate 1-dehydrogenaseAlhambraNot Available1180G->CADR InferredIncreased risk of Methemoglobinemia.Details
Glucose-6-phosphate 1-dehydrogenaseBariNot Available1187C->TADR InferredIncreased risk of Methemoglobinemia.Details
Glucose-6-phosphate 1-dehydrogenasePuerto LimonNot Available1192G->AADR InferredIncreased risk of Methemoglobinemia.Details
Glucose-6-phosphate 1-dehydrogenaseCovao do LoboNot Available1205C>AADR InferredIncreased risk of Methemoglobinemia.Details
Glucose-6-phosphate 1-dehydrogenaseClinicNot Available1215G->AADR InferredIncreased risk of Methemoglobinemia.Details
Glucose-6-phosphate 1-dehydrogenaseUtrechtNot Available1225C->TADR InferredIncreased risk of Methemoglobinemia.Details
Glucose-6-phosphate 1-dehydrogenaseSuwalkiNot Available1226C->GADR InferredIncreased risk of Methemoglobinemia.Details
Glucose-6-phosphate 1-dehydrogenaseRiversideNot Available1228G->TADR InferredIncreased risk of Methemoglobinemia.Details
Glucose-6-phosphate 1-dehydrogenaseJapan, ShinagawaNot Available1229G->AADR InferredIncreased risk of Methemoglobinemia.Details
Glucose-6-phosphate 1-dehydrogenaseKawasakiNot Available1229G->CADR InferredIncreased risk of Methemoglobinemia.Details
Glucose-6-phosphate 1-dehydrogenaseMunichNot Available1231A->GADR InferredIncreased risk of Methemoglobinemia.Details
Glucose-6-phosphate 1-dehydrogenaseGeorgiaNot Available1284C->AADR InferredIncreased risk of Methemoglobinemia.Details
Glucose-6-phosphate 1-dehydrogenaseSumareNot Available1292T->GADR InferredIncreased risk of Methemoglobinemia.Details
Glucose-6-phosphate 1-dehydrogenaseTelti/KobeNot Available1318C->TADR InferredIncreased risk of Methemoglobinemia.Details
Glucose-6-phosphate 1-dehydrogenaseSantiago de Cuba, MoriokaNot Available1339G->AADR InferredIncreased risk of Methemoglobinemia.Details
Glucose-6-phosphate 1-dehydrogenaseHarimaNot Available1358T->AADR InferredIncreased risk of Methemoglobinemia.Details
Glucose-6-phosphate 1-dehydrogenaseFiguera da FozNot Available1366G->CADR InferredIncreased risk of Methemoglobinemia.Details
Glucose-6-phosphate 1-dehydrogenaseAmiensNot Available1367A>TADR InferredIncreased risk of Methemoglobinemia.Details
Glucose-6-phosphate 1-dehydrogenaseBangkok NoiNot Available1376G->T, 1502T->GADR InferredIncreased risk of Methemoglobinemia.Details
Glucose-6-phosphate 1-dehydrogenaseFukayaNot Available1462G->AADR InferredIncreased risk of Methemoglobinemia.Details
Glucose-6-phosphate 1-dehydrogenaseCampinasNot Available1463G->TADR InferredIncreased risk of Methemoglobinemia.Details
Glucose-6-phosphate 1-dehydrogenaseBuenos AiresNot Available1465C>TADR InferredIncreased risk of Methemoglobinemia.Details
Glucose-6-phosphate 1-dehydrogenaseArakawaNot Available1466C->TADR InferredIncreased risk of Methemoglobinemia.Details
Glucose-6-phosphate 1-dehydrogenaseBrightonNot Available1488_1490delGAAADR InferredIncreased risk of Methemoglobinemia.Details
Glucose-6-phosphate 1-dehydrogenaseKozukataNot Available159G->CADR InferredIncreased risk of Methemoglobinemia.Details
Glucose-6-phosphate 1-dehydrogenaseAmsterdamNot Available180_182delTCTADR InferredIncreased risk of Methemoglobinemia.Details
Glucose-6-phosphate 1-dehydrogenaseNo nameNot Available202G->A, 376A->G, 1264C>GADR InferredIncreased risk of Methemoglobinemia.Details
Glucose-6-phosphate 1-dehydrogenaseSwanseaNot Available224T->CADR InferredIncreased risk of Methemoglobinemia.Details
Glucose-6-phosphate 1-dehydrogenaseUrayasuNot Available281_283delAGAADR InferredIncreased risk of Methemoglobinemia.Details
Glucose-6-phosphate 1-dehydrogenaseVancouverNot Available317C->G544C->T592C->TADR InferredIncreased risk of Methemoglobinemia.Details
Glucose-6-phosphate 1-dehydrogenaseMt SinaiNot Available376A->G, 1159C->TADR InferredIncreased risk of Methemoglobinemia.Details
Glucose-6-phosphate 1-dehydrogenasePlymouthNot Available488G->AADR InferredIncreased risk of Methemoglobinemia.Details
Glucose-6-phosphate 1-dehydrogenaseVolendamNot Available514C->TADR InferredIncreased risk of Methemoglobinemia.Details
Glucose-6-phosphate 1-dehydrogenaseShinshuNot Available527A->GADR InferredIncreased risk of Methemoglobinemia.Details
Glucose-6-phosphate 1-dehydrogenaseChikugoNot Available535A->TADR InferredIncreased risk of Methemoglobinemia.Details
Glucose-6-phosphate 1-dehydrogenaseTsukuiNot Available561_563delCTCADR InferredIncreased risk of Methemoglobinemia.Details
Glucose-6-phosphate 1-dehydrogenasePedoplis-CkaroNot Available573C>GADR InferredIncreased risk of Methemoglobinemia.Details
Glucose-6-phosphate 1-dehydrogenaseSantiagoNot Available593G->CADR InferredIncreased risk of Methemoglobinemia.Details
Glucose-6-phosphate 1-dehydrogenaseMinnesota, Marion, Gastonia, LeJeuneNot Available637G->TADR InferredIncreased risk of Methemoglobinemia.Details
Glucose-6-phosphate 1-dehydrogenaseCincinnatiNot Available637G->T, 1037A->TADR InferredIncreased risk of Methemoglobinemia.Details
Glucose-6-phosphate 1-dehydrogenaseHarilaouNot Available648T->GADR InferredIncreased risk of Methemoglobinemia.Details
Glucose-6-phosphate 1-dehydrogenaseNorth DallasNot Available683_685delACAADR InferredIncreased risk of Methemoglobinemia.Details
Glucose-6-phosphate 1-dehydrogenaseAsahikawaNot Available695G->AADR InferredIncreased risk of Methemoglobinemia.Details
Glucose-6-phosphate 1-dehydrogenaseDurhamNot Available713A->GADR InferredIncreased risk of Methemoglobinemia.Details
Glucose-6-phosphate 1-dehydrogenaseStonybrookNot Available724_729delGGCACTADR InferredIncreased risk of Methemoglobinemia.Details
Glucose-6-phosphate 1-dehydrogenaseWayneNot Available769C->GADR InferredIncreased risk of Methemoglobinemia.Details
Glucose-6-phosphate 1-dehydrogenaseAveiroNot Available806G->AADR InferredIncreased risk of Methemoglobinemia.Details
Glucose-6-phosphate 1-dehydrogenaseCleveland CorumNot Available820G->AADR InferredIncreased risk of Methemoglobinemia.Details
Glucose-6-phosphate 1-dehydrogenaseLilleNot Available821A>TADR InferredIncreased risk of Methemoglobinemia.Details
Glucose-6-phosphate 1-dehydrogenaseBangkokNot Available825G>CADR InferredIncreased risk of Methemoglobinemia.Details
Glucose-6-phosphate 1-dehydrogenaseSugaoNot Available826C->TADR InferredIncreased risk of Methemoglobinemia.Details
Glucose-6-phosphate 1-dehydrogenaseLa JollaNot Available832T->CADR InferredIncreased risk of Methemoglobinemia.Details
Glucose-6-phosphate 1-dehydrogenaseWexhamNot Available833C->TADR InferredIncreased risk of Methemoglobinemia.Details
Glucose-6-phosphate 1-dehydrogenasePiotrkowNot Available851T>CADR InferredIncreased risk of Methemoglobinemia.Details
Glucose-6-phosphate 1-dehydrogenaseWest VirginiaNot Available910G->TADR InferredIncreased risk of Methemoglobinemia.Details
Glucose-6-phosphate 1-dehydrogenaseOmiyaNot Available921G->CADR InferredIncreased risk of Methemoglobinemia.Details
Glucose-6-phosphate 1-dehydrogenaseNaraNot Available953_976delCCACCAAAGGGTACCTGGAC GACCADR InferredIncreased risk of Methemoglobinemia.Details
Glucose-6-phosphate 1-dehydrogenaseManhattanNot Available962G->AADR InferredIncreased risk of Methemoglobinemia.Details
Glucose-6-phosphate 1-dehydrogenaseRehevotNot Available964T->CADR InferredIncreased risk of Methemoglobinemia.Details
Glucose-6-phosphate 1-dehydrogenaseHoniaraNot Available99A->G / 1360C->TADR InferredIncreased risk of Methemoglobinemia.Details
Glucose-6-phosphate 1-dehydrogenaseTokyo, FukushimaNot Available1246G->AADR InferredIncreased risk of Methemoglobinemia.Details
Glucose-6-phosphate 1-dehydrogenaseChathamNot Available1003G->AADR InferredIncreased risk of Methemoglobinemia.Details
Glucose-6-phosphate 1-dehydrogenaseFushanNot Available1004C->AADR InferredIncreased risk of Methemoglobinemia.Details
Glucose-6-phosphate 1-dehydrogenasePartenopeNot Available1052G->TADR InferredIncreased risk of Methemoglobinemia.Details
Glucose-6-phosphate 1-dehydrogenaseIerapetraNot Available1057C->TADR InferredIncreased risk of Methemoglobinemia.Details
Glucose-6-phosphate 1-dehydrogenaseAnadiaNot Available1193A->GADR InferredIncreased risk of Methemoglobinemia.Details
Glucose-6-phosphate 1-dehydrogenaseAbenoNot Available1220A->CADR InferredIncreased risk of Methemoglobinemia.Details
Glucose-6-phosphate 1-dehydrogenaseSurabayaNot Available1291G->AADR InferredIncreased risk of Methemoglobinemia.Details
Glucose-6-phosphate 1-dehydrogenasePawneeNot Available1316G->CADR InferredIncreased risk of Methemoglobinemia.Details
Glucose-6-phosphate 1-dehydrogenaseS. AntiocoNot Available1342A->GADR InferredIncreased risk of Methemoglobinemia.Details
Glucose-6-phosphate 1-dehydrogenaseCassanoNot Available1347G->CADR InferredIncreased risk of Methemoglobinemia.Details
Glucose-6-phosphate 1-dehydrogenaseHermoupolisNot Available1347G->C / 1360C->TADR InferredIncreased risk of Methemoglobinemia.Details
Glucose-6-phosphate 1-dehydrogenaseUnion,Maewo, Chinese-2, KaloNot Available1360C->TADR InferredIncreased risk of Methemoglobinemia.Details
Glucose-6-phosphate 1-dehydrogenaseAndalusNot Available1361G->AADR InferredIncreased risk of Methemoglobinemia.Details
Glucose-6-phosphate 1-dehydrogenaseCosenzaNot Available1376G->CADR InferredIncreased risk of Methemoglobinemia.Details
Glucose-6-phosphate 1-dehydrogenaseCanton, Taiwan- Hakka, Gifu-like, Agrigento-likeNot Available1376G->TADR InferredIncreased risk of Methemoglobinemia.Details
Glucose-6-phosphate 1-dehydrogenaseFloresNot Available1387C->AADR InferredIncreased risk of Methemoglobinemia.Details
