
Accession Number
DB00263  (APRD00595)
Small Molecule
Approved, Vet approved

A short-acting sulfonamide antibacterial with activity against a wide range of gram- negative and gram-positive organisms. [PubChem]

  • 3,4-Dimethyl-5-sulfanilamidoisoxazole
  • 3,4-Dimethyl-5-sulfonamidoisoxazole
  • 3,4-Dimethyl-5-sulphanilamidoisoxazole
  • 3,4-Dimethyl-5-sulphonamidoisoxazole
  • 3,4-Dimethylisoxazole-5-sulfanilamide
  • 3,4-Dimethylisoxazole-5-sulphanilamide
  • 4-Amino-N-(3,4-dimethyl-5-isoxazolyl)benzenesulfonamide
  • 4-Amino-N-(3,4-dimethyl-5-isoxazolyl)benzenesulphonamide
  • 5-(4-Aminophenylsulfonamido)-3,4-dimethylisoxazole
  • 5-(p-Aminobenzenesulfonamido)-3,4-dimethylisoxazole
  • 5-(p-Aminobenzenesulphonamido)-3,4-dimethylisoxazole
  • 5-Sulfanilamido-3,4-dimethylisoxazole
  • 5-Sulphanilamido-3,4-dimethyl-isoxazole
  • N'-(3,4)Dimethylisoxazol-5-yl-sulphanilamide
  • N1-(3,4-dimethyl-5-isoxazolyl)sulfanilamide
  • N1-(3,4-dimethyl-5-isoxazolyl)sulphanilamide
  • Sulfadimethylisoxazole
  • Sulfafurazol
  • Sulfafurazole
  • Sulfafurazolum
  • Sulfaisoxazole
  • Sulfasoxazole
  • Sulfisonazole
  • Sulfisoxasole
  • Sulfisoxazol
  • Sulfofurazole
  • Sulphadimethylisoxazole
  • Sulphafurazol
  • Sulphafurazole
  • Sulphaisoxazole
  • Sulphisoxazol
  • Sulphofurazole
Product Ingredients
IngredientUNIICASInChI Key
Sulfisoxazole diolamine30S4B46J8B4299-60-9FEPTXVIRMZIGFY-UHFFFAOYSA-N
Prescription Products
NameDosageStrengthRouteLabellerMarketing StartMarketing End
Apo Sulfisoxazole Tab 500mgTablet500 mgOralApotex Corporation1977-12-31Not applicableCanada
Sulfisoxazole 500mg TabletsTablet500 mgOralLaboratoires Confab IncNot applicableNot applicableCanada
Sulfizole Tab 500mgTablet500 mgOralIcn Pharmaceuticals1963-12-312005-04-26Canada
Generic Prescription Products
NameDosageStrengthRouteLabellerMarketing StartMarketing End
Novo-soxazole 500mgTablet500 mgOralNovopharm Limited1967-12-312005-08-10Canada
Mixture Products
NameIngredientsDosageRouteLabellerMarketing StartMarketing End
PediazoleSulfisoxazole (600 mg) + Erythromycin (200 mg)Powder, for suspensionOralAmdipharm Limited1983-12-312017-07-17Canada
International/Other Brands
Gantrisin (Roche) / Neoxazol
CAS number
Average: 267.304
Monoisotopic: 267.067761987
Chemical Formula
InChI Key



For the treatment of severe, repeated, or long-lasting urinary tract infections, meningococcal meningitis, acute otitis media, trachoma, inclusion conjunctivitis, nocardiosis, chancroid, toxoplasmosis, malaria and other bacterial infections.

Associated Conditions

Sulfisoxazole is a sulfonamide antibiotic. The sulfonamides are synthetic bacteriostatic antibiotics with a wide spectrum against most gram-positive and many gram-negative organisms. However, many strains of an individual species may be resistant. Sulfonamides inhibit multiplication of bacteria by acting as competitive inhibitors of p-aminobenzoic acid in the folic acid metabolism cycle. Bacterial sensitivity is the same for the various sulfonamides, and resistance to one sulfonamide indicates resistance to all. Most sulfonamides are readily absorbed orally. However, parenteral administration is difficult, since the soluble sulfonamide salts are highly alkaline and irritating to the tissues. The sulfonamides are widely distributed throughout all tissues. High levels are achieved in pleural, peritoneal, synovial, and ocular fluids. Although these drugs are no longer used to treat meningitis, CSF levels are high in meningeal infections. Their antibacterial action is inhibited by pus.

Mechanism of action

Sulfisoxazole is a competitive inhibitor of the enzyme dihydropteroate synthetase. It inhibits bacterial synthesis of dihydrofolic acid by preventing the condensation of the pteridine with para-aminobenzoic acid (PABA), a substrate of the enzyme dihydropteroate synthetase. The inhibited reaction is necessary in these organisms for the synthesis of folic acid.

ADihydropteroate synthase
Escherichia coli (strain K12)
Not Available
Volume of distribution
Not Available
Protein binding
Not Available
Not Available
Route of elimination

The mean urinary excretion recovery following oral administration of sulfisoxazole is 97% within 48 hours, of which 52% is intact drug, with the remaining as the N4-acetylated metabolite. It is excreted in human milk.

