
Accession Number
DB00263  (APRD00595)
Small Molecule
Approved, Vet approved

A short-acting sulfonamide antibacterial with activity against a wide range of gram- negative and gram-positive organisms.

  • 3,4-Dimethyl-5-sulfanilamidoisoxazole
  • 3,4-Dimethyl-5-sulfonamidoisoxazole
  • 3,4-Dimethyl-5-sulphanilamidoisoxazole
  • 3,4-Dimethyl-5-sulphonamidoisoxazole
  • 3,4-Dimethylisoxazole-5-sulfanilamide
  • 3,4-Dimethylisoxazole-5-sulphanilamide
  • 4-Amino-N-(3,4-dimethyl-5-isoxazolyl)benzenesulfonamide
  • 4-Amino-N-(3,4-dimethyl-5-isoxazolyl)benzenesulphonamide
  • 5-(4-Aminophenylsulfonamido)-3,4-dimethylisoxazole
  • 5-(p-Aminobenzenesulfonamido)-3,4-dimethylisoxazole
  • 5-(p-Aminobenzenesulphonamido)-3,4-dimethylisoxazole
  • 5-Sulfanilamido-3,4-dimethylisoxazole
  • 5-Sulphanilamido-3,4-dimethyl-isoxazole
  • N'-(3,4)Dimethylisoxazol-5-yl-sulphanilamide
  • N1-(3,4-dimethyl-5-isoxazolyl)sulfanilamide
  • N1-(3,4-dimethyl-5-isoxazolyl)sulphanilamide
  • Sulfadimethylisoxazole
  • Sulfafurazol
  • Sulfafurazole
  • Sulfafurazolum
  • Sulfaisoxazole
  • Sulfasoxazole
  • Sulfisonazole
  • Sulfisoxasole
  • Sulfisoxazol
  • Sulfisoxazole
  • Sulfofurazole
  • Sulphadimethylisoxazole
  • Sulphafurazol
  • Sulphafurazole
  • Sulphaisoxazole
  • Sulphisoxazol
  • Sulphofurazole
Product Ingredients
IngredientUNIICASInChI Key
Sulfisoxazole diolamine30S4B46J8B4299-60-9FEPTXVIRMZIGFY-UHFFFAOYSA-N
Prescription Products
NameDosageStrengthRouteLabellerMarketing StartMarketing End
Apo Sulfisoxazole Tab 500mgTablet500 mgOralApotex Corporation1977-12-31Not applicableCanada
Sulfisoxazole 500mg TabletsTablet500 mgOralLaboratoires Confab IncNot applicableNot applicableCanada
Sulfizole Tab 500mgTablet500 mgOralIcn Pharmaceuticals1963-12-312005-04-26Canada
Generic Prescription Products
NameDosageStrengthRouteLabellerMarketing StartMarketing End
Novo-soxazole 500mgTablet500 mgOralNovopharm Limited1967-12-312005-08-10Canada
Mixture Products
NameIngredientsDosageRouteLabellerMarketing StartMarketing End
PediazoleSulfisoxazole (600 mg) + Erythromycin (200 mg)Powder, for suspensionOralAmdipharm Limited1983-12-312017-07-17Canada
International/Other Brands
Gantrisin (Roche) / Neoxazol
CAS number
Average: 267.304
Monoisotopic: 267.067761987
Chemical Formula
InChI Key



For the treatment of severe, repeated, or long-lasting urinary tract infections, meningococcal meningitis, acute otitis media, trachoma, inclusion conjunctivitis, nocardiosis, chancroid, toxoplasmosis, malaria and other bacterial infections.

Associated Conditions

Sulfisoxazole is a sulfonamide antibiotic. The sulfonamides are synthetic bacteriostatic antibiotics with a wide spectrum against most gram-positive and many gram-negative organisms. However, many strains of an individual species may be resistant. Sulfonamides inhibit multiplication of bacteria by acting as competitive inhibitors of p-aminobenzoic acid in the folic acid metabolism cycle. Bacterial sensitivity is the same for the various sulfonamides, and resistance to one sulfonamide indicates resistance to all. Most sulfonamides are readily absorbed orally. However, parenteral administration is difficult, since the soluble sulfonamide salts are highly alkaline and irritating to the tissues. The sulfonamides are widely distributed throughout all tissues. High levels are achieved in pleural, peritoneal, synovial, and ocular fluids. Although these drugs are no longer used to treat meningitis, CSF levels are high in meningeal infections. Their antibacterial action is inhibited by pus.

Mechanism of action

Sulfisoxazole is a competitive inhibitor of the enzyme dihydropteroate synthetase. It inhibits bacterial synthesis of dihydrofolic acid by preventing the condensation of the pteridine with para-aminobenzoic acid (PABA), a substrate of the enzyme dihydropteroate synthetase. The inhibited reaction is necessary in these organisms for the synthesis of folic acid.

ADihydropteroate synthase
Escherichia coli (strain K12)
Not Available
Volume of distribution
Not Available
Protein binding
Not Available
Not Available
Route of elimination

The mean urinary excretion recovery following oral administration of sulfisoxazole is 97% within 48 hours, of which 52% is intact drug, with the remaining as the N4-acetylated metabolite. It is excreted in human milk.

