
Logo pink
Are you a
new drug developer?
Contact us to learn more about our customized products and solutions.
Nalidixic acid
Accession Number
DB00779  (APRD01133)
Small Molecule
Approved, Investigational

Nalidixic acid is a synthetic 1,8-naphthyridine antimicrobial agent with a limited bacteriocidal spectrum. It is an inhibitor of the A subunit of bacterial DNA gyrase.

  • 1-Aethyl-7-methyl-1,8-naphthyridin-4-on-3-karbonsaeure
  • 1-ethyl-1,4-dihydro-7-methyl-4-oxo-1,8-naphthyridine-3-carboxylic acid
  • 1-ethyl-7-methyl-1,4-dihydro-1,8-naphthyridin-4-one-3-carboxylic acid
  • 1-Ethyl-7-methyl-4-oxo-1,4-dihydro-[1,8]naphthyridine-3-carboxylic acid
  • 1,4-dihydro-1-ethyl-7-methyl-4-oxo-1,8-naphthyridine-3-carboxylic acid
  • 3-carboxy-1-ethyl-7-methyl-1,8-naphthyridin-4-one
  • Acide nalidixique
  • Acido nalidixico
  • Acidum nalidixicum
  • Nalidixic acid
  • Nalidixinsäure
External IDs
NSC-82174 / WIN 18,320 / Win 18320 / WIN-18320
Prescription Products
NameDosageStrengthRouteLabellerMarketing StartMarketing End
NegGramTablet500 mg/1OralSanofi Aventis1964-03-062003-08-01Us
NegGramTablet500 mgOralSanofi Aventis1964-12-312007-03-28Canada
International/Other Brands
Adix (Nenza Pharma) / Curiemylon (Panion & BF) / Degram (Doctor's Chemical Works) / Delugi (Washington) / Dixicon (Jayson) / Glanega (Meider) / Gramazine (Johnson) / Gramoneg (Ranbaxy) / Huei Yi (Chen Ho) / Lisalenb (San Tong) / Litalon (Li Ta) / Nadixin (Pei Jin) / Nadon (Century) / Nagomin (Ming Ta) / Nal-acid (Farmanic Chemipharma) / Nalic (Yu Sheng) / Nalicid (Torrent) / Nalid (Square) / Nalidin (Fu Yuan) / Nalidix (Dar-Al-Dawa) / Naligram (Acme) / Nalitomylon (The Central) / Nalix (Aristopharma) / Nalixid (Zentiva) / Nalixin (Yung Sine) / Nebactil (Beximco) / Negachine (Hor Chen) / Nevigramon (Sanofi-Aventis) / Unaserus (Isei) / Wintomylon (Sanofi Aventis) / Wintorin (Sankei Yakuhin) / Youdix (Yoshindo) / Zuno-Nathasid (Yung Chang)
CAS number
Average: 232.2353
Monoisotopic: 232.08479226
Chemical Formula
InChI Key
1-ethyl-7-methyl-4-oxo-1,4-dihydro-1,8-naphthyridine-3-carboxylic acid



For the treatment of urinary tract infections caused by susceptible gram-negative microorganisms, including the majority of E. Coli, Enterobacter species, Klebsiella species, and Proteus species.


Nalidixic acid is a quinolone antibacterial agent for oral administration. Nalidixic acid has marked antibacterial activity against gram-negative bacteria including Enterobacter species, Escherichia coli, Morganella Morganii; Proteus Mirabilis, Proteus vulgaris, and Providencia rettgeri. Pseudomonas species are generally resistant to the drug. Nalidixic acid is bactericidal and is effective over the entire urinary pH range. Conventional chromosomal resistance to nalidixic acid taken in full dosage has been reported to emerge in approximately 2 to 14 percent of patients during treatment; however, bacterial resistance to nalidixic acid has not been shown to be transferable via R factor.

Mechanism of action

Evidence exists for Nalidixic acid that its active metabolite, hydroxynalidixic acid, binds strongly, but reversibly, to DNA, interfering with synthesis of RNA and, consequently, with protein synthesis.


Following oral administration, nalidixic acid is rapidly absorbed from the gastrointestinal tract. Bioavailability is approximately 96%. Absorption may be delayed if taken with antacids.