Half life
Not Available
Not Available

LD50=6800 mg/kg (Orally in mice)

Affected organisms
  • Enteric bacteria and other eubacteria
Not Available
Pharmacogenomic Effects/ADRs
Interacting Gene/EnzymeAllele nameGenotype(s)Defining Change(s)Type(s)DescriptionDetails
Glucose-6-phosphate 1-dehydrogenaseVilleurbanneNot Available1000_1002delACCADR InferredIncreased risk of dose-related hemolysis.Details
Glucose-6-phosphate 1-dehydrogenaseTorunNot Available1006A->GADR InferredIncreased risk of dose-related hemolysis.Details
Glucose-6-phosphate 1-dehydrogenaseSunderlandNot Available105_107delCATADR InferredIncreased risk of dose-related hemolysis.Details
Glucose-6-phosphate 1-dehydrogenaseIwatsukiNot Available1081G->AADR InferredIncreased risk of dose-related hemolysis.Details
Glucose-6-phosphate 1-dehydrogenaseSerresNot Available1082C->TADR InferredIncreased risk of dose-related hemolysis.Details
Glucose-6-phosphate 1-dehydrogenaseTondelaNot Available1084_1101delCTGAACGAGCGCAAGGCCADR InferredIncreased risk of dose-related hemolysis.Details
Glucose-6-phosphate 1-dehydrogenaseLoma LindaNot Available1089C->AADR InferredIncreased risk of dose-related hemolysis.Details
Glucose-6-phosphate 1-dehydrogenaseAachenNot Available1089C->GADR InferredIncreased risk of dose-related hemolysis.Details
Glucose-6-phosphate 1-dehydrogenaseTenriNot Available1096A->GADR InferredIncreased risk of dose-related hemolysis.Details
Glucose-6-phosphate 1-dehydrogenaseMontpellierNot Available1132G>AADR InferredIncreased risk of dose-related hemolysis.Details
Glucose-6-phosphate 1-dehydrogenaseCalvo MackennaNot Available1138A->GADR InferredIncreased risk of dose-related hemolysis.Details
Glucose-6-phosphate 1-dehydrogenaseRileyNot Available1139T->CADR InferredIncreased risk of dose-related hemolysis.Details
Glucose-6-phosphate 1-dehydrogenaseOlomoucNot Available1141T->CADR InferredIncreased risk of dose-related hemolysis.Details
Glucose-6-phosphate 1-dehydrogenaseTomahNot Available1153T->CADR InferredIncreased risk of dose-related hemolysis.Details
Glucose-6-phosphate 1-dehydrogenaseLynwoodNot Available1154G->TADR InferredIncreased risk of dose-related hemolysis.Details
Glucose-6-phosphate 1-dehydrogenaseMadridNot Available1155C->GADR InferredIncreased risk of dose-related hemolysis.Details
Glucose-6-phosphate 1-dehydrogenaseIowa, Walter Reed, SpringfieldNot Available1156A->GADR InferredIncreased risk of dose-related hemolysis.Details
Glucose-6-phosphate 1-dehydrogenaseBeverly Hills, Genova, Iwate, Niigata, YamaguchiNot Available1160G->AADR InferredIncreased risk of dose-related hemolysis.Details
Glucose-6-phosphate 1-dehydrogenaseHartfordNot Available1162A->GADR InferredIncreased risk of dose-related hemolysis.Details
Glucose-6-phosphate 1-dehydrogenasePrahaNot Available1166A->GADR InferredIncreased risk of dose-related hemolysis.Details
Glucose-6-phosphate 1-dehydrogenaseKrakowNot Available1175T>CADR InferredIncreased risk of dose-related hemolysis.Details
Glucose-6-phosphate 1-dehydrogenaseWisconsinNot Available1177C->GADR InferredIncreased risk of dose-related hemolysis.Details
Glucose-6-phosphate 1-dehydrogenaseNashville, Anaheim, PorticiNot Available1178G->AADR InferredIncreased risk of dose-related hemolysis.Details
Glucose-6-phosphate 1-dehydrogenaseAlhambraNot Available1180G->CADR InferredIncreased risk of dose-related hemolysis.Details
Glucose-6-phosphate 1-dehydrogenaseBariNot Available1187C->TADR InferredIncreased risk of dose-related hemolysis.Details
Glucose-6-phosphate 1-dehydrogenasePuerto LimonNot Available1192G->AADR InferredIncreased risk of dose-related hemolysis.Details
Glucose-6-phosphate 1-dehydrogenaseCovao do LoboNot Available1205C>AADR InferredIncreased risk of dose-related hemolysis.Details
Glucose-6-phosphate 1-dehydrogenaseClinicNot Available1215G->AADR InferredIncreased risk of dose-related hemolysis.Details
Glucose-6-phosphate 1-dehydrogenaseUtrechtNot Available1225C->TADR InferredIncreased risk of dose-related hemolysis.Details
Glucose-6-phosphate 1-dehydrogenaseSuwalkiNot Available1226C->GADR InferredIncreased risk of dose-related hemolysis.Details
Glucose-6-phosphate 1-dehydrogenaseRiversideNot Available1228G->TADR InferredIncreased risk of dose-related hemolysis.Details
Glucose-6-phosphate 1-dehydrogenaseJapan, ShinagawaNot Available1229G->AADR InferredIncreased risk of dose-related hemolysis.Details
Glucose-6-phosphate 1-dehydrogenaseKawasakiNot Available1229G->CADR InferredIncreased risk of dose-related hemolysis.Details
Glucose-6-phosphate 1-dehydrogenaseMunichNot Available1231A->GADR InferredIncreased risk of dose-related hemolysis.Details
Glucose-6-phosphate 1-dehydrogenaseGeorgiaNot Available1284C->AADR InferredIncreased risk of dose-related hemolysis.Details
Glucose-6-phosphate 1-dehydrogenaseSumareNot Available1292T->GADR InferredIncreased risk of dose-related hemolysis.Details
Glucose-6-phosphate 1-dehydrogenaseTelti/KobeNot Available1318C->TADR InferredIncreased risk of dose-related hemolysis.Details
Glucose-6-phosphate 1-dehydrogenaseSantiago de Cuba, MoriokaNot Available1339G->AADR InferredIncreased risk of dose-related hemolysis.Details
Glucose-6-phosphate 1-dehydrogenaseHarimaNot Available1358T->AADR InferredIncreased risk of dose-related hemolysis.Details
Glucose-6-phosphate 1-dehydrogenaseFiguera da FozNot Available1366G->CADR InferredIncreased risk of dose-related hemolysis.Details
Glucose-6-phosphate 1-dehydrogenaseAmiensNot Available1367A>TADR InferredIncreased risk of dose-related hemolysis.Details
Glucose-6-phosphate 1-dehydrogenaseBangkok NoiNot Available1376G->T, 1502T->GADR InferredIncreased risk of dose-related hemolysis.Details
Glucose-6-phosphate 1-dehydrogenaseFukayaNot Available1462G->AADR InferredIncreased risk of dose-related hemolysis.Details
Glucose-6-phosphate 1-dehydrogenaseCampinasNot Available1463G->TADR InferredIncreased risk of dose-related hemolysis.Details
Glucose-6-phosphate 1-dehydrogenaseBuenos AiresNot Available1465C>TADR InferredIncreased risk of dose-related hemolysis.Details
Glucose-6-phosphate 1-dehydrogenaseArakawaNot Available1466C->TADR InferredIncreased risk of dose-related hemolysis.Details
Glucose-6-phosphate 1-dehydrogenaseBrightonNot Available1488_1490delGAAADR InferredIncreased risk of dose-related hemolysis.Details
Glucose-6-phosphate 1-dehydrogenaseKozukataNot Available159G->CADR InferredIncreased risk of dose-related hemolysis.Details
Glucose-6-phosphate 1-dehydrogenaseAmsterdamNot Available180_182delTCTADR InferredIncreased risk of dose-related hemolysis.Details
Glucose-6-phosphate 1-dehydrogenaseNo nameNot Available202G->A, 376A->G, 1264C>GADR InferredIncreased risk of dose-related hemolysis.Details
Glucose-6-phosphate 1-dehydrogenaseSwanseaNot Available224T->CADR InferredIncreased risk of dose-related hemolysis.Details
