You are using an unsupported browser. Please upgrade your browser to a newer version to get the best experience on DrugBank.
Accession NumberDB00263  (APRD00595)
TypeSmall Molecule
GroupsApproved, Vet Approved
DescriptionA short-acting sulfonamide antibacterial with activity against a wide range of gram- negative and gram-positive organisms. [PubChem]
External IDs Not Available
Product Ingredients
IngredientUNIICASInChI KeyDetails
Acetyl sulfisoxazoleWBT5QH3KED 80-74-0JFNWFXVFBDDWCX-UHFFFAOYSA-NDetails
Sulfisoxazole diolamine30S4B46J8B 4299-60-9FEPTXVIRMZIGFY-UHFFFAOYSA-NDetails
Approved Prescription Products
NameDosageStrengthRouteLabellerMarketing StartMarketing End
Novo-soxazole 500mgTablet500 mgOralNovopharm Limited1967-12-312005-08-10Canada
Sulfisoxazole 500mg TabletsTablet500 mgOralLaboratoires Confab IncNot applicableNot applicableCanada
Sulfizole Tab 500mgTablet500 mgOralIcn Pharmaceuticals1963-12-312005-04-26Canada
Approved Generic Prescription Products
NameDosageStrengthRouteLabellerMarketing StartMarketing End
Apo Sulfisoxazole Tab 500mgTablet500 mgOralApotex Corporation1977-12-31Not applicableCanada
Approved Over the Counter ProductsNot Available
Unapproved/Other Products Not Available
International Brands
NeoxazolNot Available
Brand mixtures
Erythromycin Ethylsuccinate and Sulfisoxazole AcetylRebel Distributors
PediazoleAmdipharm Limited
CAS number127-69-5
WeightAverage: 267.304
Monoisotopic: 267.067761987
Chemical FormulaC11H13N3O3S
IndicationFor the treatment of severe, repeated, or long-lasting urinary tract infections, meningococcal meningitis, acute otitis media, trachoma, inclusion conjunctivitis, nocardiosis, chancroid, toxoplasmosis, malaria and other bacterial infections.
Structured Indications
PharmacodynamicsSulfisoxazole is a sulfonamide antibiotic. The sulfonamides are synthetic bacteriostatic antibiotics with a wide spectrum against most gram-positive and many gram-negative organisms. However, many strains of an individual species may be resistant. Sulfonamides inhibit multiplication of bacteria by acting as competitive inhibitors of p-aminobenzoic acid in the folic acid metabolism cycle. Bacterial sensitivity is the same for the various sulfonamides, and resistance to one sulfonamide indicates resistance to all. Most sulfonamides are readily absorbed orally. However, parenteral administration is difficult, since the soluble sulfonamide salts are highly alkaline and irritating to the tissues. The sulfonamides are widely distributed throughout all tissues. High levels are achieved in pleural, peritoneal, synovial, and ocular fluids. Although these drugs are no longer used to treat meningitis, CSF levels are high in meningeal infections. Their antibacterial action is inhibited by pus.
Mechanism of actionSulfisoxazole is a competitive inhibitor of the enzyme dihydropteroate synthetase. It inhibits bacterial synthesis of dihydrofolic acid by preventing the condensation of the pteridine with para-aminobenzoic acid (PABA), a substrate of the enzyme dihydropteroate synthetase. The inhibited reaction is necessary in these organisms for the synthesis of folic acid.
TargetKindPharmacological actionActionsOrganismUniProt ID
Dihydropteroate synthaseProteinyes
Escherichia coli (strain K12)P0AC13 details
Related Articles
AbsorptionNot Available
Volume of distributionNot Available
Protein bindingNot Available
MetabolismNot Available
Route of eliminationThe mean urinary excretion recovery following oral administration of sulfisoxazole is 97% within 48 hours, of which 52% is intact drug, with the remaining as the N4-acetylated metabolite. It is excreted in human milk.
Half lifeNot Available
ClearanceNot Available
ToxicityLD50=6800 mg/kg (Orally in mice)
Affected organisms
  • Enteric bacteria and other eubacteria
PathwaysNot Available
Pharmacogenomic Effects/ADRs
Interacting Gene/EnzymeAllele nameGenotype(s)Defining Change(s)Type(s)DescriptionDetails
Glucose-6-phosphate 1-dehydrogenaseVilleurbanne---1000_1002delACCADR InferredIncreased risk of dose-related hemolysis. Details
Glucose-6-phosphate 1-dehydrogenaseTorun---1006A->GADR InferredIncreased risk of dose-related hemolysis. Details
Glucose-6-phosphate 1-dehydrogenaseSunderland---105_107delCATADR InferredIncreased risk of dose-related hemolysis. Details
Glucose-6-phosphate 1-dehydrogenaseIwatsuki---1081G->AADR InferredIncreased risk of dose-related hemolysis. Details
Glucose-6-phosphate 1-dehydrogenaseSerres---1082C->TADR InferredIncreased risk of dose-related hemolysis. Details
Glucose-6-phosphate 1-dehydrogenaseTondela---1084_1101delCTGAACGAGCGCAAGGCCADR InferredIncreased risk of dose-related hemolysis. Details
Glucose-6-phosphate 1-dehydrogenaseLoma Linda---1089C->AADR InferredIncreased risk of dose-related hemolysis. Details
Glucose-6-phosphate 1-dehydrogenaseAachen---1089C->GADR InferredIncreased risk of dose-related hemolysis. Details
Glucose-6-phosphate 1-dehydrogenaseTenri---1096A->GADR InferredIncreased risk of dose-related hemolysis. Details
Glucose-6-phosphate 1-dehydrogenaseMontpellier---1132G>AADR InferredIncreased risk of dose-related hemolysis. Details
Glucose-6-phosphate 1-dehydrogenaseCalvo Mackenna---1138A->GADR InferredIncreased risk of dose-related hemolysis. Details
Glucose-6-phosphate 1-dehydrogenaseRiley---1139T->CADR InferredIncreased risk of dose-related hemolysis. Details
Glucose-6-phosphate 1-dehydrogenaseOlomouc---1141T->CADR InferredIncreased risk of dose-related hemolysis. Details
Glucose-6-phosphate 1-dehydrogenaseTomah---1153T->CADR InferredIncreased risk of dose-related hemolysis. Details
Glucose-6-phosphate 1-dehydrogenaseLynwood---1154G->TADR InferredIncreased risk of dose-related hemolysis. Details
Glucose-6-phosphate 1-dehydrogenaseMadrid---1155C->GADR InferredIncreased risk of dose-related hemolysis. Details
Glucose-6-phosphate 1-dehydrogenaseIowa, Walter Reed, Springfield---1156A->GADR InferredIncreased risk of dose-related hemolysis. Details
Glucose-6-phosphate 1-dehydrogenaseBeverly Hills, Genova, Iwate, Niigata, Yamaguchi---1160G->AADR InferredIncreased risk of dose-related hemolysis. Details
Glucose-6-phosphate 1-dehydrogenaseHartford---1162A->GADR InferredIncreased risk of dose-related hemolysis. Details
Glucose-6-phosphate 1-dehydrogenasePraha---1166A->GADR InferredIncreased risk of dose-related hemolysis. Details
Glucose-6-phosphate 1-dehydrogenaseKrakow---1175T>CADR InferredIncreased risk of dose-related hemolysis. Details
Glucose-6-phosphate 1-dehydrogenaseWisconsin---1177C->GADR InferredIncreased risk of dose-related hemolysis. Details
Glucose-6-phosphate 1-dehydrogenaseNashville, Anaheim, Portici---1178G->AADR InferredIncreased risk of dose-related hemolysis. Details
Glucose-6-phosphate 1-dehydrogenaseAlhambra---1180G->CADR InferredIncreased risk of dose-related hemolysis. Details
Glucose-6-phosphate 1-dehydrogenaseBari---1187C->TADR InferredIncreased risk of dose-related hemolysis. Details
Glucose-6-phosphate 1-dehydrogenasePuerto Limon---1192G->AADR InferredIncreased risk of dose-related hemolysis. Details
Glucose-6-phosphate 1-dehydrogenaseCovao do Lobo---1205C>AADR InferredIncreased risk of dose-related hemolysis. Details
Glucose-6-phosphate 1-dehydrogenaseClinic---1215G->AADR InferredIncreased risk of dose-related hemolysis. Details
Glucose-6-phosphate 1-dehydrogenaseUtrecht---1225C->TADR InferredIncreased risk of dose-related hemolysis. Details
Glucose-6-phosphate 1-dehydrogenaseSuwalki---1226C->GADR InferredIncreased risk of dose-related hemolysis. Details
Glucose-6-phosphate 1-dehydrogenaseRiverside---1228G->TADR InferredIncreased risk of dose-related hemolysis. Details
Glucose-6-phosphate 1-dehydrogenaseJapan, Shinagawa---1229G->AADR InferredIncreased risk of dose-related hemolysis. Details
Glucose-6-phosphate 1-dehydrogenaseKawasaki---1229G->CADR InferredIncreased risk of dose-related hemolysis. Details
Glucose-6-phosphate 1-dehydrogenaseMunich---1231A->GADR InferredIncreased risk of dose-related hemolysis. Details
Glucose-6-phosphate 1-dehydrogenaseGeorgia---1284C->AADR InferredIncreased risk of dose-related hemolysis. Details
Glucose-6-phosphate 1-dehydrogenaseSumare---1292T->GADR InferredIncreased risk of dose-related hemolysis. Details
Glucose-6-phosphate 1-dehydrogenaseTelti/Kobe---1318C->TADR InferredIncreased risk of dose-related hemolysis. Details
Glucose-6-phosphate 1-dehydrogenaseSantiago de Cuba, Morioka---1339G->AADR InferredIncreased risk of dose-related hemolysis. Details
Glucose-6-phosphate 1-dehydrogenaseHarima---1358T->AADR InferredIncreased risk of dose-related hemolysis. Details
Glucose-6-phosphate 1-dehydrogenaseFiguera da Foz---1366G->CADR InferredIncreased risk of dose-related hemolysis. Details
Glucose-6-phosphate 1-dehydrogenaseAmiens---1367A>TADR InferredIncreased risk of dose-related hemolysis. Details
Glucose-6-phosphate 1-dehydrogenaseBangkok Noi---1376G->T, 1502T->GADR InferredIncreased risk of dose-related hemolysis. Details
Glucose-6-phosphate 1-dehydrogenaseFukaya---1462G->AADR InferredIncreased risk of dose-related hemolysis. Details
Glucose-6-phosphate 1-dehydrogenaseCampinas---1463G->TADR InferredIncreased risk of dose-related hemolysis. Details
Glucose-6-phosphate 1-dehydrogenaseBuenos Aires---1465C>TADR InferredIncreased risk of dose-related hemolysis. Details
Glucose-6-phosphate 1-dehydrogenaseArakawa---1466C->TADR InferredIncreased risk of dose-related hemolysis. Details
Glucose-6-phosphate 1-dehydrogenaseBrighton---1488_1490delGAAADR InferredIncreased risk of dose-related hemolysis. Details
Glucose-6-phosphate 1-dehydrogenaseKozukata---159G->CADR InferredIncreased risk of dose-related hemolysis. Details
Glucose-6-phosphate 1-dehydrogenaseAmsterdam---180_182delTCTADR InferredIncreased risk of dose-related hemolysis. Details
Glucose-6-phosphate 1-dehydrogenaseNo name---202G->A, 376A->G, 1264C>GADR InferredIncreased risk of dose-related hemolysis. Details
Glucose-6-phosphate 1-dehydrogenaseSwansea---224T->CADR InferredIncreased risk of dose-related hemolysis. Details
Glucose-6-phosphate 1-dehydrogenaseUrayasu---281_283delAGAADR InferredIncreased risk of dose-related hemolysis. Details
Glucose-6-phosphate 1-dehydrogenaseVancouver---317C->G544C->T592C->TADR InferredIncreased risk of dose-related hemolysis. Details
Glucose-6-phosphate 1-dehydrogenaseMt Sinai---376A->G, 1159C->TADR InferredIncreased risk of dose-related hemolysis. Details
Glucose-6-phosphate 1-dehydrogenasePlymouth---488G->AADR InferredIncreased risk of dose-related hemolysis. Details
Glucose-6-phosphate 1-dehydrogenaseVolendam---514C->TADR InferredIncreased risk of dose-related hemolysis. Details
Glucose-6-phosphate 1-dehydrogenaseShinshu---527A->GADR InferredIncreased risk of dose-related hemolysis. Details
Glucose-6-phosphate 1-dehydrogenaseChikugo---535A->TADR InferredIncreased risk of dose-related hemolysis. Details
Glucose-6-phosphate 1-dehydrogenaseTsukui---561_563delCTCADR InferredIncreased risk of dose-related hemolysis. Details
Glucose-6-phosphate 1-dehydrogenasePedoplis-Ckaro---573C>GADR InferredIncreased risk of dose-related hemolysis. Details
Glucose-6-phosphate 1-dehydrogenaseSantiago---593G->CADR InferredIncreased risk of dose-related hemolysis. Details
Glucose-6-phosphate 1-dehydrogenaseMinnesota, Marion, Gastonia, LeJeune---637G->TADR InferredIncreased risk of dose-related hemolysis. Details
Glucose-6-phosphate 1-dehydrogenaseCincinnati---637G->T, 1037A->TADR InferredIncreased risk of dose-related hemolysis. Details
Glucose-6-phosphate 1-dehydrogenaseHarilaou---648T->GADR InferredIncreased risk of dose-related hemolysis. Details
Glucose-6-phosphate 1-dehydrogenaseNorth Dallas---683_685delACAADR InferredIncreased risk of dose-related hemolysis. Details
Glucose-6-phosphate 1-dehydrogenaseAsahikawa---695G->AADR InferredIncreased risk of dose-related hemolysis. Details
Glucose-6-phosphate 1-dehydrogenaseDurham---713A->GADR InferredIncreased risk of dose-related hemolysis. Details
Glucose-6-phosphate 1-dehydrogenaseStonybrook---724_729delGGCACTADR InferredIncreased risk of dose-related hemolysis. Details
Glucose-6-phosphate 1-dehydrogenaseWayne---769C->GADR InferredIncreased risk of dose-related hemolysis. Details
Glucose-6-phosphate 1-dehydrogenaseAveiro---806G->AADR InferredIncreased risk of dose-related hemolysis. Details
Glucose-6-phosphate 1-dehydrogenaseCleveland Corum---820G->AADR InferredIncreased risk of dose-related hemolysis. Details
Glucose-6-phosphate 1-dehydrogenaseLille---821A>TADR InferredIncreased risk of dose-related hemolysis. Details
Glucose-6-phosphate 1-dehydrogenaseBangkok---825G>CADR InferredIncreased risk of dose-related hemolysis. Details
Glucose-6-phosphate 1-dehydrogenaseSugao---826C->TADR InferredIncreased risk of dose-related hemolysis. Details
Glucose-6-phosphate 1-dehydrogenaseLa Jolla---832T->CADR InferredIncreased risk of dose-related hemolysis. Details
Glucose-6-phosphate 1-dehydrogenaseWexham---833C->TADR InferredIncreased risk of dose-related hemolysis. Details
Glucose-6-phosphate 1-dehydrogenasePiotrkow---851T>CADR InferredIncreased risk of dose-related hemolysis. Details
Glucose-6-phosphate 1-dehydrogenaseWest Virginia---910G->TADR InferredIncreased risk of dose-related hemolysis. Details
Glucose-6-phosphate 1-dehydrogenaseOmiya---921G->CADR InferredIncreased risk of dose-related hemolysis. Details
Glucose-6-phosphate 1-dehydrogenaseNara---953_976delCCACCAAAGGGTACCTGGAC GACCADR InferredIncreased risk of dose-related hemolysis. Details
