You are using an unsupported browser. Please upgrade your browser to a newer version to get the best experience on DrugBank.
Accession NumberDB00750  (APRD00180)
TypeSmall Molecule
DescriptionA local anesthetic that is similar pharmacologically to lidocaine. Currently, it is used most often for infiltration anesthesia in dentistry. (From AMA Drug Evaluations Annual, 1992, p165)
Prilocaine base
External IDs Astra 1512 / L 67
Product Ingredients
IngredientUNIICASInChI KeyDetails
Prilocaine HydrochlorideMJW015BAPH 1786-81-8BJPJNTKRKALCPP-UHFFFAOYSA-NDetails
Approved Prescription Products
NameDosageStrengthRouteLabellerMarketing StartMarketing End
4% Citanest Plain DentalSolution40 mgInfiltrationDentsply Pharmaceutical2015-12-23Not applicableCanada
AgoneazeKitTopicalAlvix Laboratories2016-01-12Not applicableUs
Dentsply 4% Prilocaine Hydrochloride Dental InjectionSolution40 mgInfiltrationDentsply Pharmaceutical1964-12-312016-06-03Canada
Approved Generic Prescription Products
NameDosageStrengthRouteLabellerMarketing StartMarketing End
Citanest PlainInjection, solution40 mg/mLDentalDentsply Pharmaceutical1965-11-18Not applicableUs
Prilocaine HydrochlorideInjection, solution40 mg/mLSubcutaneousSeptodont2011-01-01Not applicableUs
Approved Over the Counter ProductsNot Available
Unapproved/Other Products Not Available
International Brands
Brand mixtures
4% Citanest Forte Dental With Epinephrine 1:200,000Dentsply Pharmaceutical
Anodyne LptFortus Pharma, Llc
Citanest ForteDentsply Pharmaceutical
Dentsply 4% Prilocaine and Epinephrine Injection 1:200,000Dentsply Pharmaceutical
Dermacinrx Cinlone-I CpiPure Tek Corporation
Dermacinrx Cinlone-II CpiPure Tek Corporation
Dermacinrx EmpricainePure Tek Corporation
Dermacinrx PrikaanShoreline Pharmaceuticals, Inc.
Dermacinrx PrizopakPure Tek Corporation
DolotranzTaleos Pharma
EmlaActavis Pharma Company
Emla CrmAstra Zeneca
Emla PatchAstra Zeneca
FortacinPlethora Solutions Limited
IV Infusion CpiPure Tek Corporation
Lido BdkAsclemed Usa, Inc.
Lido-prilo Caine PackTmig, Inc.
Lidocaine 2.5% and Prilocaine 2.5% CreamWelgo, Llc
Lidocaine and PrilocaineActavis Pharma Company
Lidocaine-prilocaine-cream BaseHumco Holding Group. Inc.
LidoprilSterling Knight Pharmaceuticals, Llc
Lidopril XRSterling Knight Pharmaceuticals, Llc
LiprozonepakMed Arbor Llc
Medolor Pak Lidocaine and Prilocaine Cream KitMed Arbor Llc
OraqixDentsply Pharmaceutical
PrikaanShoreline Pharmaceuticals, Inc.
Prikaan LiteShoreline Pharmaceuticals, Inc.
Prilocaine HCl 4% Epineph 1:200000injNovocol Inc.
Prilocaine Hydrochloride With EpinephrineSeptodont
PrilolidSterling Knight Pharmaceuticals, Llc
Relador Pak PlusAccelis Pharma
Relador Pak With Occlusive DressingAccelis Pharma
Venipuncture CpiPure Tek Corporation
CAS number721-50-6
WeightAverage: 220.3107
Monoisotopic: 220.157563272
Chemical FormulaC13H20N2O
IndicationUsed as a local anaesthetic and is often used in dentistry.
Structured Indications Not Available
PharmacodynamicsPrilocaine binds to the intracellular surface of sodium channels which blocks the subsequent influx of sodium into the cell. Action potential propagation and never function is, therefore, prevented. This block is reversible and when the drug diffuses away from the cell, sodium channel function is restored and nerve propagation returns.
Mechanism of actionPrilocaine acts on sodium channels on the neuronal cell membrane, limiting the spread of seizure activity and reducing seizure propagation. The antiarrhythmic actions are mediated through effects on sodium channels in Purkinje fibers.
TargetKindPharmacological actionActionsOrganismUniProt ID
Sodium channel protein type 5 subunit alphaProteinyes
HumanQ14524 details
Related Articles
AbsorptionNot Available
Volume of distributionNot Available
Protein binding98%
MetabolismNot Available
Route of eliminationPrilocaine is metabolized in both the liver and the kidney and excreted via the kidney.
Half lifeNot Available
ClearanceNot Available
ToxicityNot Available
Affected organisms
  • Humans and other mammals
PathwayCategorySMPDB ID
Prilocaine Action PathwayDrug actionSMP00401
Pharmacogenomic Effects/ADRs
Interacting Gene/EnzymeSNP RS IDsAllele nameGenotypeDefining ChangeType(s)DescriptionDetails
Glucose-6-phosphate 1-dehydrogenaseNot AvailableVilleurbanne---1000_1002delACCADR InferredIncreased risk of Methemoglobinemia. Details
Glucose-6-phosphate 1-dehydrogenaseNot AvailableTorun---1006A->GADR InferredIncreased risk of Methemoglobinemia. Details
Glucose-6-phosphate 1-dehydrogenaseNot AvailableSunderland---105_107delCATADR InferredIncreased risk of Methemoglobinemia. Details
Glucose-6-phosphate 1-dehydrogenaseNot AvailableIwatsuki---1081G->AADR InferredIncreased risk of Methemoglobinemia. Details
Glucose-6-phosphate 1-dehydrogenaseNot AvailableSerres---1082C->TADR InferredIncreased risk of Methemoglobinemia. Details
Glucose-6-phosphate 1-dehydrogenaseNot AvailableTondela---1084_1101delCTGAACGAGCGCAAGGCCADR InferredIncreased risk of Methemoglobinemia. Details
Glucose-6-phosphate 1-dehydrogenaseNot AvailableLoma Linda---1089C->AADR InferredIncreased risk of Methemoglobinemia. Details
Glucose-6-phosphate 1-dehydrogenaseNot AvailableAachen---1089C->GADR InferredIncreased risk of Methemoglobinemia. Details
Glucose-6-phosphate 1-dehydrogenaseNot AvailableTenri---1096A->GADR InferredIncreased risk of Methemoglobinemia. Details
Glucose-6-phosphate 1-dehydrogenaseNot AvailableMontpellier---1132G>AADR InferredIncreased risk of Methemoglobinemia. Details
Glucose-6-phosphate 1-dehydrogenaseNot AvailableCalvo Mackenna---1138A->GADR InferredIncreased risk of Methemoglobinemia. Details
Glucose-6-phosphate 1-dehydrogenaseNot AvailableRiley---1139T->CADR InferredIncreased risk of Methemoglobinemia. Details
Glucose-6-phosphate 1-dehydrogenaseNot AvailableOlomouc---1141T->CADR InferredIncreased risk of Methemoglobinemia. Details
Glucose-6-phosphate 1-dehydrogenaseNot AvailableTomah---1153T->CADR InferredIncreased risk of Methemoglobinemia. Details
Glucose-6-phosphate 1-dehydrogenaseNot AvailableLynwood---1154G->TADR InferredIncreased risk of Methemoglobinemia. Details
Glucose-6-phosphate 1-dehydrogenaseNot AvailableMadrid---1155C->GADR InferredIncreased risk of Methemoglobinemia. Details
Glucose-6-phosphate 1-dehydrogenaseNot AvailableIowa, Walter Reed, Springfield---1156A->GADR InferredIncreased risk of Methemoglobinemia. Details
Glucose-6-phosphate 1-dehydrogenaseNot AvailableBeverly Hills, Genova, Iwate, Niigata, Yamaguchi---1160G->AADR InferredIncreased risk of Methemoglobinemia. Details
Glucose-6-phosphate 1-dehydrogenaseNot AvailableHartford---1162A->GADR InferredIncreased risk of Methemoglobinemia. Details
Glucose-6-phosphate 1-dehydrogenaseNot AvailablePraha---1166A->GADR InferredIncreased risk of Methemoglobinemia. Details
Glucose-6-phosphate 1-dehydrogenaseNot AvailableKrakow---1175T>CADR InferredIncreased risk of Methemoglobinemia. Details
Glucose-6-phosphate 1-dehydrogenaseNot AvailableWisconsin---1177C->GADR InferredIncreased risk of Methemoglobinemia. Details
Glucose-6-phosphate 1-dehydrogenaseNot AvailableNashville, Anaheim, Portici---1178G->AADR InferredIncreased risk of Methemoglobinemia. Details
Glucose-6-phosphate 1-dehydrogenaseNot AvailableAlhambra---1180G->CADR InferredIncreased risk of Methemoglobinemia. Details
Glucose-6-phosphate 1-dehydrogenaseNot AvailableBari---1187C->TADR InferredIncreased risk of Methemoglobinemia. Details
Glucose-6-phosphate 1-dehydrogenaseNot AvailablePuerto Limon---1192G->AADR InferredIncreased risk of Methemoglobinemia. Details
Glucose-6-phosphate 1-dehydrogenaseNot AvailableCovao do Lobo---1205C>AADR InferredIncreased risk of Methemoglobinemia. Details
Glucose-6-phosphate 1-dehydrogenaseNot AvailableClinic---1215G->AADR InferredIncreased risk of Methemoglobinemia. Details
Glucose-6-phosphate 1-dehydrogenaseNot AvailableUtrecht---1225C->TADR InferredIncreased risk of Methemoglobinemia. Details
Glucose-6-phosphate 1-dehydrogenaseNot AvailableSuwalki---1226C->GADR InferredIncreased risk of Methemoglobinemia. Details
Glucose-6-phosphate 1-dehydrogenaseNot AvailableRiverside---1228G->TADR InferredIncreased risk of Methemoglobinemia. Details
Glucose-6-phosphate 1-dehydrogenaseNot AvailableJapan, Shinagawa---1229G->AADR InferredIncreased risk of Methemoglobinemia. Details
Glucose-6-phosphate 1-dehydrogenaseNot AvailableKawasaki---1229G->CADR InferredIncreased risk of Methemoglobinemia. Details
Glucose-6-phosphate 1-dehydrogenaseNot AvailableMunich---1231A->GADR InferredIncreased risk of Methemoglobinemia. Details
Glucose-6-phosphate 1-dehydrogenaseNot AvailableGeorgia---1284C->AADR InferredIncreased risk of Methemoglobinemia. Details
Glucose-6-phosphate 1-dehydrogenaseNot AvailableSumare---1292T->GADR InferredIncreased risk of Methemoglobinemia. Details
Glucose-6-phosphate 1-dehydrogenaseNot AvailableTelti/Kobe---1318C->TADR InferredIncreased risk of Methemoglobinemia. Details
Glucose-6-phosphate 1-dehydrogenaseNot AvailableSantiago de Cuba, Morioka---1339G->AADR InferredIncreased risk of Methemoglobinemia. Details
Glucose-6-phosphate 1-dehydrogenaseNot AvailableHarima---1358T->AADR InferredIncreased risk of Methemoglobinemia. Details
Glucose-6-phosphate 1-dehydrogenaseNot AvailableFiguera da Foz---1366G->CADR InferredIncreased risk of Methemoglobinemia. Details
Glucose-6-phosphate 1-dehydrogenaseNot AvailableAmiens---1367A>TADR InferredIncreased risk of Methemoglobinemia. Details
Glucose-6-phosphate 1-dehydrogenaseNot AvailableBangkok Noi---1376G->T, 1502T->GADR InferredIncreased risk of Methemoglobinemia. Details
Glucose-6-phosphate 1-dehydrogenaseNot AvailableFukaya---1462G->AADR InferredIncreased risk of Methemoglobinemia. Details
Glucose-6-phosphate 1-dehydrogenaseNot AvailableCampinas---1463G->TADR InferredIncreased risk of Methemoglobinemia. Details
