
Nalidixic Acid
Accession Number
DB00779  (APRD01133)
Small Molecule
Approved, Investigational

A synthetic 1,8-naphthyridine antimicrobial agent with a limited bacteriocidal spectrum. It is an inhibitor of the A subunit of bacterial DNA gyrase. [PubChem]

  • 1-Aethyl-7-methyl-1,8-naphthyridin-4-on-3-karbonsaeure
  • 1-Ethyl-1,4-dihydro-7-methyl-4-oxo-1,8-naphthyridine-3-carboxylic acid
  • 1-Ethyl-7-methyl-1,4-dihydro-1,8-naphthyridin-4-one-3-carboxylic acid
  • 1-Ethyl-7-methyl-4-oxo-1,4-dihydro-[1,8]naphthyridine-3-carboxylic acid
  • 1,4-dihydro-1-Ethyl-7-methyl-4-oxo-1,8-naphthyridine-3-carboxylic acid
  • 3-Carboxy-1-ethyl-7-methyl-1,8-naphthyridin-4-one
  • Acide nalidixique
  • Acido nalidixico
  • Acidum Nalidixicum
  • Nalidixic acid
  • Nalidixinsäure
External IDs
NSC-82174 / WIN 18,320 / Win 18320 / WIN-18320
Prescription Products
NameDosageStrengthRouteLabellerMarketing StartMarketing End
NeggramTablet500 mgOralSanofi Aventis1964-12-312007-03-28Canada
International/Other Brands
Adix (Nenza Pharma) / Curiemylon (Panion & BF) / Degram (Doctor's Chemical Works) / Delugi (Washington) / Dixicon (Jayson) / Glanega (Meider) / Gramazine (Johnson) / Gramoneg (Ranbaxy) / Huei Yi (Chen Ho) / Lisalenb (San Tong) / Litalon (Li Ta) / Nadixin (Pei Jin) / Nadon (Century) / Nagomin (Ming Ta) / Nal-acid (Farmanic Chemipharma) / Nalic (Yu Sheng) / Nalicid (Torrent) / Nalid (Square) / Nalidin (Fu Yuan) / Nalidix (Dar-Al-Dawa) / Naligram (Acme) / Nalitomylon (The Central) / Nalix (Aristopharma) / Nalixid (Zentiva) / Nalixin (Yung Sine) / Nebactil (Beximco) / Negachine (Hor Chen) / Nevigramon (Sanofi-Aventis) / Unaserus (Isei) / Wintomylon (Sanofi Aventis) / Wintorin (Sankei Yakuhin) / Youdix (Yoshindo) / Zuno-Nathasid (Yung Chang)
CAS number
Average: 232.2353
Monoisotopic: 232.08479226
Chemical Formula
InChI Key
1-ethyl-7-methyl-4-oxo-1,4-dihydro-1,8-naphthyridine-3-carboxylic acid



For the treatment of urinary tract infections caused by susceptible gram-negative microorganisms, including the majority of E. Coli, Enterobacter species, Klebsiella species, and Proteus species.

Structured Indications
Not Available

Nalidixic acid is a quinolone antibacterial agent for oral administration. Nalidixic acid has marked antibacterial activity against gram-negative bacteria including Enterobacter species, Escherichia coli, Morganella Morganii; Proteus Mirabilis, Proteus vulgaris, and Providencia rettgeri. Pseudomonas species are generally resistant to the drug. Nalidixic acid is bactericidal and is effective over the entire urinary pH range. Conventional chromosomal resistance to nalidixic acid taken in full dosage has been reported to emerge in approximately 2 to 14 percent of patients during treatment; however, bacterial resistance to nalidixic acid has not been shown to be transferable via R factor.

Mechanism of action

Evidence exists for Nalidixic acid that its active metabolite, hydroxynalidixic acid, binds strongly, but reversibly, to DNA, interfering with synthesis of RNA and, consequently, with protein synthesis.


Following oral administration, nalidixic acid is rapidly absorbed from the gastrointestinal tract. Bioavailability is approximately 96%. Absorption may be delayed if taken with antacids.

Volume of distribution
Not Available
Protein binding

Nalidixic acid is 93% bound to protein in the blood, and the active metabolite, hydroxynalidixic acid is 63% bound.


Hepatic. 30% of administered dose is metabolized to the active metabolite, hydroxynalidixic acid. Rapid conjugation of parent drug and active metabolite to inactive metabolites. Metabolism may vary widely among individuals. In the urine, hydroxynalidixic acid represents 80 to 85% of the antibacterial activity.

Route of elimination

Following oral administration, NegGram is rapidly absorbed from the gastrointestinal tract, partially metabolized in the liver, and rapidly excreted through the kidneys. Approximately four percent of NegGram is excreted in the feces.

Half life

1.1 to 2.5 hours in healthy adult patients, and up to 21 hours in patients with impaired renal function.

Not Available

ORAL (LD50): Acute: 1160 mg/kg [Rat]. 572 mg/kg [Mouse]. Toxic psychosis, convulsions, increased intracranial pressure, or metabolic acidosis may occur in patients taking more than the recommended dosage. Vomiting, nausea, and lethargy may also occur following overdosage.