Glucose-6-phosphate 1-dehydrogenaseManhattan---962G->AADR InferredIncreased risk of dose-related hemolysis. Details
Glucose-6-phosphate 1-dehydrogenaseRehevot---964T->CADR InferredIncreased risk of dose-related hemolysis. Details
Glucose-6-phosphate 1-dehydrogenaseHoniara---99A->G / 1360C->TADR InferredIncreased risk of dose-related hemolysis. Details
Glucose-6-phosphate 1-dehydrogenaseTokyo, Fukushima---1246G->AADR InferredIncreased risk of dose-related hemolysis. Details
Glucose-6-phosphate 1-dehydrogenaseChatham---1003G->AADR InferredIncreased risk of dose-related hemolysis. Details
Glucose-6-phosphate 1-dehydrogenaseFushan---1004C->AADR InferredIncreased risk of dose-related hemolysis. Details
Glucose-6-phosphate 1-dehydrogenasePartenope---1052G->TADR InferredIncreased risk of dose-related hemolysis. Details
Glucose-6-phosphate 1-dehydrogenaseIerapetra---1057C->TADR InferredIncreased risk of dose-related hemolysis. Details
Glucose-6-phosphate 1-dehydrogenaseAnadia---1193A->GADR InferredIncreased risk of dose-related hemolysis. Details
Glucose-6-phosphate 1-dehydrogenaseAbeno---1220A->CADR InferredIncreased risk of dose-related hemolysis. Details
Glucose-6-phosphate 1-dehydrogenaseSurabaya---1291G->AADR InferredIncreased risk of dose-related hemolysis. Details
Glucose-6-phosphate 1-dehydrogenasePawnee---1316G->CADR InferredIncreased risk of dose-related hemolysis. Details
Glucose-6-phosphate 1-dehydrogenaseS. Antioco---1342A->GADR InferredIncreased risk of dose-related hemolysis. Details
Glucose-6-phosphate 1-dehydrogenaseCassano---1347G->CADR InferredIncreased risk of dose-related hemolysis. Details
Glucose-6-phosphate 1-dehydrogenaseHermoupolis---1347G->C / 1360C->TADR InferredIncreased risk of dose-related hemolysis. Details
Glucose-6-phosphate 1-dehydrogenaseUnion,Maewo, Chinese-2, Kalo---1360C->TADR InferredIncreased risk of dose-related hemolysis. Details
Glucose-6-phosphate 1-dehydrogenaseAndalus---1361G->AADR InferredIncreased risk of dose-related hemolysis. Details
Glucose-6-phosphate 1-dehydrogenaseCosenza---1376G->CADR InferredIncreased risk of dose-related hemolysis. Details
Glucose-6-phosphate 1-dehydrogenaseCanton, Taiwan- Hakka, Gifu-like, Agrigento-like---1376G->TADR InferredIncreased risk of dose-related hemolysis. Details
Glucose-6-phosphate 1-dehydrogenaseFlores---1387C->AADR InferredIncreased risk of dose-related hemolysis. Details
Glucose-6-phosphate 1-dehydrogenaseKaiping, Anant, Dhon, Sapporo-like, Wosera---1388G->AADR InferredIncreased risk of dose-related hemolysis. Details
Glucose-6-phosphate 1-dehydrogenaseKamogawa---169C->TADR InferredIncreased risk of dose-related hemolysis. Details
Glucose-6-phosphate 1-dehydrogenaseCostanzo---179T>CADR InferredIncreased risk of dose-related hemolysis. Details
Glucose-6-phosphate 1-dehydrogenaseAmazonia---185C->AADR InferredIncreased risk of dose-related hemolysis. Details
Glucose-6-phosphate 1-dehydrogenaseSongklanagarind---196T->AADR InferredIncreased risk of dose-related hemolysis. Details
Glucose-6-phosphate 1-dehydrogenaseHechi---202G->A / 871G->AADR InferredIncreased risk of dose-related hemolysis. Details
Glucose-6-phosphate 1-dehydrogenaseNamouru---208T->CADR InferredIncreased risk of dose-related hemolysis. Details
Glucose-6-phosphate 1-dehydrogenaseBao Loc---352T>CADR InferredIncreased risk of dose-related hemolysis. Details
Glucose-6-phosphate 1-dehydrogenaseCrispim---375G->T, 379G->T383T->C384C>TADR InferredIncreased risk of dose-related hemolysis. Details
Glucose-6-phosphate 1-dehydrogenaseAcrokorinthos---376A->G / 463C->GADR InferredIncreased risk of dose-related hemolysis. Details
Glucose-6-phosphate 1-dehydrogenaseSanta Maria---376A->G / 542A->TADR InferredIncreased risk of dose-related hemolysis. Details
Glucose-6-phosphate 1-dehydrogenaseAnanindeua---376A->G / 871G->AADR InferredIncreased risk of dose-related hemolysis. Details
Glucose-6-phosphate 1-dehydrogenaseVanua Lava---383T->CADR InferredIncreased risk of dose-related hemolysis. Details
Glucose-6-phosphate 1-dehydrogenaseValladolid---406C->TADR InferredIncreased risk of dose-related hemolysis. Details
Glucose-6-phosphate 1-dehydrogenaseBelem---409C->TADR InferredIncreased risk of dose-related hemolysis. Details
Glucose-6-phosphate 1-dehydrogenaseLiuzhou---442G->AADR InferredIncreased risk of dose-related hemolysis. Details
Glucose-6-phosphate 1-dehydrogenaseShenzen---473G>AADR InferredIncreased risk of dose-related hemolysis. Details
Glucose-6-phosphate 1-dehydrogenaseTaipei “Chinese- 3”---493A->GADR InferredIncreased risk of dose-related hemolysis. Details
Glucose-6-phosphate 1-dehydrogenaseToledo---496C>TADR InferredIncreased risk of dose-related hemolysis. Details
Glucose-6-phosphate 1-dehydrogenaseNaone---497G->AADR InferredIncreased risk of dose-related hemolysis. Details
Glucose-6-phosphate 1-dehydrogenaseNankang---517T->CADR InferredIncreased risk of dose-related hemolysis. Details
Glucose-6-phosphate 1-dehydrogenaseMiaoli---519C->GADR InferredIncreased risk of dose-related hemolysis. Details
Glucose-6-phosphate 1-dehydrogenaseMediterranean, Dallas, Panama‚ Sassari, Cagliari, Birmingham---563C->TADR InferredIncreased risk of dose-related hemolysis. Details
Glucose-6-phosphate 1-dehydrogenaseCoimbra Shunde---592C->TADR InferredIncreased risk of dose-related hemolysis. Details
Glucose-6-phosphate 1-dehydrogenaseNilgiri---593G>AADR InferredIncreased risk of dose-related hemolysis. Details
Glucose-6-phosphate 1-dehydrogenaseRadlowo---679C->TADR InferredIncreased risk of dose-related hemolysis. Details
Glucose-6-phosphate 1-dehydrogenaseRoubaix---811G>CADR InferredIncreased risk of dose-related hemolysis. Details
Glucose-6-phosphate 1-dehydrogenaseHaikou---835A->GADR InferredIncreased risk of dose-related hemolysis. Details
Glucose-6-phosphate 1-dehydrogenaseChinese-1---835A->TADR InferredIncreased risk of dose-related hemolysis. Details
Glucose-6-phosphate 1-dehydrogenaseMizushima---848A>GADR InferredIncreased risk of dose-related hemolysis. Details
Glucose-6-phosphate 1-dehydrogenaseOsaka---853C->TADR InferredIncreased risk of dose-related hemolysis. Details
Glucose-6-phosphate 1-dehydrogenaseViangchan, Jammu---871G->AADR InferredIncreased risk of dose-related hemolysis. Details
Glucose-6-phosphate 1-dehydrogenaseSeoul---916G->AADR InferredIncreased risk of dose-related hemolysis. Details
Glucose-6-phosphate 1-dehydrogenaseLudhiana---929G->AADR InferredIncreased risk of dose-related hemolysis. Details
Glucose-6-phosphate 1-dehydrogenaseFarroupilha---977C->AADR InferredIncreased risk of dose-related hemolysis. Details
Glucose-6-phosphate 1-dehydrogenaseChinese-5---1024C->TADR InferredIncreased risk of dose-related hemolysis. Details
Glucose-6-phosphate 1-dehydrogenaseRignano---130G>AADR InferredIncreased risk of dose-related hemolysis. Details
Glucose-6-phosphate 1-dehydrogenaseOrissa---131C->GADR InferredIncreased risk of dose-related hemolysis. Details
Glucose-6-phosphate 1-dehydrogenaseG6PDNice---1380G>CADR InferredIncreased risk of dose-related hemolysis. Details
Glucose-6-phosphate 1-dehydrogenaseKamiube, Keelung---1387C->TADR InferredIncreased risk of dose-related hemolysis. Details
Glucose-6-phosphate 1-dehydrogenaseNeapolis---1400C->GADR InferredIncreased risk of dose-related hemolysis. Details
Glucose-6-phosphate 1-dehydrogenaseAures---143T->CADR InferredIncreased risk of dose-related hemolysis. Details
Glucose-6-phosphate 1-dehydrogenaseSplit---1442C->GADR InferredIncreased risk of dose-related hemolysis. Details
Glucose-6-phosphate 1-dehydrogenaseKambos---148C->TADR InferredIncreased risk of dose-related hemolysis. Details
Glucose-6-phosphate 1-dehydrogenasePalestrina---170G>AADR InferredIncreased risk of dose-related hemolysis. Details
Glucose-6-phosphate 1-dehydrogenaseMetaponto---172G->AADR InferredIncreased risk of dose-related hemolysis. Details
Glucose-6-phosphate 1-dehydrogenaseMusashino---185C->TADR InferredIncreased risk of dose-related hemolysis. Details
Glucose-6-phosphate 1-dehydrogenaseAsahi---202G->AADR InferredIncreased risk of dose-related hemolysis. Details
Glucose-6-phosphate 1-dehydrogenaseA- (202), Ferrara I---202G->A / 376A->GADR InferredIncreased risk of dose-related hemolysis. Details
Glucose-6-phosphate 1-dehydrogenaseMurcia Oristano---209A->GADR InferredIncreased risk of dose-related hemolysis. Details
Glucose-6-phosphate 1-dehydrogenaseUbe Konan---241C->TADR InferredIncreased risk of dose-related hemolysis. Details
Glucose-6-phosphate 1-dehydrogenaseLagosanto---242G->AADR InferredIncreased risk of dose-related hemolysis. Details
Glucose-6-phosphate 1-dehydrogenaseGuangzhou---274C->TADR InferredIncreased risk of dose-related hemolysis. Details
Glucose-6-phosphate 1-dehydrogenaseHammersmith---323T->AADR InferredIncreased risk of dose-related hemolysis. Details
Glucose-6-phosphate 1-dehydrogenaseSinnai---34G->TADR InferredIncreased risk of dose-related hemolysis. Details
Glucose-6-phosphate 1-dehydrogenaseA- (680)---376A->G / 680G->TADR InferredIncreased risk of dose-related hemolysis. Details
Glucose-6-phosphate 1-dehydrogenaseA- (968), Betica,Selma, Guantanamo---376A->G / 968T->CADR InferredIncreased risk of dose-related hemolysis. Details
Glucose-6-phosphate 1-dehydrogenaseSalerno Pyrgos---383T>GADR InferredIncreased risk of dose-related hemolysis. Details
Glucose-6-phosphate 1-dehydrogenaseQuing Yan---392G->TADR InferredIncreased risk of dose-related hemolysis. Details
Glucose-6-phosphate 1-dehydrogenaseLages---40G->AADR InferredIncreased risk of dose-related hemolysis. Details
Glucose-6-phosphate 1-dehydrogenaseIlesha---466G->AADR InferredIncreased risk of dose-related hemolysis. Details
Glucose-6-phosphate 1-dehydrogenaseMahidol---487G->AADR InferredIncreased risk of dose-related hemolysis. Details
Glucose-6-phosphate 1-dehydrogenaseMalaga---542A->TADR InferredIncreased risk of dose-related hemolysis. Details
Glucose-6-phosphate 1-dehydrogenaseSibari---634A->GADR InferredIncreased risk of dose-related hemolysis. Details
Glucose-6-phosphate 1-dehydrogenaseMexico City---680G->AADR InferredIncreased risk of dose-related hemolysis. Details
Glucose-6-phosphate 1-dehydrogenaseNanning---703C->TADR InferredIncreased risk of dose-related hemolysis. Details
Glucose-6-phosphate 1-dehydrogenaseSeattle, Lodi, Modena, Ferrara II, Athens-like---844G->CADR InferredIncreased risk of dose-related hemolysis. Details
Glucose-6-phosphate 1-dehydrogenaseBajo Maumere---844G->TADR InferredIncreased risk of dose-related hemolysis. Details
Glucose-6-phosphate 1-dehydrogenaseMontalbano---854G->AADR InferredIncreased risk of dose-related hemolysis. Details
Glucose-6-phosphate 1-dehydrogenaseKalyan-Kerala, Jamnaga, Rohini---949G->AADR InferredIncreased risk of dose-related hemolysis. Details
Glucose-6-phosphate 1-dehydrogenaseGaohe---95A->GADR InferredIncreased risk of dose-related hemolysis. Details
Drug Interactions
DrugInteractionDrug group
7,8-DICHLORO-1,2,3,4-TETRAHYDROISOQUINOLINE7,8-DICHLORO-1,2,3,4-TETRAHYDROISOQUINOLINE may increase the hypoglycemic activities of Sulfisoxazole.Experimental
AbirateroneThe metabolism of Abiraterone can be decreased when combined with Sulfisoxazole.Approved
AcarboseAcarbose may increase the hypoglycemic activities of Sulfisoxazole.Approved, Investigational
AceclofenacThe metabolism of Aceclofenac can be decreased when combined with Sulfisoxazole.Approved
AcenocoumarolThe metabolism of Acenocoumarol can be decreased when combined with Sulfisoxazole.Approved
AcetaminophenThe metabolism of Acetaminophen can be decreased when combined with Sulfisoxazole.Approved
AcetohexamideAcetohexamide may increase the hypoglycemic activities of Sulfisoxazole.Withdrawn
Acetylsalicylic acidThe metabolism of Acetylsalicylic acid can be decreased when combined with Sulfisoxazole.Approved, Vet Approved
AdinazolamThe metabolism of Adinazolam can be decreased when combined with Sulfisoxazole.Approved
AicarAicar may increase the hypoglycemic activities of Sulfisoxazole.Experimental
AlbendazoleThe metabolism of Albendazole can be decreased when combined with Sulfisoxazole.Approved, Vet Approved
AlclometasoneThe metabolism of Alclometasone can be decreased when combined with Sulfisoxazole.Approved
AlfentanilThe metabolism of Alfentanil can be decreased when combined with Sulfisoxazole.Approved, Illicit
AlfuzosinAlfuzosin may increase the QTc-prolonging activities of Sulfisoxazole.Approved, Investigational
AliskirenThe metabolism of Aliskiren can be decreased when combined with Sulfisoxazole.Approved, Investigational
AllylestrenolThe metabolism of Allylestrenol can be decreased when combined with Sulfisoxazole.Approved
AlmotriptanThe metabolism of Almotriptan can be decreased when combined with Sulfisoxazole.Approved, Investigational
AlogliptinThe metabolism of Alogliptin can be decreased when combined with Sulfisoxazole.Approved
AlosetronThe metabolism of Alosetron can be decreased when combined with Sulfisoxazole.Approved, Withdrawn
AlprazolamThe metabolism of Alprazolam can be decreased when combined with Sulfisoxazole.Approved, Illicit, Investigational
AmantadineAmantadine may increase the QTc-prolonging activities of Sulfisoxazole.Approved
AmbrisentanThe metabolism of Ambrisentan can be decreased when combined with Sulfisoxazole.Approved, Investigational
AmbroxolThe metabolism of Ambroxol can be decreased when combined with Sulfisoxazole.Approved
AminophenazoneThe metabolism of Aminophenazone can be decreased when combined with Sulfisoxazole.Approved, Withdrawn