Glucose-6-phosphate 1-dehydrogenaseUrayasuNot Available281_283delAGAADR InferredIncreased risk of dose-related hemolysis.Details
Glucose-6-phosphate 1-dehydrogenaseVancouverNot Available317C->G544C->T592C->TADR InferredIncreased risk of dose-related hemolysis.Details
Glucose-6-phosphate 1-dehydrogenaseMt SinaiNot Available376A->G, 1159C->TADR InferredIncreased risk of dose-related hemolysis.Details
Glucose-6-phosphate 1-dehydrogenasePlymouthNot Available488G->AADR InferredIncreased risk of dose-related hemolysis.Details
Glucose-6-phosphate 1-dehydrogenaseVolendamNot Available514C->TADR InferredIncreased risk of dose-related hemolysis.Details
Glucose-6-phosphate 1-dehydrogenaseShinshuNot Available527A->GADR InferredIncreased risk of dose-related hemolysis.Details
Glucose-6-phosphate 1-dehydrogenaseChikugoNot Available535A->TADR InferredIncreased risk of dose-related hemolysis.Details
Glucose-6-phosphate 1-dehydrogenaseTsukuiNot Available561_563delCTCADR InferredIncreased risk of dose-related hemolysis.Details
Glucose-6-phosphate 1-dehydrogenasePedoplis-CkaroNot Available573C>GADR InferredIncreased risk of dose-related hemolysis.Details
Glucose-6-phosphate 1-dehydrogenaseSantiagoNot Available593G->CADR InferredIncreased risk of dose-related hemolysis.Details
Glucose-6-phosphate 1-dehydrogenaseMinnesota, Marion, Gastonia, LeJeuneNot Available637G->TADR InferredIncreased risk of dose-related hemolysis.Details
Glucose-6-phosphate 1-dehydrogenaseCincinnatiNot Available637G->T, 1037A->TADR InferredIncreased risk of dose-related hemolysis.Details
Glucose-6-phosphate 1-dehydrogenaseHarilaouNot Available648T->GADR InferredIncreased risk of dose-related hemolysis.Details
Glucose-6-phosphate 1-dehydrogenaseNorth DallasNot Available683_685delACAADR InferredIncreased risk of dose-related hemolysis.Details
Glucose-6-phosphate 1-dehydrogenaseAsahikawaNot Available695G->AADR InferredIncreased risk of dose-related hemolysis.Details
Glucose-6-phosphate 1-dehydrogenaseDurhamNot Available713A->GADR InferredIncreased risk of dose-related hemolysis.Details
Glucose-6-phosphate 1-dehydrogenaseStonybrookNot Available724_729delGGCACTADR InferredIncreased risk of dose-related hemolysis.Details
Glucose-6-phosphate 1-dehydrogenaseWayneNot Available769C->GADR InferredIncreased risk of dose-related hemolysis.Details
Glucose-6-phosphate 1-dehydrogenaseAveiroNot Available806G->AADR InferredIncreased risk of dose-related hemolysis.Details
Glucose-6-phosphate 1-dehydrogenaseCleveland CorumNot Available820G->AADR InferredIncreased risk of dose-related hemolysis.Details
Glucose-6-phosphate 1-dehydrogenaseLilleNot Available821A>TADR InferredIncreased risk of dose-related hemolysis.Details
Glucose-6-phosphate 1-dehydrogenaseBangkokNot Available825G>CADR InferredIncreased risk of dose-related hemolysis.Details
Glucose-6-phosphate 1-dehydrogenaseSugaoNot Available826C->TADR InferredIncreased risk of dose-related hemolysis.Details
Glucose-6-phosphate 1-dehydrogenaseLa JollaNot Available832T->CADR InferredIncreased risk of dose-related hemolysis.Details
Glucose-6-phosphate 1-dehydrogenaseWexhamNot Available833C->TADR InferredIncreased risk of dose-related hemolysis.Details
Glucose-6-phosphate 1-dehydrogenasePiotrkowNot Available851T>CADR InferredIncreased risk of dose-related hemolysis.Details
Glucose-6-phosphate 1-dehydrogenaseWest VirginiaNot Available910G->TADR InferredIncreased risk of dose-related hemolysis.Details
Glucose-6-phosphate 1-dehydrogenaseOmiyaNot Available921G->CADR InferredIncreased risk of dose-related hemolysis.Details
Glucose-6-phosphate 1-dehydrogenaseNaraNot Available953_976delCCACCAAAGGGTACCTGGAC GACCADR InferredIncreased risk of dose-related hemolysis.Details
Glucose-6-phosphate 1-dehydrogenaseManhattanNot Available962G->AADR InferredIncreased risk of dose-related hemolysis.Details
Glucose-6-phosphate 1-dehydrogenaseRehevotNot Available964T->CADR InferredIncreased risk of dose-related hemolysis.Details
Glucose-6-phosphate 1-dehydrogenaseHoniaraNot Available99A->G / 1360C->TADR InferredIncreased risk of dose-related hemolysis.Details
Glucose-6-phosphate 1-dehydrogenaseTokyo, FukushimaNot Available1246G->AADR InferredIncreased risk of dose-related hemolysis.Details
Glucose-6-phosphate 1-dehydrogenaseChathamNot Available1003G->AADR InferredIncreased risk of dose-related hemolysis.Details
Glucose-6-phosphate 1-dehydrogenaseFushanNot Available1004C->AADR InferredIncreased risk of dose-related hemolysis.Details
Glucose-6-phosphate 1-dehydrogenasePartenopeNot Available1052G->TADR InferredIncreased risk of dose-related hemolysis.Details
Glucose-6-phosphate 1-dehydrogenaseIerapetraNot Available1057C->TADR InferredIncreased risk of dose-related hemolysis.Details
Glucose-6-phosphate 1-dehydrogenaseAnadiaNot Available1193A->GADR InferredIncreased risk of dose-related hemolysis.Details
Glucose-6-phosphate 1-dehydrogenaseAbenoNot Available1220A->CADR InferredIncreased risk of dose-related hemolysis.Details
Glucose-6-phosphate 1-dehydrogenaseSurabayaNot Available1291G->AADR InferredIncreased risk of dose-related hemolysis.Details
Glucose-6-phosphate 1-dehydrogenasePawneeNot Available1316G->CADR InferredIncreased risk of dose-related hemolysis.Details
Glucose-6-phosphate 1-dehydrogenaseS. AntiocoNot Available1342A->GADR InferredIncreased risk of dose-related hemolysis.Details
Glucose-6-phosphate 1-dehydrogenaseCassanoNot Available1347G->CADR InferredIncreased risk of dose-related hemolysis.Details
Glucose-6-phosphate 1-dehydrogenaseHermoupolisNot Available1347G->C / 1360C->TADR InferredIncreased risk of dose-related hemolysis.Details
Glucose-6-phosphate 1-dehydrogenaseUnion,Maewo, Chinese-2, KaloNot Available1360C->TADR InferredIncreased risk of dose-related hemolysis.Details
Glucose-6-phosphate 1-dehydrogenaseAndalusNot Available1361G->AADR InferredIncreased risk of dose-related hemolysis.Details
Glucose-6-phosphate 1-dehydrogenaseCosenzaNot Available1376G->CADR InferredIncreased risk of dose-related hemolysis.Details
Glucose-6-phosphate 1-dehydrogenaseCanton, Taiwan- Hakka, Gifu-like, Agrigento-likeNot Available1376G->TADR InferredIncreased risk of dose-related hemolysis.Details
Glucose-6-phosphate 1-dehydrogenaseFloresNot Available1387C->AADR InferredIncreased risk of dose-related hemolysis.Details
Glucose-6-phosphate 1-dehydrogenaseKaiping, Anant, Dhon, Sapporo-like, WoseraNot Available1388G->AADR InferredIncreased risk of dose-related hemolysis.Details
Glucose-6-phosphate 1-dehydrogenaseKamogawaNot Available169C->TADR InferredIncreased risk of dose-related hemolysis.Details
Glucose-6-phosphate 1-dehydrogenaseCostanzoNot Available179T>CADR InferredIncreased risk of dose-related hemolysis.Details
Glucose-6-phosphate 1-dehydrogenaseAmazoniaNot Available185C->AADR InferredIncreased risk of dose-related hemolysis.Details