Glucose-6-phosphate 1-dehydrogenaseNot AvailableBuenos Aires---1465C>TADR InferredIncreased risk of Methemoglobinemia. Details
Glucose-6-phosphate 1-dehydrogenaseNot AvailableArakawa---1466C->TADR InferredIncreased risk of Methemoglobinemia. Details
Glucose-6-phosphate 1-dehydrogenaseNot AvailableBrighton---1488_1490delGAAADR InferredIncreased risk of Methemoglobinemia. Details
Glucose-6-phosphate 1-dehydrogenaseNot AvailableKozukata---159G->CADR InferredIncreased risk of Methemoglobinemia. Details
Glucose-6-phosphate 1-dehydrogenaseNot AvailableAmsterdam---180_182delTCTADR InferredIncreased risk of Methemoglobinemia. Details
Glucose-6-phosphate 1-dehydrogenaseNot AvailableNo name---202G->A, 376A->G, 1264C>GADR InferredIncreased risk of Methemoglobinemia. Details
Glucose-6-phosphate 1-dehydrogenaseNot AvailableSwansea---224T->CADR InferredIncreased risk of Methemoglobinemia. Details
Glucose-6-phosphate 1-dehydrogenaseNot AvailableUrayasu---281_283delAGAADR InferredIncreased risk of Methemoglobinemia. Details
Glucose-6-phosphate 1-dehydrogenaseNot AvailableVancouver---317C->G544C->T592C->TADR InferredIncreased risk of Methemoglobinemia. Details
Glucose-6-phosphate 1-dehydrogenaseNot AvailableMt Sinai---376A->G, 1159C->TADR InferredIncreased risk of Methemoglobinemia. Details
Glucose-6-phosphate 1-dehydrogenaseNot AvailablePlymouth---488G->AADR InferredIncreased risk of Methemoglobinemia. Details
Glucose-6-phosphate 1-dehydrogenaseNot AvailableVolendam---514C->TADR InferredIncreased risk of Methemoglobinemia. Details
Glucose-6-phosphate 1-dehydrogenaseNot AvailableShinshu---527A->GADR InferredIncreased risk of Methemoglobinemia. Details
Glucose-6-phosphate 1-dehydrogenaseNot AvailableChikugo---535A->TADR InferredIncreased risk of Methemoglobinemia. Details
Glucose-6-phosphate 1-dehydrogenaseNot AvailableTsukui---561_563delCTCADR InferredIncreased risk of Methemoglobinemia. Details
Glucose-6-phosphate 1-dehydrogenaseNot AvailablePedoplis-Ckaro---573C>GADR InferredIncreased risk of Methemoglobinemia. Details
Glucose-6-phosphate 1-dehydrogenaseNot AvailableSantiago---593G->CADR InferredIncreased risk of Methemoglobinemia. Details
Glucose-6-phosphate 1-dehydrogenaseNot AvailableMinnesota, Marion, Gastonia, LeJeune---637G->TADR InferredIncreased risk of Methemoglobinemia. Details
Glucose-6-phosphate 1-dehydrogenaseNot AvailableCincinnati---637G->T, 1037A->TADR InferredIncreased risk of Methemoglobinemia. Details
Glucose-6-phosphate 1-dehydrogenaseNot AvailableHarilaou---648T->GADR InferredIncreased risk of Methemoglobinemia. Details
Glucose-6-phosphate 1-dehydrogenaseNot AvailableNorth Dallas---683_685delACAADR InferredIncreased risk of Methemoglobinemia. Details
Glucose-6-phosphate 1-dehydrogenaseNot AvailableAsahikawa---695G->AADR InferredIncreased risk of Methemoglobinemia. Details
Glucose-6-phosphate 1-dehydrogenaseNot AvailableDurham---713A->GADR InferredIncreased risk of Methemoglobinemia. Details
Glucose-6-phosphate 1-dehydrogenaseNot AvailableStonybrook---724_729delGGCACTADR InferredIncreased risk of Methemoglobinemia. Details
Glucose-6-phosphate 1-dehydrogenaseNot AvailableWayne---769C->GADR InferredIncreased risk of Methemoglobinemia. Details
Glucose-6-phosphate 1-dehydrogenaseNot AvailableAveiro---806G->AADR InferredIncreased risk of Methemoglobinemia. Details
Glucose-6-phosphate 1-dehydrogenaseNot AvailableCleveland Corum---820G->AADR InferredIncreased risk of Methemoglobinemia. Details
Glucose-6-phosphate 1-dehydrogenaseNot AvailableLille---821A>TADR InferredIncreased risk of Methemoglobinemia. Details
Glucose-6-phosphate 1-dehydrogenaseNot AvailableBangkok---825G>CADR InferredIncreased risk of Methemoglobinemia. Details
Glucose-6-phosphate 1-dehydrogenaseNot AvailableSugao---826C->TADR InferredIncreased risk of Methemoglobinemia. Details
Glucose-6-phosphate 1-dehydrogenaseNot AvailableLa Jolla---832T->CADR InferredIncreased risk of Methemoglobinemia. Details
Glucose-6-phosphate 1-dehydrogenaseNot AvailableWexham---833C->TADR InferredIncreased risk of Methemoglobinemia. Details
Glucose-6-phosphate 1-dehydrogenaseNot AvailablePiotrkow---851T>CADR InferredIncreased risk of Methemoglobinemia. Details
Glucose-6-phosphate 1-dehydrogenaseNot AvailableWest Virginia---910G->TADR InferredIncreased risk of Methemoglobinemia. Details
Glucose-6-phosphate 1-dehydrogenaseNot AvailableOmiya---921G->CADR InferredIncreased risk of Methemoglobinemia. Details
Glucose-6-phosphate 1-dehydrogenaseNot AvailableNara---953_976delCCACCAAAGGGTACCTGGAC GACCADR InferredIncreased risk of Methemoglobinemia. Details
Glucose-6-phosphate 1-dehydrogenaseNot AvailableManhattan---962G->AADR InferredIncreased risk of Methemoglobinemia. Details
Glucose-6-phosphate 1-dehydrogenaseNot AvailableRehevot---964T->CADR InferredIncreased risk of Methemoglobinemia. Details
Glucose-6-phosphate 1-dehydrogenaseNot AvailableHoniara---99A->G, 1360C->TADR InferredIncreased risk of Methemoglobinemia. Details
Glucose-6-phosphate 1-dehydrogenaseNot AvailableTokyo, Fukushima---1246G->AADR InferredIncreased risk of Methemoglobinemia. Details
Glucose-6-phosphate 1-dehydrogenaseNot AvailableChatham---1003G->AADR InferredIncreased risk of Methemoglobinemia. Details
Glucose-6-phosphate 1-dehydrogenaseNot AvailableFushan---1004C->AADR InferredIncreased risk of Methemoglobinemia. Details
Glucose-6-phosphate 1-dehydrogenaseNot AvailablePartenope---1052G->TADR InferredIncreased risk of Methemoglobinemia. Details
Glucose-6-phosphate 1-dehydrogenaseNot AvailableIerapetra---1057C->TADR InferredIncreased risk of Methemoglobinemia. Details
Glucose-6-phosphate 1-dehydrogenaseNot AvailableAnadia---1193A->GADR InferredIncreased risk of Methemoglobinemia. Details
Glucose-6-phosphate 1-dehydrogenaseNot AvailableAbeno---1220A->CADR InferredIncreased risk of Methemoglobinemia. Details
Glucose-6-phosphate 1-dehydrogenaseNot AvailableSurabaya---1291G->AADR InferredIncreased risk of Methemoglobinemia. Details
Glucose-6-phosphate 1-dehydrogenaseNot AvailablePawnee---1316G->CADR InferredIncreased risk of Methemoglobinemia. Details
Glucose-6-phosphate 1-dehydrogenaseNot AvailableS. Antioco---1342A->GADR InferredIncreased risk of Methemoglobinemia. Details
Glucose-6-phosphate 1-dehydrogenaseNot AvailableCassano---1347G->CADR InferredIncreased risk of Methemoglobinemia. Details
Glucose-6-phosphate 1-dehydrogenaseNot AvailableHermoupolis---1347G->C, 1360C->TADR InferredIncreased risk of Methemoglobinemia. Details
Glucose-6-phosphate 1-dehydrogenaseNot AvailableUnion,Maewo, Chinese-2, Kalo---1360C->TADR InferredIncreased risk of Methemoglobinemia. Details
Glucose-6-phosphate 1-dehydrogenaseNot AvailableAndalus---1361G->AADR InferredIncreased risk of Methemoglobinemia. Details
Glucose-6-phosphate 1-dehydrogenaseNot AvailableCosenza---1376G->CADR InferredIncreased risk of Methemoglobinemia. Details
Glucose-6-phosphate 1-dehydrogenaseNot AvailableCanton, Taiwan- Hakka, Gifu-like, Agrigento-like---1376G->TADR InferredIncreased risk of Methemoglobinemia. Details
Glucose-6-phosphate 1-dehydrogenaseNot AvailableFlores---1387C->AADR InferredIncreased risk of Methemoglobinemia. Details
Glucose-6-phosphate 1-dehydrogenaseNot AvailableKaiping, Anant, Dhon, Sapporo-like, Wosera---1388G->AADR InferredIncreased risk of Methemoglobinemia. Details
Glucose-6-phosphate 1-dehydrogenaseNot AvailableKamogawa---169C->TADR InferredIncreased risk of Methemoglobinemia. Details
Glucose-6-phosphate 1-dehydrogenaseNot AvailableCostanzo---179T>CADR InferredIncreased risk of Methemoglobinemia. Details
Glucose-6-phosphate 1-dehydrogenaseNot AvailableAmazonia---185C->AADR InferredIncreased risk of Methemoglobinemia. Details
Glucose-6-phosphate 1-dehydrogenaseNot AvailableSongklanagarind---196T->AADR InferredIncreased risk of Methemoglobinemia. Details
Glucose-6-phosphate 1-dehydrogenaseNot AvailableHechi---202G->A, 871G->AADR InferredIncreased risk of Methemoglobinemia. Details
Glucose-6-phosphate 1-dehydrogenaseNot AvailableNamouru---208T->CADR InferredIncreased risk of Methemoglobinemia. Details
Glucose-6-phosphate 1-dehydrogenaseNot AvailableBao Loc---352T>CADR InferredIncreased risk of Methemoglobinemia. Details
Glucose-6-phosphate 1-dehydrogenaseNot AvailableCrispim---375G->T, 379G->T383T->C384C>TADR InferredIncreased risk of Methemoglobinemia. Details
Glucose-6-phosphate 1-dehydrogenaseNot AvailableAcrokorinthos---376A->G, 463C->GADR InferredIncreased risk of Methemoglobinemia. Details
Glucose-6-phosphate 1-dehydrogenaseNot AvailableSanta Maria---376A->G, 542A->TADR InferredIncreased risk of Methemoglobinemia. Details
Glucose-6-phosphate 1-dehydrogenaseNot AvailableAnanindeua---376A->G, 871G->AADR InferredIncreased risk of Methemoglobinemia. Details
Glucose-6-phosphate 1-dehydrogenaseNot AvailableVanua Lava---383T->CADR InferredIncreased risk of Methemoglobinemia. Details
Glucose-6-phosphate 1-dehydrogenaseNot AvailableValladolid---406C->TADR InferredIncreased risk of Methemoglobinemia. Details
Glucose-6-phosphate 1-dehydrogenaseNot AvailableBelem---409C->TADR InferredIncreased risk of Methemoglobinemia. Details
Glucose-6-phosphate 1-dehydrogenaseNot AvailableLiuzhou---442G->AADR InferredIncreased risk of Methemoglobinemia. Details
Glucose-6-phosphate 1-dehydrogenaseNot AvailableShenzen---473G>AADR InferredIncreased risk of Methemoglobinemia. Details
Glucose-6-phosphate 1-dehydrogenaseNot AvailableTaipei “Chinese- 3”---493A->GADR InferredIncreased risk of Methemoglobinemia. Details
Glucose-6-phosphate 1-dehydrogenaseNot AvailableToledo---496C>TADR InferredIncreased risk of Methemoglobinemia. Details
Glucose-6-phosphate 1-dehydrogenaseNot AvailableNaone---497G->AADR InferredIncreased risk of Methemoglobinemia. Details
Glucose-6-phosphate 1-dehydrogenaseNot AvailableNankang---517T->CADR InferredIncreased risk of Methemoglobinemia. Details