Affected organisms
  • Enteric bacteria and other eubacteria
Not Available
Pharmacogenomic Effects/ADRs
Interacting Gene/EnzymeAllele nameGenotype(s)Defining Change(s)Type(s)DescriptionDetails
Glucose-6-phosphate 1-dehydrogenaseVilleurbanneNot Available1000_1002delACCADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseTorunNot Available1006A->GADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseSunderlandNot Available105_107delCATADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseIwatsukiNot Available1081G->AADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseSerresNot Available1082C->TADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseTondelaNot Available1084_1101delCTGAACGAGCGCAAGGCCADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseLoma LindaNot Available1089C->AADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseAachenNot Available1089C->GADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseTenriNot Available1096A->GADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseMontpellierNot Available1132G>AADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseCalvo MackennaNot Available1138A->GADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseRileyNot Available1139T->CADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseOlomoucNot Available1141T->CADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseTomahNot Available1153T->CADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseLynwoodNot Available1154G->TADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseMadridNot Available1155C->GADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseIowa, Walter Reed, SpringfieldNot Available1156A->GADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseBeverly Hills, Genova, Iwate, Niigata, YamaguchiNot Available1160G->AADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseHartfordNot Available1162A->GADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenasePrahaNot Available1166A->GADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseKrakowNot Available1175T>CADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseWisconsinNot Available1177C->GADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseNashville, Anaheim, PorticiNot Available1178G->AADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseAlhambraNot Available1180G->CADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseBariNot Available1187C->TADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenasePuerto LimonNot Available1192G->AADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseCovao do LoboNot Available1205C>AADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseClinicNot Available1215G->AADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseUtrechtNot Available1225C->TADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseSuwalkiNot Available1226C->GADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseRiversideNot Available1228G->TADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseJapan, ShinagawaNot Available1229G->AADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseKawasakiNot Available1229G->CADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseMunichNot Available1231A->GADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseGeorgiaNot Available1284C->AADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseSumareNot Available1292T->GADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseTelti/KobeNot Available1318C->TADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseSantiago de Cuba, MoriokaNot Available1339G->AADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseHarimaNot Available1358T->AADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseFiguera da FozNot Available1366G->CADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseAmiensNot Available1367A>TADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseBangkok NoiNot Available1376G->T, 1502T->GADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseFukayaNot Available1462G->AADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseCampinasNot Available1463G->TADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseBuenos AiresNot Available1465C>TADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseArakawaNot Available1466C->TADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseBrightonNot Available1488_1490delGAAADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseKozukataNot Available159G->CADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseAmsterdamNot Available180_182delTCTADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseNo nameNot Available202G->A, 376A->G, 1264C>GADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseSwanseaNot Available224T->CADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseUrayasuNot Available281_283delAGAADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseVancouverNot Available317C->G544C->T592C->TADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseMt SinaiNot Available376A->G, 1159C->TADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenasePlymouthNot Available488G->AADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseVolendamNot Available514C->TADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseShinshuNot Available527A->GADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseChikugoNot Available535A->TADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseTsukuiNot Available561_563delCTCADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenasePedoplis-CkaroNot Available573C>GADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseSantiagoNot Available593G->CADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseMinnesota, Marion, Gastonia, LeJeuneNot Available637G->TADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseCincinnatiNot Available637G->T, 1037A->TADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseHarilaouNot Available648T->GADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseNorth DallasNot Available683_685delACAADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseAsahikawaNot Available695G->AADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseDurhamNot Available713A->GADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseStonybrookNot Available724_729delGGCACTADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseWayneNot Available769C->GADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseAveiroNot Available806G->AADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseCleveland CorumNot Available820G->AADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseLilleNot Available821A>TADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseBangkokNot Available825G>CADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseSugaoNot Available826C->TADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseLa JollaNot Available832T->CADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseWexhamNot Available833C->TADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenasePiotrkowNot Available851T>CADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseWest VirginiaNot Available910G->TADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseOmiyaNot Available921G->CADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseNaraNot Available953_976delCCACCAAAGGGTACCTGGAC GACCADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseManhattanNot Available962G->AADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseRehevotNot Available964T->CADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseHoniaraNot Available99A->G / 1360C->TADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseTokyo, FukushimaNot Available1246G->AADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseChathamNot Available1003G->AADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseFushanNot Available1004C->AADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenasePartenopeNot Available1052G->TADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseIerapetraNot Available1057C->TADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseAnadiaNot Available1193A->GADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseAbenoNot Available1220A->CADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseSurabayaNot Available1291G->AADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenasePawneeNot Available1316G->CADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseS. AntiocoNot Available1342A->GADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseCassanoNot Available1347G->CADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseHermoupolisNot Available1347G->C / 1360C->TADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseUnion,Maewo, Chinese-2, KaloNot Available1360C->TADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseAndalusNot Available1361G->AADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseCosenzaNot Available1376G->CADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseCanton, Taiwan- Hakka, Gifu-like, Agrigento-likeNot Available1376G->TADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseFloresNot Available1387C->AADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseKaiping, Anant, Dhon, Sapporo-like, WoseraNot Available1388G->AADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseKamogawaNot Available169C->TADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseCostanzoNot Available179T>CADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseAmazoniaNot Available185C->AADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseSongklanagarindNot Available196T->AADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseHechiNot Available202G->A / 871G->AADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseNamouruNot Available208T->CADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseBao LocNot Available352T>CADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseCrispimNot Available375G->T, 379G->T383T->C384C>TADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseAcrokorinthosNot Available376A->G / 463C->GADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseSanta MariaNot Available376A->G / 542A->TADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseAnanindeuaNot Available376A->G / 871G->AADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseVanua LavaNot Available383T->CADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseValladolidNot Available406C->TADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseBelemNot Available409C->TADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseLiuzhouNot Available442G->AADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseShenzenNot Available473G>AADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseTaipei “Chinese- 3”Not Available493A->GADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseToledoNot Available496C>TADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseNaoneNot Available497G->AADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseNankangNot Available517T->CADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseMiaoliNot Available519C->GADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseMediterranean, Dallas, Panama‚ Sassari, Cagliari, BirminghamNot Available563C->TADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseCoimbra ShundeNot Available592C->TADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseNilgiriNot Available593G>AADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseRadlowoNot Available679C->TADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseRoubaixNot Available811G>CADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseHaikouNot Available835A->GADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseChinese-1Not Available835A->TADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseMizushimaNot Available848A>GADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseOsakaNot Available853C->TADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseViangchan, JammuNot Available871G->AADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseSeoulNot Available916G->AADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseLudhianaNot Available929G->AADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseFarroupilhaNot Available977C->AADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseChinese-5Not Available1024C->TADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseRignanoNot Available130G>AADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseOrissaNot Available131C->GADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseG6PDNiceNot Available1380G>CADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseKamiube, KeelungNot Available1387C->TADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseNeapolisNot Available1400C->GADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseAuresNot Available143T->CADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseSplitNot Available1442C->GADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseKambosNot Available148C->TADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenasePalestrinaNot Available170G>AADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseMetapontoNot Available172G->AADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseMusashinoNot Available185C->TADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseAsahiNot Available202G->AADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseA- (202), Ferrara INot Available202G->A / 376A->GADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseMurcia OristanoNot Available209A->GADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseUbe KonanNot Available241C->TADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseLagosantoNot Available242G->AADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseGuangzhouNot Available274C->TADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseHammersmithNot Available323T->AADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseSinnaiNot Available34G->TADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseA- (680)Not Available376A->G / 680G->TADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseA- (968), Betica,Selma, GuantanamoNot Available376A->G / 968T->CADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseSalerno PyrgosNot Available383T>GADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseQuing YanNot Available392G->TADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseLagesNot Available40G->AADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseIleshaNot Available466G->AADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseMahidolNot Available487G->AADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseMalagaNot Available542A->TADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseSibariNot Available634A->GADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseMexico CityNot Available680G->AADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseNanningNot Available703C->TADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseSeattle, Lodi, Modena, Ferrara II, Athens-likeNot Available844G->CADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseBajo MaumereNot Available844G->TADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseMontalbanoNot Available854G->AADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseKalyan-Kerala, Jamnaga, RohiniNot Available949G->AADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseGaoheNot Available95A->GADR InferredIncreased risk of hemolytic anemia.Details