Glucose-6-phosphate 1-dehydrogenaseSongklanagarindNot Available196T->AADR InferredIncreased risk of dose-related hemolysis.Details
Glucose-6-phosphate 1-dehydrogenaseHechiNot Available202G->A / 871G->AADR InferredIncreased risk of dose-related hemolysis.Details
Glucose-6-phosphate 1-dehydrogenaseNamouruNot Available208T->CADR InferredIncreased risk of dose-related hemolysis.Details
Glucose-6-phosphate 1-dehydrogenaseBao LocNot Available352T>CADR InferredIncreased risk of dose-related hemolysis.Details
Glucose-6-phosphate 1-dehydrogenaseCrispimNot Available375G->T, 379G->T383T->C384C>TADR InferredIncreased risk of dose-related hemolysis.Details
Glucose-6-phosphate 1-dehydrogenaseAcrokorinthosNot Available376A->G / 463C->GADR InferredIncreased risk of dose-related hemolysis.Details
Glucose-6-phosphate 1-dehydrogenaseSanta MariaNot Available376A->G / 542A->TADR InferredIncreased risk of dose-related hemolysis.Details
Glucose-6-phosphate 1-dehydrogenaseAnanindeuaNot Available376A->G / 871G->AADR InferredIncreased risk of dose-related hemolysis.Details
Glucose-6-phosphate 1-dehydrogenaseVanua LavaNot Available383T->CADR InferredIncreased risk of dose-related hemolysis.Details
Glucose-6-phosphate 1-dehydrogenaseValladolidNot Available406C->TADR InferredIncreased risk of dose-related hemolysis.Details
Glucose-6-phosphate 1-dehydrogenaseBelemNot Available409C->TADR InferredIncreased risk of dose-related hemolysis.Details
Glucose-6-phosphate 1-dehydrogenaseLiuzhouNot Available442G->AADR InferredIncreased risk of dose-related hemolysis.Details
Glucose-6-phosphate 1-dehydrogenaseShenzenNot Available473G>AADR InferredIncreased risk of dose-related hemolysis.Details
Glucose-6-phosphate 1-dehydrogenaseTaipei “Chinese- 3”Not Available493A->GADR InferredIncreased risk of dose-related hemolysis.Details
Glucose-6-phosphate 1-dehydrogenaseToledoNot Available496C>TADR InferredIncreased risk of dose-related hemolysis.Details
Glucose-6-phosphate 1-dehydrogenaseNaoneNot Available497G->AADR InferredIncreased risk of dose-related hemolysis.Details
Glucose-6-phosphate 1-dehydrogenaseNankangNot Available517T->CADR InferredIncreased risk of dose-related hemolysis.Details
Glucose-6-phosphate 1-dehydrogenaseMiaoliNot Available519C->GADR InferredIncreased risk of dose-related hemolysis.Details
Glucose-6-phosphate 1-dehydrogenaseMediterranean, Dallas, Panama‚ Sassari, Cagliari, BirminghamNot Available563C->TADR InferredIncreased risk of dose-related hemolysis.Details
Glucose-6-phosphate 1-dehydrogenaseCoimbra ShundeNot Available592C->TADR InferredIncreased risk of dose-related hemolysis.Details
Glucose-6-phosphate 1-dehydrogenaseNilgiriNot Available593G>AADR InferredIncreased risk of dose-related hemolysis.Details
Glucose-6-phosphate 1-dehydrogenaseRadlowoNot Available679C->TADR InferredIncreased risk of dose-related hemolysis.Details
Glucose-6-phosphate 1-dehydrogenaseRoubaixNot Available811G>CADR InferredIncreased risk of dose-related hemolysis.Details
Glucose-6-phosphate 1-dehydrogenaseHaikouNot Available835A->GADR InferredIncreased risk of dose-related hemolysis.Details
Glucose-6-phosphate 1-dehydrogenaseChinese-1Not Available835A->TADR InferredIncreased risk of dose-related hemolysis.Details
Glucose-6-phosphate 1-dehydrogenaseMizushimaNot Available848A>GADR InferredIncreased risk of dose-related hemolysis.Details
Glucose-6-phosphate 1-dehydrogenaseOsakaNot Available853C->TADR InferredIncreased risk of dose-related hemolysis.Details
Glucose-6-phosphate 1-dehydrogenaseViangchan, JammuNot Available871G->AADR InferredIncreased risk of dose-related hemolysis.Details
Glucose-6-phosphate 1-dehydrogenaseSeoulNot Available916G->AADR InferredIncreased risk of dose-related hemolysis.Details
Glucose-6-phosphate 1-dehydrogenaseLudhianaNot Available929G->AADR InferredIncreased risk of dose-related hemolysis.Details
Glucose-6-phosphate 1-dehydrogenaseFarroupilhaNot Available977C->AADR InferredIncreased risk of dose-related hemolysis.Details
Glucose-6-phosphate 1-dehydrogenaseChinese-5Not Available1024C->TADR InferredIncreased risk of dose-related hemolysis.Details
Glucose-6-phosphate 1-dehydrogenaseRignanoNot Available130G>AADR InferredIncreased risk of dose-related hemolysis.Details
Glucose-6-phosphate 1-dehydrogenaseOrissaNot Available131C->GADR InferredIncreased risk of dose-related hemolysis.Details
Glucose-6-phosphate 1-dehydrogenaseG6PDNiceNot Available1380G>CADR InferredIncreased risk of dose-related hemolysis.Details
Glucose-6-phosphate 1-dehydrogenaseKamiube, KeelungNot Available1387C->TADR InferredIncreased risk of dose-related hemolysis.Details
Glucose-6-phosphate 1-dehydrogenaseNeapolisNot Available1400C->GADR InferredIncreased risk of dose-related hemolysis.Details
Glucose-6-phosphate 1-dehydrogenaseAuresNot Available143T->CADR InferredIncreased risk of dose-related hemolysis.Details
Glucose-6-phosphate 1-dehydrogenaseSplitNot Available1442C->GADR InferredIncreased risk of dose-related hemolysis.Details
Glucose-6-phosphate 1-dehydrogenaseKambosNot Available148C->TADR InferredIncreased risk of dose-related hemolysis.Details
Glucose-6-phosphate 1-dehydrogenasePalestrinaNot Available170G>AADR InferredIncreased risk of dose-related hemolysis.Details
Glucose-6-phosphate 1-dehydrogenaseMetapontoNot Available172G->AADR InferredIncreased risk of dose-related hemolysis.Details
Glucose-6-phosphate 1-dehydrogenaseMusashinoNot Available185C->TADR InferredIncreased risk of dose-related hemolysis.Details
Glucose-6-phosphate 1-dehydrogenaseAsahiNot Available202G->AADR InferredIncreased risk of dose-related hemolysis.Details
Glucose-6-phosphate 1-dehydrogenaseA- (202), Ferrara INot Available202G->A / 376A->GADR InferredIncreased risk of dose-related hemolysis.Details
Glucose-6-phosphate 1-dehydrogenaseMurcia OristanoNot Available209A->GADR InferredIncreased risk of dose-related hemolysis.Details
Glucose-6-phosphate 1-dehydrogenaseUbe KonanNot Available241C->TADR InferredIncreased risk of dose-related hemolysis.Details
Glucose-6-phosphate 1-dehydrogenaseLagosantoNot Available242G->AADR InferredIncreased risk of dose-related hemolysis.Details
Glucose-6-phosphate 1-dehydrogenaseGuangzhouNot Available274C->TADR InferredIncreased risk of dose-related hemolysis.Details
Glucose-6-phosphate 1-dehydrogenaseHammersmithNot Available323T->AADR InferredIncreased risk of dose-related hemolysis.Details
Glucose-6-phosphate 1-dehydrogenaseSinnaiNot Available34G->TADR InferredIncreased risk of dose-related hemolysis.Details
Glucose-6-phosphate 1-dehydrogenaseA- (680)Not Available376A->G / 680G->TADR InferredIncreased risk of dose-related hemolysis.Details
Glucose-6-phosphate 1-dehydrogenaseA- (968), Betica,Selma, GuantanamoNot Available376A->G / 968T->CADR InferredIncreased risk of dose-related hemolysis.Details