AminophyllineThe metabolism of Aminophylline can be decreased when combined with Sulfisoxazole.Approved
Aminosalicylic AcidAminosalicylic Acid may increase the hypoglycemic activities of Sulfisoxazole.Approved
AmiodaroneSulfisoxazole may increase the QTc-prolonging activities of Amiodarone.Approved, Investigational
AmitriptylineThe metabolism of Amitriptyline can be decreased when combined with Sulfisoxazole.Approved
AmlodipineThe metabolism of Amlodipine can be decreased when combined with Sulfisoxazole.Approved
AmoxapineAmoxapine may increase the QTc-prolonging activities of Sulfisoxazole.Approved
AmprenavirThe metabolism of Amprenavir can be decreased when combined with Sulfisoxazole.Approved
AnagrelideSulfisoxazole may increase the QTc-prolonging activities of Anagrelide.Approved
AntipyrineThe metabolism of Antipyrine can be decreased when combined with Sulfisoxazole.Approved
ApixabanThe serum concentration of Apixaban can be increased when it is combined with Sulfisoxazole.Approved
ApomorphineApomorphine may increase the QTc-prolonging activities of Sulfisoxazole.Approved, Investigational
ApremilastThe metabolism of Apremilast can be decreased when combined with Sulfisoxazole.Approved, Investigational
AprepitantThe metabolism of Sulfisoxazole can be increased when combined with Aprepitant.Approved, Investigational
Arachidonic AcidThe metabolism of Arachidonic Acid can be decreased when combined with Sulfisoxazole.Experimental
ArformoterolThe metabolism of Arformoterol can be decreased when combined with Sulfisoxazole.Approved, Investigational
ArgatrobanThe metabolism of Argatroban can be decreased when combined with Sulfisoxazole.Approved, Investigational
AripiprazoleThe serum concentration of Aripiprazole can be increased when it is combined with Sulfisoxazole.Approved, Investigational
Arsenic trioxideSulfisoxazole may increase the QTc-prolonging activities of Arsenic trioxide.Approved, Investigational
ArtemetherSulfisoxazole may increase the QTc-prolonging activities of Artemether.Approved
AsenapineSulfisoxazole may increase the QTc-prolonging activities of Asenapine.Approved
AstemizoleThe metabolism of Astemizole can be decreased when combined with Sulfisoxazole.Approved, Withdrawn
AtazanavirThe metabolism of Atazanavir can be decreased when combined with Sulfisoxazole.Approved, Investigational
AtomoxetineAtomoxetine may increase the QTc-prolonging activities of Sulfisoxazole.Approved
AtorvastatinThe metabolism of Atorvastatin can be decreased when combined with Sulfisoxazole.Approved
AvanafilThe serum concentration of Avanafil can be increased when it is combined with Sulfisoxazole.Approved
AxitinibThe metabolism of Axitinib can be decreased when combined with Sulfisoxazole.Approved, Investigational
AzelastineThe metabolism of Azelastine can be decreased when combined with Sulfisoxazole.Approved
AzithromycinAzithromycin may increase the QTc-prolonging activities of Sulfisoxazole.Approved
BalsalazideBalsalazide may increase the hypoglycemic activities of Sulfisoxazole.Approved, Investigational
BanoxantroneThe metabolism of Banoxantrone can be decreased when combined with Sulfisoxazole.Investigational
BedaquilineSulfisoxazole may increase the QTc-prolonging activities of Bedaquiline.Approved
BenmoxinBenmoxin may increase the hypoglycemic activities of Sulfisoxazole.Withdrawn
BenzphetamineThe metabolism of Benzphetamine can be decreased when combined with Sulfisoxazole.Approved, Illicit
Benzyl alcoholThe metabolism of Benzyl alcohol can be decreased when combined with Sulfisoxazole.Approved
BexaroteneThe metabolism of Bexarotene can be decreased when combined with Sulfisoxazole.Approved, Investigational
BezafibrateThe metabolism of Bezafibrate can be decreased when combined with Sulfisoxazole.Approved
BicalutamideThe metabolism of Bicalutamide can be decreased when combined with Sulfisoxazole.Approved
BisoprololThe metabolism of Bisoprolol can be decreased when combined with Sulfisoxazole.Approved
BoceprevirThe metabolism of Boceprevir can be decreased when combined with Sulfisoxazole.Approved
BortezomibThe metabolism of Bortezomib can be decreased when combined with Sulfisoxazole.Approved, Investigational
BosentanThe serum concentration of Bosentan can be increased when it is combined with Sulfisoxazole.Approved, Investigational
BosutinibThe serum concentration of Bosutinib can be increased when it is combined with Sulfisoxazole.Approved
Brentuximab vedotinThe metabolism of Brentuximab vedotin can be decreased when combined with Sulfisoxazole.Approved
BrexpiprazoleThe serum concentration of Brexpiprazole can be increased when it is combined with Sulfisoxazole.Approved
BrinzolamideThe metabolism of Brinzolamide can be decreased when combined with Sulfisoxazole.Approved
BromazepamThe metabolism of Bromazepam can be decreased when combined with Sulfisoxazole.Approved, Illicit
BromocriptineThe metabolism of Bromocriptine can be decreased when combined with Sulfisoxazole.Approved, Investigational
BrompheniramineThe metabolism of Brompheniramine can be decreased when combined with Sulfisoxazole.Approved
BudesonideThe serum concentration of Budesonide can be increased when it is combined with Sulfisoxazole.Approved
BudesonideThe metabolism of Budesonide can be decreased when combined with Sulfisoxazole.Approved
BuforminBuformin may increase the hypoglycemic activities of Sulfisoxazole.Withdrawn
BupivacaineThe metabolism of Bupivacaine can be decreased when combined with Sulfisoxazole.Approved, Investigational
BuprenorphineThe metabolism of Buprenorphine can be decreased when combined with Sulfisoxazole.Approved, Illicit, Investigational, Vet Approved
BupropionThe metabolism of Bupropion can be decreased when combined with Sulfisoxazole.Approved
BuserelinBuserelin may increase the QTc-prolonging activities of Sulfisoxazole.Approved
BuspironeThe metabolism of Buspirone can be decreased when combined with Sulfisoxazole.Approved, Investigational
BusulfanThe metabolism of Busulfan can be decreased when combined with Sulfisoxazole.Approved, Investigational
CabazitaxelThe metabolism of Cabazitaxel can be decreased when combined with Sulfisoxazole.Approved
CabergolineThe metabolism of Cabergoline can be decreased when combined with Sulfisoxazole.Approved
CabozantinibThe metabolism of Cabozantinib can be decreased when combined with Sulfisoxazole.Approved
CaffeineThe metabolism of Caffeine can be decreased when combined with Sulfisoxazole.Approved
CalcitriolThe metabolism of Calcitriol can be decreased when combined with Sulfisoxazole.Approved, Nutraceutical
CanagliflozinThe metabolism of Canagliflozin can be decreased when combined with Sulfisoxazole.Approved
CandesartanThe metabolism of Candesartan can be decreased when combined with Sulfisoxazole.Approved
CapecitabineThe metabolism of Sulfisoxazole can be decreased when combined with Capecitabine.Approved, Investigational
CarbamazepineThe metabolism of Sulfisoxazole can be increased when combined with Carbamazepine.Approved, Investigational
CarbinoxamineThe metabolism of Carbinoxamine can be decreased when combined with Sulfisoxazole.Approved
CariprazineThe metabolism of Cariprazine can be decreased when combined with Sulfisoxazole.Approved
CaroxazoneCaroxazone may increase the hypoglycemic activities of Sulfisoxazole.Withdrawn
CarvedilolThe serum concentration of Carvedilol can be increased when it is combined with Sulfisoxazole.Approved, Investigational
CastanospermineCastanospermine may increase the hypoglycemic activities of Sulfisoxazole.Experimental
CelecoxibThe metabolism of Celecoxib can be decreased when combined with Sulfisoxazole.Approved, Investigational
CeliprololThe metabolism of Celiprolol can be decreased when combined with Sulfisoxazole.Approved, Investigational
CephalexinThe metabolism of Cephalexin can be decreased when combined with Sulfisoxazole.Approved, Vet Approved
CeritinibThe serum concentration of Sulfisoxazole can be increased when it is combined with Ceritinib.Approved
CerivastatinThe metabolism of Cerivastatin can be decreased when combined with Sulfisoxazole.Withdrawn
CevimelineThe metabolism of Cevimeline can be decreased when combined with Sulfisoxazole.Approved
Chenodeoxycholic acidThe metabolism of Chenodeoxycholic acid can be decreased when combined with Sulfisoxazole.Approved
ChlordiazepoxideThe metabolism of Chlordiazepoxide can be decreased when combined with Sulfisoxazole.Approved, Illicit
ChloroquineSulfisoxazole may increase the QTc-prolonging activities of Chloroquine.Approved, Vet Approved
ChlorphenamineThe metabolism of Chlorphenamine can be decreased when combined with Sulfisoxazole.Approved
ChlorpromazineSulfisoxazole may increase the QTc-prolonging activities of Chlorpromazine.Approved, Vet Approved
ChlorpropamideThe metabolism of Chlorpropamide can be decreased when combined with Sulfisoxazole.Approved
ChlorzoxazoneThe metabolism of Chlorzoxazone can be decreased when combined with Sulfisoxazole.Approved
CholecalciferolThe metabolism of Cholecalciferol can be decreased when combined with Sulfisoxazole.Approved, Nutraceutical
CiclesonideThe metabolism of Ciclesonide can be decreased when combined with Sulfisoxazole.Approved, Investigational
CiglitazoneCiglitazone may increase the hypoglycemic activities of Sulfisoxazole.Experimental
CilostazolThe serum concentration of Cilostazol can be increased when it is combined with Sulfisoxazole.Approved
CinacalcetThe metabolism of Cinacalcet can be decreased when combined with Sulfisoxazole.Approved
CinnarizineThe metabolism of Cinnarizine can be decreased when combined with Sulfisoxazole.Approved
CinoxacinCinoxacin may increase the hypoglycemic activities of Sulfisoxazole.Approved, Withdrawn
CiprofloxacinSulfisoxazole may increase the QTc-prolonging activities of Ciprofloxacin.Approved, Investigational
CisaprideSulfisoxazole may increase the QTc-prolonging activities of Cisapride.Approved, Investigational, Withdrawn
CitalopramSulfisoxazole may increase the QTc-prolonging activities of Citalopram.Approved
ClarithromycinSulfisoxazole may increase the QTc-prolonging activities of Clarithromycin.Approved
ClindamycinThe metabolism of Clindamycin can be decreased when combined with Sulfisoxazole.Approved, Vet Approved
ClobazamThe metabolism of Clobazam can be decreased when combined with Sulfisoxazole.Approved, Illicit
ClofazimineThe metabolism of Clofazimine can be decreased when combined with Sulfisoxazole.Approved, Investigational
ClofibrateThe metabolism of Clofibrate can be decreased when combined with Sulfisoxazole.Approved
ClomipramineClomipramine may increase the QTc-prolonging activities of Sulfisoxazole.Approved, Vet Approved
ClonazepamThe metabolism of Clonazepam can be decreased when combined with Sulfisoxazole.Approved, Illicit
ClonidineThe metabolism of Clonidine can be decreased when combined with Sulfisoxazole.Approved
ClopidogrelThe metabolism of Clopidogrel can be decreased when combined with Sulfisoxazole.Approved, Nutraceutical
ClorazepateThe metabolism of Clorazepate can be decreased when combined with Sulfisoxazole.Approved, Illicit
ClotiazepamThe metabolism of Clotiazepam can be decreased when combined with Sulfisoxazole.Approved, Illicit
ClotrimazoleThe metabolism of Sulfisoxazole can be decreased when combined with Clotrimazole.Approved, Vet Approved
ClozapineSulfisoxazole may increase the QTc-prolonging activities of Clozapine.Approved
CobimetinibThe serum concentration of Cobimetinib can be increased when it is combined with Sulfisoxazole.Approved
CocaineThe metabolism of Cocaine can be decreased when combined with Sulfisoxazole.Approved, Illicit
CodeineThe metabolism of Codeine can be decreased when combined with Sulfisoxazole.Approved, Illicit
ColchicineThe serum concentration of Colchicine can be increased when it is combined with Sulfisoxazole.Approved
ConivaptanThe metabolism of Conivaptan can be decreased when combined with Sulfisoxazole.Approved, Investigational
Conjugated Equine EstrogensThe metabolism of Conjugated Equine Estrogens can be decreased when combined with Sulfisoxazole.Approved
Cortisone acetateThe metabolism of Cortisone acetate can be decreased when combined with Sulfisoxazole.Approved
CrizotinibSulfisoxazole may increase the QTc-prolonging activities of Crizotinib.Approved
CyclobenzaprineThe metabolism of Cyclobenzaprine can be decreased when combined with Sulfisoxazole.Approved
CyclophosphamideThe metabolism of Cyclophosphamide can be decreased when combined with Sulfisoxazole.Approved, Investigational
CyclosporineThe metabolism of Cyclosporine can be decreased when combined with Sulfisoxazole.Approved, Investigational, Vet Approved
CyclosporineSulfisoxazole may increase the nephrotoxic activities of Cyclosporine.Approved, Investigational, Vet Approved
CytarabineThe metabolism of Cytarabine can be decreased when combined with Sulfisoxazole.Approved, Investigational
DabrafenibThe serum concentration of Sulfisoxazole can be decreased when it is combined with Dabrafenib.Approved
DaclatasvirThe metabolism of Daclatasvir can be decreased when combined with Sulfisoxazole.Approved
DantroleneThe metabolism of Dantrolene can be decreased when combined with Sulfisoxazole.Approved
DapagliflozinThe metabolism of Dapagliflozin can be decreased when combined with Sulfisoxazole.Approved
DapoxetineThe serum concentration of Dapoxetine can be increased when it is combined with Sulfisoxazole.Investigational
DapsoneThe metabolism of Dapsone can be decreased when combined with Sulfisoxazole.Approved, Investigational