Glucose-6-phosphate 1-dehydrogenaseNot AvailableMiaoli---519C->GADR InferredIncreased risk of Methemoglobinemia. Details
Glucose-6-phosphate 1-dehydrogenaseNot AvailableMediterranean, Dallas, Panama‚ Sassari, Cagliari, Birmingham---563C->TADR InferredIncreased risk of Methemoglobinemia. Details
Glucose-6-phosphate 1-dehydrogenaseNot AvailableCoimbra Shunde---592C->TADR InferredIncreased risk of Methemoglobinemia. Details
Glucose-6-phosphate 1-dehydrogenaseNot AvailableNilgiri---593G>AADR InferredIncreased risk of Methemoglobinemia. Details
Glucose-6-phosphate 1-dehydrogenaseNot AvailableRadlowo---679C->TADR InferredIncreased risk of Methemoglobinemia. Details
Glucose-6-phosphate 1-dehydrogenaseNot AvailableRoubaix---811G>CADR InferredIncreased risk of Methemoglobinemia. Details
Glucose-6-phosphate 1-dehydrogenaseNot AvailableHaikou---835A->GADR InferredIncreased risk of Methemoglobinemia. Details
Glucose-6-phosphate 1-dehydrogenaseNot AvailableChinese-1---835A->TADR InferredIncreased risk of Methemoglobinemia. Details
Glucose-6-phosphate 1-dehydrogenaseNot AvailableMizushima---848A>GADR InferredIncreased risk of Methemoglobinemia. Details
Glucose-6-phosphate 1-dehydrogenaseNot AvailableOsaka---853C->TADR InferredIncreased risk of Methemoglobinemia. Details
Glucose-6-phosphate 1-dehydrogenaseNot AvailableViangchan, Jammu---871G->AADR InferredIncreased risk of Methemoglobinemia. Details
Glucose-6-phosphate 1-dehydrogenaseNot AvailableSeoul---916G->AADR InferredIncreased risk of Methemoglobinemia. Details
Glucose-6-phosphate 1-dehydrogenaseNot AvailableLudhiana---929G->AADR InferredIncreased risk of Methemoglobinemia. Details
Glucose-6-phosphate 1-dehydrogenaseNot AvailableFarroupilha---977C->AADR InferredIncreased risk of Methemoglobinemia. Details
Glucose-6-phosphate 1-dehydrogenaseNot AvailableChinese-5---1024C->TADR InferredIncreased risk of Methemoglobinemia. Details
Glucose-6-phosphate 1-dehydrogenaseNot AvailableRignano---130G>AADR InferredIncreased risk of Methemoglobinemia. Details
Glucose-6-phosphate 1-dehydrogenaseNot AvailableOrissa---131C->GADR InferredIncreased risk of Methemoglobinemia. Details
Glucose-6-phosphate 1-dehydrogenaseNot AvailableG6PDNice---1380G>CADR InferredIncreased risk of Methemoglobinemia. Details
Glucose-6-phosphate 1-dehydrogenaseNot AvailableKamiube, Keelung---1387C->TADR InferredIncreased risk of Methemoglobinemia. Details
Glucose-6-phosphate 1-dehydrogenaseNot AvailableNeapolis---1400C->GADR InferredIncreased risk of Methemoglobinemia. Details
Glucose-6-phosphate 1-dehydrogenaseNot AvailableAures---143T->CADR InferredIncreased risk of Methemoglobinemia. Details
Glucose-6-phosphate 1-dehydrogenaseNot AvailableSplit---1442C->GADR InferredIncreased risk of Methemoglobinemia. Details
Glucose-6-phosphate 1-dehydrogenaseNot AvailableKambos---148C->TADR InferredIncreased risk of Methemoglobinemia. Details
Glucose-6-phosphate 1-dehydrogenaseNot AvailablePalestrina---170G>AADR InferredIncreased risk of Methemoglobinemia. Details
Glucose-6-phosphate 1-dehydrogenaseNot AvailableMetaponto---172G->AADR InferredIncreased risk of Methemoglobinemia. Details
Glucose-6-phosphate 1-dehydrogenaseNot AvailableMusashino---185C->TADR InferredIncreased risk of Methemoglobinemia. Details
Glucose-6-phosphate 1-dehydrogenaseNot AvailableAsahi---202G->AADR InferredIncreased risk of Methemoglobinemia. Details
Glucose-6-phosphate 1-dehydrogenaseNot AvailableA- (202), Ferrara I---202G->A, 376A->GADR InferredIncreased risk of Methemoglobinemia. Details
Glucose-6-phosphate 1-dehydrogenaseNot AvailableMurcia Oristano---209A->GADR InferredIncreased risk of Methemoglobinemia. Details
Glucose-6-phosphate 1-dehydrogenaseNot AvailableUbe Konan---241C->TADR InferredIncreased risk of Methemoglobinemia. Details
Glucose-6-phosphate 1-dehydrogenaseNot AvailableLagosanto---242G->AADR InferredIncreased risk of Methemoglobinemia. Details
Glucose-6-phosphate 1-dehydrogenaseNot AvailableGuangzhou---274C->TADR InferredIncreased risk of Methemoglobinemia. Details
Glucose-6-phosphate 1-dehydrogenaseNot AvailableHammersmith---323T->AADR InferredIncreased risk of Methemoglobinemia. Details
Glucose-6-phosphate 1-dehydrogenaseNot AvailableSinnai---34G->TADR InferredIncreased risk of Methemoglobinemia. Details
Glucose-6-phosphate 1-dehydrogenaseNot AvailableA- (680)---376A->G, 680G->TADR InferredIncreased risk of Methemoglobinemia. Details
Glucose-6-phosphate 1-dehydrogenaseNot AvailableA- (968), Betica,Selma, Guantanamo---376A->G, 968T->CADR InferredIncreased risk of Methemoglobinemia. Details
Glucose-6-phosphate 1-dehydrogenaseNot AvailableSalerno Pyrgos---383T>GADR InferredIncreased risk of Methemoglobinemia. Details
Glucose-6-phosphate 1-dehydrogenaseNot AvailableQuing Yan---392G->TADR InferredIncreased risk of Methemoglobinemia. Details
Glucose-6-phosphate 1-dehydrogenaseNot AvailableLages---40G->AADR InferredIncreased risk of Methemoglobinemia. Details
Glucose-6-phosphate 1-dehydrogenaseNot AvailableIlesha---466G->AADR InferredIncreased risk of Methemoglobinemia. Details
Glucose-6-phosphate 1-dehydrogenaseNot AvailableMahidol---487G->AADR InferredIncreased risk of Methemoglobinemia. Details
Glucose-6-phosphate 1-dehydrogenaseNot AvailableMalaga---542A->TADR InferredIncreased risk of Methemoglobinemia. Details
Glucose-6-phosphate 1-dehydrogenaseNot AvailableSibari---634A->GADR InferredIncreased risk of Methemoglobinemia. Details
Glucose-6-phosphate 1-dehydrogenaseNot AvailableMexico City---680G->AADR InferredIncreased risk of Methemoglobinemia. Details
Glucose-6-phosphate 1-dehydrogenaseNot AvailableNanning---703C->TADR InferredIncreased risk of Methemoglobinemia. Details
Glucose-6-phosphate 1-dehydrogenaseNot AvailableSeattle, Lodi, Modena, Ferrara II, Athens-like---844G->CADR InferredIncreased risk of Methemoglobinemia. Details
Glucose-6-phosphate 1-dehydrogenaseNot AvailableBajo Maumere---844G->TADR InferredIncreased risk of Methemoglobinemia. Details
Glucose-6-phosphate 1-dehydrogenaseNot AvailableMontalbano---854G->AADR InferredIncreased risk of Methemoglobinemia. Details
Glucose-6-phosphate 1-dehydrogenaseNot AvailableKalyan-Kerala, Jamnaga, Rohini---949G->AADR InferredIncreased risk of Methemoglobinemia. Details
Glucose-6-phosphate 1-dehydrogenaseNot AvailableGaohe---95A->GADR InferredIncreased risk of Methemoglobinemia. Details
Drug Interactions
DrugInteractionDrug group
7-NitroindazoleThe risk or severity of adverse effects can be increased when Prilocaine is combined with 7-Nitroindazole.Experimental
AcepromazineThe risk or severity of adverse effects can be increased when Prilocaine is combined with Acepromazine.Approved, Vet Approved
AceprometazineThe risk or severity of adverse effects can be increased when Prilocaine is combined with Aceprometazine.Approved
AcetaminophenThe risk or severity of adverse effects can be increased when Acetaminophen is combined with Prilocaine.Approved
AdipiplonThe risk or severity of adverse effects can be increased when Prilocaine is combined with adipiplon.Investigational
AgomelatineThe risk or severity of adverse effects can be increased when Prilocaine is combined with Agomelatine.Approved, Investigational
AlfaxaloneThe risk or severity of adverse effects can be increased when Prilocaine is combined with Alfaxalone.Vet Approved
AlfentanilThe risk or severity of adverse effects can be increased when Prilocaine is combined with Alfentanil.Approved, Illicit
AlphacetylmethadolThe risk or severity of adverse effects can be increased when Prilocaine is combined with Alphacetylmethadol.Experimental, Illicit
AlprazolamThe risk or severity of adverse effects can be increased when Alprazolam is combined with Prilocaine.Approved, Illicit, Investigational
AmisulprideThe risk or severity of adverse effects can be increased when Prilocaine is combined with Amisulpride.Approved, Investigational
AmitriptylineThe risk or severity of adverse effects can be increased when Prilocaine is combined with Amitriptyline.Approved
AmobarbitalThe risk or severity of adverse effects can be increased when Prilocaine is combined with Amobarbital.Approved, Illicit
AmoxapineThe risk or severity of adverse effects can be increased when Prilocaine is combined with Amoxapine.Approved
AmperozideThe risk or severity of adverse effects can be increased when Prilocaine is combined with Amperozide.Experimental
Amyl NitriteThe risk or severity of adverse effects can be increased when Amyl Nitrite is combined with Prilocaine.Approved
AntipyrineThe risk or severity of adverse effects can be increased when Antipyrine is combined with Prilocaine.Approved
AripiprazoleThe risk or severity of adverse effects can be increased when Prilocaine is combined with Aripiprazole.Approved, Investigational
ArticaineThe risk or severity of adverse effects can be increased when Prilocaine is combined with Articaine.Approved
AsenapineThe risk or severity of adverse effects can be increased when Prilocaine is combined with Asenapine.Approved
AzaperoneThe risk or severity of adverse effects can be increased when Prilocaine is combined with Azaperone.Vet Approved
AzelastinePrilocaine may increase the central nervous system depressant (CNS depressant) activities of Azelastine.Approved
AzelastineThe risk or severity of adverse effects can be increased when Prilocaine is combined with Azelastine.Approved
BaclofenThe risk or severity of adverse effects can be increased when Prilocaine is combined with Baclofen.Approved
BarbitalThe risk or severity of adverse effects can be increased when Prilocaine is combined with Barbital.Illicit
BenperidolThe risk or severity of adverse effects can be increased when Prilocaine is combined with Benperidol.Investigational
BenzocaineThe risk or severity of adverse effects can be increased when Benzocaine is combined with Prilocaine.Approved