Glucose-6-phosphate 1-dehydrogenaseSalerno PyrgosNot Available383T>GADR InferredIncreased risk of dose-related hemolysis.Details
Glucose-6-phosphate 1-dehydrogenaseQuing YanNot Available392G->TADR InferredIncreased risk of dose-related hemolysis.Details
Glucose-6-phosphate 1-dehydrogenaseLagesNot Available40G->AADR InferredIncreased risk of dose-related hemolysis.Details
Glucose-6-phosphate 1-dehydrogenaseIleshaNot Available466G->AADR InferredIncreased risk of dose-related hemolysis.Details
Glucose-6-phosphate 1-dehydrogenaseMahidolNot Available487G->AADR InferredIncreased risk of dose-related hemolysis.Details
Glucose-6-phosphate 1-dehydrogenaseMalagaNot Available542A->TADR InferredIncreased risk of dose-related hemolysis.Details
Glucose-6-phosphate 1-dehydrogenaseSibariNot Available634A->GADR InferredIncreased risk of dose-related hemolysis.Details
Glucose-6-phosphate 1-dehydrogenaseMexico CityNot Available680G->AADR InferredIncreased risk of dose-related hemolysis.Details
Glucose-6-phosphate 1-dehydrogenaseNanningNot Available703C->TADR InferredIncreased risk of dose-related hemolysis.Details
Glucose-6-phosphate 1-dehydrogenaseSeattle, Lodi, Modena, Ferrara II, Athens-likeNot Available844G->CADR InferredIncreased risk of dose-related hemolysis.Details
Glucose-6-phosphate 1-dehydrogenaseBajo MaumereNot Available844G->TADR InferredIncreased risk of dose-related hemolysis.Details
Glucose-6-phosphate 1-dehydrogenaseMontalbanoNot Available854G->AADR InferredIncreased risk of dose-related hemolysis.Details
Glucose-6-phosphate 1-dehydrogenaseKalyan-Kerala, Jamnaga, RohiniNot Available949G->AADR InferredIncreased risk of dose-related hemolysis.Details
Glucose-6-phosphate 1-dehydrogenaseGaoheNot Available95A->GADR InferredIncreased risk of dose-related hemolysis.Details


Drug Interactions
DrugInteractionDrug group
(1S,6R)-3-{[3-(TRIFLUOROMETHYL)-5,6-DIHYDRO[1,2,4]TRIAZOLO[4,3-A]PYRAZIN-7(8H)-YL]CARBONYL}-6-(2,4,5-TRIFLUOROPHENYL)CYCLOHEX-3-EN-1-AMINE(1S,6R)-3-{[3-(TRIFLUOROMETHYL)-5,6-DIHYDRO[1,2,4]TRIAZOLO[4,3-A]PYRAZIN-7(8H)-YL]CARBONYL}-6-(2,4,5-TRIFLUOROPHENYL)CYCLOHEX-3-EN-1-AMINE may increase the hypoglycemic activities of Sulfisoxazole.Experimental
2,4-thiazolidinedione2,4-thiazolidinedione may increase the hypoglycemic activities of Sulfisoxazole.Investigational
7,8-Dichloro-1,2,3,4-tetrahydroisoquinoline7,8-Dichloro-1,2,3,4-tetrahydroisoquinoline may increase the hypoglycemic activities of Sulfisoxazole.Experimental
AbemaciclibThe metabolism of Abemaciclib can be decreased when combined with Sulfisoxazole.Approved, Investigational
AbirateroneThe metabolism of Abiraterone can be decreased when combined with Sulfisoxazole.Approved
AcarboseThe therapeutic efficacy of Acarbose can be increased when used in combination with Sulfisoxazole.Approved, Investigational
AceclofenacThe metabolism of Aceclofenac can be decreased when combined with Sulfisoxazole.Approved, Investigational
AcenocoumarolThe metabolism of Acenocoumarol can be decreased when combined with Sulfisoxazole.Approved, Investigational
AcetohexamideAcetohexamide may increase the hypoglycemic activities of Sulfisoxazole.Approved, Investigational, Withdrawn
Acetyl sulfisoxazoleThe metabolism of Acetyl sulfisoxazole can be decreased when combined with Sulfisoxazole.Approved, Vet Approved
Acetylsalicylic acidThe metabolism of Acetylsalicylic acid can be decreased when combined with Sulfisoxazole.Approved, Vet Approved
AdinazolamThe metabolism of Adinazolam can be decreased when combined with Sulfisoxazole.Approved
AICA ribonucleotideAICA ribonucleotide may increase the hypoglycemic activities of Sulfisoxazole.Experimental, Investigational
AlaproclateAlaproclate may increase the hypoglycemic activities of Sulfisoxazole.Experimental
AlbendazoleThe metabolism of Albendazole can be decreased when combined with Sulfisoxazole.Approved, Vet Approved
AlclometasoneThe metabolism of Alclometasone can be decreased when combined with Sulfisoxazole.Approved
AlfentanilThe metabolism of Alfentanil can be decreased when combined with Sulfisoxazole.Approved, Illicit
AlfuzosinThe metabolism of Alfuzosin can be decreased when combined with Sulfisoxazole.Approved, Investigational
AliskirenThe metabolism of Aliskiren can be decreased when combined with Sulfisoxazole.Approved, Investigational
AllicinAllicin may increase the hypoglycemic activities of Sulfisoxazole.Investigational
AllylestrenolThe metabolism of Allylestrenol can be decreased when combined with Sulfisoxazole.Approved
AlmotriptanThe metabolism of Almotriptan can be decreased when combined with Sulfisoxazole.Approved, Investigational
AlogliptinThe metabolism of Alogliptin can be decreased when combined with Sulfisoxazole.Approved
AlosetronThe metabolism of Alosetron can be decreased when combined with Sulfisoxazole.Approved, Withdrawn
AloxiprinAloxiprin may increase the hypoglycemic activities of Sulfisoxazole.Experimental
alpha-Tocopherol acetateThe metabolism of alpha-Tocopherol acetate can be decreased when combined with Sulfisoxazole.Approved
AlprazolamThe metabolism of Alprazolam can be decreased when combined with Sulfisoxazole.Approved, Illicit, Investigational
AmantadineAmantadine may increase the QTc-prolonging activities of Sulfisoxazole.Approved
AmbrisentanThe metabolism of Ambrisentan can be decreased when combined with Sulfisoxazole.Approved, Investigational
AmbroxolThe metabolism of Ambroxol can be decreased when combined with Sulfisoxazole.Approved, Investigational
AminophenazoneThe metabolism of Aminophenazone can be decreased when combined with Sulfisoxazole.Approved, Withdrawn
AminophyllineThe metabolism of Aminophylline can be decreased when combined with Sulfisoxazole.Approved
Aminosalicylic AcidAminosalicylic Acid may increase the hypoglycemic activities of Sulfisoxazole.Approved
AmiodaroneThe risk or severity of QTc prolongation can be increased when Sulfisoxazole is combined with Amiodarone.Approved, Investigational
AmitriptylineThe metabolism of Amitriptyline can be decreased when combined with Sulfisoxazole.Approved
AmoxapineAmoxapine may increase the QTc-prolonging activities of Sulfisoxazole.Approved
AmphetamineAmphetamine may increase the hypoglycemic activities of Sulfisoxazole.Approved, Illicit, Investigational
AmprenavirThe metabolism of Amprenavir can be decreased when combined with Sulfisoxazole.Approved, Investigational
AnagrelideSulfisoxazole may increase the QTc-prolonging activities of Anagrelide.Approved
AntipyrineThe metabolism of Antipyrine can be decreased when combined with Sulfisoxazole.Approved, Investigational
ApalutamideThe serum concentration of Sulfisoxazole can be decreased when it is combined with Apalutamide.Approved, Investigational
ApixabanThe serum concentration of Apixaban can be increased when it is combined with Sulfisoxazole.Approved