Half life
Not Available
Not Available

LD50=6800 mg/kg (Orally in mice)

Affected organisms
  • Enteric bacteria and other eubacteria
Not Available
Pharmacogenomic Effects/ADRs
Interacting Gene/EnzymeAllele nameGenotype(s)Defining Change(s)Type(s)DescriptionDetails
Glucose-6-phosphate 1-dehydrogenaseVilleurbanneNot Available1000_1002delACCADR InferredIncreased risk of dose-related hemolysis.Details
Glucose-6-phosphate 1-dehydrogenaseTorunNot Available1006A->GADR InferredIncreased risk of dose-related hemolysis.Details
Glucose-6-phosphate 1-dehydrogenaseSunderlandNot Available105_107delCATADR InferredIncreased risk of dose-related hemolysis.Details
Glucose-6-phosphate 1-dehydrogenaseIwatsukiNot Available1081G->AADR InferredIncreased risk of dose-related hemolysis.Details
Glucose-6-phosphate 1-dehydrogenaseSerresNot Available1082C->TADR InferredIncreased risk of dose-related hemolysis.Details
Glucose-6-phosphate 1-dehydrogenaseTondelaNot Available1084_1101delCTGAACGAGCGCAAGGCCADR InferredIncreased risk of dose-related hemolysis.Details
Glucose-6-phosphate 1-dehydrogenaseLoma LindaNot Available1089C->AADR InferredIncreased risk of dose-related hemolysis.Details
Glucose-6-phosphate 1-dehydrogenaseAachenNot Available1089C->GADR InferredIncreased risk of dose-related hemolysis.Details
Glucose-6-phosphate 1-dehydrogenaseTenriNot Available1096A->GADR InferredIncreased risk of dose-related hemolysis.Details
Glucose-6-phosphate 1-dehydrogenaseMontpellierNot Available1132G>AADR InferredIncreased risk of dose-related hemolysis.Details
Glucose-6-phosphate 1-dehydrogenaseCalvo MackennaNot Available1138A->GADR InferredIncreased risk of dose-related hemolysis.Details
Glucose-6-phosphate 1-dehydrogenaseRileyNot Available1139T->CADR InferredIncreased risk of dose-related hemolysis.Details
Glucose-6-phosphate 1-dehydrogenaseOlomoucNot Available1141T->CADR InferredIncreased risk of dose-related hemolysis.Details
Glucose-6-phosphate 1-dehydrogenaseTomahNot Available1153T->CADR InferredIncreased risk of dose-related hemolysis.Details
Glucose-6-phosphate 1-dehydrogenaseLynwoodNot Available1154G->TADR InferredIncreased risk of dose-related hemolysis.Details
Glucose-6-phosphate 1-dehydrogenaseMadridNot Available1155C->GADR InferredIncreased risk of dose-related hemolysis.Details
Glucose-6-phosphate 1-dehydrogenaseIowa, Walter Reed, SpringfieldNot Available1156A->GADR InferredIncreased risk of dose-related hemolysis.Details
Glucose-6-phosphate 1-dehydrogenaseBeverly Hills, Genova, Iwate, Niigata, YamaguchiNot Available1160G->AADR InferredIncreased risk of dose-related hemolysis.Details
Glucose-6-phosphate 1-dehydrogenaseHartfordNot Available1162A->GADR InferredIncreased risk of dose-related hemolysis.Details
Glucose-6-phosphate 1-dehydrogenasePrahaNot Available1166A->GADR InferredIncreased risk of dose-related hemolysis.Details
Glucose-6-phosphate 1-dehydrogenaseKrakowNot Available1175T>CADR InferredIncreased risk of dose-related hemolysis.Details
Glucose-6-phosphate 1-dehydrogenaseWisconsinNot Available1177C->GADR InferredIncreased risk of dose-related hemolysis.Details
Glucose-6-phosphate 1-dehydrogenaseNashville, Anaheim, PorticiNot Available1178G->AADR InferredIncreased risk of dose-related hemolysis.Details
Glucose-6-phosphate 1-dehydrogenaseAlhambraNot Available1180G->CADR InferredIncreased risk of dose-related hemolysis.Details
Glucose-6-phosphate 1-dehydrogenaseBariNot Available1187C->TADR InferredIncreased risk of dose-related hemolysis.Details
Glucose-6-phosphate 1-dehydrogenasePuerto LimonNot Available1192G->AADR InferredIncreased risk of dose-related hemolysis.Details
Glucose-6-phosphate 1-dehydrogenaseCovao do LoboNot Available1205C>AADR InferredIncreased risk of dose-related hemolysis.Details
Glucose-6-phosphate 1-dehydrogenaseClinicNot Available1215G->AADR InferredIncreased risk of dose-related hemolysis.Details
Glucose-6-phosphate 1-dehydrogenaseUtrechtNot Available1225C->TADR InferredIncreased risk of dose-related hemolysis.Details
Glucose-6-phosphate 1-dehydrogenaseSuwalkiNot Available1226C->GADR InferredIncreased risk of dose-related hemolysis.Details
Glucose-6-phosphate 1-dehydrogenaseRiversideNot Available1228G->TADR InferredIncreased risk of dose-related hemolysis.Details
Glucose-6-phosphate 1-dehydrogenaseJapan, ShinagawaNot Available1229G->AADR InferredIncreased risk of dose-related hemolysis.Details
Glucose-6-phosphate 1-dehydrogenaseKawasakiNot Available1229G->CADR InferredIncreased risk of dose-related hemolysis.Details
Glucose-6-phosphate 1-dehydrogenaseMunichNot Available1231A->GADR InferredIncreased risk of dose-related hemolysis.Details
Glucose-6-phosphate 1-dehydrogenaseGeorgiaNot Available1284C->AADR InferredIncreased risk of dose-related hemolysis.Details
Glucose-6-phosphate 1-dehydrogenaseSumareNot Available1292T->GADR InferredIncreased risk of dose-related hemolysis.Details
Glucose-6-phosphate 1-dehydrogenaseTelti/KobeNot Available1318C->TADR InferredIncreased risk of dose-related hemolysis.Details
Glucose-6-phosphate 1-dehydrogenaseSantiago de Cuba, MoriokaNot Available1339G->AADR InferredIncreased risk of dose-related hemolysis.Details
Glucose-6-phosphate 1-dehydrogenaseHarimaNot Available1358T->AADR InferredIncreased risk of dose-related hemolysis.Details
Glucose-6-phosphate 1-dehydrogenaseFiguera da FozNot Available1366G->CADR InferredIncreased risk of dose-related hemolysis.Details
Glucose-6-phosphate 1-dehydrogenaseAmiensNot Available1367A>TADR InferredIncreased risk of dose-related hemolysis.Details