DarifenacinThe metabolism of Darifenacin can be decreased when combined with Sulfisoxazole.Approved, Investigational
DarunavirThe metabolism of Darunavir can be decreased when combined with Sulfisoxazole.Approved
DasabuvirThe metabolism of Dasabuvir can be decreased when combined with Sulfisoxazole.Approved
DasatinibDasatinib may increase the QTc-prolonging activities of Sulfisoxazole.Approved, Investigational
DaunorubicinThe metabolism of Daunorubicin can be decreased when combined with Sulfisoxazole.Approved
DegarelixDegarelix may increase the QTc-prolonging activities of Sulfisoxazole.Approved
DelavirdineThe metabolism of Sulfisoxazole can be decreased when combined with Delavirdine.Approved
DesfluraneDesflurane may increase the QTc-prolonging activities of Sulfisoxazole.Approved
DesipramineDesipramine may increase the QTc-prolonging activities of Sulfisoxazole.Approved
DesvenlafaxineThe metabolism of Desvenlafaxine can be decreased when combined with Sulfisoxazole.Approved
DexamethasoneThe metabolism of Dexamethasone can be decreased when combined with Sulfisoxazole.Approved, Investigational, Vet Approved
DexketoprofenThe risk or severity of adverse effects can be increased when Dexketoprofen is combined with Sulfisoxazole.Approved
DextromethorphanThe metabolism of Dextromethorphan can be decreased when combined with Sulfisoxazole.Approved
DextropropoxypheneThe metabolism of Dextropropoxyphene can be decreased when combined with Sulfisoxazole.Approved, Illicit, Withdrawn
DiazepamThe metabolism of Diazepam can be decreased when combined with Sulfisoxazole.Approved, Illicit, Vet Approved
DiclofenacThe metabolism of Diclofenac can be decreased when combined with Sulfisoxazole.Approved, Vet Approved
DiclofenacThe serum concentration of Diclofenac can be increased when it is combined with Sulfisoxazole.Approved, Vet Approved
DicoumarolThe metabolism of Dicoumarol can be decreased when combined with Sulfisoxazole.Approved
DiflunisalDiflunisal may increase the hypoglycemic activities of Sulfisoxazole.Approved
DigitoxinThe metabolism of Digitoxin can be decreased when combined with Sulfisoxazole.Approved
DigoxinThe metabolism of Digoxin can be decreased when combined with Sulfisoxazole.Approved
DihydrocodeineThe metabolism of Dihydrocodeine can be decreased when combined with Sulfisoxazole.Approved, Illicit
DihydroergotamineThe metabolism of Dihydroergotamine can be decreased when combined with Sulfisoxazole.Approved
DihydrotestosteroneDihydrotestosterone may increase the hypoglycemic activities of Sulfisoxazole.Illicit
DiltiazemThe metabolism of Diltiazem can be decreased when combined with Sulfisoxazole.Approved
DiphenhydramineThe metabolism of Diphenhydramine can be decreased when combined with Sulfisoxazole.Approved
DisopyramideSulfisoxazole may increase the QTc-prolonging activities of Disopyramide.Approved
DisulfiramThe metabolism of Disulfiram can be decreased when combined with Sulfisoxazole.Approved
DocetaxelThe metabolism of Docetaxel can be decreased when combined with Sulfisoxazole.Approved, Investigational
DofetilideThe serum concentration of Dofetilide can be increased when it is combined with Sulfisoxazole.Approved
DolasetronSulfisoxazole may increase the QTc-prolonging activities of Dolasetron.Approved
DomperidoneThe serum concentration of Domperidone can be increased when it is combined with Sulfisoxazole.Approved, Investigational, Vet Approved
DonepezilThe metabolism of Donepezil can be decreased when combined with Sulfisoxazole.Approved
DopamineThe metabolism of Dopamine can be decreased when combined with Sulfisoxazole.Approved
DorzolamideThe metabolism of Dorzolamide can be decreased when combined with Sulfisoxazole.Approved
DoxepinThe metabolism of Doxepin can be decreased when combined with Sulfisoxazole.Approved
DoxorubicinThe serum concentration of Doxorubicin can be increased when it is combined with Sulfisoxazole.Approved, Investigational
DoxorubicinThe metabolism of Doxorubicin can be decreased when combined with Sulfisoxazole.Approved, Investigational
DronabinolThe serum concentration of Dronabinol can be increased when it is combined with Sulfisoxazole.Approved, Illicit
DronedaroneSulfisoxazole may increase the QTc-prolonging activities of Dronedarone.Approved
DroperidolSulfisoxazole may increase the QTc-prolonging activities of Droperidol.Approved, Vet Approved
DulaglutideDulaglutide may increase the hypoglycemic activities of Sulfisoxazole.Approved
DuloxetineDuloxetine may increase the hypoglycemic activities of Sulfisoxazole.Approved
DutasterideThe metabolism of Dutasteride can be decreased when combined with Sulfisoxazole.Approved, Investigational
EfavirenzThe metabolism of Efavirenz can be decreased when combined with Sulfisoxazole.Approved, Investigational
EletriptanThe serum concentration of Eletriptan can be increased when it is combined with Sulfisoxazole.Approved, Investigational
EliglustatThe serum concentration of Eliglustat can be increased when it is combined with Sulfisoxazole.Approved
ElvitegravirThe metabolism of Elvitegravir can be decreased when combined with Sulfisoxazole.Approved
EmpagliflozinEmpagliflozin may increase the hypoglycemic activities of Sulfisoxazole.Approved
EnalaprilThe metabolism of Enalapril can be decreased when combined with Sulfisoxazole.Approved, Vet Approved
EnoxacinEnoxacin may increase the hypoglycemic activities of Sulfisoxazole.Approved
EnzalutamideThe metabolism of Enzalutamide can be decreased when combined with Sulfisoxazole.Approved
EpinastineThe metabolism of Epinastine can be decreased when combined with Sulfisoxazole.Approved, Investigational
EplerenoneThe serum concentration of Eplerenone can be increased when it is combined with Sulfisoxazole.Approved
EpoprostenolThe metabolism of Epoprostenol can be decreased when combined with Sulfisoxazole.Approved
ErgocalciferolThe metabolism of Ergocalciferol can be decreased when combined with Sulfisoxazole.Approved, Nutraceutical
Ergoloid mesylateThe metabolism of Ergoloid mesylate can be decreased when combined with Sulfisoxazole.Approved
ErgonovineThe metabolism of Ergonovine can be decreased when combined with Sulfisoxazole.Approved
ErgotamineThe metabolism of Ergotamine can be decreased when combined with Sulfisoxazole.Approved
EribulinEribulin may increase the QTc-prolonging activities of Sulfisoxazole.Approved, Investigational
ErlotinibThe metabolism of Erlotinib can be decreased when combined with Sulfisoxazole.Approved, Investigational
ErythromycinErythromycin may increase the QTc-prolonging activities of Sulfisoxazole.Approved, Vet Approved
EscitalopramSulfisoxazole may increase the QTc-prolonging activities of Escitalopram.Approved, Investigational
EsomeprazoleThe metabolism of Esomeprazole can be decreased when combined with Sulfisoxazole.Approved, Investigational
EstazolamThe metabolism of Estazolam can be decreased when combined with Sulfisoxazole.Approved, Illicit
EstradiolThe metabolism of Estradiol can be decreased when combined with Sulfisoxazole.Approved, Investigational, Vet Approved
EstramustineThe metabolism of Estramustine can be decreased when combined with Sulfisoxazole.Approved
EstroneThe metabolism of Estrone can be decreased when combined with Sulfisoxazole.Approved
Estrone sulfateThe metabolism of Estrone sulfate can be decreased when combined with Sulfisoxazole.Approved
EszopicloneThe metabolism of Eszopiclone can be decreased when combined with Sulfisoxazole.Approved
EthanolThe metabolism of Ethanol can be decreased when combined with Sulfisoxazole.Approved
Ethinyl EstradiolThe metabolism of Ethinyl Estradiol can be decreased when combined with Sulfisoxazole.Approved
EthosuximideThe metabolism of Ethosuximide can be decreased when combined with Sulfisoxazole.Approved
Ethyl biscoumacetateSulfisoxazole may increase the anticoagulant activities of Ethyl biscoumacetate.Withdrawn
EthylmorphineThe metabolism of Ethylmorphine can be decreased when combined with Sulfisoxazole.Approved, Illicit
EtodolacThe metabolism of Etodolac can be decreased when combined with Sulfisoxazole.Approved, Investigational, Vet Approved
EtonogestrelThe metabolism of Etonogestrel can be decreased when combined with Sulfisoxazole.Approved, Investigational
EtoperidoneEtoperidone may increase the hypoglycemic activities of Sulfisoxazole.Approved
EtoposideThe metabolism of Etoposide can be decreased when combined with Sulfisoxazole.Approved
EtoricoxibThe metabolism of Etoricoxib can be decreased when combined with Sulfisoxazole.Approved, Investigational
EtravirineThe metabolism of Etravirine can be decreased when combined with Sulfisoxazole.Approved
EverolimusThe serum concentration of Everolimus can be increased when it is combined with Sulfisoxazole.Approved
ExemestaneThe metabolism of Exemestane can be decreased when combined with Sulfisoxazole.Approved, Investigational
ExenatideExenatide may increase the hypoglycemic activities of Sulfisoxazole.Approved, Investigational
EzogabineEzogabine may increase the QTc-prolonging activities of Sulfisoxazole.Approved
FamciclovirThe metabolism of Famciclovir can be decreased when combined with Sulfisoxazole.Approved
FamotidineFamotidine may increase the QTc-prolonging activities of Sulfisoxazole.Approved
FelbamateFelbamate may increase the QTc-prolonging activities of Sulfisoxazole.Approved
FelodipineThe metabolism of Felodipine can be decreased when combined with Sulfisoxazole.Approved, Investigational
FenofibrateThe metabolism of Fenofibrate can be decreased when combined with Sulfisoxazole.Approved
FentanylThe serum concentration of Fentanyl can be increased when it is combined with Sulfisoxazole.Approved, Illicit, Investigational, Vet Approved
FesoterodineThe metabolism of Fesoterodine can be decreased when combined with Sulfisoxazole.Approved
FinasterideThe metabolism of Finasteride can be decreased when combined with Sulfisoxazole.Approved
FingolimodFingolimod may increase the QTc-prolonging activities of Sulfisoxazole.Approved, Investigational
FlecainideSulfisoxazole may increase the QTc-prolonging activities of Flecainide.Approved, Withdrawn
FleroxacinFleroxacin may increase the hypoglycemic activities of Sulfisoxazole.Approved
FlibanserinThe serum concentration of Flibanserin can be increased when it is combined with Sulfisoxazole.Approved
FloxuridineThe metabolism of Sulfisoxazole can be decreased when combined with Floxuridine.Approved
FluconazoleThe metabolism of Sulfisoxazole can be decreased when combined with Fluconazole.Approved
FlumequineFlumequine may increase the hypoglycemic activities of Sulfisoxazole.Withdrawn
FlunarizineThe metabolism of Flunarizine can be decreased when combined with Sulfisoxazole.Approved
FlunisolideThe metabolism of Flunisolide can be decreased when combined with Sulfisoxazole.Approved, Investigational
FlunitrazepamThe metabolism of Flunitrazepam can be decreased when combined with Sulfisoxazole.Approved, Illicit
FluorometholoneThe metabolism of Fluorometholone can be decreased when combined with Sulfisoxazole.Approved
FluorouracilThe metabolism of Sulfisoxazole can be decreased when combined with Fluorouracil.Approved
FluoxetineSulfisoxazole may increase the QTc-prolonging activities of Fluoxetine.Approved, Vet Approved
FluoxymesteroneFluoxymesterone may increase the hypoglycemic activities of Sulfisoxazole.Approved, Illicit
FlupentixolSulfisoxazole may increase the QTc-prolonging activities of Flupentixol.Approved, Withdrawn
FlurazepamThe metabolism of Flurazepam can be decreased when combined with Sulfisoxazole.Approved, Illicit
FlurbiprofenThe metabolism of Flurbiprofen can be decreased when combined with Sulfisoxazole.Approved, Investigational
FlutamideThe metabolism of Flutamide can be decreased when combined with Sulfisoxazole.Approved
Fluticasone furoateThe metabolism of Fluticasone furoate can be decreased when combined with Sulfisoxazole.Approved
Fluticasone PropionateThe metabolism of Fluticasone Propionate can be decreased when combined with Sulfisoxazole.Approved
FluvastatinThe metabolism of Fluvastatin can be decreased when combined with Sulfisoxazole.Approved
FluvoxamineThe metabolism of Sulfisoxazole can be decreased when combined with Fluvoxamine.Approved, Investigational
FormoterolThe metabolism of Formoterol can be decreased when combined with Sulfisoxazole.Approved, Investigational
FosamprenavirThe metabolism of Fosamprenavir can be decreased when combined with Sulfisoxazole.Approved
FoscarnetFoscarnet may increase the QTc-prolonging activities of Sulfisoxazole.Approved
FosphenytoinThe metabolism of Sulfisoxazole can be increased when combined with Fosphenytoin.Approved
FulvestrantThe metabolism of Fulvestrant can be decreased when combined with Sulfisoxazole.Approved, Investigational
FurazolidoneFurazolidone may increase the hypoglycemic activities of Sulfisoxazole.Approved, Vet Approved
Gadobenic acidSulfisoxazole may increase the QTc-prolonging activities of Gadobenic acid.Approved
GalantamineGalantamine may increase the QTc-prolonging activities of Sulfisoxazole.Approved
GatifloxacinGatifloxacin may increase the hypoglycemic activities of Sulfisoxazole.Approved, Investigational
GavestinelThe metabolism of Gavestinel can be decreased when combined with Sulfisoxazole.Investigational
GefitinibThe metabolism of Gefitinib can be decreased when combined with Sulfisoxazole.Approved, Investigational
GemfibrozilThe metabolism of Sulfisoxazole can be decreased when combined with Gemfibrozil.Approved