Benzyl alcoholThe risk or severity of adverse effects can be increased when Prilocaine is combined with Benzyl alcohol.Approved
BrexpiprazoleThe risk or severity of adverse effects can be increased when Prilocaine is combined with Brexpiprazole.Approved
BrimonidineThe risk or severity of adverse effects can be increased when Prilocaine is combined with Brimonidine.Approved
BrimonidineBrimonidine may increase the central nervous system depressant (CNS depressant) activities of Prilocaine.Approved
BromazepamThe risk or severity of adverse effects can be increased when Prilocaine is combined with Bromazepam.Approved, Illicit
BrompheniramineThe risk or severity of adverse effects can be increased when Prilocaine is combined with Brompheniramine.Approved
BrotizolamThe risk or severity of adverse effects can be increased when Prilocaine is combined with Brotizolam.Approved, Withdrawn
BupivacaineThe risk or severity of adverse effects can be increased when Bupivacaine is combined with Prilocaine.Approved, Investigational
BuprenorphinePrilocaine may increase the central nervous system depressant (CNS depressant) activities of Buprenorphine.Approved, Illicit, Investigational, Vet Approved
BuspironeThe risk or severity of adverse effects can be increased when Buspirone is combined with Prilocaine.Approved, Investigational
ButabarbitalThe risk or severity of adverse effects can be increased when Butabarbital is combined with Prilocaine.Approved, Illicit
ButacaineThe risk or severity of adverse effects can be increased when Prilocaine is combined with Butacaine.Vet Approved
ButalbitalThe risk or severity of adverse effects can be increased when Butalbital is combined with Prilocaine.Approved, Illicit
ButambenThe risk or severity of adverse effects can be increased when Prilocaine is combined with Butamben.Approved
ButethalThe risk or severity of adverse effects can be increased when Prilocaine is combined with Butethal.Approved, Illicit
ButorphanolThe risk or severity of adverse effects can be increased when Butorphanol is combined with Prilocaine.Approved, Illicit, Vet Approved
CarbamazepineThe risk or severity of adverse effects can be increased when Carbamazepine is combined with Prilocaine.Approved, Investigational
CarbinoxamineThe risk or severity of adverse effects can be increased when Prilocaine is combined with Carbinoxamine.Approved
CarfentanilThe risk or severity of adverse effects can be increased when Prilocaine is combined with Carfentanil.Illicit, Vet Approved
CarisoprodolThe risk or severity of adverse effects can be increased when Prilocaine is combined with Carisoprodol.Approved
CelecoxibThe risk or severity of adverse effects can be increased when Celecoxib is combined with Prilocaine.Approved, Investigational
CetirizineThe risk or severity of adverse effects can be increased when Prilocaine is combined with Cetirizine.Approved
Chloral hydrateThe risk or severity of adverse effects can be increased when Prilocaine is combined with Chloral hydrate.Approved, Illicit, Vet Approved
ChlordiazepoxideThe risk or severity of adverse effects can be increased when Chlordiazepoxide is combined with Prilocaine.Approved, Illicit
ChlormezanoneThe risk or severity of adverse effects can be increased when Prilocaine is combined with Chlormezanone.Approved, Withdrawn
ChloroprocaineThe risk or severity of adverse effects can be increased when Prilocaine is combined with Chloroprocaine.Approved
ChloroquineThe risk or severity of adverse effects can be increased when Chloroquine is combined with Prilocaine.Approved, Vet Approved
ChlorphenamineThe risk or severity of adverse effects can be increased when Prilocaine is combined with Chlorphenamine.Approved
ChlorpromazineThe risk or severity of adverse effects can be increased when Chlorpromazine is combined with Prilocaine.Approved, Vet Approved
ChlorprothixeneThe risk or severity of adverse effects can be increased when Prilocaine is combined with Chlorprothixene.Approved, Withdrawn
ChlorzoxazoneThe risk or severity of adverse effects can be increased when Prilocaine is combined with Chlorzoxazone.Approved
CinchocaineThe risk or severity of adverse effects can be increased when Cinchocaine is combined with Prilocaine.Approved, Vet Approved
CitalopramThe risk or severity of adverse effects can be increased when Prilocaine is combined with Citalopram.Approved
ClemastineThe risk or severity of adverse effects can be increased when Prilocaine is combined with Clemastine.Approved
ClidiniumThe risk or severity of adverse effects can be increased when Prilocaine is combined with Clidinium.Approved
ClobazamThe risk or severity of adverse effects can be increased when Prilocaine is combined with Clobazam.Approved, Illicit
clomethiazoleThe risk or severity of adverse effects can be increased when Prilocaine is combined with clomethiazole.Investigational
ClomipramineThe risk or severity of adverse effects can be increased when Prilocaine is combined with Clomipramine.Approved, Vet Approved
ClonazepamThe risk or severity of adverse effects can be increased when Prilocaine is combined with Clonazepam.Approved, Illicit
ClonidineThe risk or severity of adverse effects can be increased when Prilocaine is combined with Clonidine.Approved
ClorazepateThe risk or severity of adverse effects can be increased when Clorazepate is combined with Prilocaine.Approved, Illicit
ClozapineThe risk or severity of adverse effects can be increased when Clozapine is combined with Prilocaine.Approved
CocaineThe risk or severity of adverse effects can be increased when Prilocaine is combined with Cocaine.Approved, Illicit
CodeineThe risk or severity of adverse effects can be increased when Codeine is combined with Prilocaine.Approved, Illicit
CyclizineThe risk or severity of adverse effects can be increased when Prilocaine is combined with Cyclizine.Approved
CyclobenzaprineThe risk or severity of adverse effects can be increased when Prilocaine is combined with Cyclobenzaprine.Approved
CyproheptadineThe risk or severity of adverse effects can be increased when Prilocaine is combined with Cyproheptadine.Approved
DantroleneThe risk or severity of adverse effects can be increased when Prilocaine is combined with Dantrolene.Approved
DapiprazoleThe risk or severity of adverse effects can be increased when Dapiprazole is combined with Prilocaine.Approved
DapoxetineThe risk or severity of adverse effects can be increased when Prilocaine is combined with Dapoxetine.Investigational
DapsoneThe risk or severity of adverse effects can be increased when Dapsone is combined with Prilocaine.Approved, Investigational
DeramciclaneThe risk or severity of adverse effects can be increased when Prilocaine is combined with deramciclane.Investigational
DesfluraneThe risk or severity of adverse effects can be increased when Prilocaine is combined with Desflurane.Approved
DesipramineThe risk or severity of adverse effects can be increased when Prilocaine is combined with Desipramine.Approved
DesloratadineThe risk or severity of adverse effects can be increased when Prilocaine is combined with Desloratadine.Approved, Investigational
DesvenlafaxineThe risk or severity of adverse effects can be increased when Prilocaine is combined with Desvenlafaxine.Approved
DetomidineThe risk or severity of adverse effects can be increased when Prilocaine is combined with Detomidine.Vet Approved
DexbrompheniramineThe risk or severity of adverse effects can be increased when Prilocaine is combined with Dexbrompheniramine.Approved
DexmedetomidineThe risk or severity of adverse effects can be increased when Dexmedetomidine is combined with Prilocaine.Approved, Vet Approved
DextromoramideThe risk or severity of adverse effects can be increased when Prilocaine is combined with Dextromoramide.Experimental, Illicit
DextropropoxypheneThe risk or severity of adverse effects can be increased when Dextropropoxyphene is combined with Prilocaine.Approved, Illicit, Withdrawn
DezocineThe risk or severity of adverse effects can be increased when Prilocaine is combined with Dezocine.Approved
DiazepamThe risk or severity of adverse effects can be increased when Prilocaine is combined with Diazepam.Approved, Illicit, Vet Approved
DifenoxinThe risk or severity of adverse effects can be increased when Prilocaine is combined with Difenoxin.Approved, Illicit
DihydrocodeineThe risk or severity of adverse effects can be increased when Prilocaine is combined with Dihydrocodeine.Approved, Illicit
DihydroetorphineThe risk or severity of adverse effects can be increased when Prilocaine is combined with Dihydroetorphine.Experimental, Illicit
DihydromorphineThe risk or severity of adverse effects can be increased when Prilocaine is combined with Dihydromorphine.Experimental, Illicit
DimenhydrinateThe risk or severity of adverse effects can be increased when Prilocaine is combined with Dimenhydrinate.Approved
DiphenhydramineThe risk or severity of adverse effects can be increased when Prilocaine is combined with Diphenhydramine.Approved
DiphenoxylateThe risk or severity of adverse effects can be increased when Prilocaine is combined with Diphenoxylate.Approved, Illicit
DoramectinThe risk or severity of adverse effects can be increased when Prilocaine is combined with Doramectin.Vet Approved
DoxepinThe risk or severity of adverse effects can be increased when Prilocaine is combined with Doxepin.Approved
DoxylamineDoxylamine may increase the central nervous system depressant (CNS depressant) activities of Prilocaine.Approved, Vet Approved
DPDPEThe risk or severity of adverse effects can be increased when Prilocaine is combined with DPDPE.Investigational
DronabinolDronabinol may increase the central nervous system depressant (CNS depressant) activities of Prilocaine.Approved, Illicit