Glucose-6-phosphate 1-dehydrogenaseKaiping, Anant, Dhon, Sapporo-like, WoseraNot Available1388G->AADR InferredIncreased risk of Methemoglobinemia.Details
Glucose-6-phosphate 1-dehydrogenaseKamogawaNot Available169C->TADR InferredIncreased risk of Methemoglobinemia.Details
Glucose-6-phosphate 1-dehydrogenaseCostanzoNot Available179T>CADR InferredIncreased risk of Methemoglobinemia.Details
Glucose-6-phosphate 1-dehydrogenaseAmazoniaNot Available185C->AADR InferredIncreased risk of Methemoglobinemia.Details
Glucose-6-phosphate 1-dehydrogenaseSongklanagarindNot Available196T->AADR InferredIncreased risk of Methemoglobinemia.Details
Glucose-6-phosphate 1-dehydrogenaseHechiNot Available202G->A / 871G->AADR InferredIncreased risk of Methemoglobinemia.Details
Glucose-6-phosphate 1-dehydrogenaseNamouruNot Available208T->CADR InferredIncreased risk of Methemoglobinemia.Details
Glucose-6-phosphate 1-dehydrogenaseBao LocNot Available352T>CADR InferredIncreased risk of Methemoglobinemia.Details
Glucose-6-phosphate 1-dehydrogenaseCrispimNot Available375G->T, 379G->T383T->C384C>TADR InferredIncreased risk of Methemoglobinemia.Details
Glucose-6-phosphate 1-dehydrogenaseAcrokorinthosNot Available376A->G / 463C->GADR InferredIncreased risk of Methemoglobinemia.Details
Glucose-6-phosphate 1-dehydrogenaseSanta MariaNot Available376A->G / 542A->TADR InferredIncreased risk of Methemoglobinemia.Details
Glucose-6-phosphate 1-dehydrogenaseAnanindeuaNot Available376A->G / 871G->AADR InferredIncreased risk of Methemoglobinemia.Details
Glucose-6-phosphate 1-dehydrogenaseVanua LavaNot Available383T->CADR InferredIncreased risk of Methemoglobinemia.Details
Glucose-6-phosphate 1-dehydrogenaseValladolidNot Available406C->TADR InferredIncreased risk of Methemoglobinemia.Details
Glucose-6-phosphate 1-dehydrogenaseBelemNot Available409C->TADR InferredIncreased risk of Methemoglobinemia.Details
Glucose-6-phosphate 1-dehydrogenaseLiuzhouNot Available442G->AADR InferredIncreased risk of Methemoglobinemia.Details
Glucose-6-phosphate 1-dehydrogenaseShenzenNot Available473G>AADR InferredIncreased risk of Methemoglobinemia.Details
Glucose-6-phosphate 1-dehydrogenaseTaipei “Chinese- 3”Not Available493A->GADR InferredIncreased risk of Methemoglobinemia.Details
Glucose-6-phosphate 1-dehydrogenaseToledoNot Available496C>TADR InferredIncreased risk of Methemoglobinemia.Details
Glucose-6-phosphate 1-dehydrogenaseNaoneNot Available497G->AADR InferredIncreased risk of Methemoglobinemia.Details
Glucose-6-phosphate 1-dehydrogenaseNankangNot Available517T->CADR InferredIncreased risk of Methemoglobinemia.Details
Glucose-6-phosphate 1-dehydrogenaseMiaoliNot Available519C->GADR InferredIncreased risk of Methemoglobinemia.Details
Glucose-6-phosphate 1-dehydrogenaseMediterranean, Dallas, Panama‚ Sassari, Cagliari, BirminghamNot Available563C->TADR InferredIncreased risk of Methemoglobinemia.Details
Glucose-6-phosphate 1-dehydrogenaseCoimbra ShundeNot Available592C->TADR InferredIncreased risk of Methemoglobinemia.Details
Glucose-6-phosphate 1-dehydrogenaseNilgiriNot Available593G>AADR InferredIncreased risk of Methemoglobinemia.Details
Glucose-6-phosphate 1-dehydrogenaseRadlowoNot Available679C->TADR InferredIncreased risk of Methemoglobinemia.Details
Glucose-6-phosphate 1-dehydrogenaseRoubaixNot Available811G>CADR InferredIncreased risk of Methemoglobinemia.Details
Glucose-6-phosphate 1-dehydrogenaseHaikouNot Available835A->GADR InferredIncreased risk of Methemoglobinemia.Details
Glucose-6-phosphate 1-dehydrogenaseChinese-1Not Available835A->TADR InferredIncreased risk of Methemoglobinemia.Details
Glucose-6-phosphate 1-dehydrogenaseMizushimaNot Available848A>GADR InferredIncreased risk of Methemoglobinemia.Details
Glucose-6-phosphate 1-dehydrogenaseOsakaNot Available853C->TADR InferredIncreased risk of Methemoglobinemia.Details
Glucose-6-phosphate 1-dehydrogenaseViangchan, JammuNot Available871G->AADR InferredIncreased risk of Methemoglobinemia.Details
Glucose-6-phosphate 1-dehydrogenaseSeoulNot Available916G->AADR InferredIncreased risk of Methemoglobinemia.Details
Glucose-6-phosphate 1-dehydrogenaseLudhianaNot Available929G->AADR InferredIncreased risk of Methemoglobinemia.Details
Glucose-6-phosphate 1-dehydrogenaseFarroupilhaNot Available977C->AADR InferredIncreased risk of Methemoglobinemia.Details
Glucose-6-phosphate 1-dehydrogenaseChinese-5Not Available1024C->TADR InferredIncreased risk of Methemoglobinemia.Details
Glucose-6-phosphate 1-dehydrogenaseRignanoNot Available130G>AADR InferredIncreased risk of Methemoglobinemia.Details
Glucose-6-phosphate 1-dehydrogenaseOrissaNot Available131C->GADR InferredIncreased risk of Methemoglobinemia.Details
Glucose-6-phosphate 1-dehydrogenaseG6PDNiceNot Available1380G>CADR InferredIncreased risk of Methemoglobinemia.Details
Glucose-6-phosphate 1-dehydrogenaseKamiube, KeelungNot Available1387C->TADR InferredIncreased risk of Methemoglobinemia.Details
Glucose-6-phosphate 1-dehydrogenaseNeapolisNot Available1400C->GADR InferredIncreased risk of Methemoglobinemia.Details
Glucose-6-phosphate 1-dehydrogenaseAuresNot Available143T->CADR InferredIncreased risk of Methemoglobinemia.Details
Glucose-6-phosphate 1-dehydrogenaseSplitNot Available1442C->GADR InferredIncreased risk of Methemoglobinemia.Details
Glucose-6-phosphate 1-dehydrogenaseKambosNot Available148C->TADR InferredIncreased risk of Methemoglobinemia.Details
Glucose-6-phosphate 1-dehydrogenasePalestrinaNot Available170G>AADR InferredIncreased risk of Methemoglobinemia.Details
Glucose-6-phosphate 1-dehydrogenaseMetapontoNot Available172G->AADR InferredIncreased risk of Methemoglobinemia.Details
Glucose-6-phosphate 1-dehydrogenaseMusashinoNot Available185C->TADR InferredIncreased risk of Methemoglobinemia.Details
Glucose-6-phosphate 1-dehydrogenaseAsahiNot Available202G->AADR InferredIncreased risk of Methemoglobinemia.Details
Glucose-6-phosphate 1-dehydrogenaseA- (202), Ferrara INot Available202G->A / 376A->GADR InferredIncreased risk of Methemoglobinemia.Details
Glucose-6-phosphate 1-dehydrogenaseMurcia OristanoNot Available209A->GADR InferredIncreased risk of Methemoglobinemia.Details
Glucose-6-phosphate 1-dehydrogenaseUbe KonanNot Available241C->TADR InferredIncreased risk of Methemoglobinemia.Details
Glucose-6-phosphate 1-dehydrogenaseLagosantoNot Available242G->AADR InferredIncreased risk of Methemoglobinemia.Details
Glucose-6-phosphate 1-dehydrogenaseGuangzhouNot Available274C->TADR InferredIncreased risk of Methemoglobinemia.Details
Glucose-6-phosphate 1-dehydrogenaseHammersmithNot Available323T->AADR InferredIncreased risk of Methemoglobinemia.Details
Glucose-6-phosphate 1-dehydrogenaseSinnaiNot Available34G->TADR InferredIncreased risk of Methemoglobinemia.Details
Glucose-6-phosphate 1-dehydrogenaseA- (680)Not Available376A->G / 680G->TADR InferredIncreased risk of Methemoglobinemia.Details
Glucose-6-phosphate 1-dehydrogenaseA- (968), Betica,Selma, GuantanamoNot Available376A->G / 968T->CADR InferredIncreased risk of Methemoglobinemia.Details
Glucose-6-phosphate 1-dehydrogenaseSalerno PyrgosNot Available383T>GADR InferredIncreased risk of Methemoglobinemia.Details
Glucose-6-phosphate 1-dehydrogenaseQuing YanNot Available392G->TADR InferredIncreased risk of Methemoglobinemia.Details
Glucose-6-phosphate 1-dehydrogenaseLagesNot Available40G->AADR InferredIncreased risk of Methemoglobinemia.Details
Glucose-6-phosphate 1-dehydrogenaseIleshaNot Available466G->AADR InferredIncreased risk of Methemoglobinemia.Details
Glucose-6-phosphate 1-dehydrogenaseMahidolNot Available487G->AADR InferredIncreased risk of Methemoglobinemia.Details
Glucose-6-phosphate 1-dehydrogenaseMalagaNot Available542A->TADR InferredIncreased risk of Methemoglobinemia.Details
Glucose-6-phosphate 1-dehydrogenaseSibariNot Available634A->GADR InferredIncreased risk of Methemoglobinemia.Details
Glucose-6-phosphate 1-dehydrogenaseMexico CityNot Available680G->AADR InferredIncreased risk of Methemoglobinemia.Details
Glucose-6-phosphate 1-dehydrogenaseNanningNot Available703C->TADR InferredIncreased risk of Methemoglobinemia.Details
Glucose-6-phosphate 1-dehydrogenaseSeattle, Lodi, Modena, Ferrara II, Athens-likeNot Available844G->CADR InferredIncreased risk of Methemoglobinemia.Details
Glucose-6-phosphate 1-dehydrogenaseBajo MaumereNot Available844G->TADR InferredIncreased risk of Methemoglobinemia.Details
Glucose-6-phosphate 1-dehydrogenaseMontalbanoNot Available854G->AADR InferredIncreased risk of Methemoglobinemia.Details
Glucose-6-phosphate 1-dehydrogenaseKalyan-Kerala, Jamnaga, RohiniNot Available949G->AADR InferredIncreased risk of Methemoglobinemia.Details
Glucose-6-phosphate 1-dehydrogenaseGaoheNot Available95A->GADR InferredIncreased risk of Methemoglobinemia.Details
NADH-cytochrome b5 reductase 3---Not AvailableExon 2 c.129C>A / Exon 2 c.149G>A  … show all ADR InferredIncreased risk of Methemoglobinemia.Details


Drug Interactions
DrugInteractionDrug group
7-NitroindazoleThe risk or severity of adverse effects can be increased when Prilocaine is combined with 7-Nitroindazole.Experimental
AcepromazineThe risk or severity of adverse effects can be increased when Prilocaine is combined with Acepromazine.Approved, Vet Approved
AceprometazineThe risk or severity of adverse effects can be increased when Prilocaine is combined with Aceprometazine.Approved
AcetaminophenThe risk or severity of adverse effects can be increased when Acetaminophen is combined with Prilocaine.Approved