Volume of distribution
Not Available
Protein binding

Nalidixic acid is 93% bound to protein in the blood, and the active metabolite, hydroxynalidixic acid is 63% bound.


Hepatic. 30% of administered dose is metabolized to the active metabolite, hydroxynalidixic acid. Rapid conjugation of parent drug and active metabolite to inactive metabolites. Metabolism may vary widely among individuals. In the urine, hydroxynalidixic acid represents 80 to 85% of the antibacterial activity.

Route of elimination

Following oral administration, NegGram is rapidly absorbed from the gastrointestinal tract, partially metabolized in the liver, and rapidly excreted through the kidneys. Approximately four percent of NegGram is excreted in the feces.

Half life

1.1 to 2.5 hours in healthy adult patients, and up to 21 hours in patients with impaired renal function.

Not Available

ORAL (LD50): Acute: 1160 mg/kg [Rat]. 572 mg/kg [Mouse]. Toxic psychosis, convulsions, increased intracranial pressure, or metabolic acidosis may occur in patients taking more than the recommended dosage. Vomiting, nausea, and lethargy may also occur following overdosage.

Affected organisms
  • Enteric bacteria and other eubacteria
Not Available
Pharmacogenomic Effects/ADRs
Interacting Gene/EnzymeAllele nameGenotype(s)Defining Change(s)Type(s)DescriptionDetails
Glucose-6-phosphate 1-dehydrogenaseVilleurbanneNot Available1000_1002delACCADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseTorunNot Available1006A->GADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseSunderlandNot Available105_107delCATADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseIwatsukiNot Available1081G->AADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseSerresNot Available1082C->TADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseTondelaNot Available1084_1101delCTGAACGAGCGCAAGGCCADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseLoma LindaNot Available1089C->AADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseAachenNot Available1089C->GADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseTenriNot Available1096A->GADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseMontpellierNot Available1132G>AADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseCalvo MackennaNot Available1138A->GADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseRileyNot Available1139T->CADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseOlomoucNot Available1141T->CADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseTomahNot Available1153T->CADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseLynwoodNot Available1154G->TADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseMadridNot Available1155C->GADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseIowa, Walter Reed, SpringfieldNot Available1156A->GADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseBeverly Hills, Genova, Iwate, Niigata, YamaguchiNot Available1160G->AADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseHartfordNot Available1162A->GADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenasePrahaNot Available1166A->GADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseKrakowNot Available1175T>CADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseWisconsinNot Available1177C->GADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseNashville, Anaheim, PorticiNot Available1178G->AADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseAlhambraNot Available1180G->CADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseBariNot Available1187C->TADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenasePuerto LimonNot Available1192G->AADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseCovao do LoboNot Available1205C>AADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseClinicNot Available1215G->AADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseUtrechtNot Available1225C->TADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseSuwalkiNot Available1226C->GADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseRiversideNot Available1228G->TADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseJapan, ShinagawaNot Available1229G->AADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseKawasakiNot Available1229G->CADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseMunichNot Available1231A->GADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseGeorgiaNot Available1284C->AADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseSumareNot Available1292T->GADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseTelti/KobeNot Available1318C->TADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseSantiago de Cuba, MoriokaNot Available1339G->AADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseHarimaNot Available1358T->AADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseFiguera da FozNot Available1366G->CADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseAmiensNot Available1367A>TADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseBangkok NoiNot Available1376G->T, 1502T->GADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseFukayaNot Available1462G->AADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseCampinasNot Available1463G->TADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseBuenos AiresNot Available1465C>TADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseArakawaNot Available1466C->TADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseBrightonNot Available1488_1490delGAAADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseKozukataNot Available159G->CADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseAmsterdamNot Available180_182delTCTADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseNo nameNot Available202G->A, 376A->G, 1264C>GADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseSwanseaNot Available224T->CADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseUrayasuNot Available281_283delAGAADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseVancouverNot Available317C->G544C->T592C->TADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseMt SinaiNot Available376A->G, 1159C->TADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenasePlymouthNot Available488G->AADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseVolendamNot Available514C->TADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseShinshuNot Available527A->GADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseChikugoNot Available535A->TADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseTsukuiNot Available561_563delCTCADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenasePedoplis-CkaroNot Available573C>GADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseSantiagoNot Available593G->CADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseMinnesota, Marion, Gastonia, LeJeuneNot Available637G->TADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseCincinnatiNot Available637G->T, 1037A->TADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseHarilaouNot Available648T->GADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseNorth DallasNot Available683_685delACAADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseAsahikawaNot Available695G->AADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseDurhamNot Available713A->GADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseStonybrookNot Available724_729delGGCACTADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseWayneNot Available769C->GADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseAveiroNot Available806G->AADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseCleveland CorumNot Available820G->AADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseLilleNot Available821A>TADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseBangkokNot Available825G>CADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseSugaoNot Available826C->TADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseLa JollaNot Available832T->CADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseWexhamNot Available833C->TADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenasePiotrkowNot Available851T>CADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseWest VirginiaNot Available910G->TADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseOmiyaNot Available921G->CADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseNaraNot Available953_976delCCACCAAAGGGTACCTGGAC GACCADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseManhattanNot Available962G->AADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseRehevotNot Available964T->CADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseHoniaraNot Available99A->G / 1360C->TADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseTokyo, FukushimaNot Available1246G->AADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseChathamNot Available1003G->AADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseFushanNot Available1004C->AADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenasePartenopeNot Available1052G->TADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseIerapetraNot Available1057C->TADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseAnadiaNot Available1193A->GADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseAbenoNot Available1220A->CADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseSurabayaNot Available1291G->AADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenasePawneeNot Available1316G->CADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseS. AntiocoNot Available1342A->GADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseCassanoNot Available1347G->CADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseHermoupolisNot Available1347G->C / 1360C->TADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseUnion,Maewo, Chinese-2, KaloNot Available1360C->TADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseAndalusNot Available1361G->AADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseCosenzaNot Available1376G->CADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseCanton, Taiwan- Hakka, Gifu-like, Agrigento-likeNot Available1376G->TADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseFloresNot Available1387C->AADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseKaiping, Anant, Dhon, Sapporo-like, WoseraNot Available1388G->AADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseKamogawaNot Available169C->TADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseCostanzoNot Available179T>CADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseAmazoniaNot Available185C->AADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseSongklanagarindNot Available196T->AADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseHechiNot Available202G->A / 871G->AADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseNamouruNot Available208T->CADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseBao LocNot Available352T>CADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseCrispimNot Available375G->T, 379G->T383T->C384C>TADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseAcrokorinthosNot Available376A->G / 463C->GADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseSanta MariaNot Available376A->G / 542A->TADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseAnanindeuaNot Available376A->G / 871G->AADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseVanua LavaNot Available383T->CADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseValladolidNot Available406C->TADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseBelemNot Available409C->TADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseLiuzhouNot Available442G->AADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseShenzenNot Available473G>AADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseTaipei “Chinese- 3”Not Available493A->GADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseToledoNot Available496C>TADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseNaoneNot Available497G->AADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseNankangNot Available517T->CADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseMiaoliNot Available519C->GADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseMediterranean, Dallas, Panama‚ Sassari, Cagliari, BirminghamNot Available563C->TADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseCoimbra ShundeNot Available592C->TADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseNilgiriNot Available593G>AADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseRadlowoNot Available679C->TADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseRoubaixNot Available811G>CADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseHaikouNot Available835A->GADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseChinese-1Not Available835A->TADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseMizushimaNot Available848A>GADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseOsakaNot Available853C->TADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseViangchan, JammuNot Available871G->AADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseSeoulNot Available916G->AADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseLudhianaNot Available929G->AADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseFarroupilhaNot Available977C->AADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseChinese-5Not Available1024C->TADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseRignanoNot Available130G>AADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseOrissaNot Available131C->GADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseG6PDNiceNot Available1380G>CADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseKamiube, KeelungNot Available1387C->TADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseNeapolisNot Available1400C->GADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseAuresNot Available143T->CADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseSplitNot Available1442C->GADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseKambosNot Available148C->TADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenasePalestrinaNot Available170G>AADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseMetapontoNot Available172G->AADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseMusashinoNot Available185C->TADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseAsahiNot Available202G->AADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseA- (202), Ferrara INot Available202G->A / 376A->GADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseMurcia OristanoNot Available209A->GADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseUbe KonanNot Available241C->TADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseLagosantoNot Available242G->AADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseGuangzhouNot Available274C->TADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseHammersmithNot Available323T->AADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseSinnaiNot Available34G->TADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseA- (680)Not Available376A->G / 680G->TADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseA- (968), Betica,Selma, GuantanamoNot Available376A->G / 968T->CADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseSalerno PyrgosNot Available383T>GADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseQuing YanNot Available392G->TADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseLagesNot Available40G->AADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseIleshaNot Available466G->AADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseMahidolNot Available487G->AADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseMalagaNot Available542A->TADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseSibariNot Available634A->GADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseMexico CityNot Available680G->AADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseNanningNot Available703C->TADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseSeattle, Lodi, Modena, Ferrara II, Athens-likeNot Available844G->CADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseBajo MaumereNot Available844G->TADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseMontalbanoNot Available854G->AADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseKalyan-Kerala, Jamnaga, RohiniNot Available949G->AADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseGaoheNot Available95A->GADR InferredIncreased risk of hemolytic anemia.Details