ApomorphineApomorphine may increase the QTc-prolonging activities of Sulfisoxazole.Approved, Investigational
ApremilastThe metabolism of Apremilast can be decreased when combined with Sulfisoxazole.Approved, Investigational
AprepitantThe metabolism of Sulfisoxazole can be increased when combined with Aprepitant.Approved, Investigational
Arachidonic AcidThe metabolism of Arachidonic Acid can be decreased when combined with Sulfisoxazole.Experimental
ArformoterolThe metabolism of Arformoterol can be decreased when combined with Sulfisoxazole.Approved, Investigational
ArgatrobanThe metabolism of Argatroban can be decreased when combined with Sulfisoxazole.Approved, Investigational
AripiprazoleThe serum concentration of Aripiprazole can be increased when it is combined with Sulfisoxazole.Approved, Investigational
Arsenic trioxideSulfisoxazole may increase the QTc-prolonging activities of Arsenic trioxide.Approved, Investigational
ArtemetherSulfisoxazole may increase the QTc-prolonging activities of Artemether.Approved
AsenapineSulfisoxazole may increase the QTc-prolonging activities of Asenapine.Approved
AstemizoleThe metabolism of Astemizole can be decreased when combined with Sulfisoxazole.Approved, Withdrawn
AsunaprevirThe serum concentration of Asunaprevir can be increased when it is combined with Sulfisoxazole.Approved, Investigational, Withdrawn
AtazanavirThe metabolism of Atazanavir can be decreased when combined with Sulfisoxazole.Approved, Investigational
AtomoxetineAtomoxetine may increase the QTc-prolonging activities of Sulfisoxazole.Approved
AtorvastatinThe risk or severity of adverse effects can be increased when Sulfisoxazole is combined with Atorvastatin.Approved
AvanafilThe serum concentration of Avanafil can be increased when it is combined with Sulfisoxazole.Approved
AvatrombopagThe metabolism of Avatrombopag can be decreased when combined with Sulfisoxazole.Approved, Investigational
AxitinibThe metabolism of Axitinib can be decreased when combined with Sulfisoxazole.Approved, Investigational
AzelastineThe metabolism of Azelastine can be decreased when combined with Sulfisoxazole.Approved
AzithromycinAzithromycin may increase the QTc-prolonging activities of Sulfisoxazole.Approved
BalaglitazoneBalaglitazone may increase the hypoglycemic activities of Sulfisoxazole.Investigational
BalsalazideBalsalazide may increase the hypoglycemic activities of Sulfisoxazole.Approved, Investigational
BanoxantroneThe metabolism of Banoxantrone can be decreased when combined with Sulfisoxazole.Investigational
BaricitinibThe metabolism of Baricitinib can be decreased when combined with Sulfisoxazole.Approved, Investigational
BedaquilineSulfisoxazole may increase the QTc-prolonging activities of Bedaquiline.Approved
Bempedoic acidBempedoic acid may increase the hypoglycemic activities of Sulfisoxazole.Investigational
BenmoxinBenmoxin may increase the hypoglycemic activities of Sulfisoxazole.Withdrawn
BenzatropineThe risk or severity of QTc prolongation can be increased when Benzatropine is combined with Sulfisoxazole.Approved
BepridilThe risk or severity of QTc prolongation can be increased when Sulfisoxazole is combined with Bepridil.Approved, Withdrawn
BexaroteneThe metabolism of Bexarotene can be decreased when combined with Sulfisoxazole.Approved, Investigational
BezafibrateThe metabolism of Bezafibrate can be decreased when combined with Sulfisoxazole.Approved, Investigational
BicalutamideThe metabolism of Bicalutamide can be decreased when combined with Sulfisoxazole.Approved
BictegravirThe metabolism of Bictegravir can be decreased when combined with Sulfisoxazole.Approved, Investigational
BisoprololThe metabolism of Bisoprolol can be decreased when combined with Sulfisoxazole.Approved
BlonanserinThe metabolism of Blonanserin can be decreased when combined with Sulfisoxazole.Approved, Investigational
BoceprevirThe metabolism of Boceprevir can be decreased when combined with Sulfisoxazole.Approved, Withdrawn
BortezomibThe metabolism of Bortezomib can be decreased when combined with Sulfisoxazole.Approved, Investigational
BosentanThe serum concentration of Bosentan can be increased when it is combined with Sulfisoxazole.Approved, Investigational
BosutinibThe serum concentration of Bosutinib can be increased when it is combined with Sulfisoxazole.Approved
Botulinum Toxin Type BThe risk or severity of adverse effects can be increased when Sulfisoxazole is combined with Botulinum Toxin Type B.Approved, Investigational
Brentuximab vedotinThe metabolism of Brentuximab vedotin can be decreased when combined with Sulfisoxazole.Approved, Investigational
BrexpiprazoleThe serum concentration of Brexpiprazole can be increased when it is combined with Sulfisoxazole.Approved, Investigational
BrigatinibThe metabolism of Brigatinib can be decreased when combined with Sulfisoxazole.Approved, Investigational
BrinzolamideThe metabolism of Brinzolamide can be decreased when combined with Sulfisoxazole.Approved
BrivaracetamThe metabolism of Brivaracetam can be decreased when combined with Sulfisoxazole.Approved, Investigational
BrofaromineBrofaromine may increase the hypoglycemic activities of Sulfisoxazole.Experimental
BromazepamThe metabolism of Bromazepam can be decreased when combined with Sulfisoxazole.Approved, Illicit, Investigational
BromocriptineThe risk or severity of adverse effects can be increased when Bromocriptine is combined with Sulfisoxazole.Approved, Investigational
BrompheniramineThe risk or severity of QTc prolongation can be increased when Brompheniramine is combined with Sulfisoxazole.Approved
BuforminBuformin may increase the hypoglycemic activities of Sulfisoxazole.Investigational, Withdrawn
BupivacaineThe metabolism of Bupivacaine can be decreased when combined with Sulfisoxazole.Approved, Investigational
BuprenorphineThe metabolism of Buprenorphine can be decreased when combined with Sulfisoxazole.Approved, Illicit, Investigational, Vet Approved
BuserelinBuserelin may increase the QTc-prolonging activities of Sulfisoxazole.Approved, Investigational
BuspironeThe metabolism of Buspirone can be decreased when combined with Sulfisoxazole.Approved, Investigational
BusulfanThe metabolism of Busulfan can be decreased when combined with Sulfisoxazole.Approved, Investigational
CabazitaxelThe metabolism of Cabazitaxel can be decreased when combined with Sulfisoxazole.Approved
CabergolineThe risk or severity of adverse effects can be increased when Cabergoline is combined with Sulfisoxazole.Approved
CabozantinibThe metabolism of Cabozantinib can be decreased when combined with Sulfisoxazole.Approved, Investigational
CalcitriolThe metabolism of Calcitriol can be decreased when combined with Sulfisoxazole.Approved, Nutraceutical
CanagliflozinThe metabolism of Canagliflozin can be decreased when combined with Sulfisoxazole.Approved