AdipiplonThe risk or severity of adverse effects can be increased when Prilocaine is combined with Adipiplon.Investigational
AgomelatineThe risk or severity of adverse effects can be increased when Prilocaine is combined with Agomelatine.Approved, Investigational
AlaproclateThe risk or severity of adverse effects can be increased when Prilocaine is combined with Alaproclate.Experimental
AlfaxaloneThe risk or severity of adverse effects can be increased when Prilocaine is combined with Alfaxalone.Vet Approved
AlfentanilThe risk or severity of adverse effects can be increased when Alfentanil is combined with Prilocaine.Approved, Illicit
AllopregnanoloneThe risk or severity of adverse effects can be increased when Prilocaine is combined with Allopregnanolone.Investigational
AlphacetylmethadolThe risk or severity of adverse effects can be increased when Prilocaine is combined with Alphacetylmethadol.Experimental, Illicit
AlphaprodineThe risk or severity of adverse effects can be increased when Prilocaine is combined with Alphaprodine.Illicit
AlprazolamThe risk or severity of adverse effects can be increased when Alprazolam is combined with Prilocaine.Approved, Illicit, Investigational
AmisulprideThe risk or severity of adverse effects can be increased when Prilocaine is combined with Amisulpride.Approved, Investigational
AmitriptylineThe risk or severity of adverse effects can be increased when Prilocaine is combined with Amitriptyline.Approved
AmobarbitalThe risk or severity of adverse effects can be increased when Amobarbital is combined with Prilocaine.Approved, Illicit
AmoxapineThe risk or severity of adverse effects can be increased when Prilocaine is combined with Amoxapine.Approved
AmperozideThe risk or severity of adverse effects can be increased when Prilocaine is combined with Amperozide.Experimental
Amyl NitriteThe risk or severity of adverse effects can be increased when Amyl Nitrite is combined with Prilocaine.Approved
AntipyrineThe risk or severity of adverse effects can be increased when Antipyrine is combined with Prilocaine.Approved
AripiprazoleThe risk or severity of adverse effects can be increased when Aripiprazole is combined with Prilocaine.Approved, Investigational
ArticaineThe risk or severity of adverse effects can be increased when Prilocaine is combined with Articaine.Approved
AsenapineThe risk or severity of adverse effects can be increased when Asenapine is combined with Prilocaine.Approved
AzaperoneThe risk or severity of adverse effects can be increased when Prilocaine is combined with Azaperone.Vet Approved
AzelastinePrilocaine may increase the central nervous system depressant (CNS depressant) activities of Azelastine.Approved
BaclofenThe risk or severity of adverse effects can be increased when Prilocaine is combined with Baclofen.Approved
BarbitalThe risk or severity of adverse effects can be increased when Prilocaine is combined with Barbital.Illicit
BenperidolThe risk or severity of adverse effects can be increased when Prilocaine is combined with Benperidol.Investigational
BenzocaineThe risk or severity of adverse effects can be increased when Benzocaine is combined with Prilocaine.Approved
Benzyl alcoholThe risk or severity of adverse effects can be increased when Prilocaine is combined with Benzyl alcohol.Approved
BrexpiprazoleThe risk or severity of adverse effects can be increased when Prilocaine is combined with Brexpiprazole.Approved
BrimonidineBrimonidine may increase the central nervous system depressant (CNS depressant) activities of Prilocaine.Approved
BromazepamThe risk or severity of adverse effects can be increased when Bromazepam is combined with Prilocaine.Approved, Illicit
BromisovalThe risk or severity of adverse effects can be increased when Prilocaine is combined with Bromisoval.Experimental
BromperidolThe risk or severity of adverse effects can be increased when Prilocaine is combined with Bromperidol.Investigational
BrompheniramineThe risk or severity of adverse effects can be increased when Prilocaine is combined with Brompheniramine.Approved
BrotizolamThe risk or severity of adverse effects can be increased when Prilocaine is combined with Brotizolam.Approved, Withdrawn
BupivacaineThe risk or severity of adverse effects can be increased when Bupivacaine is combined with Prilocaine.Approved, Investigational
BuprenorphinePrilocaine may increase the central nervous system depressant (CNS depressant) activities of Buprenorphine.Approved, Illicit, Investigational, Vet Approved
BuspironeThe risk or severity of adverse effects can be increased when Buspirone is combined with Prilocaine.Approved, Investigational
ButabarbitalThe risk or severity of adverse effects can be increased when Butabarbital is combined with Prilocaine.Approved, Illicit
ButacaineThe risk or severity of adverse effects can be increased when Prilocaine is combined with Butacaine.Vet Approved
ButalbitalThe risk or severity of adverse effects can be increased when Butalbital is combined with Prilocaine.Approved, Illicit
ButambenThe risk or severity of adverse effects can be increased when Prilocaine is combined with Butamben.Approved
ButethalThe risk or severity of adverse effects can be increased when Prilocaine is combined with Butethal.Approved, Illicit
ButorphanolThe risk or severity of adverse effects can be increased when Butorphanol is combined with Prilocaine.Approved, Illicit, Vet Approved
CanertinibThe risk or severity of adverse effects can be increased when Prilocaine is combined with Canertinib.Investigational
CarbamazepineThe risk or severity of adverse effects can be increased when Carbamazepine is combined with Prilocaine.Approved, Investigational
CarbinoxamineThe risk or severity of adverse effects can be increased when Prilocaine is combined with Carbinoxamine.Approved
CarfentanilThe risk or severity of adverse effects can be increased when Prilocaine is combined with Carfentanil.Illicit, Vet Approved
CarisoprodolThe risk or severity of adverse effects can be increased when Prilocaine is combined with Carisoprodol.Approved
CelecoxibThe risk or severity of adverse effects can be increased when Celecoxib is combined with Prilocaine.Approved, Investigational
CetirizineThe risk or severity of adverse effects can be increased when Prilocaine is combined with Cetirizine.Approved
Chloral hydrateThe risk or severity of adverse effects can be increased when Prilocaine is combined with Chloral hydrate.Approved, Illicit, Vet Approved
ChlordiazepoxideThe risk or severity of adverse effects can be increased when Chlordiazepoxide is combined with Prilocaine.Approved, Illicit
ChlormezanoneThe risk or severity of adverse effects can be increased when Prilocaine is combined with Chlormezanone.Approved, Withdrawn
ChloroprocaineThe risk or severity of adverse effects can be increased when Prilocaine is combined with Chloroprocaine.Approved
ChloroquineThe risk or severity of adverse effects can be increased when Chloroquine is combined with Prilocaine.Approved, Vet Approved
ChlorphenamineThe risk or severity of adverse effects can be increased when Prilocaine is combined with Chlorphenamine.Approved
ChlorpromazineThe risk or severity of adverse effects can be increased when Chlorpromazine is combined with Prilocaine.Approved, Vet Approved
ChlorprothixeneThe risk or severity of adverse effects can be increased when Prilocaine is combined with Chlorprothixene.Approved, Withdrawn
ChlorzoxazoneThe risk or severity of adverse effects can be increased when Prilocaine is combined with Chlorzoxazone.Approved
CinchocaineThe risk or severity of adverse effects can be increased when Cinchocaine is combined with Prilocaine.Approved, Vet Approved
CitalopramThe risk or severity of adverse effects can be increased when Prilocaine is combined with Citalopram.Approved
ClemastineThe risk or severity of adverse effects can be increased when Prilocaine is combined with Clemastine.Approved
ClidiniumThe risk or severity of adverse effects can be increased when Prilocaine is combined with Clidinium.Approved
ClobazamThe risk or severity of adverse effects can be increased when Prilocaine is combined with Clobazam.Approved, Illicit
clomethiazoleThe risk or severity of adverse effects can be increased when Prilocaine is combined with clomethiazole.Investigational
ClomipramineThe risk or severity of adverse effects can be increased when Prilocaine is combined with Clomipramine.Approved, Vet Approved
ClonazepamThe risk or severity of adverse effects can be increased when Prilocaine is combined with Clonazepam.Approved, Illicit
ClonidineThe risk or severity of adverse effects can be increased when Prilocaine is combined with Clonidine.Approved
ClopenthixolThe risk or severity of adverse effects can be increased when Prilocaine is combined with Clopenthixol.Experimental
ClorazepateThe risk or severity of adverse effects can be increased when Clorazepate is combined with Prilocaine.Approved, Illicit
ClothiapineThe risk or severity of adverse effects can be increased when Prilocaine is combined with Clothiapine.Experimental
ClozapineThe risk or severity of adverse effects can be increased when Clozapine is combined with Prilocaine.Approved
CocaineThe risk or severity of adverse effects can be increased when Prilocaine is combined with Cocaine.Approved, Illicit
CodeineThe risk or severity of adverse effects can be increased when Codeine is combined with Prilocaine.Approved, Illicit