GemifloxacinSulfisoxazole may increase the QTc-prolonging activities of Gemifloxacin.Approved, Investigational
GlibornurideGlibornuride may increase the hypoglycemic activities of Sulfisoxazole.Withdrawn
GliclazideThe metabolism of Gliclazide can be decreased when combined with Sulfisoxazole.Approved
GlimepirideThe metabolism of Glimepiride can be decreased when combined with Sulfisoxazole.Approved
GlipizideThe metabolism of Glipizide can be decreased when combined with Sulfisoxazole.Approved
GliquidoneGliquidone may increase the hypoglycemic activities of Sulfisoxazole.Approved
GlisoxepideSulfisoxazole may increase the hypoglycemic activities of Glisoxepide.Approved
GlyburideThe metabolism of Glyburide can be decreased when combined with Sulfisoxazole.Approved
GoserelinGoserelin may increase the QTc-prolonging activities of Sulfisoxazole.Approved
GranisetronSulfisoxazole may increase the QTc-prolonging activities of Granisetron.Approved, Investigational
GrepafloxacinThe metabolism of Grepafloxacin can be decreased when combined with Sulfisoxazole.Withdrawn
GuanfacineThe metabolism of Guanfacine can be decreased when combined with Sulfisoxazole.Approved, Investigational
HalofantrineThe serum concentration of Halofantrine can be increased when it is combined with Sulfisoxazole.Approved
HaloperidolSulfisoxazole may increase the QTc-prolonging activities of Haloperidol.Approved
HalothaneThe metabolism of Halothane can be decreased when combined with Sulfisoxazole.Approved, Vet Approved
HexamethylenetetramineThe risk or severity of adverse effects can be increased when Hexamethylenetetramine is combined with Sulfisoxazole.Approved, Vet Approved
HexobarbitalThe metabolism of Hexobarbital can be decreased when combined with Sulfisoxazole.Approved
HistamineThe metabolism of Histamine Phosphate can be decreased when combined with Sulfisoxazole.Approved, Investigational
HistrelinHistrelin may increase the QTc-prolonging activities of Sulfisoxazole.Approved
HydracarbazineHydracarbazine may increase the hypoglycemic activities of Sulfisoxazole.Approved
HydrocodoneThe serum concentration of Hydrocodone can be increased when it is combined with Sulfisoxazole.Approved, Illicit
HydrocortisoneThe metabolism of Hydrocortisone can be decreased when combined with Sulfisoxazole.Approved, Vet Approved
HydromorphoneThe metabolism of Hydromorphone can be decreased when combined with Sulfisoxazole.Approved, Illicit
Hydroxyprogesterone caproateThe metabolism of Hydroxyprogesterone caproate can be decreased when combined with Sulfisoxazole.Approved
HydroxyzineHydroxyzine may increase the QTc-prolonging activities of Sulfisoxazole.Approved
IbandronateIbandronate may increase the QTc-prolonging activities of Sulfisoxazole.Approved, Investigational
IbrutinibThe serum concentration of Ibrutinib can be increased when it is combined with Sulfisoxazole.Approved
IbuprofenThe metabolism of Ibuprofen can be decreased when combined with Sulfisoxazole.Approved
IbutilideSulfisoxazole may increase the QTc-prolonging activities of Ibutilide.Approved
IdarubicinThe metabolism of Idarubicin can be decreased when combined with Sulfisoxazole.Approved
IfosfamideThe serum concentration of the active metabolites of Ifosfamide can be reduced when Ifosfamide is used in combination with Sulfisoxazole resulting in a loss in efficacy.Approved
IloperidoneSulfisoxazole may increase the QTc-prolonging activities of Iloperidone.Approved
ImatinibThe serum concentration of Imatinib can be increased when it is combined with Sulfisoxazole.Approved
ImipramineImipramine may increase the QTc-prolonging activities of Sulfisoxazole.Approved
ImiquimodThe metabolism of Imiquimod can be decreased when combined with Sulfisoxazole.Approved, Investigational
IndacaterolIndacaterol may increase the QTc-prolonging activities of Sulfisoxazole.Approved
IndalpineIndalpine may increase the hypoglycemic activities of Sulfisoxazole.Investigational, Withdrawn
IndapamideIndapamide may increase the QTc-prolonging activities of Sulfisoxazole.Approved
IndinavirThe metabolism of Indinavir can be decreased when combined with Sulfisoxazole.Approved
IndomethacinThe metabolism of Indomethacin can be decreased when combined with Sulfisoxazole.Approved, Investigational
Insulin AspartSulfisoxazole may increase the hypoglycemic activities of Insulin Aspart.Approved
Insulin DetemirSulfisoxazole may increase the hypoglycemic activities of Insulin Detemir.Approved
Insulin GlargineInsulin Glargine may increase the hypoglycemic activities of Sulfisoxazole.Approved
Insulin GlulisineSulfisoxazole may increase the hypoglycemic activities of Insulin Glulisine.Approved
Insulin HumanInsulin Human may increase the hypoglycemic activities of Sulfisoxazole.Approved, Investigational
Insulin LisproInsulin Lispro may increase the hypoglycemic activities of Sulfisoxazole.Approved
Insulin PorkInsulin Pork may increase the hypoglycemic activities of Sulfisoxazole.Approved
Ipratropium bromideThe metabolism of Ipratropium bromide can be decreased when combined with Sulfisoxazole.Approved
IproclozideIproclozide may increase the hypoglycemic activities of Sulfisoxazole.Withdrawn
IproniazidIproniazid may increase the hypoglycemic activities of Sulfisoxazole.Withdrawn
IrbesartanThe metabolism of Irbesartan can be decreased when combined with Sulfisoxazole.Approved, Investigational
IrinotecanThe metabolism of Irinotecan can be decreased when combined with Sulfisoxazole.Approved, Investigational
IsavuconazoniumThe metabolism of Isavuconazonium can be decreased when combined with Sulfisoxazole.Approved, Investigational
IsocarboxazidIsocarboxazid may increase the hypoglycemic activities of Sulfisoxazole.Approved
IsofluraneIsoflurane may increase the QTc-prolonging activities of Sulfisoxazole.Approved, Vet Approved
Isosorbide DinitrateThe metabolism of Isosorbide Dinitrate can be decreased when combined with Sulfisoxazole.Approved
Isosorbide MononitrateThe metabolism of Isosorbide Mononitrate can be decreased when combined with Sulfisoxazole.Approved
IsradipineIsradipine may increase the QTc-prolonging activities of Sulfisoxazole.Approved
ItraconazoleItraconazole may increase the QTc-prolonging activities of Sulfisoxazole.Approved, Investigational
IvabradineThe serum concentration of Ivabradine can be increased when it is combined with Sulfisoxazole.Approved
IvacaftorThe serum concentration of Ivacaftor can be increased when it is combined with Sulfisoxazole.Approved
IvermectinThe metabolism of Ivermectin can be decreased when combined with Sulfisoxazole.Approved, Vet Approved
IxabepiloneThe metabolism of Ixabepilone can be decreased when combined with Sulfisoxazole.Approved, Investigational
IxazomibThe metabolism of Ixazomib can be decreased when combined with Sulfisoxazole.Approved
KetamineThe metabolism of Ketamine can be decreased when combined with Sulfisoxazole.Approved, Vet Approved
KetazolamThe metabolism of Ketazolam can be decreased when combined with Sulfisoxazole.Approved
KetobemidoneThe metabolism of Ketobemidone can be decreased when combined with Sulfisoxazole.Approved
KetoconazoleKetoconazole may increase the QTc-prolonging activities of Sulfisoxazole.Approved, Investigational
KetoprofenThe metabolism of Ketoprofen can be decreased when combined with Sulfisoxazole.Approved, Vet Approved
LacosamideThe serum concentration of Lacosamide can be increased when it is combined with Sulfisoxazole.Approved
LanreotideSulfisoxazole may increase the hypoglycemic activities of Lanreotide.Approved
LansoprazoleThe metabolism of Lansoprazole can be decreased when combined with Sulfisoxazole.Approved, Investigational
LapatinibLapatinib may increase the QTc-prolonging activities of Sulfisoxazole.Approved, Investigational
LaquinimodThe metabolism of Laquinimod can be decreased when combined with Sulfisoxazole.Investigational
LeflunomideThe metabolism of Leflunomide can be decreased when combined with Sulfisoxazole.Approved, Investigational
LenvatinibSulfisoxazole may increase the QTc-prolonging activities of Lenvatinib.Approved
LercanidipineThe metabolism of Lercanidipine can be decreased when combined with Sulfisoxazole.Approved, Investigational
LesinuradThe metabolism of Lesinurad can be decreased when combined with Sulfisoxazole.Approved
LetrozoleThe metabolism of Letrozole can be decreased when combined with Sulfisoxazole.Approved, Investigational
LeuprolideLeuprolide may increase the QTc-prolonging activities of Sulfisoxazole.Approved, Investigational
LevobupivacaineThe metabolism of Levobupivacaine can be decreased when combined with Sulfisoxazole.Approved
LevocetirizineThe metabolism of Levocetirizine can be decreased when combined with Sulfisoxazole.Approved
LevofloxacinSulfisoxazole may increase the QTc-prolonging activities of Levofloxacin.Approved, Investigational
Levomethadyl AcetateThe metabolism of Levomethadyl Acetate can be decreased when combined with Sulfisoxazole.Approved
LevomilnacipranThe metabolism of Levomilnacipran can be decreased when combined with Sulfisoxazole.Approved
LevonorgestrelThe metabolism of Levonorgestrel can be decreased when combined with Sulfisoxazole.Approved, Investigational
LevothyroxineThe metabolism of Levothyroxine can be decreased when combined with Sulfisoxazole.Approved
LicofeloneThe metabolism of Licofelone can be decreased when combined with Sulfisoxazole.Investigational
LidocaineThe metabolism of Lidocaine can be decreased when combined with Sulfisoxazole.Approved, Vet Approved
LinagliptinLinagliptin may increase the hypoglycemic activities of Sulfisoxazole.Approved
LiraglutideLiraglutide may increase the hypoglycemic activities of Sulfisoxazole.Approved
LisurideThe metabolism of Lisuride can be decreased when combined with Sulfisoxazole.Approved
LithiumLithium may increase the QTc-prolonging activities of Sulfisoxazole.Approved
LomefloxacinLomefloxacin may increase the hypoglycemic activities of Sulfisoxazole.Approved
LomitapideThe serum concentration of Lomitapide can be increased when it is combined with Sulfisoxazole.Approved
LoperamideThe metabolism of Loperamide can be decreased when combined with Sulfisoxazole.Approved
LopinavirSulfisoxazole may increase the QTc-prolonging activities of Lopinavir.Approved
LoratadineThe metabolism of Loratadine can be decreased when combined with Sulfisoxazole.Approved
LorcaserinThe metabolism of Lorcaserin can be decreased when combined with Sulfisoxazole.Approved
LornoxicamThe metabolism of Lornoxicam can be decreased when combined with Sulfisoxazole.Approved
LosartanThe metabolism of Losartan can be decreased when combined with Sulfisoxazole.Approved
LovastatinThe metabolism of Lovastatin can be decreased when combined with Sulfisoxazole.Approved, Investigational
LumacaftorThe serum concentration of Sulfisoxazole can be decreased when it is combined with Lumacaftor.Approved
LumefantrineSulfisoxazole may increase the QTc-prolonging activities of Lumefantrine.Approved
LumiracoxibThe metabolism of Lumiracoxib can be decreased when combined with Sulfisoxazole.Approved, Investigational
LurasidoneThe serum concentration of Lurasidone can be increased when it is combined with Sulfisoxazole.Approved
MacitentanThe metabolism of Macitentan can be decreased when combined with Sulfisoxazole.Approved
MaprotilineMaprotiline may increase the QTc-prolonging activities of Sulfisoxazole.Approved
MaravirocThe metabolism of Maraviroc can be decreased when combined with Sulfisoxazole.Approved, Investigational
MebanazineMebanazine may increase the hypoglycemic activities of Sulfisoxazole.Withdrawn
MebendazoleThe metabolism of Mebendazole can be decreased when combined with Sulfisoxazole.Approved, Vet Approved
MecamylamineThe risk or severity of adverse effects can be increased when Sulfisoxazole is combined with Mecamylamine.Approved
MecaserminSulfisoxazole may increase the hypoglycemic activities of Mecasermin.Approved, Investigational
Medroxyprogesterone acetateThe metabolism of Medroxyprogesterone acetate can be decreased when combined with Sulfisoxazole.Approved, Investigational
Mefenamic acidThe metabolism of Mefenamic acid can be decreased when combined with Sulfisoxazole.Approved
MefloquineMefloquine may increase the QTc-prolonging activities of Sulfisoxazole.Approved
MelatoninThe metabolism of Melatonin can be decreased when combined with Sulfisoxazole.Approved, Nutraceutical, Vet Approved
MeloxicamThe metabolism of Meloxicam can be decreased when combined with Sulfisoxazole.Approved, Vet Approved
MephenytoinThe metabolism of Mephenytoin can be decreased when combined with Sulfisoxazole.Investigational, Withdrawn
MesalazineMesalazine may increase the hypoglycemic activities of Sulfisoxazole.Approved
MestranolThe metabolism of Mestranol can be decreased when combined with Sulfisoxazole.Approved
MetforminMetformin may increase the hypoglycemic activities of Sulfisoxazole.Approved
MethadoneSulfisoxazole may increase the QTc-prolonging activities of Methadone.Approved
MethaqualoneThe metabolism of Methaqualone can be decreased when combined with Sulfisoxazole.Illicit, Withdrawn
MethotrexateThe risk or severity of adverse effects can be increased when Sulfisoxazole is combined with Methotrexate.Approved
MethotrimeprazineMethotrimeprazine may increase the QTc-prolonging activities of Sulfisoxazole.Approved
MethoxsalenThe metabolism of Methoxsalen can be decreased when combined with Sulfisoxazole.Approved
MethoxyfluraneThe metabolism of Methoxyflurane can be decreased when combined with Sulfisoxazole.Approved, Vet Approved