Drug Interactions
DrugInteractionDrug group
16-BromoepiandrosteroneThe risk or severity of adverse effects can be increased when 16-Bromoepiandrosterone is combined with Nalidixic Acid.Investigational
19-norandrostenedioneThe risk or severity of adverse effects can be increased when 19-norandrostenedione is combined with Nalidixic Acid.Experimental, Illicit
5-androstenedioneThe risk or severity of adverse effects can be increased when 5-androstenedione is combined with Nalidixic Acid.Experimental, Illicit
AcarboseNalidixic Acid may increase the hypoglycemic activities of Acarbose.Approved, Investigational
AceclofenacAceclofenac may increase the neuroexcitatory activities of Nalidixic Acid.Approved, Investigational
AcemetacinAcemetacin may increase the neuroexcitatory activities of Nalidixic Acid.Approved
AcenocoumarolNalidixic Acid may increase the anticoagulant activities of Acenocoumarol.Approved
AcetyldigitoxinAcetyldigitoxin may decrease the cardiotoxic activities of Nalidixic Acid.Approved
AcetyldigoxinAcetyldigoxin may decrease the cardiotoxic activities of Nalidixic Acid.Experimental
Acetylsalicylic acidAcetylsalicylic acid may increase the neuroexcitatory activities of Nalidixic Acid.Approved, Vet Approved
AdapaleneAdapalene may increase the neuroexcitatory activities of Nalidixic Acid.Approved
AlbiglutideNalidixic Acid may increase the hypoglycemic activities of Albiglutide.Approved
AlclofenacAlclofenac may increase the neuroexcitatory activities of Nalidixic Acid.Approved, Withdrawn
AlclometasoneThe risk or severity of adverse effects can be increased when Alclometasone is combined with Nalidixic Acid.Approved
AldosteroneThe risk or severity of adverse effects can be increased when Aldosterone is combined with Nalidixic Acid.Experimental, Investigational
AlgeldrateAlgeldrate can cause a decrease in the absorption of Nalidixic Acid resulting in a reduced serum concentration and potentially a decrease in efficacy.Approved, Experimental
AlmagateAlmagate can cause a decrease in the absorption of Nalidixic Acid resulting in a reduced serum concentration and potentially a decrease in efficacy.Experimental
AlmasilateAlmasilate can cause a decrease in the absorption of Nalidixic Acid resulting in a reduced serum concentration and potentially a decrease in efficacy.Approved, Experimental
AlminoprofenAlminoprofen may increase the neuroexcitatory activities of Nalidixic Acid.Experimental
AlogliptinNalidixic Acid may increase the hypoglycemic activities of Alogliptin.Approved
AloglutamolAloglutamol can cause a decrease in the absorption of Nalidixic Acid resulting in a reduced serum concentration and potentially a decrease in efficacy.Experimental
AluminiumAluminium can cause a decrease in the absorption of Nalidixic Acid resulting in a reduced serum concentration and potentially a decrease in efficacy.Approved
Aluminium acetoacetateAluminium acetoacetate can cause a decrease in the absorption of Nalidixic Acid resulting in a reduced serum concentration and potentially a decrease in efficacy.Experimental
Aluminium glycinateAluminium glycinate can cause a decrease in the absorption of Nalidixic Acid resulting in a reduced serum concentration and potentially a decrease in efficacy.Experimental
Aluminum hydroxideAluminum hydroxide can cause a decrease in the absorption of Nalidixic Acid resulting in a reduced serum concentration and potentially a decrease in efficacy.Approved
Ambroxol acefyllinateThe metabolism of Ambroxol acefyllinate can be decreased when combined with Nalidixic Acid.Experimental, Investigational
AmcinonideThe risk or severity of adverse effects can be increased when Amcinonide is combined with Nalidixic Acid.Approved
AminophyllineThe metabolism of Aminophylline can be decreased when combined with Nalidixic Acid.Approved
AndrographolideAndrographolide may increase the neuroexcitatory activities of Nalidixic Acid.Investigational
AndrostenedioneThe risk or severity of adverse effects can be increased when Androstenedione is combined with Nalidixic Acid.Experimental, Illicit
AnecortaveThe risk or severity of adverse effects can be increased when Anecortave is combined with Nalidixic Acid.Investigational
anecortave acetateThe risk or severity of adverse effects can be increased when anecortave acetate is combined with Nalidixic Acid.Investigational
AnisodamineAnisodamine may increase the neuroexcitatory activities of Nalidixic Acid.Investigational
AntipyrineAntipyrine may increase the neuroexcitatory activities of Nalidixic Acid.Approved
ApocyninApocynin may increase the neuroexcitatory activities of Nalidixic Acid.Investigational
ApremilastApremilast may increase the neuroexcitatory activities of Nalidixic Acid.Approved, Investigational
AtamestaneThe risk or severity of adverse effects can be increased when Atamestane is combined with Nalidixic Acid.Investigational
AzapropazoneAzapropazone may increase the neuroexcitatory activities of Nalidixic Acid.Withdrawn
AzelastineAzelastine may increase the neuroexcitatory activities of Nalidixic Acid.Approved
BalsalazideBalsalazide may increase the neuroexcitatory activities of Nalidixic Acid.Approved, Investigational
BCG vaccineThe therapeutic efficacy of BCG vaccine can be decreased when used in combination with Nalidixic Acid.Investigational
Beclomethasone dipropionateThe risk or severity of adverse effects can be increased when Beclomethasone dipropionate is combined with Nalidixic Acid.Approved, Investigational
BendazacBendazac may increase the neuroexcitatory activities of Nalidixic Acid.Experimental
BenorilateBenorilate may increase the neuroexcitatory activities of Nalidixic Acid.Experimental
BenoxaprofenBenoxaprofen may increase the neuroexcitatory activities of Nalidixic Acid.Withdrawn
BenzydamineBenzydamine may increase the neuroexcitatory activities of Nalidixic Acid.Approved
BetamethasoneThe risk or severity of adverse effects can be increased when Betamethasone is combined with Nalidixic Acid.Approved, Vet Approved
BevacizumabBevacizumab may increase the cardiotoxic activities of Nalidixic Acid.Approved, Investigational
BevoniumBevonium may increase the neuroexcitatory activities of Nalidixic Acid.Experimental
Bismuth SubcitrateBismuth Subcitrate can cause a decrease in the absorption of Nalidixic Acid resulting in a reduced serum concentration and potentially a decrease in efficacy.Approved
Bismuth subnitrateBismuth subnitrate can cause a decrease in the absorption of Nalidixic Acid resulting in a reduced serum concentration and potentially a decrease in efficacy.Experimental
BromfenacBromfenac may increase the neuroexcitatory activities of Nalidixic Acid.Approved
BromocriptineNalidixic Acid may increase the hypoglycemic activities of Bromocriptine.Approved, Investigational
BucillamineBucillamine may increase the neuroexcitatory activities of Nalidixic Acid.Investigational
BudesonideThe risk or severity of adverse effects can be increased when Budesonide is combined with Nalidixic Acid.Approved
BufexamacBufexamac may increase the neuroexcitatory activities of Nalidixic Acid.Experimental
BumadizoneBumadizone may increase the neuroexcitatory activities of Nalidixic Acid.Experimental
CabazitaxelThe risk or severity of adverse effects can be increased when Cabazitaxel is combined with Nalidixic Acid.Approved
Calcium AcetateCalcium Acetate can cause a decrease in the absorption of Nalidixic Acid resulting in a reduced serum concentration and potentially a decrease in efficacy.Approved
Calcium CarbonateCalcium Carbonate can cause a decrease in the absorption of Nalidixic Acid resulting in a reduced serum concentration and potentially a decrease in efficacy.Approved
Calcium ChlorideCalcium Chloride can cause a decrease in the absorption of Nalidixic Acid resulting in a reduced serum concentration and potentially a decrease in efficacy.Approved
Calcium CitrateCalcium Citrate can cause a decrease in the absorption of Nalidixic Acid resulting in a reduced serum concentration and potentially a decrease in efficacy.Approved