Glucose-6-phosphate 1-dehydrogenaseBangkok NoiNot Available1376G->T, 1502T->GADR InferredIncreased risk of dose-related hemolysis.Details
Glucose-6-phosphate 1-dehydrogenaseFukayaNot Available1462G->AADR InferredIncreased risk of dose-related hemolysis.Details
Glucose-6-phosphate 1-dehydrogenaseCampinasNot Available1463G->TADR InferredIncreased risk of dose-related hemolysis.Details
Glucose-6-phosphate 1-dehydrogenaseBuenos AiresNot Available1465C>TADR InferredIncreased risk of dose-related hemolysis.Details
Glucose-6-phosphate 1-dehydrogenaseArakawaNot Available1466C->TADR InferredIncreased risk of dose-related hemolysis.Details
Glucose-6-phosphate 1-dehydrogenaseBrightonNot Available1488_1490delGAAADR InferredIncreased risk of dose-related hemolysis.Details
Glucose-6-phosphate 1-dehydrogenaseKozukataNot Available159G->CADR InferredIncreased risk of dose-related hemolysis.Details
Glucose-6-phosphate 1-dehydrogenaseAmsterdamNot Available180_182delTCTADR InferredIncreased risk of dose-related hemolysis.Details
Glucose-6-phosphate 1-dehydrogenaseNo nameNot Available202G->A, 376A->G, 1264C>GADR InferredIncreased risk of dose-related hemolysis.Details
Glucose-6-phosphate 1-dehydrogenaseSwanseaNot Available224T->CADR InferredIncreased risk of dose-related hemolysis.Details
Glucose-6-phosphate 1-dehydrogenaseUrayasuNot Available281_283delAGAADR InferredIncreased risk of dose-related hemolysis.Details
Glucose-6-phosphate 1-dehydrogenaseVancouverNot Available317C->G544C->T592C->TADR InferredIncreased risk of dose-related hemolysis.Details
Glucose-6-phosphate 1-dehydrogenaseMt SinaiNot Available376A->G, 1159C->TADR InferredIncreased risk of dose-related hemolysis.Details
Glucose-6-phosphate 1-dehydrogenasePlymouthNot Available488G->AADR InferredIncreased risk of dose-related hemolysis.Details
Glucose-6-phosphate 1-dehydrogenaseVolendamNot Available514C->TADR InferredIncreased risk of dose-related hemolysis.Details
Glucose-6-phosphate 1-dehydrogenaseShinshuNot Available527A->GADR InferredIncreased risk of dose-related hemolysis.Details
Glucose-6-phosphate 1-dehydrogenaseChikugoNot Available535A->TADR InferredIncreased risk of dose-related hemolysis.Details
Glucose-6-phosphate 1-dehydrogenaseTsukuiNot Available561_563delCTCADR InferredIncreased risk of dose-related hemolysis.Details
Glucose-6-phosphate 1-dehydrogenasePedoplis-CkaroNot Available573C>GADR InferredIncreased risk of dose-related hemolysis.Details
Glucose-6-phosphate 1-dehydrogenaseSantiagoNot Available593G->CADR InferredIncreased risk of dose-related hemolysis.Details
Glucose-6-phosphate 1-dehydrogenaseMinnesota, Marion, Gastonia, LeJeuneNot Available637G->TADR InferredIncreased risk of dose-related hemolysis.Details
Glucose-6-phosphate 1-dehydrogenaseCincinnatiNot Available637G->T, 1037A->TADR InferredIncreased risk of dose-related hemolysis.Details
Glucose-6-phosphate 1-dehydrogenaseHarilaouNot Available648T->GADR InferredIncreased risk of dose-related hemolysis.Details
Glucose-6-phosphate 1-dehydrogenaseNorth DallasNot Available683_685delACAADR InferredIncreased risk of dose-related hemolysis.Details
Glucose-6-phosphate 1-dehydrogenaseAsahikawaNot Available695G->AADR InferredIncreased risk of dose-related hemolysis.Details
Glucose-6-phosphate 1-dehydrogenaseDurhamNot Available713A->GADR InferredIncreased risk of dose-related hemolysis.Details
Glucose-6-phosphate 1-dehydrogenaseStonybrookNot Available724_729delGGCACTADR InferredIncreased risk of dose-related hemolysis.Details
Glucose-6-phosphate 1-dehydrogenaseWayneNot Available769C->GADR InferredIncreased risk of dose-related hemolysis.Details
Glucose-6-phosphate 1-dehydrogenaseAveiroNot Available806G->AADR InferredIncreased risk of dose-related hemolysis.Details
Glucose-6-phosphate 1-dehydrogenaseCleveland CorumNot Available820G->AADR InferredIncreased risk of dose-related hemolysis.Details
Glucose-6-phosphate 1-dehydrogenaseLilleNot Available821A>TADR InferredIncreased risk of dose-related hemolysis.Details
Glucose-6-phosphate 1-dehydrogenaseBangkokNot Available825G>CADR InferredIncreased risk of dose-related hemolysis.Details
Glucose-6-phosphate 1-dehydrogenaseSugaoNot Available826C->TADR InferredIncreased risk of dose-related hemolysis.Details
Glucose-6-phosphate 1-dehydrogenaseLa JollaNot Available832T->CADR InferredIncreased risk of dose-related hemolysis.Details
Glucose-6-phosphate 1-dehydrogenaseWexhamNot Available833C->TADR InferredIncreased risk of dose-related hemolysis.Details
Glucose-6-phosphate 1-dehydrogenasePiotrkowNot Available851T>CADR InferredIncreased risk of dose-related hemolysis.Details
Glucose-6-phosphate 1-dehydrogenaseWest VirginiaNot Available910G->TADR InferredIncreased risk of dose-related hemolysis.Details
Glucose-6-phosphate 1-dehydrogenaseOmiyaNot Available921G->CADR InferredIncreased risk of dose-related hemolysis.Details
Glucose-6-phosphate 1-dehydrogenaseNaraNot Available953_976delCCACCAAAGGGTACCTGGAC GACCADR InferredIncreased risk of dose-related hemolysis.Details
Glucose-6-phosphate 1-dehydrogenaseManhattanNot Available962G->AADR InferredIncreased risk of dose-related hemolysis.Details
Glucose-6-phosphate 1-dehydrogenaseRehevotNot Available964T->CADR InferredIncreased risk of dose-related hemolysis.Details
Glucose-6-phosphate 1-dehydrogenaseHoniaraNot Available99A->G / 1360C->TADR InferredIncreased risk of dose-related hemolysis.Details
Glucose-6-phosphate 1-dehydrogenaseTokyo, FukushimaNot Available1246G->AADR InferredIncreased risk of dose-related hemolysis.Details
Glucose-6-phosphate 1-dehydrogenaseChathamNot Available1003G->AADR InferredIncreased risk of dose-related hemolysis.Details