CyclizineThe risk or severity of adverse effects can be increased when Prilocaine is combined with Cyclizine.Approved
CyclobenzaprineThe risk or severity of adverse effects can be increased when Cyclobenzaprine is combined with Prilocaine.Approved
CyproheptadineThe risk or severity of adverse effects can be increased when Prilocaine is combined with Cyproheptadine.Approved
DantroleneThe risk or severity of adverse effects can be increased when Prilocaine is combined with Dantrolene.Approved
DapiprazoleThe risk or severity of adverse effects can be increased when Dapiprazole is combined with Prilocaine.Approved
DapoxetineThe risk or severity of adverse effects can be increased when Prilocaine is combined with Dapoxetine.Investigational
DapsoneThe risk or severity of adverse effects can be increased when Dapsone is combined with Prilocaine.Approved, Investigational
DeramciclaneThe risk or severity of adverse effects can be increased when Prilocaine is combined with Deramciclane.Investigational
DesfluraneThe risk or severity of adverse effects can be increased when Desflurane is combined with Prilocaine.Approved
DesipramineThe risk or severity of adverse effects can be increased when Prilocaine is combined with Desipramine.Approved
DesloratadineThe risk or severity of adverse effects can be increased when Prilocaine is combined with Desloratadine.Approved, Investigational
DesvenlafaxineThe risk or severity of adverse effects can be increased when Prilocaine is combined with Desvenlafaxine.Approved
DetomidineThe risk or severity of adverse effects can be increased when Prilocaine is combined with Detomidine.Vet Approved
DexbrompheniramineThe risk or severity of adverse effects can be increased when Prilocaine is combined with Dexbrompheniramine.Approved
DexmedetomidineThe risk or severity of adverse effects can be increased when Dexmedetomidine is combined with Prilocaine.Approved, Vet Approved
DextromoramideThe risk or severity of adverse effects can be increased when Prilocaine is combined with Dextromoramide.Experimental, Illicit
DextropropoxypheneThe risk or severity of adverse effects can be increased when Dextropropoxyphene is combined with Prilocaine.Approved, Illicit, Withdrawn
DezocineThe risk or severity of adverse effects can be increased when Prilocaine is combined with Dezocine.Approved
DiazepamThe risk or severity of adverse effects can be increased when Diazepam is combined with Prilocaine.Approved, Illicit, Vet Approved
Diethyl etherThe risk or severity of adverse effects can be increased when Prilocaine is combined with Diethyl ether.Experimental
DifenoxinThe risk or severity of adverse effects can be increased when Prilocaine is combined with Difenoxin.Approved, Illicit
DihydrocodeineThe risk or severity of adverse effects can be increased when Dihydrocodeine is combined with Prilocaine.Approved, Illicit
DihydroetorphineThe risk or severity of adverse effects can be increased when Prilocaine is combined with Dihydroetorphine.Experimental, Illicit
DihydromorphineThe risk or severity of adverse effects can be increased when Prilocaine is combined with Dihydromorphine.Experimental, Illicit
DimenhydrinateThe risk or severity of adverse effects can be increased when Prilocaine is combined with Dimenhydrinate.Approved
DiphenhydramineThe risk or severity of adverse effects can be increased when Diphenhydramine is combined with Prilocaine.Approved
DiphenoxylateThe risk or severity of adverse effects can be increased when Diphenoxylate is combined with Prilocaine.Approved, Illicit
DixyrazineThe risk or severity of adverse effects can be increased when Prilocaine is combined with Dixyrazine.Experimental
DoramectinThe risk or severity of adverse effects can be increased when Prilocaine is combined with Doramectin.Vet Approved
DoxepinThe risk or severity of adverse effects can be increased when Prilocaine is combined with Doxepin.Approved
DoxylamineDoxylamine may increase the central nervous system depressant (CNS depressant) activities of Prilocaine.Approved, Vet Approved
DPDPEThe risk or severity of adverse effects can be increased when Prilocaine is combined with DPDPE.Investigational
DronabinolDronabinol may increase the central nervous system depressant (CNS depressant) activities of Prilocaine.Approved, Illicit
DroperidolDroperidol may increase the central nervous system depressant (CNS depressant) activities of Prilocaine.Approved, Vet Approved
DrotebanolThe risk or severity of adverse effects can be increased when Prilocaine is combined with Drotebanol.Experimental, Illicit
DuloxetineThe risk or severity of adverse effects can be increased when Prilocaine is combined with Duloxetine.Approved
DyclonineThe risk or severity of adverse effects can be increased when Dyclonine is combined with Prilocaine.Approved
EcgonineThe risk or severity of adverse effects can be increased when Prilocaine is combined with Ecgonine.Experimental, Illicit
EcopipamThe risk or severity of adverse effects can be increased when Prilocaine is combined with Ecopipam.Investigational
EfavirenzThe risk or severity of adverse effects can be increased when Prilocaine is combined with Efavirenz.Approved, Investigational
EltanoloneThe risk or severity of adverse effects can be increased when Prilocaine is combined with Eltanolone.Investigational
EnfluraneThe risk or severity of adverse effects can be increased when Enflurane is combined with Prilocaine.Approved, Vet Approved
EntacaponeThe risk or severity of adverse effects can be increased when Prilocaine is combined with Entacapone.Approved, Investigational
EscitalopramThe risk or severity of adverse effects can be increased when Prilocaine is combined with Escitalopram.Approved, Investigational
EstazolamThe risk or severity of adverse effects can be increased when Estazolam is combined with Prilocaine.Approved, Illicit
EszopicloneThe risk or severity of adverse effects can be increased when Eszopiclone is combined with Prilocaine.Approved
EthanolPrilocaine may increase the central nervous system depressant (CNS depressant) activities of Ethanol.Approved
EthchlorvynolThe risk or severity of adverse effects can be increased when Ethchlorvynol is combined with Prilocaine.Approved, Illicit, Withdrawn
EthosuximideThe risk or severity of adverse effects can be increased when Prilocaine is combined with Ethosuximide.Approved
EthotoinThe risk or severity of adverse effects can be increased when Prilocaine is combined with Ethotoin.Approved
Ethyl carbamateThe risk or severity of adverse effects can be increased when Prilocaine is combined with Ethyl carbamate.Withdrawn
Ethyl chlorideThe risk or severity of adverse effects can be increased when Prilocaine is combined with Ethyl chloride.Experimental
Ethyl loflazepateThe risk or severity of adverse effects can be increased when Prilocaine is combined with Ethyl loflazepate.Approved, Illicit
EthylmorphineThe risk or severity of adverse effects can be increased when Prilocaine is combined with Ethylmorphine.Approved, Illicit
EtidocaineThe risk or severity of adverse effects can be increased when Prilocaine is combined with Etidocaine.Approved
EtifoxineThe risk or severity of adverse effects can be increased when Prilocaine is combined with Etifoxine.Withdrawn
EtizolamThe risk or severity of adverse effects can be increased when Prilocaine is combined with Etizolam.Approved
EtomidateThe risk or severity of adverse effects can be increased when Etomidate is combined with Prilocaine.Approved
EtoperidoneThe risk or severity of adverse effects can be increased when Prilocaine is combined with Etoperidone.Approved
EtorphineThe risk or severity of adverse effects can be increased when Prilocaine is combined with Etorphine.Illicit, Vet Approved
EzogabineThe risk or severity of adverse effects can be increased when Prilocaine is combined with Ezogabine.Approved
FelbamateThe risk or severity of adverse effects can be increased when Prilocaine is combined with Felbamate.Approved
FencamfamineThe risk or severity of adverse effects can be increased when Prilocaine is combined with Fencamfamine.Approved, Illicit, Withdrawn
FentanylThe risk or severity of adverse effects can be increased when Fentanyl is combined with Prilocaine.Approved, Illicit, Investigational, Vet Approved
FexofenadineThe risk or severity of adverse effects can be increased when Prilocaine is combined with Fexofenadine.Approved
FlibanserinThe risk or severity of adverse effects can be increased when Prilocaine is combined with Flibanserin.Approved
FluanisoneThe risk or severity of adverse effects can be increased when Prilocaine is combined with Fluanisone.Experimental
FludiazepamThe risk or severity of adverse effects can be increased when Prilocaine is combined with Fludiazepam.Approved, Illicit
FlunarizineThe risk or severity of adverse effects can be increased when Prilocaine is combined with Flunarizine.Approved
FlunitrazepamThe risk or severity of adverse effects can be increased when Prilocaine is combined with Flunitrazepam.Approved, Illicit
FluoxetineThe risk or severity of adverse effects can be increased when Prilocaine is combined with Fluoxetine.Approved, Vet Approved
FlupentixolThe risk or severity of adverse effects can be increased when Flupentixol is combined with Prilocaine.Approved, Withdrawn
FluphenazineThe risk or severity of adverse effects can be increased when Fluphenazine is combined with Prilocaine.Approved
FlurazepamThe risk or severity of adverse effects can be increased when Flurazepam is combined with Prilocaine.Approved, Illicit