Calcium glubionateCalcium glubionate can cause a decrease in the absorption of Nalidixic Acid resulting in a reduced serum concentration and potentially a decrease in efficacy.Approved
Calcium GluceptateCalcium Gluceptate can cause a decrease in the absorption of Nalidixic Acid resulting in a reduced serum concentration and potentially a decrease in efficacy.Approved
Calcium gluconateCalcium gluconate can cause a decrease in the absorption of Nalidixic Acid resulting in a reduced serum concentration and potentially a decrease in efficacy.Approved, Vet Approved
Calcium lactateCalcium lactate can cause a decrease in the absorption of Nalidixic Acid resulting in a reduced serum concentration and potentially a decrease in efficacy.Approved, Experimental, Investigational, Vet Approved
Calcium lactate gluconateCalcium lactate gluconate can cause a decrease in the absorption of Nalidixic Acid resulting in a reduced serum concentration and potentially a decrease in efficacy.Experimental
Calcium laevulateCalcium laevulate can cause a decrease in the absorption of Nalidixic Acid resulting in a reduced serum concentration and potentially a decrease in efficacy.Experimental
Calcium pangamateCalcium pangamate can cause a decrease in the absorption of Nalidixic Acid resulting in a reduced serum concentration and potentially a decrease in efficacy.Experimental
Calcium PhosphateCalcium Phosphate can cause a decrease in the absorption of Nalidixic Acid resulting in a reduced serum concentration and potentially a decrease in efficacy.Approved
Calcium silicateCalcium silicate can cause a decrease in the absorption of Nalidixic Acid resulting in a reduced serum concentration and potentially a decrease in efficacy.Experimental
CanagliflozinNalidixic Acid may increase the hypoglycemic activities of Canagliflozin.Approved
Carbaspirin calciumCarbaspirin calcium may increase the neuroexcitatory activities of Nalidixic Acid.Experimental, Investigational
CarprofenCarprofen may increase the neuroexcitatory activities of Nalidixic Acid.Approved, Vet Approved, Withdrawn
CaseinCasein can cause a decrease in the absorption of Nalidixic Acid resulting in a reduced serum concentration and potentially a decrease in efficacy.Approved
CastanospermineCastanospermine may increase the neuroexcitatory activities of Nalidixic Acid.Experimental
CelecoxibCelecoxib may increase the neuroexcitatory activities of Nalidixic Acid.Approved, Investigational
ChloroquineChloroquine may increase the neuroexcitatory activities of Nalidixic Acid.Approved, Vet Approved
ChlorpropamideNalidixic Acid may increase the hypoglycemic activities of Chlorpropamide.Approved
Choline magnesium trisalicylateCholine magnesium trisalicylate may increase the neuroexcitatory activities of Nalidixic Acid.Approved
CiclesonideThe risk or severity of adverse effects can be increased when Ciclesonide is combined with Nalidixic Acid.Approved, Investigational
ClobetasolThe risk or severity of adverse effects can be increased when Clobetasol is combined with Nalidixic Acid.Investigational
Clobetasol propionateThe risk or severity of adverse effects can be increased when Clobetasol propionate is combined with Nalidixic Acid.Approved
ClobetasoneThe risk or severity of adverse effects can be increased when Clobetasone is combined with Nalidixic Acid.Approved
ClocortoloneThe risk or severity of adverse effects can be increased when Clocortolone is combined with Nalidixic Acid.Approved
ClonixinClonixin may increase the neuroexcitatory activities of Nalidixic Acid.Approved
ClorindioneNalidixic Acid may increase the anticoagulant activities of Clorindione.Experimental
Cortexolone 17α-propionateThe risk or severity of adverse effects can be increased when Cortexolone 17α-propionate is combined with Nalidixic Acid.Investigational
CorticosteroneThe risk or severity of adverse effects can be increased when Corticosterone is combined with Nalidixic Acid.Experimental
Cortisone acetateThe risk or severity of adverse effects can be increased when Cortisone acetate is combined with Nalidixic Acid.Approved
CurcuminCurcumin may increase the neuroexcitatory activities of Nalidixic Acid.Investigational
CyclophosphamideCyclophosphamide may increase the cardiotoxic activities of Nalidixic Acid.Approved, Investigational
CymarinCymarin may decrease the cardiotoxic activities of Nalidixic Acid.Experimental
D-LimoneneD-Limonene may increase the neuroexcitatory activities of Nalidixic Acid.Investigational
DapagliflozinNalidixic Acid may increase the hypoglycemic activities of Dapagliflozin.Approved
DeflazacortThe risk or severity of adverse effects can be increased when Deflazacort is combined with Nalidixic Acid.Approved
DeslanosideDeslanoside may decrease the cardiotoxic activities of Nalidixic Acid.Approved
DesonideThe risk or severity of adverse effects can be increased when Desonide is combined with Nalidixic Acid.Approved, Investigational
DesoximetasoneThe risk or severity of adverse effects can be increased when Desoximetasone is combined with Nalidixic Acid.Approved
Desoxycorticosterone acetateThe risk or severity of adverse effects can be increased when Desoxycorticosterone acetate is combined with Nalidixic Acid.Approved
Desoxycorticosterone PivalateThe risk or severity of adverse effects can be increased when Desoxycorticosterone Pivalate is combined with Nalidixic Acid.Experimental, Vet Approved
DexamethasoneThe risk or severity of adverse effects can be increased when Dexamethasone is combined with Nalidixic Acid.Approved, Investigational, Vet Approved
Dexamethasone isonicotinateThe risk or severity of adverse effects can be increased when Dexamethasone isonicotinate is combined with Nalidixic Acid.Vet Approved
DiclofenacDiclofenac may increase the neuroexcitatory activities of Nalidixic Acid.Approved, Vet Approved
DicoumarolNalidixic Acid may increase the anticoagulant activities of Dicoumarol.Approved
DidanosineThe serum concentration of Didanosine can be decreased when it is combined with Nalidixic Acid.Approved
DifenpiramideDifenpiramide may increase the neuroexcitatory activities of Nalidixic Acid.Experimental
DiflorasoneThe risk or severity of adverse effects can be increased when Diflorasone is combined with Nalidixic Acid.Approved
DiflunisalDiflunisal may increase the neuroexcitatory activities of Nalidixic Acid.Approved
DifluocortoloneThe risk or severity of adverse effects can be increased when Difluocortolone is combined with Nalidixic Acid.Approved, Investigational
DifluprednateThe risk or severity of adverse effects can be increased when Difluprednate is combined with Nalidixic Acid.Approved
DigitoxinDigitoxin may decrease the cardiotoxic activities of Nalidixic Acid.Approved, Investigational
DigoxinDigoxin may decrease the cardiotoxic activities of Nalidixic Acid.Approved
Digoxin Immune Fab (Ovine)Digoxin Immune Fab (Ovine) may decrease the cardiotoxic activities of Nalidixic Acid.Approved
DiphenadioneNalidixic Acid may increase the anticoagulant activities of Diphenadione.Experimental
DisopyramideNalidixic Acid may increase the hypoglycemic activities of Disopyramide.Approved
DocetaxelThe risk or severity of adverse effects can be increased when Docetaxel is combined with Nalidixic Acid.Approved, Investigational
DroxicamDroxicam may increase the neuroexcitatory activities of Nalidixic Acid.Approved
DulaglutideNalidixic Acid may increase the hypoglycemic activities of Dulaglutide.Approved
DuvelisibDuvelisib may increase the neuroexcitatory activities of Nalidixic Acid.Investigational
DyphyllineThe metabolism of Dyphylline can be decreased when combined with Nalidixic Acid.Approved
E-6201E-6201 may increase the neuroexcitatory activities of Nalidixic Acid.Investigational
EmpagliflozinNalidixic Acid may increase the hypoglycemic activities of Empagliflozin.Approved
EpirizoleEpirizole may increase the neuroexcitatory activities of Nalidixic Acid.Approved
EquileninThe risk or severity of adverse effects can be increased when Equilenin is combined with Nalidixic Acid.Experimental
EquilinThe risk or severity of adverse effects can be increased when Equilin is combined with Nalidixic Acid.Approved