Drug Interactions
(R)-warfarinThe therapeutic efficacy of (R)-warfarin can be increased when used in combination with Nalidixic acid.
(S)-WarfarinThe therapeutic efficacy of (S)-Warfarin can be increased when used in combination with Nalidixic acid.
2,4-thiazolidinedioneThe therapeutic efficacy of 2,4-thiazolidinedione can be increased when used in combination with Nalidixic acid.
3-isobutyl-1-methyl-7H-xanthineThe metabolism of 3-isobutyl-1-methyl-7H-xanthine can be decreased when combined with Nalidixic acid.
4-hydroxycoumarinThe therapeutic efficacy of 4-hydroxycoumarin can be increased when used in combination with Nalidixic acid.
6-O-benzylguanineThe metabolism of 6-O-benzylguanine can be decreased when combined with Nalidixic acid.
7-DeazaguanineThe metabolism of 7-Deazaguanine can be decreased when combined with Nalidixic acid.
7-NitroindazoleThe therapeutic efficacy of 7-Nitroindazole can be decreased when used in combination with Nalidixic acid.
7,9-DimethylguanineThe metabolism of 7,9-Dimethylguanine can be decreased when combined with Nalidixic acid.
8-azaguanineThe metabolism of 8-azaguanine can be decreased when combined with Nalidixic acid.
Food Interactions
  • Take with food to reduce irritation. Drink liberally.


Synthesis Reference

Charles L. Fox, Jr., Shanta Modak, Keith Reemtsma, "Injection-resistant materials and method of making same through use of nalidixic acid derivatives." U.S. Patent US4563485, issued July, 1984.

General References
Not Available
External Links
Human Metabolome Database
KEGG Compound
PubChem Compound
PubChem Substance
Therapeutic Targets Database
RxList Drug Page Drug Page
ATC Codes
J01MB02 — Nalidixic acid
PDB Entries
FDA label
Download (47.9 KB)
Download (73.2 KB)

Clinical Trials

Clinical Trials


  • Sanofi aventis us llc
  • Mutual pharmaceutical co inc
  • Watson laboratories inc
  • Professional Co.
  • Sanofi-Aventis Inc.
Dosage forms
TabletOral500 mg/1
TabletOral500 mg
Unit descriptionCostUnit
Nalidixic acid powder7.2USD g
DrugBank does not sell nor buy drugs. Pricing information is supplied for informational purposes only.
Not Available