DroperidolDroperidol may increase the central nervous system depressant (CNS depressant) activities of Prilocaine.Approved, Vet Approved
DrotebanolThe risk or severity of adverse effects can be increased when Prilocaine is combined with Drotebanol.Experimental, Illicit
DuloxetineThe risk or severity of adverse effects can be increased when Prilocaine is combined with Duloxetine.Approved
DyclonineThe risk or severity of adverse effects can be increased when Dyclonine is combined with Prilocaine.Approved
EcgonineThe risk or severity of adverse effects can be increased when Prilocaine is combined with Ecgonine.Experimental, Illicit
ECGONINE METHYL ESTERThe risk or severity of adverse effects can be increased when Prilocaine is combined with ECGONINE METHYL ESTER.Experimental
EcopipamThe risk or severity of adverse effects can be increased when Prilocaine is combined with Ecopipam.Investigational
EfavirenzThe risk or severity of adverse effects can be increased when Prilocaine is combined with Efavirenz.Approved, Investigational
EnfluraneThe risk or severity of adverse effects can be increased when Enflurane is combined with Prilocaine.Approved, Vet Approved
EntacaponeThe risk or severity of adverse effects can be increased when Prilocaine is combined with Entacapone.Approved, Investigational
EscitalopramThe risk or severity of adverse effects can be increased when Prilocaine is combined with Escitalopram.Approved, Investigational
EstazolamThe risk or severity of adverse effects can be increased when Prilocaine is combined with Estazolam.Approved, Illicit
EszopicloneThe risk or severity of adverse effects can be increased when Eszopiclone is combined with Prilocaine.Approved
EthanolPrilocaine may increase the central nervous system depressant (CNS depressant) activities of Ethanol.Approved
EthchlorvynolThe risk or severity of adverse effects can be increased when Ethchlorvynol is combined with Prilocaine.Approved, Illicit, Withdrawn
EthosuximideThe risk or severity of adverse effects can be increased when Prilocaine is combined with Ethosuximide.Approved
EthotoinThe risk or severity of adverse effects can be increased when Prilocaine is combined with Ethotoin.Approved
Ethyl carbamateThe risk or severity of adverse effects can be increased when Prilocaine is combined with Ethyl carbamate.Withdrawn
Ethyl loflazepateThe risk or severity of adverse effects can be increased when Prilocaine is combined with Ethyl loflazepate.Approved, Illicit
EthylmorphineThe risk or severity of adverse effects can be increased when Prilocaine is combined with Ethylmorphine.Approved, Illicit
EtidocaineThe risk or severity of adverse effects can be increased when Prilocaine is combined with Etidocaine.Approved
EtifoxineThe risk or severity of adverse effects can be increased when Prilocaine is combined with Etifoxine.Withdrawn
EtizolamThe risk or severity of adverse effects can be increased when Prilocaine is combined with Etizolam.Approved
EtomidateThe risk or severity of adverse effects can be increased when Etomidate is combined with Prilocaine.Approved
EtoperidoneThe risk or severity of adverse effects can be increased when Prilocaine is combined with Etoperidone.Approved
EtorphineThe risk or severity of adverse effects can be increased when Prilocaine is combined with Etorphine.Illicit, Vet Approved
EzogabineThe risk or severity of adverse effects can be increased when Prilocaine is combined with Ezogabine.Approved
FelbamateThe risk or severity of adverse effects can be increased when Prilocaine is combined with Felbamate.Approved
FencamfamineThe risk or severity of adverse effects can be increased when Prilocaine is combined with Fencamfamine.Approved, Illicit, Withdrawn
FentanylThe risk or severity of adverse effects can be increased when Prilocaine is combined with Fentanyl.Approved, Illicit, Investigational, Vet Approved
FexofenadineThe risk or severity of adverse effects can be increased when Prilocaine is combined with Fexofenadine.Approved
FlibanserinThe risk or severity of adverse effects can be increased when Prilocaine is combined with Flibanserin.Approved
FludiazepamThe risk or severity of adverse effects can be increased when Prilocaine is combined with Fludiazepam.Approved, Illicit
FlunarizineThe risk or severity of adverse effects can be increased when Prilocaine is combined with Flunarizine.Approved
FlunitrazepamThe risk or severity of adverse effects can be increased when Prilocaine is combined with Flunitrazepam.Approved, Illicit
FluoxetineThe risk or severity of adverse effects can be increased when Prilocaine is combined with Fluoxetine.Approved, Vet Approved
FlupentixolThe risk or severity of adverse effects can be increased when Prilocaine is combined with Flupentixol.Approved, Withdrawn
FluphenazineThe risk or severity of adverse effects can be increased when Fluphenazine is combined with Prilocaine.Approved
FlurazepamThe risk or severity of adverse effects can be increased when Flurazepam is combined with Prilocaine.Approved, Illicit
FluspirileneThe risk or severity of adverse effects can be increased when Prilocaine is combined with Fluspirilene.Approved
FlutamideThe risk or severity of adverse effects can be increased when Flutamide is combined with Prilocaine.Approved
Fluticasone PropionateThe risk or severity of adverse effects can be increased when Prilocaine is combined with Fluticasone Propionate.Approved
FluvoxamineThe risk or severity of adverse effects can be increased when Fluvoxamine is combined with Prilocaine.Approved, Investigational
FosphenytoinThe risk or severity of adverse effects can be increased when Prilocaine is combined with Fosphenytoin.Approved
FospropofolThe risk or severity of adverse effects can be increased when Prilocaine is combined with Fospropofol.Approved, Illicit
GabapentinThe risk or severity of adverse effects can be increased when Prilocaine is combined with Gabapentin.Approved, Investigational
gabapentin enacarbilThe risk or severity of adverse effects can be increased when Prilocaine is combined with gabapentin enacarbil.Approved
Gamma Hydroxybutyric AcidThe risk or severity of adverse effects can be increased when Prilocaine is combined with Gamma Hydroxybutyric Acid.Approved, Illicit
GepironeThe risk or severity of adverse effects can be increased when Prilocaine is combined with Gepirone.Investigational
GlutethimideThe risk or severity of adverse effects can be increased when Prilocaine is combined with Glutethimide.Approved, Illicit
GuanfacineThe risk or severity of adverse effects can be increased when Prilocaine is combined with Guanfacine.Approved, Investigational
HalazepamThe risk or severity of adverse effects can be increased when Prilocaine is combined with Halazepam.Approved, Illicit, Withdrawn
HaloperidolThe risk or severity of adverse effects can be increased when Haloperidol is combined with Prilocaine.Approved
HalothaneThe risk or severity of adverse effects can be increased when Prilocaine is combined with Halothane.Approved, Vet Approved
HeroinThe risk or severity of adverse effects can be increased when Prilocaine is combined with Heroin.Approved, Illicit
HexobarbitalThe risk or severity of adverse effects can be increased when Prilocaine is combined with Hexobarbital.Approved
HyaluronidaseThe risk or severity of adverse effects can be increased when Hyaluronidase is combined with Prilocaine.Approved, Investigational
HydrocodonePrilocaine may increase the central nervous system depressant (CNS depressant) activities of Hydrocodone.Approved, Illicit
HydromorphoneThe risk or severity of adverse effects can be increased when Hydromorphone is combined with Prilocaine.Approved, Illicit
HydroxyzineHydroxyzine may increase the central nervous system depressant (CNS depressant) activities of Prilocaine.Approved
IloperidoneThe risk or severity of adverse effects can be increased when Prilocaine is combined with Iloperidone.Approved
ImipramineThe risk or severity of adverse effects can be increased when Prilocaine is combined with Imipramine.Approved
IndalpineThe risk or severity of adverse effects can be increased when Prilocaine is combined with Indalpine.Investigational, Withdrawn
IsofluraneThe risk or severity of adverse effects can be increased when Prilocaine is combined with Isoflurane.Approved, Vet Approved
IsomethepteneThe risk or severity of adverse effects can be increased when Isometheptene is combined with Prilocaine.Approved
Isosorbide DinitrateThe risk or severity of adverse effects can be increased when Isosorbide Dinitrate is combined with Prilocaine.Approved
Isosorbide MononitrateThe risk or severity of adverse effects can be increased when Isosorbide Mononitrate is combined with Prilocaine.Approved
KetamineThe risk or severity of adverse effects can be increased when Prilocaine is combined with Ketamine.Approved, Vet Approved
KetazolamThe risk or severity of adverse effects can be increased when Prilocaine is combined with Ketazolam.Approved
KetobemidoneThe risk or severity of adverse effects can be increased when Prilocaine is combined with Ketobemidone.Approved
LamotrigineThe risk or severity of adverse effects can be increased when Prilocaine is combined with Lamotrigine.Approved, Investigational
LevetiracetamThe risk or severity of adverse effects can be increased when Prilocaine is combined with Levetiracetam.Approved, Investigational
LevobupivacaineThe risk or severity of adverse effects can be increased when Prilocaine is combined with Levobupivacaine.Approved
LevocabastineThe risk or severity of adverse effects can be increased when Prilocaine is combined with Levocabastine.Approved
LevocetirizineThe risk or severity of adverse effects can be increased when Prilocaine is combined with Levocetirizine.Approved
LevodopaThe risk or severity of adverse effects can be increased when Prilocaine is combined with Levodopa.Approved