Glucose-6-phosphate 1-dehydrogenaseFushanNot Available1004C->AADR InferredIncreased risk of dose-related hemolysis.Details
Glucose-6-phosphate 1-dehydrogenasePartenopeNot Available1052G->TADR InferredIncreased risk of dose-related hemolysis.Details
Glucose-6-phosphate 1-dehydrogenaseIerapetraNot Available1057C->TADR InferredIncreased risk of dose-related hemolysis.Details
Glucose-6-phosphate 1-dehydrogenaseAnadiaNot Available1193A->GADR InferredIncreased risk of dose-related hemolysis.Details
Glucose-6-phosphate 1-dehydrogenaseAbenoNot Available1220A->CADR InferredIncreased risk of dose-related hemolysis.Details
Glucose-6-phosphate 1-dehydrogenaseSurabayaNot Available1291G->AADR InferredIncreased risk of dose-related hemolysis.Details
Glucose-6-phosphate 1-dehydrogenasePawneeNot Available1316G->CADR InferredIncreased risk of dose-related hemolysis.Details
Glucose-6-phosphate 1-dehydrogenaseS. AntiocoNot Available1342A->GADR InferredIncreased risk of dose-related hemolysis.Details
Glucose-6-phosphate 1-dehydrogenaseCassanoNot Available1347G->CADR InferredIncreased risk of dose-related hemolysis.Details
Glucose-6-phosphate 1-dehydrogenaseHermoupolisNot Available1347G->C / 1360C->TADR InferredIncreased risk of dose-related hemolysis.Details
Glucose-6-phosphate 1-dehydrogenaseUnion,Maewo, Chinese-2, KaloNot Available1360C->TADR InferredIncreased risk of dose-related hemolysis.Details
Glucose-6-phosphate 1-dehydrogenaseAndalusNot Available1361G->AADR InferredIncreased risk of dose-related hemolysis.Details
Glucose-6-phosphate 1-dehydrogenaseCosenzaNot Available1376G->CADR InferredIncreased risk of dose-related hemolysis.Details
Glucose-6-phosphate 1-dehydrogenaseCanton, Taiwan- Hakka, Gifu-like, Agrigento-likeNot Available1376G->TADR InferredIncreased risk of dose-related hemolysis.Details
Glucose-6-phosphate 1-dehydrogenaseFloresNot Available1387C->AADR InferredIncreased risk of dose-related hemolysis.Details
Glucose-6-phosphate 1-dehydrogenaseKaiping, Anant, Dhon, Sapporo-like, WoseraNot Available1388G->AADR InferredIncreased risk of dose-related hemolysis.Details
Glucose-6-phosphate 1-dehydrogenaseKamogawaNot Available169C->TADR InferredIncreased risk of dose-related hemolysis.Details
Glucose-6-phosphate 1-dehydrogenaseCostanzoNot Available179T>CADR InferredIncreased risk of dose-related hemolysis.Details
Glucose-6-phosphate 1-dehydrogenaseAmazoniaNot Available185C->AADR InferredIncreased risk of dose-related hemolysis.Details
Glucose-6-phosphate 1-dehydrogenaseSongklanagarindNot Available196T->AADR InferredIncreased risk of dose-related hemolysis.Details
Glucose-6-phosphate 1-dehydrogenaseHechiNot Available202G->A / 871G->AADR InferredIncreased risk of dose-related hemolysis.Details
Glucose-6-phosphate 1-dehydrogenaseNamouruNot Available208T->CADR InferredIncreased risk of dose-related hemolysis.Details
Glucose-6-phosphate 1-dehydrogenaseBao LocNot Available352T>CADR InferredIncreased risk of dose-related hemolysis.Details
Glucose-6-phosphate 1-dehydrogenaseCrispimNot Available375G->T, 379G->T383T->C384C>TADR InferredIncreased risk of dose-related hemolysis.Details
Glucose-6-phosphate 1-dehydrogenaseAcrokorinthosNot Available376A->G / 463C->GADR InferredIncreased risk of dose-related hemolysis.Details
Glucose-6-phosphate 1-dehydrogenaseSanta MariaNot Available376A->G / 542A->TADR InferredIncreased risk of dose-related hemolysis.Details
Glucose-6-phosphate 1-dehydrogenaseAnanindeuaNot Available376A->G / 871G->AADR InferredIncreased risk of dose-related hemolysis.Details
Glucose-6-phosphate 1-dehydrogenaseVanua LavaNot Available383T->CADR InferredIncreased risk of dose-related hemolysis.Details
Glucose-6-phosphate 1-dehydrogenaseValladolidNot Available406C->TADR InferredIncreased risk of dose-related hemolysis.Details
Glucose-6-phosphate 1-dehydrogenaseBelemNot Available409C->TADR InferredIncreased risk of dose-related hemolysis.Details
Glucose-6-phosphate 1-dehydrogenaseLiuzhouNot Available442G->AADR InferredIncreased risk of dose-related hemolysis.Details
Glucose-6-phosphate 1-dehydrogenaseShenzenNot Available473G>AADR InferredIncreased risk of dose-related hemolysis.Details
Glucose-6-phosphate 1-dehydrogenaseTaipei “Chinese- 3”Not Available493A->GADR InferredIncreased risk of dose-related hemolysis.Details
Glucose-6-phosphate 1-dehydrogenaseToledoNot Available496C>TADR InferredIncreased risk of dose-related hemolysis.Details
Glucose-6-phosphate 1-dehydrogenaseNaoneNot Available497G->AADR InferredIncreased risk of dose-related hemolysis.Details
Glucose-6-phosphate 1-dehydrogenaseNankangNot Available517T->CADR InferredIncreased risk of dose-related hemolysis.Details
Glucose-6-phosphate 1-dehydrogenaseMiaoliNot Available519C->GADR InferredIncreased risk of dose-related hemolysis.Details
Glucose-6-phosphate 1-dehydrogenaseMediterranean, Dallas, Panama‚ Sassari, Cagliari, BirminghamNot Available563C->TADR InferredIncreased risk of dose-related hemolysis.Details
Glucose-6-phosphate 1-dehydrogenaseCoimbra ShundeNot Available592C->TADR InferredIncreased risk of dose-related hemolysis.Details
Glucose-6-phosphate 1-dehydrogenaseNilgiriNot Available593G>AADR InferredIncreased risk of dose-related hemolysis.Details
Glucose-6-phosphate 1-dehydrogenaseRadlowoNot Available679C->TADR InferredIncreased risk of dose-related hemolysis.Details
Glucose-6-phosphate 1-dehydrogenaseRoubaixNot Available811G>CADR InferredIncreased risk of dose-related hemolysis.Details