EstroneThe risk or severity of adverse effects can be increased when Estrone is combined with Nalidixic Acid.Approved
Estrone sulfateThe risk or severity of adverse effects can be increased when Estrone sulfate is combined with Nalidixic Acid.Approved
EtanerceptEtanercept may increase the neuroexcitatory activities of Nalidixic Acid.Approved, Investigational
EthenzamideEthenzamide may increase the neuroexcitatory activities of Nalidixic Acid.Experimental
Ethyl biscoumacetateNalidixic Acid may increase the anticoagulant activities of Ethyl biscoumacetate.Withdrawn
EtodolacEtodolac may increase the neuroexcitatory activities of Nalidixic Acid.Approved, Investigational, Vet Approved
EtofenamateEtofenamate may increase the neuroexcitatory activities of Nalidixic Acid.Approved, Investigational
EtoricoxibEtoricoxib may increase the neuroexcitatory activities of Nalidixic Acid.Approved, Investigational
Evening primrose oilEvening primrose oil may increase the neuroexcitatory activities of Nalidixic Acid.Approved, Investigational
ExenatideNalidixic Acid may increase the hypoglycemic activities of Exenatide.Approved, Investigational
exisulindexisulind may increase the neuroexcitatory activities of Nalidixic Acid.Investigational
FelbinacFelbinac may increase the neuroexcitatory activities of Nalidixic Acid.Experimental
FenbufenFenbufen may increase the neuroexcitatory activities of Nalidixic Acid.Approved
FenoprofenFenoprofen may increase the neuroexcitatory activities of Nalidixic Acid.Approved
FentiazacFentiazac may increase the neuroexcitatory activities of Nalidixic Acid.Experimental
FeprazoneFeprazone may increase the neuroexcitatory activities of Nalidixic Acid.Experimental
Ferric CarboxymaltoseThe serum concentration of Nalidixic Acid can be decreased when it is combined with Ferric Carboxymaltose.Approved
Ferric CitrateThe serum concentration of Nalidixic Acid can be decreased when it is combined with Ferric Citrate.Approved, Investigational
Ferric pyrophosphateThe serum concentration of Nalidixic Acid can be decreased when it is combined with Ferric pyrophosphate.Approved
Ferulic acidFerulic acid may increase the neuroexcitatory activities of Nalidixic Acid.Experimental
FloctafenineFloctafenine may increase the neuroexcitatory activities of Nalidixic Acid.Approved, Withdrawn
fluasteroneThe risk or severity of adverse effects can be increased when fluasterone is combined with Nalidixic Acid.Investigational
FludrocortisoneThe risk or severity of adverse effects can be increased when Fludrocortisone is combined with Nalidixic Acid.Approved
FluindioneNalidixic Acid may increase the anticoagulant activities of Fluindione.Investigational
FlumethasoneThe risk or severity of adverse effects can be increased when Flumethasone is combined with Nalidixic Acid.Approved, Vet Approved
FlunisolideThe risk or severity of adverse effects can be increased when Flunisolide is combined with Nalidixic Acid.Approved, Investigational
FlunixinFlunixin may increase the neuroexcitatory activities of Nalidixic Acid.Vet Approved
FlunoxaprofenFlunoxaprofen may increase the neuroexcitatory activities of Nalidixic Acid.Experimental
Fluocinolone AcetonideThe risk or severity of adverse effects can be increased when Fluocinolone Acetonide is combined with Nalidixic Acid.Approved, Investigational, Vet Approved
FluocinonideThe risk or severity of adverse effects can be increased when Fluocinonide is combined with Nalidixic Acid.Approved, Investigational
FluocortoloneThe risk or severity of adverse effects can be increased when Fluocortolone is combined with Nalidixic Acid.Approved, Withdrawn
FluorometholoneThe risk or severity of adverse effects can be increased when Fluorometholone is combined with Nalidixic Acid.Approved
FluprednideneThe risk or severity of adverse effects can be increased when Fluprednidene is combined with Nalidixic Acid.Approved, Withdrawn
FluprednisoloneThe risk or severity of adverse effects can be increased when Fluprednisolone is combined with Nalidixic Acid.Approved
FlurandrenolideThe risk or severity of adverse effects can be increased when Flurandrenolide is combined with Nalidixic Acid.Approved
FlurbiprofenFlurbiprofen may increase the neuroexcitatory activities of Nalidixic Acid.Approved, Investigational
Fluticasone furoateThe risk or severity of adverse effects can be increased when Fluticasone furoate is combined with Nalidixic Acid.Approved
Fluticasone propionateThe risk or severity of adverse effects can be increased when Fluticasone propionate is combined with Nalidixic Acid.Approved
FormestaneThe risk or severity of adverse effects can be increased when Formestane is combined with Nalidixic Acid.Approved, Investigational, Withdrawn
GitoformateGitoformate may decrease the cardiotoxic activities of Nalidixic Acid.Experimental
GliclazideNalidixic Acid may increase the hypoglycemic activities of Gliclazide.Approved
GlimepirideNalidixic Acid may increase the hypoglycemic activities of Glimepiride.Approved
GlipizideNalidixic Acid may increase the hypoglycemic activities of Glipizide.Approved
GlyburideNalidixic Acid may increase the hypoglycemic activities of Glyburide.Approved
GuacetisalGuacetisal may increase the neuroexcitatory activities of Nalidixic Acid.Experimental
HalcinonideThe risk or severity of adverse effects can be increased when Halcinonide is combined with Nalidixic Acid.Approved, Investigational, Withdrawn
HE3286The risk or severity of adverse effects can be increased when HE3286 is combined with Nalidixic Acid.Investigational
HigenamineHigenamine may increase the neuroexcitatory activities of Nalidixic Acid.Investigational
HydrocortisoneThe risk or severity of adverse effects can be increased when Hydrocortisone is combined with Nalidixic Acid.Approved, Vet Approved
HydrotalciteHydrotalcite can cause a decrease in the absorption of Nalidixic Acid resulting in a reduced serum concentration and potentially a decrease in efficacy.Experimental, Investigational
IbuprofenIbuprofen may increase the neuroexcitatory activities of Nalidixic Acid.Approved
IbuproxamIbuproxam may increase the neuroexcitatory activities of Nalidixic Acid.Withdrawn
IcatibantIcatibant may increase the neuroexcitatory activities of Nalidixic Acid.Approved
Imidazole salicylateImidazole salicylate may increase the neuroexcitatory activities of Nalidixic Acid.Experimental
IndobufenIndobufen may increase the neuroexcitatory activities of Nalidixic Acid.Investigational
IndomethacinIndomethacin may increase the neuroexcitatory activities of Nalidixic Acid.Approved, Investigational
IndoprofenIndoprofen may increase the neuroexcitatory activities of Nalidixic Acid.Withdrawn
Insulin AspartNalidixic Acid may increase the hypoglycemic activities of Insulin Aspart.Approved
Insulin DetemirNalidixic Acid may increase the hypoglycemic activities of Insulin Detemir.Approved
Insulin GlargineNalidixic Acid may increase the hypoglycemic activities of Insulin Glargine.Approved
Insulin GlulisineNalidixic Acid may increase the hypoglycemic activities of Insulin Glulisine.Approved
Insulin HumanNalidixic Acid may increase the hypoglycemic activities of Insulin Human.Approved, Investigational
Insulin LisproNalidixic Acid may increase the hypoglycemic activities of Insulin Lispro.Approved
IronThe serum concentration of Nalidixic Acid can be decreased when it is combined with Iron.Approved
Iron DextranThe serum concentration of Nalidixic Acid can be decreased when it is combined with Iron Dextran.Approved, Vet Approved
Iron saccharateThe serum concentration of Nalidixic Acid can be decreased when it is combined with Iron saccharate.Approved
IsoxicamIsoxicam may increase the neuroexcitatory activities of Nalidixic Acid.Withdrawn
IstaroximeThe risk or severity of adverse effects can be increased when Istaroxime is combined with Nalidixic Acid.Investigational
KebuzoneKebuzone may increase the neuroexcitatory activities of Nalidixic Acid.Experimental
KetoprofenKetoprofen may increase the neuroexcitatory activities of Nalidixic Acid.Approved, Vet Approved
KetorolacKetorolac may increase the neuroexcitatory activities of Nalidixic Acid.Approved