FluspirileneThe risk or severity of adverse effects can be increased when Prilocaine is combined with Fluspirilene.Approved
FlutamideThe risk or severity of adverse effects can be increased when Flutamide is combined with Prilocaine.Approved
Fluticasone propionateThe risk or severity of adverse effects can be increased when Prilocaine is combined with Fluticasone propionate.Approved
FluvoxamineThe risk or severity of adverse effects can be increased when Fluvoxamine is combined with Prilocaine.Approved, Investigational
FosphenytoinThe risk or severity of adverse effects can be increased when Prilocaine is combined with Fosphenytoin.Approved
FospropofolThe risk or severity of adverse effects can be increased when Prilocaine is combined with Fospropofol.Approved, Illicit
GabapentinThe risk or severity of adverse effects can be increased when Gabapentin is combined with Prilocaine.Approved, Investigational
Gabapentin EnacarbilThe risk or severity of adverse effects can be increased when Prilocaine is combined with Gabapentin Enacarbil.Approved
Gamma Hydroxybutyric AcidThe risk or severity of adverse effects can be increased when Gamma Hydroxybutyric Acid is combined with Prilocaine.Approved, Illicit
GepironeThe risk or severity of adverse effects can be increased when Prilocaine is combined with Gepirone.Investigational
GlutethimideThe risk or severity of adverse effects can be increased when Prilocaine is combined with Glutethimide.Approved, Illicit
GuanfacineThe risk or severity of adverse effects can be increased when Prilocaine is combined with Guanfacine.Approved, Investigational
HalazepamThe risk or severity of adverse effects can be increased when Prilocaine is combined with Halazepam.Approved, Illicit, Withdrawn
HaloperidolThe risk or severity of adverse effects can be increased when Haloperidol is combined with Prilocaine.Approved
HalothaneThe risk or severity of adverse effects can be increased when Prilocaine is combined with Halothane.Approved, Vet Approved
HeroinThe risk or severity of adverse effects can be increased when Prilocaine is combined with Heroin.Approved, Illicit
HexobarbitalThe risk or severity of adverse effects can be increased when Prilocaine is combined with Hexobarbital.Approved
HyaluronidaseThe risk or severity of adverse effects can be increased when Hyaluronidase is combined with Prilocaine.Approved, Investigational
HydrocodonePrilocaine may increase the central nervous system depressant (CNS depressant) activities of Hydrocodone.Approved, Illicit
HydromorphoneThe risk or severity of adverse effects can be increased when Hydromorphone is combined with Prilocaine.Approved, Illicit
HydroxyzineHydroxyzine may increase the central nervous system depressant (CNS depressant) activities of Prilocaine.Approved
IloperidoneThe risk or severity of adverse effects can be increased when Prilocaine is combined with Iloperidone.Approved
ImipramineThe risk or severity of adverse effects can be increased when Prilocaine is combined with Imipramine.Approved
IndalpineThe risk or severity of adverse effects can be increased when Prilocaine is combined with Indalpine.Investigational, Withdrawn
IndiplonThe risk or severity of adverse effects can be increased when Prilocaine is combined with Indiplon.Investigational
IsofluraneThe risk or severity of adverse effects can be increased when Isoflurane is combined with Prilocaine.Approved, Vet Approved
IsomethepteneThe risk or severity of adverse effects can be increased when Isometheptene is combined with Prilocaine.Approved
Isosorbide DinitrateThe risk or severity of adverse effects can be increased when Isosorbide Dinitrate is combined with Prilocaine.Approved
Isosorbide MononitrateThe risk or severity of adverse effects can be increased when Isosorbide Mononitrate is combined with Prilocaine.Approved
KetamineThe risk or severity of adverse effects can be increased when Ketamine is combined with Prilocaine.Approved, Vet Approved
KetazolamThe risk or severity of adverse effects can be increased when Prilocaine is combined with Ketazolam.Approved
KetobemidoneThe risk or severity of adverse effects can be increased when Prilocaine is combined with Ketobemidone.Approved
LamotrigineThe risk or severity of adverse effects can be increased when Prilocaine is combined with Lamotrigine.Approved, Investigational
LevetiracetamThe risk or severity of adverse effects can be increased when Prilocaine is combined with Levetiracetam.Approved, Investigational
LevobupivacaineThe risk or severity of adverse effects can be increased when Prilocaine is combined with Levobupivacaine.Approved
LevocabastineThe risk or severity of adverse effects can be increased when Prilocaine is combined with Levocabastine.Approved
LevocetirizineThe risk or severity of adverse effects can be increased when Prilocaine is combined with Levocetirizine.Approved
LevodopaThe risk or severity of adverse effects can be increased when Prilocaine is combined with Levodopa.Approved
Levomethadyl AcetateThe risk or severity of adverse effects can be increased when Prilocaine is combined with Levomethadyl Acetate.Approved
LevomilnacipranThe risk or severity of adverse effects can be increased when Prilocaine is combined with Levomilnacipran.Approved
LevorphanolThe risk or severity of adverse effects can be increased when Levorphanol is combined with Prilocaine.Approved
LidocaineThe risk or severity of adverse effects can be increased when Lidocaine is combined with Prilocaine.Approved, Vet Approved
LithiumThe risk or severity of adverse effects can be increased when Prilocaine is combined with Lithium.Approved
LofentanilThe risk or severity of adverse effects can be increased when Prilocaine is combined with Lofentanil.Illicit
LoprazolamThe risk or severity of adverse effects can be increased when Prilocaine is combined with Loprazolam.Experimental
LoratadineThe risk or severity of adverse effects can be increased when Prilocaine is combined with Loratadine.Approved
LorazepamThe risk or severity of adverse effects can be increased when Lorazepam is combined with Prilocaine.Approved
LormetazepamThe risk or severity of adverse effects can be increased when Prilocaine is combined with Lormetazepam.Approved
LoxapineThe risk or severity of adverse effects can be increased when Loxapine is combined with Prilocaine.Approved
LurasidoneThe risk or severity of adverse effects can be increased when Lurasidone is combined with Prilocaine.Approved
MafenideThe risk or severity of adverse effects can be increased when Mafenide is combined with Prilocaine.Approved, Vet Approved
Magnesium SulfateMagnesium Sulfate may increase the central nervous system depressant (CNS depressant) activities of Prilocaine.Approved, Vet Approved
MaprotilineThe risk or severity of adverse effects can be increased when Prilocaine is combined with Maprotiline.Approved
MebicarThe risk or severity of adverse effects can be increased when Prilocaine is combined with Mebicar.Experimental
MeclizineThe risk or severity of adverse effects can be increased when Prilocaine is combined with Meclizine.Approved
MedazepamThe risk or severity of adverse effects can be increased when Prilocaine is combined with Medazepam.Experimental
MedetomidineThe risk or severity of adverse effects can be increased when Prilocaine is combined with Medetomidine.Vet Approved
MelatoninThe risk or severity of adverse effects can be increased when Prilocaine is combined with Melatonin.Approved, Nutraceutical, Vet Approved
MelperoneThe risk or severity of adverse effects can be increased when Prilocaine is combined with Melperone.Approved
MepivacaineThe risk or severity of adverse effects can be increased when Prilocaine is combined with Mepivacaine.Approved, Vet Approved
MeprobamateThe risk or severity of adverse effects can be increased when Meprobamate is combined with Prilocaine.Approved, Illicit
MeptazinolThe risk or severity of adverse effects can be increased when Prilocaine is combined with Meptazinol.Experimental
MesoridazineThe risk or severity of adverse effects can be increased when Prilocaine is combined with Mesoridazine.Approved
MetaxaloneThe risk or severity of adverse effects can be increased when Prilocaine is combined with Metaxalone.Approved
MethadoneThe risk or severity of adverse effects can be increased when Methadone is combined with Prilocaine.Approved
Methadyl AcetateThe risk or severity of adverse effects can be increased when Prilocaine is combined with Methadyl Acetate.Approved, Illicit
MethapyrileneThe risk or severity of adverse effects can be increased when Prilocaine is combined with Methapyrilene.Withdrawn
MethaqualoneThe risk or severity of adverse effects can be increased when Prilocaine is combined with Methaqualone.Illicit, Withdrawn
MethocarbamolThe risk or severity of adverse effects can be increased when Prilocaine is combined with Methocarbamol.Approved, Vet Approved
MethohexitalThe risk or severity of adverse effects can be increased when Methohexital is combined with Prilocaine.Approved
MethotrimeprazinePrilocaine may increase the central nervous system depressant (CNS depressant) activities of Methotrimeprazine.Approved
MethoxyfluraneThe risk or severity of adverse effects can be increased when Prilocaine is combined with Methoxyflurane.Approved, Vet Approved
MethsuximideThe risk or severity of adverse effects can be increased when Prilocaine is combined with Methsuximide.Approved