Levomethadyl AcetateThe risk or severity of adverse effects can be increased when Prilocaine is combined with Levomethadyl Acetate.Approved
LevomilnacipranThe risk or severity of adverse effects can be increased when Prilocaine is combined with Levomilnacipran.Approved
LevorphanolThe risk or severity of adverse effects can be increased when Prilocaine is combined with Levorphanol.Approved
LidocaineThe risk or severity of adverse effects can be increased when Lidocaine is combined with Prilocaine.Approved, Vet Approved
LithiumThe risk or severity of adverse effects can be increased when Prilocaine is combined with Lithium.Approved
LofentanilThe risk or severity of adverse effects can be increased when Prilocaine is combined with Lofentanil.Illicit
LoratadineThe risk or severity of adverse effects can be increased when Prilocaine is combined with Loratadine.Approved
LorazepamThe risk or severity of adverse effects can be increased when Lorazepam is combined with Prilocaine.Approved
LoxapineThe risk or severity of adverse effects can be increased when Loxapine is combined with Prilocaine.Approved
Lu AA21004The risk or severity of adverse effects can be increased when Prilocaine is combined with Lu AA21004.Investigational
LurasidoneThe risk or severity of adverse effects can be increased when Prilocaine is combined with Lurasidone.Approved
MafenideThe risk or severity of adverse effects can be increased when Mafenide is combined with Prilocaine.Approved, Vet Approved
Magnesium SulfateMagnesium Sulfate may increase the central nervous system depressant (CNS depressant) activities of Prilocaine.Approved, Vet Approved
MaprotilineThe risk or severity of adverse effects can be increased when Prilocaine is combined with Maprotiline.Approved
MeclizineThe risk or severity of adverse effects can be increased when Prilocaine is combined with Meclizine.Approved
MedetomidineThe risk or severity of adverse effects can be increased when Prilocaine is combined with Medetomidine.Vet Approved
MelatoninThe risk or severity of adverse effects can be increased when Prilocaine is combined with Melatonin.Approved, Nutraceutical, Vet Approved
MelperoneThe risk or severity of adverse effects can be increased when Prilocaine is combined with Melperone.Approved
MepivacaineThe risk or severity of adverse effects can be increased when Prilocaine is combined with Mepivacaine.Approved, Vet Approved
MeprobamateThe risk or severity of adverse effects can be increased when Meprobamate is combined with Prilocaine.Approved, Illicit
MesoridazineThe risk or severity of adverse effects can be increased when Prilocaine is combined with Mesoridazine.Approved
MetaxaloneThe risk or severity of adverse effects can be increased when Prilocaine is combined with Metaxalone.Approved
MethadoneThe risk or severity of adverse effects can be increased when Methadone is combined with Prilocaine.Approved
Methadyl AcetateThe risk or severity of adverse effects can be increased when Prilocaine is combined with Methadyl Acetate.Approved, Illicit
MethapyrileneThe risk or severity of adverse effects can be increased when Prilocaine is combined with Methapyrilene.Withdrawn
MethaqualoneThe risk or severity of adverse effects can be increased when Prilocaine is combined with Methaqualone.Illicit, Withdrawn
MethocarbamolThe risk or severity of adverse effects can be increased when Prilocaine is combined with Methocarbamol.Approved, Vet Approved
MethohexitalThe risk or severity of adverse effects can be increased when Methohexital is combined with Prilocaine.Approved
MethotrimeprazinePrilocaine may increase the central nervous system depressant (CNS depressant) activities of Methotrimeprazine.Approved
MethoxyfluraneThe risk or severity of adverse effects can be increased when Prilocaine is combined with Methoxyflurane.Approved, Vet Approved
MethsuximideThe risk or severity of adverse effects can be increased when Prilocaine is combined with Methsuximide.Approved
MethylphenobarbitalThe risk or severity of adverse effects can be increased when Prilocaine is combined with Methylphenobarbital.Approved
MetoclopramideThe risk or severity of adverse effects can be increased when Metoclopramide is combined with Prilocaine.Approved, Investigational
MetyrosinePrilocaine may increase the sedative activities of Metyrosine.Approved
MidazolamThe risk or severity of adverse effects can be increased when Midazolam is combined with Prilocaine.Approved, Illicit
MilnacipranThe risk or severity of adverse effects can be increased when Prilocaine is combined with Milnacipran.Approved
MinocyclineMinocycline may increase the central nervous system depressant (CNS depressant) activities of Prilocaine.Approved, Investigational
MirtazapinePrilocaine may increase the central nervous system depressant (CNS depressant) activities of Mirtazapine.Approved
MolindoneThe risk or severity of adverse effects can be increased when Prilocaine is combined with Molindone.Approved
MorphineThe risk or severity of adverse effects can be increased when Morphine is combined with Prilocaine.Approved, Investigational
NabiloneNabilone may increase the central nervous system depressant (CNS depressant) activities of Prilocaine.Approved, Investigational
NalbuphineThe risk or severity of adverse effects can be increased when Prilocaine is combined with Nalbuphine.Approved
NefazodoneThe risk or severity of adverse effects can be increased when Prilocaine is combined with Nefazodone.Approved, Withdrawn
NitrazepamThe risk or severity of adverse effects can be increased when Prilocaine is combined with Nitrazepam.Approved
Nitric OxideThe risk or severity of adverse effects can be increased when Nitric Oxide is combined with Prilocaine.Approved
NitrofurantoinThe risk or severity of adverse effects can be increased when Nitrofurantoin is combined with Prilocaine.Approved, Vet Approved
NitroglycerinThe risk or severity of adverse effects can be increased when Nitroglycerin is combined with Prilocaine.Approved, Investigational
NitroprussideThe risk or severity of adverse effects can be increased when Nitroprusside is combined with Prilocaine.Approved
Nitrous oxideThe risk or severity of adverse effects can be increased when Prilocaine is combined with Nitrous oxide.Approved, Vet Approved
NorfluraneThe risk or severity of adverse effects can be increased when Prilocaine is combined with 1,1,1,2 Tetrafluoroethane.Investigational
NormethadoneThe risk or severity of adverse effects can be increased when Prilocaine is combined with Normethadone.Approved, Illicit
NortriptylineThe risk or severity of adverse effects can be increased when Prilocaine is combined with Nortriptyline.Approved
OlanzapineThe risk or severity of adverse effects can be increased when Olanzapine is combined with Prilocaine.Approved, Investigational
OlopatadineThe risk or severity of adverse effects can be increased when Prilocaine is combined with Olopatadine.Approved
OndansetronThe risk or severity of adverse effects can be increased when Prilocaine is combined with Ondansetron.Approved
OpiumThe risk or severity of adverse effects can be increased when Prilocaine is combined with Opium.Approved, Illicit
OrphenadrinePrilocaine may increase the central nervous system depressant (CNS depressant) activities of Orphenadrine.Approved
OsanetantThe risk or severity of adverse effects can be increased when Prilocaine is combined with Osanetant.Investigational
OxazepamThe risk or severity of adverse effects can be increased when Prilocaine is combined with Oxazepam.Approved
OxetacaineThe risk or severity of adverse effects can be increased when Prilocaine is combined with Oxetacaine.Investigational
OxprenololThe risk or severity of adverse effects can be increased when Prilocaine is combined with Oxprenolol.Approved
OxybuprocaineThe risk or severity of adverse effects can be increased when Prilocaine is combined with Oxybuprocaine.Approved
OxycodoneThe risk or severity of adverse effects can be increased when Oxycodone is combined with Prilocaine.Approved, Illicit, Investigational
OxymorphoneThe risk or severity of adverse effects can be increased when Prilocaine is combined with Oxymorphone.Approved, Investigational, Vet Approved
PaliperidoneThe risk or severity of adverse effects can be increased when Prilocaine is combined with Paliperidone.Approved
ParaldehydePrilocaine may increase the central nervous system depressant (CNS depressant) activities of Paraldehyde.Approved
ParoxetineThe risk or severity of adverse effects can be increased when Prilocaine is combined with Paroxetine.Approved, Investigational
PentazocineThe risk or severity of adverse effects can be increased when Pentazocine is combined with Prilocaine.Approved, Vet Approved
PentobarbitalThe risk or severity of adverse effects can be increased when Pentobarbital is combined with Prilocaine.Approved, Vet Approved
PerampanelPerampanel may increase the central nervous system depressant (CNS depressant) activities of Prilocaine.Approved
PerazineThe risk or severity of adverse effects can be increased when Prilocaine is combined with Perazine.Investigational
PerospironeThe risk or severity of adverse effects can be increased when Prilocaine is combined with Perospirone.Approved
PerphenazineThe risk or severity of adverse effects can be increased when Prilocaine is combined with Perphenazine.Approved
PethidineThe risk or severity of adverse effects can be increased when Pethidine is combined with Prilocaine.Approved
PhenazopyridineThe risk or severity of adverse effects can be increased when Phenazopyridine is combined with Prilocaine.Approved
PhenobarbitalThe risk or severity of adverse effects can be increased when Phenobarbital is combined with Prilocaine.Approved
PhenoxyethanolThe risk or severity of adverse effects can be increased when Prilocaine is combined with Phenoxyethanol.Approved