Lanatoside CLanatoside C may decrease the cardiotoxic activities of Nalidixic Acid.Experimental
Lanthanum carbonateThe serum concentration of Nalidixic Acid can be decreased when it is combined with Lanthanum carbonate.Approved
LeflunomideLeflunomide may increase the neuroexcitatory activities of Nalidixic Acid.Approved, Investigational
LiraglutideNalidixic Acid may increase the hypoglycemic activities of Liraglutide.Approved
LisofyllineLisofylline may increase the neuroexcitatory activities of Nalidixic Acid.Investigational
LonazolacLonazolac may increase the neuroexcitatory activities of Nalidixic Acid.Experimental
LornoxicamLornoxicam may increase the neuroexcitatory activities of Nalidixic Acid.Approved, Investigational
LoteprednolThe risk or severity of adverse effects can be increased when Loteprednol is combined with Nalidixic Acid.Approved
LoxoprofenLoxoprofen may increase the neuroexcitatory activities of Nalidixic Acid.Approved, Investigational
LumiracoxibLumiracoxib may increase the neuroexcitatory activities of Nalidixic Acid.Approved, Investigational
MagaldrateMagaldrate can cause a decrease in the absorption of Nalidixic Acid resulting in a reduced serum concentration and potentially a decrease in efficacy.Approved, Withdrawn
Magnesium HydroxideMagnesium Hydroxide can cause a decrease in the absorption of Nalidixic Acid resulting in a reduced serum concentration and potentially a decrease in efficacy.Approved
Magnesium oxideMagnesium oxide can cause a decrease in the absorption of Nalidixic Acid resulting in a reduced serum concentration and potentially a decrease in efficacy.Approved
Magnesium peroxideMagnesium peroxide can cause a decrease in the absorption of Nalidixic Acid resulting in a reduced serum concentration and potentially a decrease in efficacy.Experimental
Magnesium salicylateThe serum concentration of Nalidixic Acid can be decreased when it is combined with Magnesium salicylate.Approved
Magnesium silicateMagnesium silicate can cause a decrease in the absorption of Nalidixic Acid resulting in a reduced serum concentration and potentially a decrease in efficacy.Approved, Experimental
Magnesium SulfateThe serum concentration of Nalidixic Acid can be decreased when it is combined with Magnesium Sulfate.Approved, Vet Approved
Magnesium TrisilicateMagnesium Trisilicate can cause a decrease in the absorption of Nalidixic Acid resulting in a reduced serum concentration and potentially a decrease in efficacy.Approved
MasoprocolMasoprocol may increase the neuroexcitatory activities of Nalidixic Acid.Approved, Investigational
ME-609The risk or severity of adverse effects can be increased when ME-609 is combined with Nalidixic Acid.Investigational
MecaserminNalidixic Acid may increase the hypoglycemic activities of Mecasermin.Approved, Investigational
Meclofenamic acidMeclofenamic acid may increase the neuroexcitatory activities of Nalidixic Acid.Approved, Vet Approved
MedrysoneThe risk or severity of adverse effects can be increased when Medrysone is combined with Nalidixic Acid.Approved
Mefenamic acidMefenamic acid may increase the neuroexcitatory activities of Nalidixic Acid.Approved
MelengestrolThe risk or severity of adverse effects can be increased when Melengestrol is combined with Nalidixic Acid.Vet Approved
MeloxicamMeloxicam may increase the neuroexcitatory activities of Nalidixic Acid.Approved, Vet Approved
MelphalanThe risk or severity of adverse effects can be increased when Nalidixic Acid is combined with Melphalan.Approved
MesalazineMesalazine may increase the neuroexcitatory activities of Nalidixic Acid.Approved
MetamizoleMetamizole may increase the neuroexcitatory activities of Nalidixic Acid.Investigational, Withdrawn
MetforminNalidixic Acid may increase the hypoglycemic activities of Metformin.Approved
MethylprednisoloneThe risk or severity of adverse effects can be increased when Methylprednisolone is combined with Nalidixic Acid.Approved, Vet Approved
MetildigoxinMetildigoxin may decrease the cardiotoxic activities of Nalidixic Acid.Experimental
MifepristoneNalidixic Acid may increase the hypoglycemic activities of Mifepristone.Approved, Investigational
MiglitolNalidixic Acid may increase the hypoglycemic activities of Miglitol.Approved
MizoribineMizoribine may increase the neuroexcitatory activities of Nalidixic Acid.Investigational
MofebutazoneMofebutazone may increase the neuroexcitatory activities of Nalidixic Acid.Experimental
MometasoneThe risk or severity of adverse effects can be increased when Mometasone is combined with Nalidixic Acid.Approved, Vet Approved
Mycophenolate mofetilMycophenolate mofetil may increase the neuroexcitatory activities of Nalidixic Acid.Approved, Investigational
Mycophenolic acidThe serum concentration of Mycophenolic acid can be decreased when it is combined with Nalidixic Acid.Approved
NabumetoneNabumetone may increase the neuroexcitatory activities of Nalidixic Acid.Approved
NafamostatNafamostat may increase the neuroexcitatory activities of Nalidixic Acid.Approved, Investigational
NaftifineNaftifine may increase the neuroexcitatory activities of Nalidixic Acid.Approved
NaproxenNaproxen may increase the neuroexcitatory activities of Nalidixic Acid.Approved, Vet Approved
NateglinideNalidixic Acid may increase the hypoglycemic activities of Nateglinide.Approved, Investigational
NCX 1022The risk or severity of adverse effects can be increased when NCX 1022 is combined with Nalidixic Acid.Investigational
NepafenacNepafenac may increase the neuroexcitatory activities of Nalidixic Acid.Approved
NifenazoneNifenazone may increase the neuroexcitatory activities of Nalidixic Acid.Experimental
Niflumic AcidNiflumic Acid may increase the neuroexcitatory activities of Nalidixic Acid.Approved
NimesulideNimesulide may increase the neuroexcitatory activities of Nalidixic Acid.Approved, Investigational, Withdrawn
NitroaspirinNitroaspirin may increase the neuroexcitatory activities of Nalidixic Acid.Investigational
OleandrinOleandrin may decrease the cardiotoxic activities of Nalidixic Acid.Experimental, Investigational
Oleoyl-estroneThe risk or severity of adverse effects can be increased when Oleoyl-estrone is combined with Nalidixic Acid.Investigational
OlopatadineOlopatadine may increase the neuroexcitatory activities of Nalidixic Acid.Approved
OlsalazineOlsalazine may increase the neuroexcitatory activities of Nalidixic Acid.Approved
OrgoteinOrgotein may increase the neuroexcitatory activities of Nalidixic Acid.Vet Approved
OuabainOuabain may decrease the cardiotoxic activities of Nalidixic Acid.Approved
OxaprozinOxaprozin may increase the neuroexcitatory activities of Nalidixic Acid.Approved
OxyphenbutazoneOxyphenbutazone may increase the neuroexcitatory activities of Nalidixic Acid.Approved, Withdrawn
PaclitaxelThe risk or severity of adverse effects can be increased when Paclitaxel is combined with Nalidixic Acid.Approved, Vet Approved
ParamethasoneThe risk or severity of adverse effects can be increased when Paramethasone is combined with Nalidixic Acid.Approved
ParecoxibParecoxib may increase the neuroexcitatory activities of Nalidixic Acid.Approved
ParthenolideParthenolide may increase the neuroexcitatory activities of Nalidixic Acid.Investigational
PentamidineNalidixic Acid may increase the hypoglycemic activities of Pentamidine.Approved
PeruvosidePeruvoside may decrease the cardiotoxic activities of Nalidixic Acid.Experimental
PhenindioneNalidixic Acid may increase the anticoagulant activities of Phenindione.Approved, Investigational
PhenprocoumonNalidixic Acid may increase the anticoagulant activities of Phenprocoumon.Approved, Investigational
PhenylbutazonePhenylbutazone may increase the neuroexcitatory activities of Nalidixic Acid.Approved, Vet Approved
Picosulfuric acidThe therapeutic efficacy of Picosulfuric acid can be decreased when used in combination with Nalidixic Acid.Approved
PimecrolimusPimecrolimus may increase the neuroexcitatory activities of Nalidixic Acid.Approved, Investigational
PioglitazoneNalidixic Acid may increase the hypoglycemic activities of Pioglitazone.Approved, Investigational