MethylecgonineThe risk or severity of adverse effects can be increased when Prilocaine is combined with Methylecgonine.Experimental
MethylphenobarbitalThe risk or severity of adverse effects can be increased when Prilocaine is combined with Methylphenobarbital.Approved
MetoclopramideThe risk or severity of adverse effects can be increased when Metoclopramide is combined with Prilocaine.Approved, Investigational
MetyrosinePrilocaine may increase the sedative activities of Metyrosine.Approved
MidazolamThe risk or severity of adverse effects can be increased when Midazolam is combined with Prilocaine.Approved, Illicit
MilnacipranThe risk or severity of adverse effects can be increased when Prilocaine is combined with Milnacipran.Approved
MinocyclineMinocycline may increase the central nervous system depressant (CNS depressant) activities of Prilocaine.Approved, Investigational
MirtazapinePrilocaine may increase the central nervous system depressant (CNS depressant) activities of Mirtazapine.Approved
MolindoneThe risk or severity of adverse effects can be increased when Prilocaine is combined with Molindone.Approved
MorphineThe risk or severity of adverse effects can be increased when Morphine is combined with Prilocaine.Approved, Investigational
NabiloneNabilone may increase the central nervous system depressant (CNS depressant) activities of Prilocaine.Approved, Investigational
NalbuphineThe risk or severity of adverse effects can be increased when Nalbuphine is combined with Prilocaine.Approved
NefazodoneThe risk or severity of adverse effects can be increased when Prilocaine is combined with Nefazodone.Approved, Withdrawn
NitrazepamThe risk or severity of adverse effects can be increased when Nitrazepam is combined with Prilocaine.Approved
Nitric OxideThe risk or severity of adverse effects can be increased when Nitric Oxide is combined with Prilocaine.Approved
NitrofurantoinThe risk or severity of adverse effects can be increased when Nitrofurantoin is combined with Prilocaine.Approved, Vet Approved
NitroglycerinThe risk or severity of adverse effects can be increased when Nitroglycerin is combined with Prilocaine.Approved, Investigational
NitroprussideThe risk or severity of adverse effects can be increased when Nitroprusside is combined with Prilocaine.Approved
Nitrous oxideThe risk or severity of adverse effects can be increased when Nitrous oxide is combined with Prilocaine.Approved, Vet Approved
NorfluraneThe risk or severity of adverse effects can be increased when Prilocaine is combined with Norflurane.Investigational
NormethadoneThe risk or severity of adverse effects can be increased when Prilocaine is combined with Normethadone.Approved, Illicit
NortriptylineThe risk or severity of adverse effects can be increased when Prilocaine is combined with Nortriptyline.Approved
OlanzapineThe risk or severity of adverse effects can be increased when Olanzapine is combined with Prilocaine.Approved, Investigational
OlopatadineThe risk or severity of adverse effects can be increased when Prilocaine is combined with Olopatadine.Approved
OndansetronThe risk or severity of adverse effects can be increased when Prilocaine is combined with Ondansetron.Approved
OpiumThe risk or severity of adverse effects can be increased when Prilocaine is combined with Opium.Approved, Illicit
OrphenadrinePrilocaine may increase the central nervous system depressant (CNS depressant) activities of Orphenadrine.Approved
OsanetantThe risk or severity of adverse effects can be increased when Prilocaine is combined with Osanetant.Investigational
OxazepamThe risk or severity of adverse effects can be increased when Oxazepam is combined with Prilocaine.Approved
OxethazaineThe risk or severity of adverse effects can be increased when Prilocaine is combined with Oxethazaine.Investigational
OxprenololThe risk or severity of adverse effects can be increased when Prilocaine is combined with Oxprenolol.Approved
OxybuprocaineThe risk or severity of adverse effects can be increased when Prilocaine is combined with Oxybuprocaine.Approved
OxycodoneThe risk or severity of adverse effects can be increased when Oxycodone is combined with Prilocaine.Approved, Illicit, Investigational
OxymorphoneThe risk or severity of adverse effects can be increased when Oxymorphone is combined with Prilocaine.Approved, Investigational, Vet Approved
PaliperidoneThe risk or severity of adverse effects can be increased when Paliperidone is combined with Prilocaine.Approved
ParaldehydePrilocaine may increase the central nervous system depressant (CNS depressant) activities of Paraldehyde.Approved
ParoxetineThe risk or severity of adverse effects can be increased when Prilocaine is combined with Paroxetine.Approved, Investigational
PenfluridolThe risk or severity of adverse effects can be increased when Prilocaine is combined with Penfluridol.Experimental
PentazocineThe risk or severity of adverse effects can be increased when Pentazocine is combined with Prilocaine.Approved, Vet Approved
PentobarbitalThe risk or severity of adverse effects can be increased when Pentobarbital is combined with Prilocaine.Approved, Vet Approved
PerampanelPerampanel may increase the central nervous system depressant (CNS depressant) activities of Prilocaine.Approved
PerazineThe risk or severity of adverse effects can be increased when Prilocaine is combined with Perazine.Investigational
PerospironeThe risk or severity of adverse effects can be increased when Prilocaine is combined with Perospirone.Approved
PerphenazineThe risk or severity of adverse effects can be increased when Perphenazine is combined with Prilocaine.Approved
PethidineThe risk or severity of adverse effects can be increased when Pethidine is combined with Prilocaine.Approved
PhenazocineThe risk or severity of adverse effects can be increased when Prilocaine is combined with Phenazocine.Experimental
PhenazopyridineThe risk or severity of adverse effects can be increased when Phenazopyridine is combined with Prilocaine.Approved
PhenibutThe risk or severity of adverse effects can be increased when Prilocaine is combined with Phenibut.Experimental
PhenobarbitalThe risk or severity of adverse effects can be increased when Phenobarbital is combined with Prilocaine.Approved
PhenoperidineThe risk or severity of adverse effects can be increased when Prilocaine is combined with Phenoperidine.Experimental
PhenoxyethanolThe risk or severity of adverse effects can be increased when Prilocaine is combined with Phenoxyethanol.Approved
PhenytoinThe risk or severity of adverse effects can be increased when Phenytoin is combined with Prilocaine.Approved, Vet Approved
PimozideThe risk or severity of adverse effects can be increased when Pimozide is combined with Prilocaine.Approved
PipamperoneThe risk or severity of adverse effects can be increased when Prilocaine is combined with Pipamperone.Approved
PipotiazineThe risk or severity of adverse effects can be increased when Prilocaine is combined with Pipotiazine.Approved
PiritramideThe risk or severity of adverse effects can be increased when Prilocaine is combined with Piritramide.Investigational
PizotifenThe risk or severity of adverse effects can be increased when Prilocaine is combined with Pizotifen.Approved
PomalidomideThe risk or severity of adverse effects can be increased when Prilocaine is combined with Pomalidomide.Approved
PramipexolePrilocaine may increase the sedative activities of Pramipexole.Approved, Investigational
PramocaineThe risk or severity of adverse effects can be increased when Prilocaine is combined with Pramocaine.Approved
PrazepamThe risk or severity of adverse effects can be increased when Prilocaine is combined with Prazepam.Approved, Illicit
PregabalinThe risk or severity of adverse effects can be increased when Pregabalin is combined with Prilocaine.Approved, Illicit, Investigational
PrimaquineThe risk or severity of adverse effects can be increased when Primaquine is combined with Prilocaine.Approved
PrimidoneThe risk or severity of adverse effects can be increased when Prilocaine is combined with Primidone.Approved, Vet Approved
ProcaineThe risk or severity of adverse effects can be increased when Procaine is combined with Prilocaine.Approved, Investigational, Vet Approved
ProchlorperazineThe risk or severity of adverse effects can be increased when Prochlorperazine is combined with Prilocaine.Approved, Vet Approved
PromazineThe risk or severity of adverse effects can be increased when Promazine is combined with Prilocaine.Approved, Vet Approved
PromethazineThe risk or severity of adverse effects can be increased when Prilocaine is combined with Promethazine.Approved
PropanididThe risk or severity of adverse effects can be increased when Prilocaine is combined with Propanidid.Experimental
ProparacaineThe risk or severity of adverse effects can be increased when Prilocaine is combined with Proparacaine.Approved, Vet Approved
PropofolThe risk or severity of adverse effects can be increased when Propofol is combined with Prilocaine.Approved, Investigational, Vet Approved
PropoxycaineThe risk or severity of adverse effects can be increased when Prilocaine is combined with Propoxycaine.Approved
ProtriptylineThe risk or severity of adverse effects can be increased when Prilocaine is combined with Protriptyline.Approved
ProxibarbalThe risk or severity of adverse effects can be increased when Prilocaine is combined with Proxibarbal.Experimental