CandesartanThe metabolism of Candesartan can be decreased when combined with Sulfisoxazole.Experimental
Candesartan cilexetilThe metabolism of Candesartan cilexetil can be decreased when combined with Sulfisoxazole.Approved
CannabidiolThe metabolism of Cannabidiol can be decreased when combined with Sulfisoxazole.Approved, Investigational
CapecitabineThe metabolism of Sulfisoxazole can be decreased when combined with Capecitabine.Approved, Investigational
Carbaspirin calciumCarbaspirin calcium may increase the hypoglycemic activities of Sulfisoxazole.Experimental, Investigational
CarbinoxamineThe metabolism of Carbinoxamine can be decreased when combined with Sulfisoxazole.Approved
CarbutamideCarbutamide may increase the hypoglycemic activities of Sulfisoxazole.Experimental
CariprazineThe metabolism of Cariprazine can be decreased when combined with Sulfisoxazole.Approved, Investigational
CaroxazoneCaroxazone may increase the hypoglycemic activities of Sulfisoxazole.Withdrawn
CastanospermineCastanospermine may increase the hypoglycemic activities of Sulfisoxazole.Experimental
CelecoxibThe metabolism of Celecoxib can be decreased when combined with Sulfisoxazole.Approved, Investigational
CeliprololThe metabolism of Celiprolol can be decreased when combined with Sulfisoxazole.Approved, Investigational
CephalexinThe metabolism of Cephalexin can be decreased when combined with Sulfisoxazole.Approved, Investigational, Vet Approved
CeritinibThe serum concentration of Sulfisoxazole can be increased when it is combined with Ceritinib.Approved
CerivastatinThe serum concentration of Cerivastatin can be increased when it is combined with Sulfisoxazole.Approved, Withdrawn
CetirizineThe risk or severity of QTc prolongation can be increased when Cetirizine is combined with Sulfisoxazole.Approved
CevimelineThe metabolism of Cevimeline can be decreased when combined with Sulfisoxazole.Approved
Chenodeoxycholic acidThe metabolism of Chenodeoxycholic acid can be decreased when combined with Sulfisoxazole.Approved
ChlordiazepoxideThe metabolism of Chlordiazepoxide can be decreased when combined with Sulfisoxazole.Approved, Illicit, Investigational
ChloroquineSulfisoxazole may increase the QTc-prolonging activities of Chloroquine.Approved, Investigational, Vet Approved
ChlorphenamineThe risk or severity of QTc prolongation can be increased when Sulfisoxazole is combined with Chlorphenamine.Approved
ChlorpromazineSulfisoxazole may increase the QTc-prolonging activities of Chlorpromazine.Approved, Investigational, Vet Approved
ChlorpropamideThe metabolism of Chlorpropamide can be decreased when combined with Sulfisoxazole.Approved, Investigational
ChlorzoxazoneThe metabolism of Chlorzoxazone can be decreased when combined with Sulfisoxazole.Approved
CholecalciferolThe metabolism of Cholecalciferol can be decreased when combined with Sulfisoxazole.Approved, Nutraceutical
CiclesonideThe metabolism of Ciclesonide can be decreased when combined with Sulfisoxazole.Approved, Investigational
CiglitazoneCiglitazone may increase the hypoglycemic activities of Sulfisoxazole.Experimental
CilostazolThe serum concentration of Cilostazol can be increased when it is combined with Sulfisoxazole.Approved, Investigational
CinacalcetThe metabolism of Cinacalcet can be decreased when combined with Sulfisoxazole.Approved
CinnarizineThe risk or severity of QTc prolongation can be increased when Sulfisoxazole is combined with Cinnarizine.Approved, Investigational
CinoxacinCinoxacin may increase the hypoglycemic activities of Sulfisoxazole.Approved, Investigational, Withdrawn
CiprofloxacinThe therapeutic efficacy of Sulfisoxazole can be increased when used in combination with Ciprofloxacin.Approved, Investigational
CisaprideSulfisoxazole may increase the QTc-prolonging activities of Cisapride.Approved, Investigational, Withdrawn
CitalopramSulfisoxazole may increase the QTc-prolonging activities of Citalopram.Approved
ClarithromycinSulfisoxazole may increase the QTc-prolonging activities of Clarithromycin.Approved
ClemastineThe risk or severity of QTc prolongation can be increased when Sulfisoxazole is combined with Clemastine.Approved, Investigational
ClobazamThe metabolism of Clobazam can be decreased when combined with Sulfisoxazole.Approved, Illicit
ClofazimineThe metabolism of Clofazimine can be decreased when combined with Sulfisoxazole.Approved, Investigational
ClofibrateThe metabolism of Clofibrate can be decreased when combined with Sulfisoxazole.Approved, Investigational
clomethiazoleThe metabolism of clomethiazole can be decreased when combined with Sulfisoxazole.Investigational
ClomipramineThe metabolism of Clomipramine can be decreased when combined with Sulfisoxazole.Approved, Investigational, Vet Approved
ClonazepamThe metabolism of Clonazepam can be decreased when combined with Sulfisoxazole.Approved, Illicit
ClonidineThe metabolism of Clonidine can be decreased when combined with Sulfisoxazole.Approved
ClopidogrelThe metabolism of Clopidogrel can be decreased when combined with Sulfisoxazole.Approved
ClorazepateThe metabolism of Clorazepate can be decreased when combined with Sulfisoxazole.Approved, Illicit
ClorindioneSulfisoxazole may increase the anticoagulant activities of Clorindione.Experimental
ClotiazepamThe metabolism of Clotiazepam can be decreased when combined with Sulfisoxazole.Approved, Illicit
ClozapineThe metabolism of Clozapine can be decreased when combined with Sulfisoxazole.Approved
CobimetinibThe serum concentration of Cobimetinib can be increased when it is combined with Sulfisoxazole.Approved, Investigational
CocaineThe metabolism of Cocaine can be decreased when combined with Sulfisoxazole.Approved, Illicit
ColchicineThe serum concentration of Colchicine can be increased when it is combined with Sulfisoxazole.Approved
ConivaptanThe metabolism of Conivaptan can be decreased when combined with Sulfisoxazole.Approved, Investigational
Conjugated estrogensThe metabolism of Conjugated estrogens can be decreased when combined with Sulfisoxazole.Approved
CopanlisibThe metabolism of Copanlisib can be decreased when combined with Sulfisoxazole.Approved, Investigational
Cortisone acetateThe metabolism of Cortisone acetate can be decreased when combined with Sulfisoxazole.Approved, Investigational
CrisaboroleThe metabolism of Sulfisoxazole can be decreased when combined with Crisaborole.Approved, Investigational
CrizotinibSulfisoxazole may increase the QTc-prolonging activities of Crizotinib.Approved
CurcuminThe metabolism of Sulfisoxazole can be decreased when combined with Curcumin.Approved, Investigational
CyclobenzaprineCyclobenzaprine may decrease the hypoglycemic activities of Sulfisoxazole.Approved