PirfenidonePirfenidone may increase the neuroexcitatory activities of Nalidixic Acid.Approved, Investigational
PiroxicamPiroxicam may increase the neuroexcitatory activities of Nalidixic Acid.Approved, Investigational
PirprofenPirprofen may increase the neuroexcitatory activities of Nalidixic Acid.Experimental
PramlintideNalidixic Acid may increase the hypoglycemic activities of Pramlintide.Approved, Investigational
PranoprofenPranoprofen may increase the neuroexcitatory activities of Nalidixic Acid.Experimental, Investigational
PrasteroneThe risk or severity of adverse effects can be increased when Prasterone is combined with Nalidixic Acid.Approved, Nutraceutical
Prasterone sulfateThe risk or severity of adverse effects can be increased when Prasterone sulfate is combined with Nalidixic Acid.Investigational
PrednicarbateThe risk or severity of adverse effects can be increased when Prednicarbate is combined with Nalidixic Acid.Approved
PrednisoloneThe risk or severity of adverse effects can be increased when Prednisolone is combined with Nalidixic Acid.Approved, Vet Approved
PrednisoneThe risk or severity of adverse effects can be increased when Prednisone is combined with Nalidixic Acid.Approved, Vet Approved
PregnenoloneThe risk or severity of adverse effects can be increased when Pregnenolone is combined with Nalidixic Acid.Experimental, Investigational
ProbenecidThe serum concentration of Nalidixic Acid can be increased when it is combined with Probenecid.Approved
ProglumetacinProglumetacin may increase the neuroexcitatory activities of Nalidixic Acid.Experimental
PropacetamolPropacetamol may increase the neuroexcitatory activities of Nalidixic Acid.Approved, Investigational
PropyphenazonePropyphenazone may increase the neuroexcitatory activities of Nalidixic Acid.Experimental
ProquazoneProquazone may increase the neuroexcitatory activities of Nalidixic Acid.Experimental
ProscillaridinProscillaridin may decrease the cardiotoxic activities of Nalidixic Acid.Experimental
PTC299PTC299 may increase the neuroexcitatory activities of Nalidixic Acid.Investigational
QuinaprilThe serum concentration of Nalidixic Acid can be decreased when it is combined with Quinapril.Approved, Investigational
QuinineNalidixic Acid may increase the hypoglycemic activities of Quinine.Approved
RepaglinideNalidixic Acid may increase the hypoglycemic activities of Repaglinide.Approved, Investigational
ResveratrolResveratrol may increase the neuroexcitatory activities of Nalidixic Acid.Approved, Experimental, Investigational
RimexoloneThe risk or severity of adverse effects can be increased when Rimexolone is combined with Nalidixic Acid.Approved
RofecoxibRofecoxib may increase the neuroexcitatory activities of Nalidixic Acid.Investigational, Withdrawn
RosiglitazoneNalidixic Acid may increase the hypoglycemic activities of Rosiglitazone.Approved, Investigational
SalicylamideSalicylamide may increase the neuroexcitatory activities of Nalidixic Acid.Approved
Salicylic acidSalicylic acid may increase the neuroexcitatory activities of Nalidixic Acid.Approved, Vet Approved
SalsalateSalsalate may increase the neuroexcitatory activities of Nalidixic Acid.Approved
SaxagliptinNalidixic Acid may increase the hypoglycemic activities of Saxagliptin.Approved
SemapimodSemapimod may increase the neuroexcitatory activities of Nalidixic Acid.Investigational
SeratrodastSeratrodast may increase the neuroexcitatory activities of Nalidixic Acid.Approved
SerrapeptaseSerrapeptase may increase the neuroexcitatory activities of Nalidixic Acid.Investigational
SevelamerSevelamer can cause a decrease in the absorption of Nalidixic Acid resulting in a reduced serum concentration and potentially a decrease in efficacy.Approved
SitagliptinNalidixic Acid may increase the hypoglycemic activities of Sitagliptin.Approved, Investigational
Sodium bicarbonateSodium bicarbonate can cause a decrease in the absorption of Nalidixic Acid resulting in a reduced serum concentration and potentially a decrease in efficacy.Approved
SRT501SRT501 may increase the neuroexcitatory activities of Nalidixic Acid.Investigational
Strontium ranelateThe serum concentration of Nalidixic Acid can be decreased when it is combined with Strontium ranelate.Approved
SucralfateThe serum concentration of Nalidixic Acid can be decreased when it is combined with Sucralfate.Approved
SulfadiazineNalidixic Acid may increase the hypoglycemic activities of Sulfadiazine.Approved, Vet Approved
SulfamethoxazoleNalidixic Acid may increase the hypoglycemic activities of Sulfamethoxazole.Approved
SulfasalazineSulfasalazine may increase the neuroexcitatory activities of Nalidixic Acid.Approved
SulfisoxazoleNalidixic Acid may increase the hypoglycemic activities of Sulfisoxazole.Approved, Vet Approved
SulindacSulindac may increase the neuroexcitatory activities of Nalidixic Acid.Approved
SunitinibNalidixic Acid may increase the hypoglycemic activities of Sunitinib.Approved, Investigational
SuprofenSuprofen may increase the neuroexcitatory activities of Nalidixic Acid.Approved, Withdrawn
SuxibuzoneSuxibuzone may increase the neuroexcitatory activities of Nalidixic Acid.Experimental
TarenflurbilTarenflurbil may increase the neuroexcitatory activities of Nalidixic Acid.Investigational
TenidapTenidap may increase the neuroexcitatory activities of Nalidixic Acid.Experimental
TenoxicamTenoxicam may increase the neuroexcitatory activities of Nalidixic Acid.Approved
TepoxalinTepoxalin may increase the neuroexcitatory activities of Nalidixic Acid.Vet Approved
TeriflunomideTeriflunomide may increase the neuroexcitatory activities of Nalidixic Acid.Approved
TheophyllineThe metabolism of Theophylline can be decreased when combined with Nalidixic Acid.Approved
Tiaprofenic acidTiaprofenic acid may increase the neuroexcitatory activities of Nalidixic Acid.Approved
TinoridineTinoridine may increase the neuroexcitatory activities of Nalidixic Acid.Investigational
TioclomarolNalidixic Acid may increase the anticoagulant activities of Tioclomarol.Experimental
TixocortolThe risk or severity of adverse effects can be increased when Tixocortol is combined with Nalidixic Acid.Approved
TolazamideNalidixic Acid may increase the hypoglycemic activities of Tolazamide.Approved
TolbutamideNalidixic Acid may increase the hypoglycemic activities of Tolbutamide.Approved
Tolfenamic AcidTolfenamic Acid may increase the neuroexcitatory activities of Nalidixic Acid.Approved
TolmetinTolmetin may increase the neuroexcitatory activities of Nalidixic Acid.Approved
TranilastTranilast may increase the neuroexcitatory activities of Nalidixic Acid.Approved, Investigational
TrastuzumabTrastuzumab may increase the cardiotoxic activities of Nalidixic Acid.Approved, Investigational
TriamcinoloneThe risk or severity of adverse effects can be increased when Triamcinolone is combined with Nalidixic Acid.Approved, Vet Approved
TribenosideTribenoside may increase the neuroexcitatory activities of Nalidixic Acid.Experimental
TriptolideTriptolide may increase the neuroexcitatory activities of Nalidixic Acid.Investigational
TromethamineTromethamine can cause a decrease in the absorption of Nalidixic Acid resulting in a reduced serum concentration and potentially a decrease in efficacy.Approved
UlobetasolThe risk or severity of adverse effects can be increased when Ulobetasol is combined with Nalidixic Acid.Approved
ValdecoxibValdecoxib may increase the neuroexcitatory activities of Nalidixic Acid.Investigational, Withdrawn
VareniclineThe serum concentration of Varenicline can be increased when it is combined with Nalidixic Acid.Approved, Investigational
WarfarinNalidixic Acid may increase the anticoagulant activities of Warfarin.Approved
ZaltoprofenZaltoprofen may increase the neuroexcitatory activities of Nalidixic Acid.Approved, Investigational
ZileutonZileuton may increase the neuroexcitatory activities of Nalidixic Acid.Approved, Investigational, Withdrawn
ZomepiracZomepirac may increase the neuroexcitatory activities of Nalidixic Acid.Withdrawn
Food Interactions
  • Take with food to reduce irritation. Drink liberally.