Experimental Properties
melting point (°C)229.5 °CPhysProp
water solubility100 mg/L (at 23 °C)MERCK INDEX (1996)
logP1.59BIOBYTE (1995)
logS-3.37ADME Research, USCD
pKa8.6OSOL,A & HOOVER,JE (1975)
Predicted Properties
Water Solubility2.3 mg/mLALOGPS
pKa (Strongest Acidic)5.95ChemAxon
pKa (Strongest Basic)4.68ChemAxon
Physiological Charge-1ChemAxon
Hydrogen Acceptor Count5ChemAxon
Hydrogen Donor Count1ChemAxon
Polar Surface Area70.5 Å2ChemAxon
Rotatable Bond Count2ChemAxon
Refractivity62.82 m3·mol-1ChemAxon
Polarizability23.65 Å3ChemAxon
Number of Rings2ChemAxon
Rule of FiveYesChemAxon
Ghose FilterYesChemAxon
Veber's RuleNoChemAxon
MDDR-like RuleNoChemAxon
Predicted ADMET features
Human Intestinal Absorption+0.9873
Blood Brain Barrier+0.8945
Caco-2 permeable+0.6315
P-glycoprotein substrateNon-substrate0.5071
P-glycoprotein inhibitor INon-inhibitor0.8838
P-glycoprotein inhibitor IINon-inhibitor0.8566
Renal organic cation transporterNon-inhibitor0.8104
CYP450 2C9 substrateNon-substrate0.7898
CYP450 2D6 substrateNon-substrate0.9116
CYP450 3A4 substrateNon-substrate0.7202
CYP450 1A2 substrateNon-inhibitor0.7888
CYP450 2C9 inhibitorNon-inhibitor0.8934
CYP450 2D6 inhibitorNon-inhibitor0.9115
CYP450 2C19 inhibitorNon-inhibitor0.7834
CYP450 3A4 inhibitorNon-inhibitor0.9531
CYP450 inhibitory promiscuityLow CYP Inhibitory Promiscuity0.8555
Ames testNon AMES toxic0.9133
BiodegradationNot ready biodegradable0.8553
Rat acute toxicity2.0874 LD50, mol/kg Not applicable
hERG inhibition (predictor I)Weak inhibitor0.9392
hERG inhibition (predictor II)Non-inhibitor0.8534
ADMET data is predicted using admetSAR, a free tool for evaluating chemical ADMET properties. (23092397)


Mass Spec (NIST)
Not Available
SpectrumSpectrum TypeSplash Key
Predicted GC-MS Spectrum - GC-MSPredicted GC-MSNot Available
Predicted MS/MS Spectrum - 10V, Positive (Annotated)Predicted LC-MS/MSNot Available
Predicted MS/MS Spectrum - 20V, Positive (Annotated)Predicted LC-MS/MSNot Available
Predicted MS/MS Spectrum - 40V, Positive (Annotated)Predicted LC-MS/MSNot Available
Predicted MS/MS Spectrum - 10V, Negative (Annotated)Predicted LC-MS/MSNot Available
Predicted MS/MS Spectrum - 20V, Negative (Annotated)Predicted LC-MS/MSNot Available
Predicted MS/MS Spectrum - 40V, Negative (Annotated)Predicted LC-MS/MSNot Available
LC-MS/MS Spectrum - LC-ESI-qTof , PositiveLC-MS/MSNot Available
LC-MS/MS Spectrum - LC-ESI-qTof , PositiveLC-MS/MSNot Available
LC-MS/MS Spectrum - LC-ESI-QQ , positiveLC-MS/MSsplash10-001i-0090000000-b3f65ce918413bce9fa8
LC-MS/MS Spectrum - LC-ESI-QQ , positiveLC-MS/MSsplash10-014i-0090000000-0ff01a82dbce74faefc6
LC-MS/MS Spectrum - LC-ESI-QQ , positiveLC-MS/MSsplash10-014r-0790000000-46caea0fd85329797145
LC-MS/MS Spectrum - LC-ESI-QQ , positiveLC-MS/MSsplash10-000i-0900000000-3572ae3957b712815a4f
LC-MS/MS Spectrum - LC-ESI-QQ , positiveLC-MS/MSsplash10-0zgr-0900000000-a89fdf787950fb2d88c2
LC-MS/MS Spectrum - LC-ESI-IT , positiveLC-MS/MSsplash10-0a4i-0290000000-db7256d80ff333bc00bf
MS/MS Spectrum - , positiveLC-MS/MSsplash10-015i-0590000000-938c78d9d632c54cdffe
MS/MS Spectrum - , positiveLC-MS/MSsplash10-014r-0590000000-0071689427e5460e9504
MS/MS Spectrum - , positiveLC-MS/MSsplash10-053i-2920000000-a81650e261062799ba89