Glucose-6-phosphate 1-dehydrogenaseHaikouNot Available835A->GADR InferredIncreased risk of dose-related hemolysis.Details
Glucose-6-phosphate 1-dehydrogenaseChinese-1Not Available835A->TADR InferredIncreased risk of dose-related hemolysis.Details
Glucose-6-phosphate 1-dehydrogenaseMizushimaNot Available848A>GADR InferredIncreased risk of dose-related hemolysis.Details
Glucose-6-phosphate 1-dehydrogenaseOsakaNot Available853C->TADR InferredIncreased risk of dose-related hemolysis.Details
Glucose-6-phosphate 1-dehydrogenaseViangchan, JammuNot Available871G->AADR InferredIncreased risk of dose-related hemolysis.Details
Glucose-6-phosphate 1-dehydrogenaseSeoulNot Available916G->AADR InferredIncreased risk of dose-related hemolysis.Details
Glucose-6-phosphate 1-dehydrogenaseLudhianaNot Available929G->AADR InferredIncreased risk of dose-related hemolysis.Details
Glucose-6-phosphate 1-dehydrogenaseFarroupilhaNot Available977C->AADR InferredIncreased risk of dose-related hemolysis.Details
Glucose-6-phosphate 1-dehydrogenaseChinese-5Not Available1024C->TADR InferredIncreased risk of dose-related hemolysis.Details
Glucose-6-phosphate 1-dehydrogenaseRignanoNot Available130G>AADR InferredIncreased risk of dose-related hemolysis.Details
Glucose-6-phosphate 1-dehydrogenaseOrissaNot Available131C->GADR InferredIncreased risk of dose-related hemolysis.Details
Glucose-6-phosphate 1-dehydrogenaseG6PDNiceNot Available1380G>CADR InferredIncreased risk of dose-related hemolysis.Details
Glucose-6-phosphate 1-dehydrogenaseKamiube, KeelungNot Available1387C->TADR InferredIncreased risk of dose-related hemolysis.Details
Glucose-6-phosphate 1-dehydrogenaseNeapolisNot Available1400C->GADR InferredIncreased risk of dose-related hemolysis.Details
Glucose-6-phosphate 1-dehydrogenaseAuresNot Available143T->CADR InferredIncreased risk of dose-related hemolysis.Details
Glucose-6-phosphate 1-dehydrogenaseSplitNot Available1442C->GADR InferredIncreased risk of dose-related hemolysis.Details
Glucose-6-phosphate 1-dehydrogenaseKambosNot Available148C->TADR InferredIncreased risk of dose-related hemolysis.Details
Glucose-6-phosphate 1-dehydrogenasePalestrinaNot Available170G>AADR InferredIncreased risk of dose-related hemolysis.Details
Glucose-6-phosphate 1-dehydrogenaseMetapontoNot Available172G->AADR InferredIncreased risk of dose-related hemolysis.Details
Glucose-6-phosphate 1-dehydrogenaseMusashinoNot Available185C->TADR InferredIncreased risk of dose-related hemolysis.Details
Glucose-6-phosphate 1-dehydrogenaseAsahiNot Available202G->AADR InferredIncreased risk of dose-related hemolysis.Details
Glucose-6-phosphate 1-dehydrogenaseA- (202), Ferrara INot Available202G->A / 376A->GADR InferredIncreased risk of dose-related hemolysis.Details
Glucose-6-phosphate 1-dehydrogenaseMurcia OristanoNot Available209A->GADR InferredIncreased risk of dose-related hemolysis.Details
Glucose-6-phosphate 1-dehydrogenaseUbe KonanNot Available241C->TADR InferredIncreased risk of dose-related hemolysis.Details
Glucose-6-phosphate 1-dehydrogenaseLagosantoNot Available242G->AADR InferredIncreased risk of dose-related hemolysis.Details
Glucose-6-phosphate 1-dehydrogenaseGuangzhouNot Available274C->TADR InferredIncreased risk of dose-related hemolysis.Details
Glucose-6-phosphate 1-dehydrogenaseHammersmithNot Available323T->AADR InferredIncreased risk of dose-related hemolysis.Details
Glucose-6-phosphate 1-dehydrogenaseSinnaiNot Available34G->TADR InferredIncreased risk of dose-related hemolysis.Details
Glucose-6-phosphate 1-dehydrogenaseA- (680)Not Available376A->G / 680G->TADR InferredIncreased risk of dose-related hemolysis.Details
Glucose-6-phosphate 1-dehydrogenaseA- (968), Betica,Selma, GuantanamoNot Available376A->G / 968T->CADR InferredIncreased risk of dose-related hemolysis.Details
Glucose-6-phosphate 1-dehydrogenaseSalerno PyrgosNot Available383T>GADR InferredIncreased risk of dose-related hemolysis.Details
Glucose-6-phosphate 1-dehydrogenaseQuing YanNot Available392G->TADR InferredIncreased risk of dose-related hemolysis.Details
Glucose-6-phosphate 1-dehydrogenaseLagesNot Available40G->AADR InferredIncreased risk of dose-related hemolysis.Details
Glucose-6-phosphate 1-dehydrogenaseIleshaNot Available466G->AADR InferredIncreased risk of dose-related hemolysis.Details
Glucose-6-phosphate 1-dehydrogenaseMahidolNot Available487G->AADR InferredIncreased risk of dose-related hemolysis.Details
Glucose-6-phosphate 1-dehydrogenaseMalagaNot Available542A->TADR InferredIncreased risk of dose-related hemolysis.Details
Glucose-6-phosphate 1-dehydrogenaseSibariNot Available634A->GADR InferredIncreased risk of dose-related hemolysis.Details
Glucose-6-phosphate 1-dehydrogenaseMexico CityNot Available680G->AADR InferredIncreased risk of dose-related hemolysis.Details
Glucose-6-phosphate 1-dehydrogenaseNanningNot Available703C->TADR InferredIncreased risk of dose-related hemolysis.Details
Glucose-6-phosphate 1-dehydrogenaseSeattle, Lodi, Modena, Ferrara II, Athens-likeNot Available844G->CADR InferredIncreased risk of dose-related hemolysis.Details
Glucose-6-phosphate 1-dehydrogenaseBajo MaumereNot Available844G->TADR InferredIncreased risk of dose-related hemolysis.Details
Glucose-6-phosphate 1-dehydrogenaseMontalbanoNot Available854G->AADR InferredIncreased risk of dose-related hemolysis.Details
Glucose-6-phosphate 1-dehydrogenaseKalyan-Kerala, Jamnaga, RohiniNot Available949G->AADR InferredIncreased risk of dose-related hemolysis.Details
Glucose-6-phosphate 1-dehydrogenaseGaoheNot Available95A->GADR InferredIncreased risk of dose-related hemolysis.Details