Synthesis Reference

Charles L. Fox, Jr., Shanta Modak, Keith Reemtsma, "Injection-resistant materials and method of making same through use of nalidixic acid derivatives." U.S. Patent US4563485, issued July, 1984.

General References
Not Available
External Links
Human Metabolome Database
KEGG Compound
PubChem Compound
PubChem Substance
Therapeutic Targets Database
RxList Drug Page Drug Page
ATC Codes
J01MB02 — Nalidixic acid
PDB Entries
FDA label
Download (47.9 KB)
Download (73.2 KB)

Clinical Trials

Clinical Trials


  • Sanofi aventis us llc
  • Mutual pharmaceutical co inc
  • Watson laboratories inc
Dosage forms
TabletOral500 mg
Unit descriptionCostUnit
Nalidixic acid powder7.2USD g
DrugBank does not sell nor buy drugs. Pricing information is supplied for informational purposes only.
Not Available


Experimental Properties
melting point (°C)229.5 °CPhysProp
water solubility100 mg/L (at 23 °C)MERCK INDEX (1996)
logP1.59BIOBYTE (1995)
logS-3.37ADME Research, USCD
pKa8.6OSOL,A & HOOVER,JE (1975)
Predicted Properties
Water Solubility2.3 mg/mLALOGPS
pKa (Strongest Acidic)5.95ChemAxon
pKa (Strongest Basic)4.68ChemAxon
Physiological Charge-1ChemAxon
Hydrogen Acceptor Count5ChemAxon
Hydrogen Donor Count1ChemAxon
Polar Surface Area70.5 Å2ChemAxon
Rotatable Bond Count2ChemAxon
Refractivity62.82 m3·mol-1ChemAxon
Polarizability23.65 Å3ChemAxon
Number of Rings2ChemAxon
Rule of FiveYesChemAxon
Ghose FilterYesChemAxon
Veber's RuleNoChemAxon
MDDR-like RuleNoChemAxon
Predicted ADMET features
Human Intestinal Absorption+0.9873
Blood Brain Barrier+0.8945
Caco-2 permeable+0.6315
P-glycoprotein substrateNon-substrate0.5071
P-glycoprotein inhibitor INon-inhibitor0.8838
P-glycoprotein inhibitor IINon-inhibitor0.8566
Renal organic cation transporterNon-inhibitor0.8104
CYP450 2C9 substrateNon-substrate0.7898
CYP450 2D6 substrateNon-substrate0.9116
CYP450 3A4 substrateNon-substrate0.7202
CYP450 1A2 substrateNon-inhibitor0.7888
CYP450 2C9 inhibitorNon-inhibitor0.8934
CYP450 2D6 inhibitorNon-inhibitor0.9115
CYP450 2C19 inhibitorNon-inhibitor0.7834
CYP450 3A4 inhibitorNon-inhibitor0.9531
CYP450 inhibitory promiscuityLow CYP Inhibitory Promiscuity0.8555
Ames testNon AMES toxic0.9133
BiodegradationNot ready biodegradable0.8553
Rat acute toxicity2.0874 LD50, mol/kg Not applicable
hERG inhibition (predictor I)Weak inhibitor0.9392
hERG inhibition (predictor II)Non-inhibitor0.8534
ADMET data is predicted using admetSAR, a free tool for evaluating chemical ADMET properties. (23092397)


Mass Spec (NIST)
Not Available
SpectrumSpectrum TypeSplash Key
Predicted GC-MS Spectrum - GC-MSPredicted GC-MSNot Available
Predicted MS/MS Spectrum - 10V, Positive (Annotated)Predicted LC-MS/MSNot Available
Predicted MS/MS Spectrum - 20V, Positive (Annotated)Predicted LC-MS/MSNot Available
Predicted MS/MS Spectrum - 40V, Positive (Annotated)Predicted LC-MS/MSNot Available
Predicted MS/MS Spectrum - 10V, Negative (Annotated)Predicted LC-MS/MSNot Available
Predicted MS/MS Spectrum - 20V, Negative (Annotated)Predicted LC-MS/MSNot Available
Predicted MS/MS Spectrum - 40V, Negative (Annotated)Predicted LC-MS/MSNot Available
LC-MS/MS Spectrum - LC-ESI-qTof , PositiveLC-MS/MSNot Available
LC-MS/MS Spectrum - LC-ESI-qTof , PositiveLC-MS/MSNot Available
LC-MS/MS Spectrum - LC-ESI-QQ , positiveLC-MS/MSsplash10-001i-0090000000-b3f65ce918413bce9fa8
LC-MS/MS Spectrum - LC-ESI-QQ , positiveLC-MS/MSsplash10-014i-0090000000-0ff01a82dbce74faefc6
LC-MS/MS Spectrum - LC-ESI-QQ , positiveLC-MS/MSsplash10-014r-0790000000-46caea0fd85329797145
LC-MS/MS Spectrum - LC-ESI-QQ , positiveLC-MS/MSsplash10-000i-0900000000-3572ae3957b712815a4f
LC-MS/MS Spectrum - LC-ESI-QQ , positiveLC-MS/MSsplash10-0zgr-0900000000-a89fdf787950fb2d88c2
LC-MS/MS Spectrum - LC-ESI-IT , positiveLC-MS/MSsplash10-0a4i-0290000000-db7256d80ff333bc00bf
MS/MS Spectrum - , positiveLC-MS/MSsplash10-015i-0590000000-938c78d9d632c54cdffe
MS/MS Spectrum - , positiveLC-MS/MSsplash10-014r-0590000000-0071689427e5460e9504
MS/MS Spectrum - , positiveLC-MS/MSsplash10-053i-2920000000-a81650e261062799ba89


This compound belongs to the class of organic compounds known as naphthyridine carboxylic acids and derivatives. These are compounds containing a naphthyridine moiety, where one of the ring atoms bears a carboxylic acid group.
Organic compounds
Super Class
Organoheterocyclic compounds
Sub Class
Direct Parent
Naphthyridine carboxylic acids and derivatives
Alternative Parents
Pyridinecarboxylic acids / Methylpyridines / Vinylogous amides / Heteroaromatic compounds / Monocarboxylic acids and derivatives / Carboxylic acids / Azacyclic compounds / Organopnictogen compounds / Organooxygen compounds / Organonitrogen compounds
show 2 more
Naphthyridine carboxylic acid / Pyridine carboxylic acid / Pyridine carboxylic acid or derivatives / Methylpyridine / Pyridine / Heteroaromatic compound / Vinylogous amide / Azacycle / Monocarboxylic acid or derivatives / Carboxylic acid
show 9 more
Molecular Framework
Aromatic heteropolycyclic compounds
External Descriptors
monocarboxylic acid, 1,8-naphthyridine derivative, quinolone antibiotic (CHEBI:100147) / 4-Quinolones (C05079)


1. DNA
Pharmacological action
General Function:
Used for biological information storage.
Specific Function:
DNA contains the instructions needed for an organism to develop, survive and reproduce.
Molecular Weight:
2.15 x 1012 Da
  1. Imming P, Sinning C, Meyer A: Drugs, their targets and the nature and number of drug targets. Nat Rev Drug Discov. 2006 Oct;5(10):821-34. [PubMed:17016423]
  2. Avsaroglu MD, Helmuth R, Junker E, Hertwig S, Schroeter A, Akcelik M, Bozoglu F, Guerra B: Plasmid-mediated quinolone resistance conferred by qnrS1 in Salmonella enterica serovar Virchow isolated from Turkish food of avian origin. J Antimicrob Chemother. 2007 Nov;60(5):1146-50. Epub 2007 Sep 19. [PubMed:17881633]
  3. Jain A, Rajeswari MR: Preferential binding of quinolones to DNA with alternating G, C / A, T sequences: a spectroscopic study. J Biomol Struct Dyn. 2002 Oct;20(2):291-9. [PubMed:12354080]


Pharmacological action
General Function
Tryptophan 2,3-dioxygenase activity
Specific Function
Incorporates oxygen into the indole moiety of tryptophan. Has a broad specificity towards tryptamine and derivatives including D- and L-tryptophan, 5-hydroxytryptophan and serotonin (By similarity).
Gene Name
Uniprot ID
Uniprot Name
Tryptophan 2,3-dioxygenase
Molecular Weight
47871.215 Da
  1. Sanzey B: Modulation of gene expression by drugs affecting deoxyribonucleic acid gyrase. J Bacteriol. 1979 Apr;138(1):40-7. [PubMed:108253]


Pharmacological action
General Function
Sodium-independent organic anion transmembrane transporter activity
Specific Function
Involved in the renal elimination of endogenous and exogenous organic anions. Functions as organic anion exchanger when the uptake of one molecule of organic anion is coupled with an efflux of one ...
Gene Name
Uniprot ID
Uniprot Name
Solute carrier family 22 member 6
Molecular Weight
61815.78 Da
  1. Sekine T, Watanabe N, Hosoyamada M, Kanai Y, Endou H: Expression cloning and characterization of a novel multispecific organic anion transporter. J Biol Chem. 1997 Jul 25;272(30):18526-9. [PubMed:9228014]

Drug created on June 13, 2005 07:24 / Updated on November 07, 2017 01:42