This compound belongs to the class of organic compounds known as naphthyridine carboxylic acids and derivatives. These are compounds containing a naphthyridine moiety, where one of the ring atoms bears a carboxylic acid group.
Organic compounds
Super Class
Organoheterocyclic compounds
Sub Class
Direct Parent
Naphthyridine carboxylic acids and derivatives
Alternative Parents
Pyridinecarboxylic acids / Methylpyridines / Vinylogous amides / Heteroaromatic compounds / Monocarboxylic acids and derivatives / Carboxylic acids / Azacyclic compounds / Organopnictogen compounds / Organooxygen compounds / Organonitrogen compounds
show 2 more
Naphthyridine carboxylic acid / Pyridine carboxylic acid / Pyridine carboxylic acid or derivatives / Methylpyridine / Pyridine / Heteroaromatic compound / Vinylogous amide / Azacycle / Monocarboxylic acid or derivatives / Carboxylic acid
show 9 more
Molecular Framework
Aromatic heteropolycyclic compounds
External Descriptors
monocarboxylic acid, 1,8-naphthyridine derivative, quinolone antibiotic (CHEBI:100147) / 4-Quinolones (C05079)


1. DNA
Pharmacological action
General Function:
Used for biological information storage.
Specific Function:
DNA contains the instructions needed for an organism to develop, survive and reproduce.
Molecular Weight:
2.15 x 1012 Da
  1. Imming P, Sinning C, Meyer A: Drugs, their targets and the nature and number of drug targets. Nat Rev Drug Discov. 2006 Oct;5(10):821-34. [PubMed:17016423]
  2. Avsaroglu MD, Helmuth R, Junker E, Hertwig S, Schroeter A, Akcelik M, Bozoglu F, Guerra B: Plasmid-mediated quinolone resistance conferred by qnrS1 in Salmonella enterica serovar Virchow isolated from Turkish food of avian origin. J Antimicrob Chemother. 2007 Nov;60(5):1146-50. Epub 2007 Sep 19. [PubMed:17881633]
  3. Jain A, Rajeswari MR: Preferential binding of quinolones to DNA with alternating G, C / A, T sequences: a spectroscopic study. J Biomol Struct Dyn. 2002 Oct;20(2):291-9. [PubMed:12354080]


Pharmacological action
General Function
Tryptophan 2,3-dioxygenase activity
Specific Function
Incorporates oxygen into the indole moiety of tryptophan. Has a broad specificity towards tryptamine and derivatives including D- and L-tryptophan, 5-hydroxytryptophan and serotonin (By similarity).
Gene Name
Uniprot ID
Uniprot Name
Tryptophan 2,3-dioxygenase
Molecular Weight
47871.215 Da
  1. Sanzey B: Modulation of gene expression by drugs affecting deoxyribonucleic acid gyrase. J Bacteriol. 1979 Apr;138(1):40-7. [PubMed:108253]


Pharmacological action
General Function
Sodium-independent organic anion transmembrane transporter activity
Specific Function
Involved in the renal elimination of endogenous and exogenous organic anions. Functions as organic anion exchanger when the uptake of one molecule of organic anion is coupled with an efflux of one ...
Gene Name
Uniprot ID
Uniprot Name
Solute carrier family 22 member 6
Molecular Weight
61815.78 Da
  1. Sekine T, Watanabe N, Hosoyamada M, Kanai Y, Endou H: Expression cloning and characterization of a novel multispecific organic anion transporter. J Biol Chem. 1997 Jul 25;272(30):18526-9. [PubMed:9228014]

Drug created on June 13, 2005 07:24 / Updated on April 19, 2019 19:21