Methylene blueMethylene blue may increase the hypoglycemic activities of Sulfisoxazole.Investigational
MethylprednisoloneThe metabolism of Methylprednisolone can be decreased when combined with Sulfisoxazole.Approved, Vet Approved
MethyltestosteroneThe metabolism of Methyltestosterone can be decreased when combined with Sulfisoxazole.Approved
MetoclopramideMetoclopramide may increase the QTc-prolonging activities of Sulfisoxazole.Approved, Investigational
MetronidazoleThe metabolism of Metronidazole can be decreased when combined with Sulfisoxazole.Approved
MexiletineThe metabolism of Mexiletine can be decreased when combined with Sulfisoxazole.Approved
MianserinThe metabolism of Mianserin can be decreased when combined with Sulfisoxazole.Approved
MibefradilThe metabolism of Mibefradil can be decreased when combined with Sulfisoxazole.Withdrawn
MiconazoleThe metabolism of Miconazole can be decreased when combined with Sulfisoxazole.Approved, Investigational, Vet Approved
MidazolamThe metabolism of Midazolam can be decreased when combined with Sulfisoxazole.Approved, Illicit
MifepristoneMifepristone may increase the QTc-prolonging activities of Sulfisoxazole.Approved, Investigational
MiglitolMiglitol may increase the hypoglycemic activities of Sulfisoxazole.Approved
MiglustatMiglustat may increase the hypoglycemic activities of Sulfisoxazole.Approved
MilnacipranMilnacipran may increase the hypoglycemic activities of Sulfisoxazole.Approved
MinaprineMinaprine may increase the hypoglycemic activities of Sulfisoxazole.Approved
MirabegronMirabegron may increase the QTc-prolonging activities of Sulfisoxazole.Approved
MirtazapineThe metabolism of Mirtazapine can be decreased when combined with Sulfisoxazole.Approved
MitiglinideMitiglinide may increase the hypoglycemic activities of Sulfisoxazole.Approved, Investigational
MoclobemideThe metabolism of Moclobemide can be decreased when combined with Sulfisoxazole.Approved
ModafinilThe metabolism of Modafinil can be decreased when combined with Sulfisoxazole.Approved, Investigational
MoexiprilMoexipril may increase the QTc-prolonging activities of Sulfisoxazole.Approved
MontelukastThe metabolism of Montelukast can be decreased when combined with Sulfisoxazole.Approved
MorphineThe metabolism of Morphine can be decreased when combined with Sulfisoxazole.Approved, Investigational
MoxifloxacinMoxifloxacin may increase the QTc-prolonging activities of Sulfisoxazole.Approved, Investigational
Mycophenolate mofetilThe metabolism of Mycophenolate mofetil can be decreased when combined with Sulfisoxazole.Approved, Investigational
Nalidixic AcidNalidixic Acid may increase the hypoglycemic activities of Sulfisoxazole.Approved
NaloxegolThe serum concentration of Naloxegol can be increased when it is combined with Sulfisoxazole.Approved
NaloxoneThe metabolism of Naloxone can be decreased when combined with Sulfisoxazole.Approved, Vet Approved
NaproxenThe metabolism of Naproxen can be decreased when combined with Sulfisoxazole.Approved, Vet Approved
NateglinideThe metabolism of Nateglinide can be decreased when combined with Sulfisoxazole.Approved, Investigational
NCX 4016NCX 4016 may increase the hypoglycemic activities of Sulfisoxazole.Investigational
NefazodoneThe metabolism of Nefazodone can be decreased when combined with Sulfisoxazole.Approved, Withdrawn
NelfinavirNelfinavir may increase the QTc-prolonging activities of Sulfisoxazole.Approved
NetupitantThe metabolism of Netupitant can be decreased when combined with Sulfisoxazole.Approved
NevirapineThe metabolism of Nevirapine can be decreased when combined with Sulfisoxazole.Approved
NialamideNialamide may increase the hypoglycemic activities of Sulfisoxazole.Withdrawn
NicardipineThe metabolism of Sulfisoxazole can be decreased when combined with Nicardipine.Approved
NiclosamideThe metabolism of Niclosamide can be decreased when combined with Sulfisoxazole.Approved, Vet Approved
NicotineThe metabolism of Nicotine can be decreased when combined with Sulfisoxazole.Approved
NifedipineThe metabolism of Nifedipine can be decreased when combined with Sulfisoxazole.Approved
NilotinibSulfisoxazole may increase the QTc-prolonging activities of Nilotinib.Approved, Investigational
NilvadipineThe metabolism of Nilvadipine can be decreased when combined with Sulfisoxazole.Approved
NimodipineThe serum concentration of Nimodipine can be increased when it is combined with Sulfisoxazole.Approved
NisoldipineThe metabolism of Nisoldipine can be decreased when combined with Sulfisoxazole.Approved
NitrazepamThe metabolism of Nitrazepam can be decreased when combined with Sulfisoxazole.Approved
NitrendipineThe metabolism of Nitrendipine can be decreased when combined with Sulfisoxazole.Approved
NorethisteroneThe metabolism of Norethisterone can be decreased when combined with Sulfisoxazole.Approved
NorfloxacinNorfloxacin may increase the QTc-prolonging activities of Sulfisoxazole.Approved
NorgestrelThe metabolism of Norgestrel can be decreased when combined with Sulfisoxazole.Approved
NortriptylineThe metabolism of Nortriptyline can be decreased when combined with Sulfisoxazole.Approved
OctamoxinOctamoxin may increase the hypoglycemic activities of Sulfisoxazole.Withdrawn
OctreotideOctreotide may increase the QTc-prolonging activities of Sulfisoxazole.Approved, Investigational
OfloxacinSulfisoxazole may increase the QTc-prolonging activities of Ofloxacin.Approved
OlanzapineOlanzapine may increase the QTc-prolonging activities of Sulfisoxazole.Approved, Investigational
OlaparibThe serum concentration of Olaparib can be increased when it is combined with Sulfisoxazole.Approved
OlodaterolThe metabolism of Olodaterol can be decreased when combined with Sulfisoxazole.Approved
OlopatadineThe metabolism of Olopatadine can be decreased when combined with Sulfisoxazole.Approved
OlsalazineOlsalazine may increase the hypoglycemic activities of Sulfisoxazole.Approved
OmeprazoleThe metabolism of Omeprazole can be decreased when combined with Sulfisoxazole.Approved, Investigational, Vet Approved
OndansetronSulfisoxazole may increase the QTc-prolonging activities of Ondansetron.Approved
OrphenadrineThe metabolism of Orphenadrine can be decreased when combined with Sulfisoxazole.Approved
OspemifeneThe serum concentration of Ospemifene can be increased when it is combined with Sulfisoxazole.Approved
OxandroloneOxandrolone may increase the hypoglycemic activities of Sulfisoxazole.Approved, Investigational
OxaprozinThe metabolism of Oxaprozin can be decreased when combined with Sulfisoxazole.Approved
OxazepamThe metabolism of Oxazepam can be decreased when combined with Sulfisoxazole.Approved
OxybutyninThe metabolism of Oxybutynin can be decreased when combined with Sulfisoxazole.Approved, Investigational
OxycodoneThe risk or severity of adverse effects can be increased when Sulfisoxazole is combined with Oxycodone.Approved, Illicit, Investigational
OxymetholoneOxymetholone may increase the hypoglycemic activities of Sulfisoxazole.Approved, Illicit
OxymorphoneThe metabolism of Oxymorphone can be decreased when combined with Sulfisoxazole.Approved, Investigational, Vet Approved
OxytocinOxytocin may increase the QTc-prolonging activities of Sulfisoxazole.Approved, Vet Approved
PaclitaxelThe metabolism of Paclitaxel can be decreased when combined with Sulfisoxazole.Approved, Vet Approved
PalbociclibThe metabolism of Palbociclib can be decreased when combined with Sulfisoxazole.Approved
PaliperidoneSulfisoxazole may increase the QTc-prolonging activities of Paliperidone.Approved
PalonosetronThe metabolism of Palonosetron can be decreased when combined with Sulfisoxazole.Approved, Investigational
PanobinostatSulfisoxazole may increase the QTc-prolonging activities of Panobinostat.Approved, Investigational
PantoprazoleThe metabolism of Pantoprazole can be decreased when combined with Sulfisoxazole.Approved
ParamethadioneThe metabolism of Paramethadione can be decreased when combined with Sulfisoxazole.Approved
ParamethasoneThe metabolism of Paramethasone can be decreased when combined with Sulfisoxazole.Approved
ParecoxibThe serum concentration of Parecoxib can be increased when it is combined with Sulfisoxazole.Approved
PargylinePargyline may increase the hypoglycemic activities of Sulfisoxazole.Approved
ParicalcitolThe metabolism of Paricalcitol can be decreased when combined with Sulfisoxazole.Approved, Investigational
ParitaprevirThe metabolism of Paritaprevir can be decreased when combined with Sulfisoxazole.Approved
ParoxetineParoxetine may increase the QTc-prolonging activities of Sulfisoxazole.Approved, Investigational
PasireotidePasireotide may increase the QTc-prolonging activities of Sulfisoxazole.Approved
PazopanibSulfisoxazole may increase the QTc-prolonging activities of Pazopanib.Approved
PefloxacinPefloxacin may increase the hypoglycemic activities of Sulfisoxazole.Approved
PegvisomantPegvisomant may increase the hypoglycemic activities of Sulfisoxazole.Approved
PentamidineSulfisoxazole may increase the QTc-prolonging activities of Pentamidine.Approved
PerampanelThe metabolism of Perampanel can be decreased when combined with Sulfisoxazole.Approved
PerflutrenSulfisoxazole may increase the QTc-prolonging activities of Perflutren.Approved
PergolideThe metabolism of Pergolide can be decreased when combined with Sulfisoxazole.Approved, Vet Approved, Withdrawn
PerhexilineThe metabolism of Perhexiline can be decreased when combined with Sulfisoxazole.Approved
PermethrinThe metabolism of Permethrin can be decreased when combined with Sulfisoxazole.Approved, Investigational
PerphenazineThe metabolism of Perphenazine can be decreased when combined with Sulfisoxazole.Approved
PethidineThe metabolism of Pethidine can be decreased when combined with Sulfisoxazole.Approved
PhenacetinThe metabolism of Phenacetin can be decreased when combined with Sulfisoxazole.Withdrawn
PhenelzinePhenelzine may increase the hypoglycemic activities of Sulfisoxazole.Approved
PhenforminPhenformin may increase the hypoglycemic activities of Sulfisoxazole.Approved, Withdrawn
PhenindioneSulfisoxazole may increase the anticoagulant activities of Phenindione.Approved
PheniprazinePheniprazine may increase the hypoglycemic activities of Sulfisoxazole.Withdrawn
PhenobarbitalThe metabolism of Sulfisoxazole can be increased when combined with Phenobarbital.Approved
PhenoxybenzamineThe metabolism of Phenoxybenzamine can be decreased when combined with Sulfisoxazole.Approved
PhenoxypropazinePhenoxypropazine may increase the hypoglycemic activities of Sulfisoxazole.Withdrawn
PhenprocoumonThe metabolism of Phenprocoumon can be decreased when combined with Sulfisoxazole.Approved
PhenylbutazoneThe metabolism of Phenylbutazone can be decreased when combined with Sulfisoxazole.Approved, Vet Approved
PhenytoinThe metabolism of Sulfisoxazole can be increased when combined with Phenytoin.Approved, Vet Approved
PilocarpineThe metabolism of Pilocarpine can be decreased when combined with Sulfisoxazole.Approved
PimecrolimusThe metabolism of Pimecrolimus can be decreased when combined with Sulfisoxazole.Approved, Investigational
PimozideThe serum concentration of Pimozide can be increased when it is combined with Sulfisoxazole.Approved
PioglitazoneThe metabolism of Pioglitazone can be decreased when combined with Sulfisoxazole.Approved, Investigational
PipotiazineThe metabolism of Pipotiazine can be decreased when combined with Sulfisoxazole.Approved
PirlindolePirlindole may increase the hypoglycemic activities of Sulfisoxazole.Approved
PiroxicamThe metabolism of Piroxicam can be decreased when combined with Sulfisoxazole.Approved, Investigational
PitavastatinThe metabolism of Pitavastatin can be decreased when combined with Sulfisoxazole.Approved
PivhydrazinePivhydrazine may increase the hypoglycemic activities of Sulfisoxazole.Withdrawn
PodofiloxThe metabolism of Podofilox can be decreased when combined with Sulfisoxazole.Approved
PomalidomideThe metabolism of Pomalidomide can be decreased when combined with Sulfisoxazole.Approved
PonatinibThe metabolism of Ponatinib can be decreased when combined with Sulfisoxazole.Approved
PosaconazolePosaconazole may increase the QTc-prolonging activities of Sulfisoxazole.Approved, Investigational, Vet Approved
PramlintidePramlintide may increase the hypoglycemic activities of Sulfisoxazole.Approved, Investigational
PrasteroneThe metabolism of Prasterone can be decreased when combined with Sulfisoxazole.Approved, Nutraceutical
PrasugrelThe metabolism of Prasugrel can be decreased when combined with Sulfisoxazole.Approved
PravastatinThe metabolism of Pravastatin can be decreased when combined with Sulfisoxazole.Approved
PrazepamThe metabolism of Prazepam can be decreased when combined with Sulfisoxazole.Approved, Illicit
PraziquantelThe metabolism of Praziquantel can be decreased when combined with Sulfisoxazole.Approved, Vet Approved
PrednisoloneThe metabolism of Prednisolone can be decreased when combined with Sulfisoxazole.Approved, Vet Approved
PrednisoneThe metabolism of Prednisone can be decreased when combined with Sulfisoxazole.Approved, Vet Approved
PrimaquineSulfisoxazole may increase the QTc-prolonging activities of Primaquine.Approved
PrimidoneThe metabolism of Sulfisoxazole can be increased when combined with Primidone.Approved, Vet Approved
ProcainamideSulfisoxazole may increase the QTc-prolonging activities of Procainamide.Approved