PhenytoinThe risk or severity of adverse effects can be increased when Phenytoin is combined with Prilocaine.Approved, Vet Approved
PimozideThe risk or severity of adverse effects can be increased when Prilocaine is combined with Pimozide.Approved
PipamperoneThe risk or severity of adverse effects can be increased when Prilocaine is combined with Pipamperone.Approved
PipotiazineThe risk or severity of adverse effects can be increased when Prilocaine is combined with Pipotiazine.Approved
PiritramideThe risk or severity of adverse effects can be increased when Prilocaine is combined with Piritramide.Investigational
PizotifenThe risk or severity of adverse effects can be increased when Prilocaine is combined with Pizotifen.Approved
PomalidomideThe risk or severity of adverse effects can be increased when Prilocaine is combined with Pomalidomide.Approved
PramipexolePrilocaine may increase the sedative activities of Pramipexole.Approved, Investigational
PramocaineThe risk or severity of adverse effects can be increased when Prilocaine is combined with Pramocaine.Approved
PrazepamThe risk or severity of adverse effects can be increased when Prilocaine is combined with Prazepam.Approved, Illicit
PregabalinThe risk or severity of adverse effects can be increased when Pregabalin is combined with Prilocaine.Approved, Illicit, Investigational
PregnanoloneThe risk or severity of adverse effects can be increased when Prilocaine is combined with Pregnanolone.Investigational
PrimaquineThe risk or severity of adverse effects can be increased when Primaquine is combined with Prilocaine.Approved
PrimidoneThe risk or severity of adverse effects can be increased when Prilocaine is combined with Primidone.Approved, Vet Approved
ProcaineThe risk or severity of adverse effects can be increased when Procaine is combined with Prilocaine.Approved, Investigational, Vet Approved
ProchlorperazineThe risk or severity of adverse effects can be increased when Prochlorperazine is combined with Prilocaine.Approved, Vet Approved
PromazineThe risk or severity of adverse effects can be increased when Promazine is combined with Prilocaine.Approved, Vet Approved
PromethazineThe risk or severity of adverse effects can be increased when Prilocaine is combined with Promethazine.Approved
ProparacaineThe risk or severity of adverse effects can be increased when Prilocaine is combined with Proparacaine.Approved, Vet Approved
PropofolThe risk or severity of adverse effects can be increased when Prilocaine is combined with Propofol.Approved, Investigational, Vet Approved
PropoxycaineThe risk or severity of adverse effects can be increased when Prilocaine is combined with Propoxycaine.Approved
ProtriptylineThe risk or severity of adverse effects can be increased when Prilocaine is combined with Protriptyline.Approved
PSD502The risk or severity of adverse effects can be increased when Prilocaine is combined with PSD502.Investigational
QuazepamThe risk or severity of adverse effects can be increased when Prilocaine is combined with Quazepam.Approved, Illicit
QuetiapineThe risk or severity of adverse effects can be increased when Prilocaine is combined with Quetiapine.Approved
QuinineThe risk or severity of adverse effects can be increased when Quinine is combined with Prilocaine.Approved
RacloprideThe risk or severity of adverse effects can be increased when Prilocaine is combined with Raclopride.Investigational
RamelteonThe risk or severity of adverse effects can be increased when Prilocaine is combined with Ramelteon.Approved, Investigational
RemifentanilThe risk or severity of adverse effects can be increased when Prilocaine is combined with Remifentanil.Approved
RemoxiprideThe risk or severity of adverse effects can be increased when Remoxipride is combined with Prilocaine.Approved, Withdrawn
ReserpineThe risk or severity of adverse effects can be increased when Reserpine is combined with Prilocaine.Approved
RisperidoneThe risk or severity of adverse effects can be increased when Risperidone is combined with Prilocaine.Approved, Investigational
RitanserinThe risk or severity of adverse effects can be increased when Prilocaine is combined with Ritanserin.Investigational
RomifidineThe risk or severity of adverse effects can be increased when Prilocaine is combined with Romifidine.Vet Approved
RopinirolePrilocaine may increase the sedative activities of Ropinirole.Approved, Investigational
RopivacaineThe risk or severity of adverse effects can be increased when Ropivacaine is combined with Prilocaine.Approved
RotigotinePrilocaine may increase the sedative activities of Rotigotine.Approved
RufinamideThe risk or severity of adverse effects can be increased when Rufinamide is combined with Prilocaine.Approved
S-EthylisothioureaThe risk or severity of adverse effects can be increased when Prilocaine is combined with S-Ethylisothiourea.Experimental
SAGE-547The risk or severity of adverse effects can be increased when Prilocaine is combined with Sage 547.Investigational
ScopolamineThe risk or severity of adverse effects can be increased when Prilocaine is combined with Scopolamine.Approved
SecobarbitalThe risk or severity of adverse effects can be increased when Secobarbital is combined with Prilocaine.Approved, Vet Approved
SertindoleThe risk or severity of adverse effects can be increased when Prilocaine is combined with Sertindole.Approved, Withdrawn
SertralineThe risk or severity of adverse effects can be increased when Prilocaine is combined with Sertraline.Approved
SevofluraneThe risk or severity of adverse effects can be increased when Prilocaine is combined with Sevoflurane.Approved, Vet Approved
Sodium NitriteThe risk or severity of adverse effects can be increased when Sodium Nitrite is combined with Prilocaine.Approved
Sodium oxybateSodium oxybate may increase the central nervous system depressant (CNS depressant) activities of Prilocaine.Approved
StiripentolThe risk or severity of adverse effects can be increased when Prilocaine is combined with Stiripentol.Approved
SufentanilThe risk or severity of adverse effects can be increased when Sufentanil is combined with Prilocaine.Approved, Investigational
SulfadiazineThe risk or severity of adverse effects can be increased when Sulfadiazine is combined with Prilocaine.Approved, Vet Approved
SulfamethoxazoleThe risk or severity of adverse effects can be increased when Sulfamethoxazole is combined with Prilocaine.Approved
SulpirideThe risk or severity of adverse effects can be increased when Sulpiride is combined with Prilocaine.Approved
SuvorexantPrilocaine may increase the central nervous system depressant (CNS depressant) activities of Suvorexant.Approved
TandospironeThe risk or severity of adverse effects can be increased when Prilocaine is combined with Tandospirone.Investigational
TapentadolTapentadol may increase the central nervous system depressant (CNS depressant) activities of Prilocaine.Approved
TasimelteonThe risk or severity of adverse effects can be increased when Prilocaine is combined with Tasimelteon.Approved
Technetium Tc-99m tilmanoceptPrilocaine may decrease effectiveness of Technetium Tc-99m tilmanocept as a diagnostic agent.Approved
TemazepamThe risk or severity of adverse effects can be increased when Temazepam is combined with Prilocaine.Approved
TetrabenazineThe risk or severity of adverse effects can be increased when Prilocaine is combined with Tetrabenazine.Approved
TetracaineThe risk or severity of adverse effects can be increased when Prilocaine is combined with Tetracaine.Approved, Vet Approved
TetrodotoxinThe risk or severity of adverse effects can be increased when Prilocaine is combined with Tetrodotoxin.Investigational
ThalidomidePrilocaine may increase the central nervous system depressant (CNS depressant) activities of Thalidomide.Approved, Investigational, Withdrawn
ThiamylalThe risk or severity of adverse effects can be increased when Prilocaine is combined with Thiamylal.Approved, Vet Approved
ThiopentalThe risk or severity of adverse effects can be increased when Thiopental is combined with Prilocaine.Approved, Vet Approved
ThioridazineThe risk or severity of adverse effects can be increased when Thioridazine is combined with Prilocaine.Approved
ThiothixeneThe risk or severity of adverse effects can be increased when Prilocaine is combined with Thiothixene.Approved
TiagabineThe risk or severity of adverse effects can be increased when Prilocaine is combined with Tiagabine.Approved
TiaprideThe risk or severity of adverse effects can be increased when Prilocaine is combined with Tiapride.Approved, Investigational
TiletamineThe risk or severity of adverse effects can be increased when Prilocaine is combined with Tiletamine.Vet Approved
TizanidineThe risk or severity of adverse effects can be increased when Prilocaine is combined with Tizanidine.Approved
TolcaponeThe risk or severity of adverse effects can be increased when Prilocaine is combined with Tolcapone.Approved, Withdrawn
TopiramateThe risk or severity of adverse effects can be increased when Prilocaine is combined with Topiramate.Approved
TramadolThe risk or severity of adverse effects can be increased when Tramadol is combined with Prilocaine.Approved, Investigational
Trans-2-PhenylcyclopropylamineThe risk or severity of adverse effects can be increased when Prilocaine is combined with Trans-2-Phenylcyclopropylamine.Experimental
TranylcypromineThe risk or severity of adverse effects can be increased when Prilocaine is combined with Tranylcypromine.Approved
TrazodoneThe risk or severity of adverse effects can be increased when Trazodone is combined with Prilocaine.Approved, Investigational
TriazolamThe risk or severity of adverse effects can be increased when Prilocaine is combined with Triazolam.Approved