PSD502The risk or severity of adverse effects can be increased when Prilocaine is combined with PSD502.Investigational
QuazepamThe risk or severity of adverse effects can be increased when Quazepam is combined with Prilocaine.Approved, Illicit
QuetiapineThe risk or severity of adverse effects can be increased when Quetiapine is combined with Prilocaine.Approved
QuinineThe risk or severity of adverse effects can be increased when Quinine is combined with Prilocaine.Approved
QuinisocaineThe risk or severity of adverse effects can be increased when Prilocaine is combined with Quinisocaine.Experimental
RacloprideThe risk or severity of adverse effects can be increased when Prilocaine is combined with Raclopride.Investigational
RamelteonThe risk or severity of adverse effects can be increased when Prilocaine is combined with Ramelteon.Approved, Investigational
RemifentanilThe risk or severity of adverse effects can be increased when Remifentanil is combined with Prilocaine.Approved
RemoxiprideThe risk or severity of adverse effects can be increased when Remoxipride is combined with Prilocaine.Approved, Withdrawn
ReserpineThe risk or severity of adverse effects can be increased when Reserpine is combined with Prilocaine.Approved
RisperidoneThe risk or severity of adverse effects can be increased when Risperidone is combined with Prilocaine.Approved, Investigational
RitanserinThe risk or severity of adverse effects can be increased when Prilocaine is combined with Ritanserin.Investigational
RomifidineThe risk or severity of adverse effects can be increased when Prilocaine is combined with Romifidine.Vet Approved
RopinirolePrilocaine may increase the sedative activities of Ropinirole.Approved, Investigational
RopivacaineThe risk or severity of adverse effects can be increased when Ropivacaine is combined with Prilocaine.Approved
RotigotinePrilocaine may increase the sedative activities of Rotigotine.Approved
RufinamideThe risk or severity of adverse effects can be increased when Rufinamide is combined with Prilocaine.Approved
ScopolamineThe risk or severity of adverse effects can be increased when Prilocaine is combined with Scopolamine.Approved
SecobarbitalThe risk or severity of adverse effects can be increased when Secobarbital is combined with Prilocaine.Approved, Vet Approved
SepranoloneThe risk or severity of adverse effects can be increased when Prilocaine is combined with Sepranolone.Investigational
SertindoleThe risk or severity of adverse effects can be increased when Prilocaine is combined with Sertindole.Approved, Withdrawn
SertralineThe risk or severity of adverse effects can be increased when Prilocaine is combined with Sertraline.Approved
SevofluraneThe risk or severity of adverse effects can be increased when Sevoflurane is combined with Prilocaine.Approved, Vet Approved
Sodium NitriteThe risk or severity of adverse effects can be increased when Sodium Nitrite is combined with Prilocaine.Approved
Sodium oxybateSodium oxybate may increase the central nervous system depressant (CNS depressant) activities of Prilocaine.Approved
StiripentolThe risk or severity of adverse effects can be increased when Prilocaine is combined with Stiripentol.Approved
SufentanilThe risk or severity of adverse effects can be increased when Sufentanil is combined with Prilocaine.Approved, Investigational
SulfadiazineThe risk or severity of adverse effects can be increased when Sulfadiazine is combined with Prilocaine.Approved, Vet Approved
SulfamethoxazoleThe risk or severity of adverse effects can be increased when Sulfamethoxazole is combined with Prilocaine.Approved
SulpirideThe risk or severity of adverse effects can be increased when Sulpiride is combined with Prilocaine.Approved
SultoprideThe risk or severity of adverse effects can be increased when Prilocaine is combined with Sultopride.Experimental
SuvorexantPrilocaine may increase the central nervous system depressant (CNS depressant) activities of Suvorexant.Approved
TandospironeThe risk or severity of adverse effects can be increased when Prilocaine is combined with Tandospirone.Investigational
TapentadolTapentadol may increase the central nervous system depressant (CNS depressant) activities of Prilocaine.Approved
TasimelteonThe risk or severity of adverse effects can be increased when Prilocaine is combined with Tasimelteon.Approved
Technetium Tc-99m tilmanoceptPrilocaine may decrease effectiveness of Technetium Tc-99m tilmanocept as a diagnostic agent.Approved
TemazepamThe risk or severity of adverse effects can be increased when Temazepam is combined with Prilocaine.Approved
TetrabenazineThe risk or severity of adverse effects can be increased when Prilocaine is combined with Tetrabenazine.Approved
TetracaineThe risk or severity of adverse effects can be increased when Prilocaine is combined with Tetracaine.Approved, Vet Approved
TetrahydropalmatineThe risk or severity of adverse effects can be increased when Prilocaine is combined with Tetrahydropalmatine.Investigational
TetrodotoxinThe risk or severity of adverse effects can be increased when Prilocaine is combined with Tetrodotoxin.Investigational
ThalidomidePrilocaine may increase the central nervous system depressant (CNS depressant) activities of Thalidomide.Approved, Investigational, Withdrawn
ThiamylalThe risk or severity of adverse effects can be increased when Prilocaine is combined with Thiamylal.Approved, Vet Approved
ThiopentalThe risk or severity of adverse effects can be increased when Thiopental is combined with Prilocaine.Approved, Vet Approved
ThioridazineThe risk or severity of adverse effects can be increased when Thioridazine is combined with Prilocaine.Withdrawn
ThiothixeneThe risk or severity of adverse effects can be increased when Thiothixene is combined with Prilocaine.Approved
TiagabineThe risk or severity of adverse effects can be increased when Prilocaine is combined with Tiagabine.Approved
TiaprideThe risk or severity of adverse effects can be increased when Prilocaine is combined with Tiapride.Approved, Investigational
TiletamineThe risk or severity of adverse effects can be increased when Prilocaine is combined with Tiletamine.Vet Approved
TilidineThe risk or severity of adverse effects can be increased when Prilocaine is combined with Tilidine.Experimental
TizanidineThe risk or severity of adverse effects can be increased when Prilocaine is combined with Tizanidine.Approved
TolcaponeThe risk or severity of adverse effects can be increased when Prilocaine is combined with Tolcapone.Approved, Withdrawn
TopiramateThe risk or severity of adverse effects can be increased when Prilocaine is combined with Topiramate.Approved
TramadolThe risk or severity of adverse effects can be increased when Tramadol is combined with Prilocaine.Approved, Investigational
Trans-2-PhenylcyclopropylamineThe risk or severity of adverse effects can be increased when Prilocaine is combined with Trans-2-Phenylcyclopropylamine.Experimental
TranylcypromineThe risk or severity of adverse effects can be increased when Prilocaine is combined with Tranylcypromine.Approved
TrazodoneThe risk or severity of adverse effects can be increased when Trazodone is combined with Prilocaine.Approved, Investigational
TriazolamThe risk or severity of adverse effects can be increased when Triazolam is combined with Prilocaine.Approved
Tricaine methanesulfonateThe risk or severity of adverse effects can be increased when Prilocaine is combined with Tricaine methanesulfonate.Vet Approved
TrichloroethyleneThe risk or severity of adverse effects can be increased when Prilocaine is combined with Trichloroethylene.Experimental
TrifluoperazineThe risk or severity of adverse effects can be increased when Trifluoperazine is combined with Prilocaine.Approved
TrifluperidolThe risk or severity of adverse effects can be increased when Prilocaine is combined with Trifluperidol.Experimental
TriflupromazineThe risk or severity of adverse effects can be increased when Triflupromazine is combined with Prilocaine.Approved, Vet Approved
TrimipramineThe risk or severity of adverse effects can be increased when Prilocaine is combined with Trimipramine.Approved
TriprolidineThe risk or severity of adverse effects can be increased when Prilocaine is combined with Triprolidine.Approved
Valproic AcidThe risk or severity of adverse effects can be increased when Valproic Acid is combined with Prilocaine.Approved, Investigational
VenlafaxineThe risk or severity of adverse effects can be increased when Prilocaine is combined with Venlafaxine.Approved
VeraliprideThe risk or severity of adverse effects can be increased when Prilocaine is combined with Veralipride.Experimental
VigabatrinThe risk or severity of adverse effects can be increased when Prilocaine is combined with Vigabatrin.Approved
Vinyl etherThe risk or severity of adverse effects can be increased when Prilocaine is combined with Vinyl ether.Experimental
VortioxetineThe risk or severity of adverse effects can be increased when Prilocaine is combined with Vortioxetine.Approved
XenonThe risk or severity of adverse effects can be increased when Prilocaine is combined with Xenon.Experimental
XylazineThe risk or severity of adverse effects can be increased when Prilocaine is combined with Xylazine.Vet Approved
ZaleplonThe risk or severity of adverse effects can be increased when Zaleplon is combined with Prilocaine.Approved, Illicit, Investigational