ProcaineThe therapeutic efficacy of Sulfisoxazole can be decreased when used in combination with Procaine.Approved, Investigational, Vet Approved
ProchlorperazineThe metabolism of Prochlorperazine can be decreased when combined with Sulfisoxazole.Approved, Vet Approved
ProgesteroneThe metabolism of Progesterone can be decreased when combined with Sulfisoxazole.Approved, Vet Approved
ProguanilThe metabolism of Proguanil can be decreased when combined with Sulfisoxazole.Approved
PromazineSulfisoxazole may increase the QTc-prolonging activities of Promazine.Approved, Vet Approved
PromethazinePromethazine may increase the QTc-prolonging activities of Sulfisoxazole.Approved
PropafenoneThe serum concentration of Propafenone can be increased when it is combined with Sulfisoxazole.Approved
PropofolThe metabolism of Propofol can be decreased when combined with Sulfisoxazole.Approved, Investigational, Vet Approved
PropranololThe metabolism of Propranolol can be decreased when combined with Sulfisoxazole.Approved, Investigational
ProtriptylineProtriptyline may increase the QTc-prolonging activities of Sulfisoxazole.Approved
PyrazinamideThe metabolism of Pyrazinamide can be decreased when combined with Sulfisoxazole.Approved
PyrimethamineThe metabolism of Sulfisoxazole can be decreased when combined with Pyrimethamine.Approved, Vet Approved
QuazepamThe metabolism of Quazepam can be decreased when combined with Sulfisoxazole.Approved, Illicit
QuetiapineSulfisoxazole may increase the QTc-prolonging activities of Quetiapine.Approved
QuinacrineThe metabolism of Quinacrine can be decreased when combined with Sulfisoxazole.Approved
QuinidineSulfisoxazole may increase the QTc-prolonging activities of Quinidine.Approved
QuinineSulfisoxazole may increase the QTc-prolonging activities of Quinine.Approved
RabeprazoleThe metabolism of Rabeprazole can be decreased when combined with Sulfisoxazole.Approved, Investigational
RaloxifeneThe metabolism of Raloxifene can be decreased when combined with Sulfisoxazole.Approved, Investigational
RamelteonThe serum concentration of Ramelteon can be increased when it is combined with Sulfisoxazole.Approved, Investigational
RanolazineThe serum concentration of Ranolazine can be increased when it is combined with Sulfisoxazole.Approved, Investigational
RasagilineRasagiline may increase the hypoglycemic activities of Sulfisoxazole.Approved
ReboxetineThe metabolism of Reboxetine can be decreased when combined with Sulfisoxazole.Approved, Investigational
RegorafenibThe metabolism of Regorafenib can be decreased when combined with Sulfisoxazole.Approved
RepaglinideSulfisoxazole may increase the hypoglycemic activities of Repaglinide.Approved, Investigational
RetapamulinThe metabolism of Retapamulin can be decreased when combined with Sulfisoxazole.Approved
RifabutinThe metabolism of Rifabutin can be decreased when combined with Sulfisoxazole.Approved
RifampicinThe metabolism of Sulfisoxazole can be increased when combined with Rifampicin.Approved
RifapentineThe metabolism of Sulfisoxazole can be increased when combined with Rifapentine.Approved
RilpivirineRilpivirine may increase the QTc-prolonging activities of Sulfisoxazole.Approved
RimonabantThe metabolism of Rimonabant can be decreased when combined with Sulfisoxazole.Approved, Investigational
RiociguatThe metabolism of Riociguat can be decreased when combined with Sulfisoxazole.Approved
RisperidoneRisperidone may increase the QTc-prolonging activities of Sulfisoxazole.Approved, Investigational
RitonavirRitonavir may increase the QTc-prolonging activities of Sulfisoxazole.Approved, Investigational
RivaroxabanThe metabolism of Rivaroxaban can be decreased when combined with Sulfisoxazole.Approved
RofecoxibThe metabolism of Rofecoxib can be decreased when combined with Sulfisoxazole.Investigational, Withdrawn
RolapitantThe metabolism of Rolapitant can be decreased when combined with Sulfisoxazole.Approved
RomidepsinThe metabolism of Romidepsin can be decreased when combined with Sulfisoxazole.Approved, Investigational
RopiniroleThe metabolism of Ropinirole can be decreased when combined with Sulfisoxazole.Approved, Investigational
RopivacaineThe metabolism of Ropivacaine can be decreased when combined with Sulfisoxazole.Approved
RosiglitazoneThe metabolism of Rosiglitazone can be decreased when combined with Sulfisoxazole.Approved, Investigational
RosoxacinRosoxacin may increase the hypoglycemic activities of Sulfisoxazole.Approved
RosuvastatinThe metabolism of Rosuvastatin can be decreased when combined with Sulfisoxazole.Approved
RotigotineThe metabolism of Rotigotine can be decreased when combined with Sulfisoxazole.Approved
RoxithromycinThe metabolism of Roxithromycin can be decreased when combined with Sulfisoxazole.Approved, Withdrawn
RuxolitinibThe metabolism of Ruxolitinib can be decreased when combined with Sulfisoxazole.Approved
SafrazineSafrazine may increase the hypoglycemic activities of Sulfisoxazole.Withdrawn
SalbutamolSalbutamol may increase the QTc-prolonging activities of Sulfisoxazole.Approved, Vet Approved
Salicylic acidThe metabolism of Salicylic acid can be decreased when combined with Sulfisoxazole.Approved, Vet Approved
SalmeterolThe serum concentration of Salmeterol can be increased when it is combined with Sulfisoxazole.Approved
SaquinavirSulfisoxazole may increase the QTc-prolonging activities of Saquinavir.Approved, Investigational
SaxagliptinThe serum concentration of Saxagliptin can be increased when it is combined with Sulfisoxazole.Approved
SecobarbitalThe metabolism of Sulfisoxazole can be increased when combined with Secobarbital.Approved, Vet Approved
SelegilineThe metabolism of Selegiline can be decreased when combined with Sulfisoxazole.Approved, Investigational, Vet Approved
SelexipagThe metabolism of Selexipag can be decreased when combined with Sulfisoxazole.Approved
SertindoleThe metabolism of Sertindole can be decreased when combined with Sulfisoxazole.Approved, Withdrawn
SertralineThe metabolism of Sertraline can be decreased when combined with Sulfisoxazole.Approved
SevofluraneSevoflurane may increase the QTc-prolonging activities of Sulfisoxazole.Approved, Vet Approved
SibutramineThe metabolism of Sibutramine can be decreased when combined with Sulfisoxazole.Approved, Illicit, Investigational, Withdrawn
SildenafilThe metabolism of Sildenafil can be decreased when combined with Sulfisoxazole.Approved, Investigational
SilodosinThe metabolism of Silodosin can be decreased when combined with Sulfisoxazole.Approved
SimeprevirThe serum concentration of Simeprevir can be increased when it is combined with Sulfisoxazole.Approved
SimvastatinThe metabolism of Simvastatin can be decreased when combined with Sulfisoxazole.Approved
SirolimusThe metabolism of Sirolimus can be decreased when combined with Sulfisoxazole.Approved, Investigational
SitagliptinThe metabolism of Sitagliptin can be decreased when combined with Sulfisoxazole.Approved, Investigational
SitaxentanThe metabolism of Sitaxentan can be decreased when combined with Sulfisoxazole.Approved, Investigational, Withdrawn
SolifenacinSolifenacin may increase the QTc-prolonging activities of Sulfisoxazole.Approved
SonidegibThe serum concentration of Sonidegib can be increased when it is combined with Sulfisoxazole.Approved, Investigational
SorafenibSorafenib may increase the QTc-prolonging activities of Sulfisoxazole.Approved, Investigational
SotalolSulfisoxazole may increase the QTc-prolonging activities of Sotalol.Approved
SparfloxacinSparfloxacin may increase the hypoglycemic activities of Sulfisoxazole.Approved
SpiramycinThe metabolism of Spiramycin can be decreased when combined with Sulfisoxazole.Approved
StanozololStanozolol may increase the hypoglycemic activities of Sulfisoxazole.Approved, Vet Approved
SufentanilThe metabolism of Sufentanil can be decreased when combined with Sulfisoxazole.Approved, Investigational
SulfadiazineThe metabolism of Sulfadiazine can be decreased when combined with Sulfisoxazole.Approved, Vet Approved
SulfamethoxazoleThe metabolism of Sulfamethoxazole can be decreased when combined with Sulfisoxazole.Approved
SulfamoxoleThe metabolism of Sulfamoxole can be decreased when combined with Sulfisoxazole.Approved
SulfinpyrazoneThe metabolism of Sulfinpyrazone can be decreased when combined with Sulfisoxazole.Approved
SulodexideSulodexide may increase the hypoglycemic activities of Sulfisoxazole.Approved, Investigational
SunitinibSunitinib may increase the QTc-prolonging activities of Sulfisoxazole.Approved, Investigational
SuprofenThe metabolism of Suprofen can be decreased when combined with Sulfisoxazole.Approved, Withdrawn
SuvorexantThe serum concentration of Suvorexant can be increased when it is combined with Sulfisoxazole.Approved
Synthetic Conjugated Estrogens, AThe metabolism of Synthetic Conjugated Estrogens, A can be decreased when combined with Sulfisoxazole.Approved
Synthetic Conjugated Estrogens, BThe metabolism of Synthetic Conjugated Estrogens, B can be decreased when combined with Sulfisoxazole.Approved
TacrolimusThe metabolism of Tacrolimus can be decreased when combined with Sulfisoxazole.Approved, Investigational
TadalafilThe metabolism of Tadalafil can be decreased when combined with Sulfisoxazole.Approved, Investigational
TamoxifenThe metabolism of Tamoxifen can be decreased when combined with Sulfisoxazole.Approved
TamsulosinThe metabolism of Tamsulosin can be decreased when combined with Sulfisoxazole.Approved, Investigational
TapentadolThe metabolism of Tapentadol can be decreased when combined with Sulfisoxazole.Approved
TasosartanThe metabolism of Tasosartan can be decreased when combined with Sulfisoxazole.Approved
TelaprevirThe metabolism of Telaprevir can be decreased when combined with Sulfisoxazole.Approved
TelavancinSulfisoxazole may increase the QTc-prolonging activities of Telavancin.Approved
TelithromycinSulfisoxazole may increase the QTc-prolonging activities of Telithromycin.Approved
TemafloxacinTemafloxacin may increase the hypoglycemic activities of Sulfisoxazole.Withdrawn
TemazepamThe metabolism of Temazepam can be decreased when combined with Sulfisoxazole.Approved
TemsirolimusThe metabolism of Temsirolimus can be decreased when combined with Sulfisoxazole.Approved
TeniposideThe metabolism of Teniposide can be decreased when combined with Sulfisoxazole.Approved
TenoxicamThe metabolism of Tenoxicam can be decreased when combined with Sulfisoxazole.Approved
TerbinafineThe metabolism of Terbinafine can be decreased when combined with Sulfisoxazole.Approved, Investigational, Vet Approved
TerbutalineTerbutaline may increase the QTc-prolonging activities of Sulfisoxazole.Approved
TerfenadineThe metabolism of Terfenadine can be decreased when combined with Sulfisoxazole.Withdrawn
TesmilifeneThe metabolism of Tesmilifene can be decreased when combined with Sulfisoxazole.Investigational
TestosteroneThe metabolism of Testosterone can be decreased when combined with Sulfisoxazole.Approved, Investigational
TetrabenazineSulfisoxazole may increase the QTc-prolonging activities of Tetrabenazine.Approved
TetracyclineThe metabolism of Tetracycline can be decreased when combined with Sulfisoxazole.Approved, Vet Approved
ThalidomideThe metabolism of Thalidomide can be decreased when combined with Sulfisoxazole.Approved, Investigational, Withdrawn
TheophyllineThe metabolism of Theophylline can be decreased when combined with Sulfisoxazole.Approved
ThiamylalThe metabolism of Thiamylal can be decreased when combined with Sulfisoxazole.Approved, Vet Approved
ThiopentalThe therapeutic efficacy of Thiopental can be increased when used in combination with Sulfisoxazole.Approved, Vet Approved
ThioridazineSulfisoxazole may increase the QTc-prolonging activities of Thioridazine.Withdrawn
ThiotepaThe metabolism of Thiotepa can be decreased when combined with Sulfisoxazole.Approved
ThiothixeneThiothixene may increase the QTc-prolonging activities of Sulfisoxazole.Approved
TiagabineThe metabolism of Tiagabine can be decreased when combined with Sulfisoxazole.Approved
TicagrelorThe metabolism of Ticagrelor can be decreased when combined with Sulfisoxazole.Approved
TiclopidineThe metabolism of Ticlopidine can be decreased when combined with Sulfisoxazole.Approved
TinidazoleThe metabolism of Tinidazole can be decreased when combined with Sulfisoxazole.Approved, Investigational
TiotropiumThe metabolism of Tiotropium can be decreased when combined with Sulfisoxazole.Approved
TipranavirThe metabolism of Tipranavir can be decreased when combined with Sulfisoxazole.Approved, Investigational
TizanidineTizanidine may increase the QTc-prolonging activities of Sulfisoxazole.Approved
TofacitinibThe metabolism of Tofacitinib can be decreased when combined with Sulfisoxazole.Approved, Investigational
TolazamideSulfisoxazole may increase the hypoglycemic activities of Tolazamide.Approved
TolbutamideThe metabolism of Tolbutamide can be decreased when combined with Sulfisoxazole.Approved
ToloxatoneToloxatone may increase the hypoglycemic activities of Sulfisoxazole.Approved
TolterodineThe metabolism of Tolterodine can be decreased when combined with Sulfisoxazole.Approved, Investigational
TolvaptanThe serum concentration of Tolvaptan can be increased when it is combined with Sulfisoxazole.Approved
TorasemideThe metabolism of Torasemide can be decreased when combined with Sulfisoxazole.Approved
ToremifeneSulfisoxazole may increase the QTc-prolonging activities of Toremifene.Approved, Investigational