Drug Interactions
(R)-warfarinThe risk or severity of bleeding can be increased when Sulfisoxazole is combined with (R)-warfarin.
(S)-WarfarinThe risk or severity of bleeding can be increased when Sulfisoxazole is combined with (S)-Warfarin.
2,4-thiazolidinedioneThe therapeutic efficacy of 2,4-thiazolidinedione can be increased when used in combination with Sulfisoxazole.
4-hydroxycoumarinThe risk or severity of bleeding can be increased when Sulfisoxazole is combined with 4-hydroxycoumarin.
5-(2-methylpiperazine-1-sulfonyl)isoquinolineThe therapeutic efficacy of Sulfisoxazole can be increased when used in combination with 5-(2-methylpiperazine-1-sulfonyl)isoquinoline.
AbexinostatThe risk or severity of QTc prolongation can be increased when Sulfisoxazole is combined with Abexinostat.
AcarboseThe therapeutic efficacy of Acarbose can be increased when used in combination with Sulfisoxazole.
AcebutololThe risk or severity of QTc prolongation can be increased when Sulfisoxazole is combined with Acebutolol.
AceclofenacThe metabolism of Aceclofenac can be decreased when combined with Sulfisoxazole.
AcenocoumarolThe metabolism of Acenocoumarol can be decreased when combined with Sulfisoxazole.
Food Interactions
Not Available