ZiconotideThe risk or severity of adverse effects can be increased when Prilocaine is combined with Ziconotide.Approved
ZimelidineThe risk or severity of adverse effects can be increased when Prilocaine is combined with Zimelidine.Withdrawn
ZiprasidoneThe risk or severity of adverse effects can be increased when Ziprasidone is combined with Prilocaine.Approved
ZolazepamThe risk or severity of adverse effects can be increased when Prilocaine is combined with Zolazepam.Vet Approved
ZolpidemPrilocaine may increase the central nervous system depressant (CNS depressant) activities of Zolpidem.Approved
ZonisamideThe risk or severity of adverse effects can be increased when Prilocaine is combined with Zonisamide.Approved, Investigational
ZopicloneThe risk or severity of adverse effects can be increased when Zopiclone is combined with Prilocaine.Approved
ZotepineThe risk or severity of adverse effects can be increased when Prilocaine is combined with Zotepine.Approved
ZuclopenthixolThe risk or severity of adverse effects can be increased when Zuclopenthixol is combined with Prilocaine.Approved, Investigational
Food Interactions
Not Available


Synthesis Reference
General References
Not Available
External Links
Human Metabolome Database
KEGG Compound
PubChem Compound
PubChem Substance
Therapeutic Targets Database
ATC Codes
N01BB54 — Prilocaine, combinationsN01BB04 — Prilocaine
AHFS Codes
  • 72:00.00
PDB Entries
Not Available
FDA label
Not Available
Download (73.4 KB)

Clinical Trials

Clinical Trials
1CompletedPreventionIntradermal Electroporation1
1CompletedSupportive CareDental Anesthesia Efficacy1
2Not Yet RecruitingTreatmentAnesthetics, Local1
2, 3CompletedTreatmentPremature Ejaculation1
3CompletedSupportive CareProcedural Pain Relief1
3CompletedTreatmentDiabetes Mellitus (DM)1
3CompletedTreatmentFacial Wrinkles at the Nasolabial Folds1
3RecruitingTreatmentArterial Hypotension / Pain / Pregnant Women1
3TerminatedTreatmentBone Marrow Diseases / Pain1
4CompletedNot AvailableHemorrhoids / Peri Anal Fistula1
4CompletedNot AvailablePeriodontal Diseases1
4CompletedSupportive CareElectrodiagnosis1
4CompletedSupportive CareLeukemias / Non Hodgkin Lymphoma (NHL)1
4CompletedSupportive CarePain1
4CompletedSupportive CareTranscervical Resection of Endometrium / Transcervical Resection of Fibroids / Transcervical Resection of Polyp1
4CompletedTreatmentBrachial Plexus Blockade1
4CompletedTreatmentDermatitis Papillaris Capillitii / Tattooing1
4CompletedTreatmentKnee Arthritis1
4CompletedTreatmentLocal Anesthesia of the Skin1
4CompletedTreatmentOther Surgical Procedures1
4RecruitingTreatmentPost Operative Pain1
4Unknown StatusDiagnosticHealthy Volunteers2
4Unknown StatusPreventionGynecological Pathologies1
Not AvailableActive Not RecruitingTreatmentHair removal therapy1
Not AvailableCompletedNot AvailableAmbulatory Surgical Procedures / Inguinal Hernias / Spinal Anaesthesia / Umbilical Hernias1
Not AvailableCompletedNot AvailableMethaemoglobinaemia1
Not AvailableCompletedBasic ScienceDiabetic Foot Proned Patients1
Not AvailableCompletedPreventionMyoma of Uterus1
Not AvailableCompletedSupportive CarePain1
Not AvailableCompletedTreatmentAllergic Skin Reaction / Anxiety Disorders1
Not AvailableCompletedTreatmentLocal Anesthesia / Postoperative pain / Self-Perception1
Not AvailableCompletedTreatmentLumbar Puncture / Topical Analgesia1
Not AvailableCompletedTreatmentOther Surgical Procedures1
Not AvailableCompletedTreatmentStrokes1
Not AvailableEnrolling by InvitationNot AvailableArthritis / Gout Acute / Headaches / Migraines / Muscle Spasms / Radicular syndrome / Synovitis / Tendonitis1
Not AvailableNot Yet RecruitingTreatmentPain1
Not AvailableRecruitingPreventionArterial Hypotension1
Not AvailableRecruitingPreventionChildren / Pain1
Not AvailableSuspendedSupportive CareNeoplasms, Malignant1
Not AvailableUnknown StatusNot AvailablePlantar Warts1
Not AvailableUnknown StatusTreatmentTuberculosis1


Not Available
Dosage forms
SolutionInfiltration40 mg
Injection, solutionDental
Injection, solutionDental40 mg/mL
Injection, solutionSubcutaneous40 mg/mL
Injection, solutionSubcutaneous
Unit descriptionCostUnit
Prilocaine hcl powder3.98USD g
DrugBank does not sell nor buy drugs. Pricing information is supplied for informational purposes only.
Patent NumberPediatric ExtensionApprovedExpires (estimated)
US6031007 No1997-04-012017-04-01Us


Experimental Properties
melting point (°C)37-38 °CPhysProp
boiling point (°C)159-162 °C at 1.00E-01 mm HgPhysProp
water solubility541 mg/LNot Available
logP2.11HANSCH,C ET AL. (1995)
Predicted Properties
Water Solubility0.326 mg/mLALOGPS
pKa (Strongest Acidic)13.51ChemAxon
pKa (Strongest Basic)8.82ChemAxon
Physiological Charge1ChemAxon
Hydrogen Acceptor Count2ChemAxon
Hydrogen Donor Count2ChemAxon
Polar Surface Area41.13 Å2ChemAxon
Rotatable Bond Count5ChemAxon
Refractivity67.86 m3·mol-1ChemAxon
Polarizability25.98 Å3ChemAxon
Number of Rings1ChemAxon
Rule of FiveYesChemAxon
Ghose FilterYesChemAxon
Veber's RuleNoChemAxon
MDDR-like RuleNoChemAxon
Predicted ADMET features
Human Intestinal Absorption+0.9557
Blood Brain Barrier+0.9285
Caco-2 permeable+0.7888
P-glycoprotein substrateSubstrate0.6968
P-glycoprotein inhibitor INon-inhibitor0.8019
P-glycoprotein inhibitor IINon-inhibitor0.9165
Renal organic cation transporterNon-inhibitor0.895
CYP450 2C9 substrateNon-substrate0.7803
CYP450 2D6 substrateNon-substrate0.5124
CYP450 3A4 substrateNon-substrate0.5253
CYP450 1A2 substrateNon-inhibitor0.9045
CYP450 2C9 inhibitorNon-inhibitor0.907
CYP450 2D6 inhibitorNon-inhibitor0.9232
CYP450 2C19 inhibitorNon-inhibitor0.9026
CYP450 3A4 inhibitorNon-inhibitor0.8309
CYP450 inhibitory promiscuityLow CYP Inhibitory Promiscuity0.6298
Ames testNon AMES toxic0.7941
BiodegradationNot ready biodegradable0.9577
Rat acute toxicity2.1374 LD50, mol/kg Not applicable
hERG inhibition (predictor I)Weak inhibitor0.9676
hERG inhibition (predictor II)Non-inhibitor0.8577
ADMET data is predicted using admetSAR, a free tool for evaluating chemical ADMET properties. (23092397 )


Mass Spec (NIST)
Download (8.45 KB)
SpectrumSpectrum TypeSplash Key
Predicted GC-MS Spectrum - GC-MSPredicted GC-MSNot Available
Predicted MS/MS Spectrum - 10V, Positive (Annotated)Predicted LC-MS/MSNot Available
Predicted MS/MS Spectrum - 20V, Positive (Annotated)Predicted LC-MS/MSNot Available
Predicted MS/MS Spectrum - 40V, Positive (Annotated)Predicted LC-MS/MSNot Available
Predicted MS/MS Spectrum - 10V, Negative (Annotated)Predicted LC-MS/MSNot Available
Predicted MS/MS Spectrum - 20V, Negative (Annotated)Predicted LC-MS/MSNot Available
Predicted MS/MS Spectrum - 40V, Negative (Annotated)Predicted LC-MS/MSNot Available
LC-MS/MS Spectrum - LC-ESI-qTof , PositiveLC-MS/MSNot Available
LC-MS/MS Spectrum - LC-ESI-qTof , PositiveLC-MS/MSNot Available
LC-MS/MS Spectrum - LC-ESI-qTof , PositiveLC-MS/MSNot Available
LC-MS/MS Spectrum - LC-ESI-QFT , positiveLC-MS/MSsplash10-000i-9010000000-62668ab56142315d25c7
LC-MS/MS Spectrum - LC-ESI-QFT , positiveLC-MS/MSsplash10-000i-9000000000-b24ca970640547e77f45
LC-MS/MS Spectrum - LC-ESI-QFT , positiveLC-MS/MSsplash10-000i-9000000000-fa235236a550137d65ac
LC-MS/MS Spectrum - LC-ESI-QFT , positiveLC-MS/MSsplash10-000i-9000000000-c5326a5261240ae38b1e
LC-MS/MS Spectrum - LC-ESI-QFT , positiveLC-MS/MSsplash10-000i-9000000000-6c794305d6cd738a7fa3
LC-MS/MS Spectrum - LC-ESI-QFT , positiveLC-MS/MSsplash10-000i-9000000000-ee81ed4cf795affc96e8
MS/MS Spectrum - , positiveLC-MS/MSsplash10-00di-0290000000-ecb70add14abedae843c
MS/MS Spectrum - , positiveLC-MS/MSsplash10-00di-0290000000-44d4259708c3f68cf9fa
MS/MS Spectrum - , positiveLC-MS/MSsplash10-00di-1390000000-c8416e476741832b2637


This compound belongs to the class of organic compounds known as alpha amino acid amides. These are amide derivatives of alpha amino acids.
Organic compounds
Super Class
Organic acids and derivatives
Carboxylic acids and derivatives
Sub Class
Amino acids, peptides, and analogues
Direct Parent
Alpha amino acid amides
Alternative Parents
Alanine and derivatives / Anilides / N-arylamides / Toluenes / Secondary carboxylic acid amides / Dialkylamines / Organopnictogen compounds / Organic oxides / Hydrocarbon derivatives / Carbonyl compounds
Alpha-amino acid amide / Alanine or derivatives / Anilide / N-arylamide / Toluene / Monocyclic benzene moiety / Benzenoid / Carboxamide group / Secondary carboxylic acid amide / Secondary amine
Molecular Framework
Aromatic homomonocyclic compounds
External Descriptors
monocarboxylic acid amide, amino acid amide (CHEBI:8404 )


Pharmacological action
General Function
Voltage-gated sodium channel activity involved in sa node cell action potential
Specific Function
This protein mediates the voltage-dependent sodium ion permeability of excitable membranes. Assuming opened or closed conformations in response to the voltage difference across the membrane, the pr...
Gene Name
Uniprot ID
Uniprot Name
Sodium channel protein type 5 subunit alpha
Molecular Weight
226937.475 Da
  1. Overington JP, Al-Lazikani B, Hopkins AL: How many drug targets are there? Nat Rev Drug Discov. 2006 Dec;5(12):993-6. [PubMed:17139284 ]
  2. Imming P, Sinning C, Meyer A: Drugs, their targets and the nature and number of drug targets. Nat Rev Drug Discov. 2006 Oct;5(10):821-34. [PubMed:17016423 ]
  3. Chen X, Ji ZL, Chen YZ: TTD: Therapeutic Target Database. Nucleic Acids Res. 2002 Jan 1;30(1):412-5. [PubMed:11752352 ]

Drug created on June 13, 2005 07:24 / Updated on October 02, 2017 04:44