TrifluoperazineThe risk or severity of adverse effects can be increased when Prilocaine is combined with Trifluoperazine.Approved
TriflupromazineThe risk or severity of adverse effects can be increased when Triflupromazine is combined with Prilocaine.Approved, Vet Approved
TrimipramineThe risk or severity of adverse effects can be increased when Prilocaine is combined with Trimipramine.Approved
TriprolidineThe risk or severity of adverse effects can be increased when Prilocaine is combined with Triprolidine.Approved
UC1010The risk or severity of adverse effects can be increased when Prilocaine is combined with Uc1010.Investigational
Valproic AcidThe risk or severity of adverse effects can be increased when Valproic Acid is combined with Prilocaine.Approved, Investigational
VenlafaxineThe risk or severity of adverse effects can be increased when Prilocaine is combined with Venlafaxine.Approved
VigabatrinThe risk or severity of adverse effects can be increased when Prilocaine is combined with Vigabatrin.Approved
VortioxetineThe risk or severity of adverse effects can be increased when Prilocaine is combined with Vortioxetine.Approved
XylazineThe risk or severity of adverse effects can be increased when Prilocaine is combined with Xylazine.Vet Approved
ZaleplonThe risk or severity of adverse effects can be increased when Prilocaine is combined with Zaleplon.Approved, Illicit, Investigational
ZiconotideThe risk or severity of adverse effects can be increased when Prilocaine is combined with Ziconotide.Approved
ZimelidineThe risk or severity of adverse effects can be increased when Prilocaine is combined with Zimelidine.Withdrawn
ZiprasidoneThe risk or severity of adverse effects can be increased when Ziprasidone is combined with Prilocaine.Approved
ZolazepamThe risk or severity of adverse effects can be increased when Prilocaine is combined with Zolazepam.Vet Approved
ZolpidemPrilocaine may increase the central nervous system depressant (CNS depressant) activities of Zolpidem.Approved
ZonisamideThe risk or severity of adverse effects can be increased when Prilocaine is combined with Zonisamide.Approved, Investigational
ZopicloneThe risk or severity of adverse effects can be increased when Zopiclone is combined with Prilocaine.Approved
ZotepineThe risk or severity of adverse effects can be increased when Prilocaine is combined with Zotepine.Approved
ZuclopenthixolThe risk or severity of adverse effects can be increased when Prilocaine is combined with Zuclopenthixol.Approved, Investigational
Food InteractionsNot Available
Synthesis Reference

General ReferencesNot Available
External Links
ATC CodesN01BB54N01BB04
AHFS Codes
  • 72:00.00
PDB EntriesNot Available
FDA labelNot Available
MSDSDownload (73.4 KB)
Clinical Trials
Clinical Trials
1CompletedPreventionIntradermal Electroporation1
1CompletedSupportive CareDental Anesthesia Efficacy1
2Not Yet RecruitingTreatmentAnesthetics, Local1
2, 3CompletedTreatmentPremature Ejaculation1
3CompletedSupportive CareProcedural Pain Relief1
3CompletedTreatmentDiabetes Mellitus (DM)1
3CompletedTreatmentFacial Wrinkles at the Nasolabial Folds1
3TerminatedTreatmentBone Marrow Diseases / Pain1
4CompletedNot AvailableHemorrhoids / Peri Anal Fistula1
4CompletedNot AvailablePeriodontal Diseases1
4CompletedSupportive CareElectrodiagnosis1
4CompletedSupportive CareLeukemias / Non Hodgkin Lymphoma (NHL)1
4CompletedSupportive CarePain1
4CompletedSupportive CareTranscervical Resection of Endometrium / Transcervical Resection of Fibroids / Transcervical Resection of Polyp1
4CompletedTreatmentAcne Keloidalis Nuchae / Tattooing1
4CompletedTreatmentBrachial Plexus Blockade1
4CompletedTreatmentKnee Arthritis1
4CompletedTreatmentLocal Anesthesia of the Skin1
4CompletedTreatmentOther Surgical Procedures1
4RecruitingTreatmentPost Operative Pain1
4Unknown StatusDiagnosticHealthy Volunteers2
4Unknown StatusPreventionGynecological Pathologies1
Not AvailableActive Not RecruitingTreatmentHair removal therapy1
Not AvailableCompletedNot AvailableAmbulatory Surgical Procedures / Anesthesia, Spinal / Inguinal Hernias / Umbilical Hernias1
Not AvailableCompletedNot AvailableMethaemoglobinaemia1
Not AvailableCompletedBasic ScienceDiabetic Foot Proned Patients1
Not AvailableCompletedPreventionMyoma of Uterus1
Not AvailableCompletedSupportive CarePain1
Not AvailableCompletedTreatmentAllergic Skin Reaction / Anxiety Disorder1
Not AvailableCompletedTreatmentLocal Anesthesia / Postoperative Pain / Self-Perception1
Not AvailableCompletedTreatmentLumbar Puncture / Topical Analgesia1
Not AvailableCompletedTreatmentOther Surgical Procedures1
Not AvailableCompletedTreatmentStroke1
Not AvailableEnrolling by InvitationNot AvailableArthritis / Gout / Headaches / Migraines / Muscle Spasms / Radicular syndrome / Synovitis / Tendonitis1
Not AvailableNot Yet RecruitingTreatmentPain1
Not AvailableRecruitingPreventionChildren / Pain1
Not AvailableRecruitingPreventionHypotension1
Not AvailableSuspendedSupportive CareNeoplasms, Malignant1
Not AvailableUnknown StatusNot AvailablePlantar Warts1
Not AvailableUnknown StatusTreatmentTuberculosis1
ManufacturersNot Available
Dosage forms
Injection, solutionDental
Injection, solutionDental40 mg/mL
SolutionInfiltration40 mg
Injection, solutionSubcutaneous40 mg/mL
Injection, solutionSubcutaneous
Unit descriptionCostUnit
Prilocaine hcl powder3.98USD g
DrugBank does not sell nor buy drugs. Pricing information is supplied for informational purposes only.
Patent NumberPediatric ExtensionApprovedExpires (estimated)
US6031007 No1997-04-012017-04-01Us
Experimental Properties
melting point37-38 °CPhysProp
boiling point159-162 °C at 1.00E-01 mm HgPhysProp
water solubility541 mg/LNot Available
logP2.11HANSCH,C ET AL. (1995)
Predicted Properties
Water Solubility0.326 mg/mLALOGPS
pKa (Strongest Acidic)13.51ChemAxon
pKa (Strongest Basic)8.82ChemAxon
Physiological Charge1ChemAxon
Hydrogen Acceptor Count2ChemAxon
Hydrogen Donor Count2ChemAxon
Polar Surface Area41.13 Å2ChemAxon
Rotatable Bond Count5ChemAxon
Refractivity67.86 m3·mol-1ChemAxon
Polarizability25.98 Å3ChemAxon
Number of Rings1ChemAxon
Rule of FiveYesChemAxon
Ghose FilterYesChemAxon
Veber's RuleYesChemAxon
MDDR-like RuleYesChemAxon
Predicted ADMET features
Human Intestinal Absorption+0.9557
Blood Brain Barrier+0.9285
Caco-2 permeable+0.7888
P-glycoprotein substrateSubstrate0.6968
P-glycoprotein inhibitor INon-inhibitor0.8019
P-glycoprotein inhibitor IINon-inhibitor0.9165
Renal organic cation transporterNon-inhibitor0.895
CYP450 2C9 substrateNon-substrate0.7803
CYP450 2D6 substrateNon-substrate0.5124
CYP450 3A4 substrateNon-substrate0.5253
CYP450 1A2 substrateNon-inhibitor0.9045
CYP450 2C9 inhibitorNon-inhibitor0.907
CYP450 2D6 inhibitorNon-inhibitor0.9232
CYP450 2C19 inhibitorNon-inhibitor0.9026
CYP450 3A4 inhibitorNon-inhibitor0.8309
CYP450 inhibitory promiscuityLow CYP Inhibitory Promiscuity0.6298
Ames testNon AMES toxic0.7941
BiodegradationNot ready biodegradable0.9577
Rat acute toxicity2.1374 LD50, mol/kg Not applicable
hERG inhibition (predictor I)Weak inhibitor0.9676
hERG inhibition (predictor II)Non-inhibitor0.8577
ADMET data is predicted using admetSAR, a free tool for evaluating chemical ADMET properties. (23092397 )
Mass Spec (NIST)Download (8.45 KB)
Spectrum TypeDescriptionSplash Key
Predicted LC-MS/MSPredicted LC-MS/MS Spectrum - 10V, PositiveNot Available
Predicted LC-MS/MSPredicted LC-MS/MS Spectrum - 20V, PositiveNot Available
Predicted LC-MS/MSPredicted LC-MS/MS Spectrum - 40V, PositiveNot Available
Predicted LC-MS/MSPredicted LC-MS/MS Spectrum - 10V, NegativeNot Available
Predicted LC-MS/MSPredicted LC-MS/MS Spectrum - 20V, NegativeNot Available
Predicted LC-MS/MSPredicted LC-MS/MS Spectrum - 40V, NegativeNot Available
DescriptionThis compound belongs to the class of organic compounds known as alpha amino acid amides. These are amide derivatives of alpha amino acids.
KingdomOrganic compounds
Super ClassOrganic acids and derivatives
ClassCarboxylic acids and derivatives
Sub ClassAmino acids, peptides, and analogues
Direct ParentAlpha amino acid amides
Alternative Parents
  • Alpha-amino acid amide
  • Alanine or derivatives
  • Anilide
  • N-arylamide
  • Toluene
  • Monocyclic benzene moiety
  • Benzenoid
  • Carboxamide group
  • Secondary carboxylic acid amide
  • Secondary amine
  • Secondary aliphatic amine
  • Organopnictogen compound
  • Amine
  • Organooxygen compound
  • Organonitrogen compound
  • Organic nitrogen compound
  • Carbonyl group
  • Organic oxygen compound
  • Organic oxide
  • Hydrocarbon derivative
  • Aromatic homomonocyclic compound
Molecular FrameworkAromatic homomonocyclic compounds
External Descriptors


Pharmacological action
General Function:
Voltage-gated sodium channel activity involved in sa node cell action potential
Specific Function:
This protein mediates the voltage-dependent sodium ion permeability of excitable membranes. Assuming opened or closed conformations in response to the voltage difference across the membrane, the protein forms a sodium-selective channel through which Na(+) ions may pass in accordance with their electrochemical gradient. It is a tetrodotoxin-resistant Na(+) channel isoform. This channel is respon...
Gene Name:
Uniprot ID:
Molecular Weight:
226937.475 Da
  1. Overington JP, Al-Lazikani B, Hopkins AL: How many drug targets are there? Nat Rev Drug Discov. 2006 Dec;5(12):993-6. [PubMed:17139284 ]
  2. Imming P, Sinning C, Meyer A: Drugs, their targets and the nature and number of drug targets. Nat Rev Drug Discov. 2006 Oct;5(10):821-34. [PubMed:17016423 ]
  3. Chen X, Ji ZL, Chen YZ: TTD: Therapeutic Target Database. Nucleic Acids Res. 2002 Jan 1;30(1):412-5. [PubMed:11752352 ]
comments powered by Disqus
Drug created on June 13, 2005 07:24 / Updated on April 22, 2017 04:12