TrabectedinThe serum concentration of Trabectedin can be increased when it is combined with Sulfisoxazole.Approved, Investigational
TramadolThe metabolism of Tramadol can be decreased when combined with Sulfisoxazole.Approved, Investigational
Trans-2-PhenylcyclopropylamineTrans-2-Phenylcyclopropylamine may increase the hypoglycemic activities of Sulfisoxazole.Experimental
TranylcypromineTranylcypromine may increase the hypoglycemic activities of Sulfisoxazole.Approved
Trastuzumab emtansineThe metabolism of Trastuzumab emtansine can be decreased when combined with Sulfisoxazole.Approved
TrazodoneTrazodone may increase the QTc-prolonging activities of Sulfisoxazole.Approved, Investigational
TreprostinilThe metabolism of Treprostinil can be decreased when combined with Sulfisoxazole.Approved, Investigational
TretinoinThe metabolism of Tretinoin can be decreased when combined with Sulfisoxazole.Approved, Investigational, Nutraceutical
TriamcinoloneThe metabolism of Triamcinolone can be decreased when combined with Sulfisoxazole.Approved, Vet Approved
TriazolamThe metabolism of Triazolam can be decreased when combined with Sulfisoxazole.Approved
TrimethadioneThe metabolism of Trimethadione can be decreased when combined with Sulfisoxazole.Approved
TrimethoprimThe metabolism of Trimethoprim can be decreased when combined with Sulfisoxazole.Approved, Vet Approved
TrimipramineThe metabolism of Trimipramine can be decreased when combined with Sulfisoxazole.Approved
TriptorelinTriptorelin may increase the QTc-prolonging activities of Sulfisoxazole.Approved, Vet Approved
TroglitazoneThe metabolism of Troglitazone can be decreased when combined with Sulfisoxazole.Withdrawn
TroleandomycinThe metabolism of Troleandomycin can be decreased when combined with Sulfisoxazole.Approved
TrovafloxacinTrovafloxacin may increase the hypoglycemic activities of Sulfisoxazole.Approved, Withdrawn
UdenafilThe metabolism of Udenafil can be decreased when combined with Sulfisoxazole.Approved, Investigational
UlipristalThe serum concentration of Ulipristal can be increased when it is combined with Sulfisoxazole.Approved
ValdecoxibThe metabolism of Valdecoxib can be decreased when combined with Sulfisoxazole.Investigational, Withdrawn
Valproic AcidThe metabolism of Valproic Acid can be decreased when combined with Sulfisoxazole.Approved, Investigational
ValsartanThe metabolism of Valsartan can be decreased when combined with Sulfisoxazole.Approved, Investigational
VandetanibSulfisoxazole may increase the QTc-prolonging activities of Vandetanib.Approved
VanoxerineThe metabolism of Vanoxerine can be decreased when combined with Sulfisoxazole.Investigational
VardenafilVardenafil may increase the QTc-prolonging activities of Sulfisoxazole.Approved
VemurafenibSulfisoxazole may increase the QTc-prolonging activities of Vemurafenib.Approved
VenetoclaxThe metabolism of Venetoclax can be decreased when combined with Sulfisoxazole.Approved
VenlafaxineThe metabolism of Venlafaxine can be decreased when combined with Sulfisoxazole.Approved
VerapamilThe metabolism of Verapamil can be decreased when combined with Sulfisoxazole.Approved
VilanterolVilanterol may increase the QTc-prolonging activities of Sulfisoxazole.Approved
VilazodoneThe serum concentration of Vilazodone can be increased when it is combined with Sulfisoxazole.Approved
VildagliptinVildagliptin may increase the hypoglycemic activities of Sulfisoxazole.Approved, Investigational
VinblastineThe metabolism of Vinblastine can be decreased when combined with Sulfisoxazole.Approved
VincristineThe metabolism of Vincristine can be decreased when combined with Sulfisoxazole.Approved, Investigational
VindesineThe serum concentration of Vindesine can be increased when it is combined with Sulfisoxazole.Approved
VinorelbineThe metabolism of Vinorelbine can be decreased when combined with Sulfisoxazole.Approved, Investigational
VismodegibThe metabolism of Vismodegib can be decreased when combined with Sulfisoxazole.Approved
VogliboseVoglibose may increase the hypoglycemic activities of Sulfisoxazole.Approved, Investigational
VoriconazoleThe metabolism of Voriconazole can be decreased when combined with Sulfisoxazole.Approved, Investigational
VorinostatVorinostat may increase the QTc-prolonging activities of Sulfisoxazole.Approved, Investigational
VortioxetineThe metabolism of Vortioxetine can be decreased when combined with Sulfisoxazole.Approved
WarfarinThe metabolism of Warfarin can be decreased when combined with Sulfisoxazole.Approved
XimelagatranThe metabolism of Ximelagatran can be decreased when combined with Sulfisoxazole.Approved, Investigational, Withdrawn
YohimbineThe metabolism of Yohimbine can be decreased when combined with Sulfisoxazole.Approved, Vet Approved
ZafirlukastThe metabolism of Zafirlukast can be decreased when combined with Sulfisoxazole.Approved, Investigational
ZalcitabineThe metabolism of Zalcitabine can be decreased when combined with Sulfisoxazole.Approved
ZaleplonThe metabolism of Zaleplon can be decreased when combined with Sulfisoxazole.Approved, Illicit, Investigational
ZaltoprofenThe metabolism of Zaltoprofen can be decreased when combined with Sulfisoxazole.Approved
ZidovudineThe metabolism of Zidovudine can be decreased when combined with Sulfisoxazole.Approved
ZileutonThe metabolism of Zileuton can be decreased when combined with Sulfisoxazole.Approved, Investigational, Withdrawn
ZimelidineZimelidine may increase the hypoglycemic activities of Sulfisoxazole.Withdrawn
ZiprasidoneSulfisoxazole may increase the QTc-prolonging activities of Ziprasidone.Approved
ZolpidemThe metabolism of Zolpidem can be decreased when combined with Sulfisoxazole.Approved
ZomepiracThe metabolism of Zomepirac can be decreased when combined with Sulfisoxazole.Withdrawn
ZonisamideThe metabolism of Zonisamide can be decreased when combined with Sulfisoxazole.Approved, Investigational
ZopicloneThe serum concentration of Zopiclone can be increased when it is combined with Sulfisoxazole.Approved
ZuclopenthixolThe serum concentration of Zuclopenthixol can be increased when it is combined with Sulfisoxazole.Approved, Investigational
Food InteractionsNot Available
Synthesis ReferenceNot Available
General ReferencesNot Available
External Links
ATC CodesJ01EB05S01AB02
AHFS Codes
  • 08:12.20
PDB EntriesNot Available
FDA labelNot Available
MSDSDownload (72 KB)
Clinical Trials
Clinical Trials
  • Hoffmann la roche inc
  • Mk laboratories inc
  • Alra laboratories inc
  • Parke davis div warner lambert co
  • Barr laboratories inc
  • Heather drug co inc
  • Impax laboratories inc
  • Ivax pharmaceuticals inc sub teva pharmaceuticals usa
  • Lannett co inc
  • Lederle laboratories div american cyanamid co
  • Pharmeral inc
  • Purepac pharmaceutical co
  • Roxane laboratories inc
  • Sandoz inc
  • Valeant pharmaceuticals international
  • Vitarine pharmaceuticals inc
  • Watson laboratories inc
  • West ward pharmaceutical corp
  • Solvay pharmaceuticals
  • Sola barnes hind
Dosage forms
TabletOral500 mg
Granule, for suspensionOral
Powder, for suspensionOral
Unit descriptionCostUnit
Sulfisoxazole crystals1.01USD g
Sulfazine EC 500 mg Enteric Coated Tabs0.42USD tab
Sulfazine ec 500 mg tablet0.38USD tablet
Sulfazine 500 mg tablet0.25USD tablet
DrugBank does not sell nor buy drugs. Pricing information is supplied for informational purposes only.
PatentsNot Available
Experimental Properties
melting point191 °CPhysProp
water solubility300 mg/L (at 37 °C)YALKOWSKY,SH & DANNENFELSER,RM (1992)
logP1.01HANSCH,C ET AL. (1995)
logS-2.91ADME Research, USCD
pKa5Not Available
Predicted Properties
Water Solubility0.313 mg/mLALOGPS
pKa (Strongest Acidic)5.8ChemAxon
pKa (Strongest Basic)2.17ChemAxon
Physiological Charge-1ChemAxon
Hydrogen Acceptor Count4ChemAxon
Hydrogen Donor Count2ChemAxon
Polar Surface Area98.22 Å2ChemAxon
Rotatable Bond Count2ChemAxon
Refractivity67.92 m3·mol-1ChemAxon
Polarizability26.93 Å3ChemAxon
Number of Rings2ChemAxon
Rule of FiveYesChemAxon
Ghose FilterYesChemAxon
Veber's RuleYesChemAxon
MDDR-like RuleYesChemAxon
Predicted ADMET features
Human Intestinal Absorption+0.9908
Blood Brain Barrier+0.9382
Caco-2 permeable-0.6046
P-glycoprotein substrateNon-substrate0.8891
P-glycoprotein inhibitor INon-inhibitor0.9357
P-glycoprotein inhibitor IINon-inhibitor0.9698
Renal organic cation transporterNon-inhibitor0.9322
CYP450 2C9 substrateNon-substrate0.8056
CYP450 2D6 substrateNon-substrate0.9116
CYP450 3A4 substrateNon-substrate0.7557
CYP450 1A2 substrateNon-inhibitor0.9621
CYP450 2C9 inhibitorNon-inhibitor0.9071
CYP450 2D6 inhibitorNon-inhibitor0.9358
CYP450 2C19 inhibitorNon-inhibitor0.9292
CYP450 3A4 inhibitorNon-inhibitor0.9386
CYP450 inhibitory promiscuityLow CYP Inhibitory Promiscuity0.8037
Ames testNon AMES toxic0.9133
BiodegradationNot ready biodegradable1.0
Rat acute toxicity1.4586 LD50, mol/kg Not applicable
hERG inhibition (predictor I)Weak inhibitor0.9896
hERG inhibition (predictor II)Non-inhibitor0.9442
ADMET data is predicted using admetSAR, a free tool for evaluating chemical ADMET properties. (23092397 )
Mass Spec (NIST)Download (8.71 KB)
Spectrum TypeDescriptionSplash Key
Predicted LC-MS/MSPredicted LC-MS/MS Spectrum - 10V, PositiveNot Available
Predicted LC-MS/MSPredicted LC-MS/MS Spectrum - 20V, PositiveNot Available
Predicted LC-MS/MSPredicted LC-MS/MS Spectrum - 40V, PositiveNot Available
Predicted LC-MS/MSPredicted LC-MS/MS Spectrum - 10V, NegativeNot Available
Predicted LC-MS/MSPredicted LC-MS/MS Spectrum - 20V, NegativeNot Available
Predicted LC-MS/MSPredicted LC-MS/MS Spectrum - 40V, NegativeNot Available
DescriptionThis compound belongs to the class of organic compounds known as aminobenzenesulfonamides. These are organic compounds containing a benzenesulfonamide moiety with an amine group attached to the benzene ring.
KingdomOrganic compounds
Super ClassBenzenoids
ClassBenzene and substituted derivatives
Sub ClassBenzenesulfonamides
Direct ParentAminobenzenesulfonamides
Alternative Parents
  • Aminobenzenesulfonamide
  • Benzenesulfonyl group
  • Aniline or substituted anilines
  • Organosulfonic acid amide
  • Azole
  • Isoxazole
  • Organic sulfonic acid or derivatives
  • Organosulfonic acid or derivatives
  • Sulfonyl
  • Aminosulfonyl compound
  • Heteroaromatic compound
  • Organoheterocyclic compound
  • Azacycle
  • Oxacycle
  • Organonitrogen compound
  • Organic nitrogen compound
  • Organic oxygen compound
  • Amine
  • Primary amine
  • Organosulfur compound
  • Organopnictogen compound
  • Organooxygen compound
  • Hydrocarbon derivative
  • Organic oxide
  • Aromatic heteromonocyclic compound
Molecular FrameworkAromatic heteromonocyclic compounds
External Descriptors


Escherichia coli (strain K12)
Pharmacological action
General Function:
Metal ion binding
Specific Function:
Catalyzes the condensation of para-aminobenzoate (pABA) with 6-hydroxymethyl-7,8-dihydropterin diphosphate (DHPt-PP) to form 7,8-dihydropteroate (H2Pte), the immediate precursor of folate derivatives.
Gene Name:
Uniprot ID:
Molecular Weight:
30614.855 Da
  1. Imming P, Sinning C, Meyer A: Drugs, their targets and the nature and number of drug targets. Nat Rev Drug Discov. 2006 Oct;5(10):821-34. [PubMed:17016423 ]
  2. Jorgensen JH, Crawford SA, Fiebelkorn KR: Susceptibility of Neisseria meningitidis to 16 antimicrobial agents and characterization of resistance mechanisms affecting some agents. J Clin Microbiol. 2005 Jul;43(7):3162-71. [PubMed:16000430 ]
  3. Fiebelkorn KR, Crawford SA, Jorgensen JH: Mutations in folP associated with elevated sulfonamide MICs for Neisseria meningitidis clinical isolates from five continents. Antimicrob Agents Chemother. 2005 Feb;49(2):536-40. [PubMed:15673729 ]
  4. Hong YL, Hossler PA, Calhoun DH, Meshnick SR: Inhibition of recombinant Pneumocystis carinii dihydropteroate synthetase by sulfa drugs. Antimicrob Agents Chemother. 1995 Aug;39(8):1756-63. [PubMed:7486915 ]


Pharmacological action
General Function:
Steroid hydroxylase activity
Specific Function:
Cytochromes P450 are a group of heme-thiolate monooxygenases. In liver microsomes, this enzyme is involved in an NADPH-dependent electron transport pathway. It oxidizes a variety of structurally unrelated compounds, including steroids, fatty acids, and xenobiotics. This enzyme contributes to the wide pharmacokinetics variability of the metabolism of drugs such as S-warfarin, diclofenac, phenyto...
Gene Name:
Uniprot ID:
Molecular Weight:
55627.365 Da
  1. Preissner S, Kroll K, Dunkel M, Senger C, Goldsobel G, Kuzman D, Guenther S, Winnenburg R, Schroeder M, Preissner R: SuperCYP: a comprehensive database on Cytochrome P450 enzymes including a tool for analysis of CYP-drug interactions. Nucleic Acids Res. 2010 Jan;38(Database issue):D237-43. doi: 10.1093/nar/gkp970. Epub 2009 Nov 24. [PubMed:19934256 ]
Pharmacological action
General Function:
Vitamin d3 25-hydroxylase activity
Specific Function:
Cytochromes P450 are a group of heme-thiolate monooxygenases. In liver microsomes, this enzyme is involved in an NADPH-dependent electron transport pathway. It performs a variety of oxidation reactions (e.g. caffeine 8-oxidation, omeprazole sulphoxidation, midazolam 1'-hydroxylation and midazolam 4-hydroxylation) of structurally unrelated compounds, including steroids, fatty acids, and xenobiot...
Gene Name:
Uniprot ID:
Molecular Weight:
57342.67 Da
comments powered by Disqus
Drug created on June 13, 2005 07:24 / Updated on April 27, 2017 14:02