General References
Not Available
External Links
Human Metabolome Database
KEGG Compound
PubChem Compound
PubChem Substance
Therapeutic Targets Database
PA164748964 Drug Page
ATC Codes
J01EB05 — SulfafurazoleS01AB02 — SulfafurazoleG01AE10 — Combinations of sulfonamides
AHFS Codes
  • 08:12.20 — Sulfonamides
Download (72 KB)

Clinical Trials

Clinical Trials


  • Hoffmann la roche inc
  • Mk laboratories inc
  • Alra laboratories inc
  • Parke davis div warner lambert co
  • Barr laboratories inc
  • Heather drug co inc
  • Impax laboratories inc
  • Ivax pharmaceuticals inc sub teva pharmaceuticals usa
  • Lannett co inc
  • Lederle laboratories div american cyanamid co
  • Pharmeral inc
  • Purepac pharmaceutical co
  • Roxane laboratories inc
  • Sandoz inc
  • Valeant pharmaceuticals international
  • Vitarine pharmaceuticals inc
  • Watson laboratories inc
  • West ward pharmaceutical corp
  • Solvay pharmaceuticals
  • Sola barnes hind
  • Amend
  • Barr Pharmaceuticals
  • Dispensing Solutions
  • Duramed
  • Major Pharmaceuticals
  • Mississippi State Dept Health
  • Pharmaceutics International Inc.
  • Pharmedix
  • Physicians Total Care Inc.
  • Preferred Pharmaceuticals Inc.
  • Qualitest
  • United Research Laboratories Inc.
Dosage forms
Powder, for suspensionOral
TabletOral500 mg
Unit descriptionCostUnit
Sulfisoxazole crystals1.01USD g
Sulfazine EC 500 mg Enteric Coated Tabs0.42USD tab
Sulfazine ec 500 mg tablet0.38USD tablet
Sulfazine 500 mg tablet0.25USD tablet
DrugBank does not sell nor buy drugs. Pricing information is supplied for informational purposes only.
Not Available


Experimental Properties
melting point (°C)191 °CPhysProp
water solubility300 mg/L (at 37 °C)YALKOWSKY,SH & DANNENFELSER,RM (1992)
logP1.01HANSCH,C ET AL. (1995)
logS-2.91ADME Research, USCD
pKa5Not Available
Predicted Properties
Water Solubility0.313 mg/mLALOGPS
pKa (Strongest Acidic)5.8ChemAxon
pKa (Strongest Basic)2.17ChemAxon
Physiological Charge-1ChemAxon
Hydrogen Acceptor Count4ChemAxon
Hydrogen Donor Count2ChemAxon
Polar Surface Area98.22 Å2ChemAxon
Rotatable Bond Count2ChemAxon
Refractivity67.92 m3·mol-1ChemAxon
Polarizability26.93 Å3ChemAxon
Number of Rings2ChemAxon
Rule of FiveYesChemAxon
Ghose FilterYesChemAxon
Veber's RuleNoChemAxon
MDDR-like RuleNoChemAxon
Predicted ADMET features
Human Intestinal Absorption+0.9908
Blood Brain Barrier+0.9382
Caco-2 permeable-0.6046
P-glycoprotein substrateNon-substrate0.8891
P-glycoprotein inhibitor INon-inhibitor0.9357
P-glycoprotein inhibitor IINon-inhibitor0.9698
Renal organic cation transporterNon-inhibitor0.9322
CYP450 2C9 substrateNon-substrate0.8056
CYP450 2D6 substrateNon-substrate0.9116
CYP450 3A4 substrateNon-substrate0.7557
CYP450 1A2 substrateNon-inhibitor0.9621
CYP450 2C9 inhibitorNon-inhibitor0.9071
CYP450 2D6 inhibitorNon-inhibitor0.9358
CYP450 2C19 inhibitorNon-inhibitor0.9292
CYP450 3A4 inhibitorNon-inhibitor0.9386
CYP450 inhibitory promiscuityLow CYP Inhibitory Promiscuity0.8037
Ames testNon AMES toxic0.9133
BiodegradationNot ready biodegradable1.0
Rat acute toxicity1.4586 LD50, mol/kg Not applicable
hERG inhibition (predictor I)Weak inhibitor0.9896
hERG inhibition (predictor II)Non-inhibitor0.9442
ADMET data is predicted using admetSAR, a free tool for evaluating chemical ADMET properties. (23092397)


Mass Spec (NIST)
Download (8.71 KB)
SpectrumSpectrum TypeSplash Key
Predicted GC-MS Spectrum - GC-MSPredicted GC-MSNot Available
Predicted MS/MS Spectrum - 10V, Positive (Annotated)Predicted LC-MS/MSNot Available
Predicted MS/MS Spectrum - 20V, Positive (Annotated)Predicted LC-MS/MSNot Available
Predicted MS/MS Spectrum - 40V, Positive (Annotated)Predicted LC-MS/MSNot Available
Predicted MS/MS Spectrum - 10V, Negative (Annotated)Predicted LC-MS/MSNot Available
Predicted MS/MS Spectrum - 20V, Negative (Annotated)Predicted LC-MS/MSNot Available
Predicted MS/MS Spectrum - 40V, Negative (Annotated)Predicted LC-MS/MSNot Available
LC-MS/MS Spectrum - LC-ESI-qTof , PositiveLC-MS/MSNot Available
LC-MS/MS Spectrum - LC-ESI-QTOF , positiveLC-MS/MSsplash10-0a4i-3900000000-23eed4bc89bcf24079bd
MS/MS Spectrum - , positiveLC-MS/MSsplash10-0aor-1930000000-47a2d9042541d8f86f85
MS/MS Spectrum - , positiveLC-MS/MSsplash10-0a4i-2930000000-9fc0d3e8e143637637e8
MS/MS Spectrum - , positiveLC-MS/MSsplash10-0a4i-5911100000-18e92b64e6fb25ed4e6d


This compound belongs to the class of organic compounds known as aminobenzenesulfonamides. These are organic compounds containing a benzenesulfonamide moiety with an amine group attached to the benzene ring.
Organic compounds
Super Class
Benzene and substituted derivatives
Sub Class
Direct Parent
Alternative Parents
Benzenesulfonyl compounds / Aniline and substituted anilines / Organosulfonamides / Isoxazoles / Heteroaromatic compounds / Aminosulfonyl compounds / Oxacyclic compounds / Azacyclic compounds / Primary amines / Organopnictogen compounds
show 3 more
Aminobenzenesulfonamide / Benzenesulfonyl group / Aniline or substituted anilines / Organosulfonic acid amide / Azole / Isoxazole / Organic sulfonic acid or derivatives / Organosulfonic acid or derivatives / Sulfonyl / Aminosulfonyl compound
show 15 more
Molecular Framework
Aromatic heteromonocyclic compounds
External Descriptors
sulfonamide, isoxazoles, sulfonamide antibiotic (CHEBI:102484)


Escherichia coli (strain K12)
Pharmacological action
General Function
Metal ion binding
Specific Function
Catalyzes the condensation of para-aminobenzoate (pABA) with 6-hydroxymethyl-7,8-dihydropterin diphosphate (DHPt-PP) to form 7,8-dihydropteroate (H2Pte), the immediate precursor of folate derivatives.
Gene Name
Uniprot ID
Uniprot Name
Dihydropteroate synthase
Molecular Weight
30614.855 Da
  1. Imming P, Sinning C, Meyer A: Drugs, their targets and the nature and number of drug targets. Nat Rev Drug Discov. 2006 Oct;5(10):821-34. [PubMed:17016423]
  2. Jorgensen JH, Crawford SA, Fiebelkorn KR: Susceptibility of Neisseria meningitidis to 16 antimicrobial agents and characterization of resistance mechanisms affecting some agents. J Clin Microbiol. 2005 Jul;43(7):3162-71. [PubMed:16000430]
  3. Fiebelkorn KR, Crawford SA, Jorgensen JH: Mutations in folP associated with elevated sulfonamide MICs for Neisseria meningitidis clinical isolates from five continents. Antimicrob Agents Chemother. 2005 Feb;49(2):536-40. [PubMed:15673729]
  4. Hong YL, Hossler PA, Calhoun DH, Meshnick SR: Inhibition of recombinant Pneumocystis carinii dihydropteroate synthetase by sulfa drugs. Antimicrob Agents Chemother. 1995 Aug;39(8):1756-63. [PubMed:7486915]


Pharmacological action
Curator comments
Data based on the findings of in vitro studies.
General Function
Steroid hydroxylase activity
Specific Function
Cytochromes P450 are a group of heme-thiolate monooxygenases. In liver microsomes, this enzyme is involved in an NADPH-dependent electron transport pathway. It oxidizes a variety of structurally un...
Gene Name
Uniprot ID
Uniprot Name
Cytochrome P450 2C9
Molecular Weight
55627.365 Da
  1. Komatsu K, Ito K, Nakajima Y, Kanamitsu Si, Imaoka S, Funae Y, Green CE, Tyson CA, Shimada N, Sugiyama Y: Prediction of in vivo drug-drug interactions between tolbutamide and various sulfonamides in humans based on in vitro experiments. Drug Metab Dispos. 2000 Apr;28(4):475-81. [PubMed:10725317]
  2. A Review on Drug Interactions in Oral Hypoglycemic Drugs by Mechanism of Cytochrome P450 Enzyme Inhibition [File]

Drug created on June 13, 2005 07:24 / Updated on February 18, 2019 20:23