CyclophosphamideThe metabolism of Cyclophosphamide can be decreased when combined with Sulfisoxazole.Approved, Investigational
CyclosporineThe metabolism of Cyclosporine can be increased when combined with Sulfisoxazole.Approved, Investigational, Vet Approved
CytarabineThe metabolism of Cytarabine can be decreased when combined with Sulfisoxazole.Approved, Investigational
DabrafenibThe serum concentration of Sulfisoxazole can be decreased when it is combined with Dabrafenib.Approved, Investigational
DaclatasvirThe metabolism of Daclatasvir can be decreased when combined with Sulfisoxazole.Approved, Investigational
DantroleneThe metabolism of Dantrolene can be decreased when combined with Sulfisoxazole.Approved, Investigational
DapagliflozinThe therapeutic efficacy of Dapagliflozin can be increased when used in combination with Sulfisoxazole.Approved
DapoxetineThe serum concentration of Dapoxetine can be increased when it is combined with Sulfisoxazole.Investigational
DapsoneThe metabolism of Dapsone can be decreased when combined with Sulfisoxazole.Approved, Investigational
DarifenacinThe metabolism of Darifenacin can be decreased when combined with Sulfisoxazole.Approved, Investigational
DarunavirThe metabolism of Darunavir can be decreased when combined with Sulfisoxazole.Approved
DasabuvirThe metabolism of Dasabuvir can be decreased when combined with Sulfisoxazole.Approved
DasatinibThe metabolism of Dasatinib can be decreased when combined with Sulfisoxazole.Approved, Investigational
DaunorubicinThe metabolism of Daunorubicin can be decreased when combined with Sulfisoxazole.Approved
DeflazacortThe metabolism of Deflazacort can be decreased when combined with Sulfisoxazole.Approved, Investigational
DegarelixDegarelix may increase the QTc-prolonging activities of Sulfisoxazole.Approved
DelamanidThe metabolism of Delamanid can be decreased when combined with Sulfisoxazole.Approved, Investigational
DelavirdineThe metabolism of Sulfisoxazole can be decreased when combined with Delavirdine.Approved
DeoxyspergualinDeoxyspergualin may increase the hypoglycemic activities of Sulfisoxazole.Investigational
DersalazineDersalazine may increase the hypoglycemic activities of Sulfisoxazole.Investigational
DesfluraneDesflurane may increase the QTc-prolonging activities of Sulfisoxazole.Approved
DesipramineDesipramine may increase the QTc-prolonging activities of Sulfisoxazole.Approved, Investigational
DesvenlafaxineDesvenlafaxine may increase the hypoglycemic activities of Sulfisoxazole.Approved, Investigational
DeutetrabenazineThe metabolism of Deutetrabenazine can be decreased when combined with Sulfisoxazole.Approved, Investigational
DexamethasoneThe therapeutic efficacy of Sulfisoxazole can be decreased when used in combination with Dexamethasone.Approved, Investigational, Vet Approved
DexbrompheniramineThe risk or severity of QTc prolongation can be increased when Dexbrompheniramine is combined with Sulfisoxazole.Approved
Dexchlorpheniramine maleateThe metabolism of Dexchlorpheniramine maleate can be decreased when combined with Sulfisoxazole.Approved
DexketoprofenThe risk or severity of adverse effects can be increased when Dexketoprofen is combined with Sulfisoxazole.Approved, Investigational
DexlansoprazoleThe metabolism of Dexlansoprazole can be decreased when combined with Sulfisoxazole.Approved, Investigational
DextropropoxypheneThe metabolism of Dextropropoxyphene can be decreased when combined with Sulfisoxazole.Approved, Illicit, Investigational, Withdrawn
DiazepamThe metabolism of Diazepam can be decreased when combined with Sulfisoxazole.Approved, Illicit, Investigational, Vet Approved
DicoumarolThe metabolism of Dicoumarol can be decreased when combined with Sulfisoxazole.Approved
DienogestThe metabolism of Dienogest can be decreased when combined with Sulfisoxazole.Approved
DiflunisalDiflunisal may increase the hypoglycemic activities of Sulfisoxazole.Approved, Investigational
DigitoxinThe metabolism of Digitoxin can be decreased when combined with Sulfisoxazole.Approved, Investigational
DigoxinThe metabolism of Digoxin can be decreased when combined with Sulfisoxazole.Approved
Dihydro-alpha-ergocryptineThe metabolism of Dihydro-alpha-ergocryptine can be decreased when combined with Sulfisoxazole.Approved
DihydrocodeineThe metabolism of Dihydrocodeine can be decreased when combined with Sulfisoxazole.Approved, Illicit
DihydroergocornineThe risk or severity of adverse effects can be increased when Dihydroergocornine is combined with Sulfisoxazole.Approved
DihydroergocristineThe risk or severity of adverse effects can be increased when Dihydroergocristine is combined with Sulfisoxazole.Approved, Experimental
DihydroergocryptineThe risk or severity of adverse effects can be increased when Dihydroergocryptine is combined with Sulfisoxazole.Experimental
DihydroergotamineThe risk or severity of adverse effects can be increased when Dihydroergotamine is combined with Sulfisoxazole.Approved, Investigational
DimenhydrinateThe risk or severity of QTc prolongation can be increased when Sulfisoxazole is combined with Dimenhydrinate.Approved
DiphenadioneSulfisoxazole may increase the anticoagulant activities of Diphenadione.Experimental
DiphenhydramineThe risk or severity of QTc prolongation can be increased when Diphenhydramine is combined with Sulfisoxazole.Approved, Investigational
DisopyramideSulfisoxazole may increase the QTc-prolonging activities of Disopyramide.Approved
DisulfiramThe metabolism of Disulfiram can be decreased when combined with Sulfisoxazole.Approved
DocetaxelThe metabolism of Docetaxel can be decreased when combined with Sulfisoxazole.Approved, Investigational
DoconexentThe metabolism of Doconexent can be decreased when combined with Sulfisoxazole.Approved, Investigational
DofetilideThe serum concentration of Dofetilide can be increased when it is combined with Sulfisoxazole.Approved, Investigational
DolasetronThe metabolism of Dolasetron can be decreased when combined with Sulfisoxazole.Approved, Investigational
DomperidoneThe serum concentration of Domperidone can be increased when it is combined with Sulfisoxazole.Approved, Investigational, Vet Approved
DonepezilThe metabolism of Donepezil can be decreased when combined with Sulfisoxazole.Approved
DopamineThe metabolism of Dopamine can be decreased when combined with Sulfisoxazole.Approved
DorzolamideThe metabolism of Dorzolamide can be decreased when combined with Sulfisoxazole.Approved
DosulepinThe metabolism of Sulfisoxazole can be decreased when combined with Dosulepin.Approved
DoxepinThe metabolism of Doxepin can be decreased when combined with Sulfisoxazole.Approved, Investigational
DoxorubicinThe serum concentration of Doxorubicin can be increased when it is combined with Sulfisoxazole.Approved, Investigational
DoxorubicinThe metabolism of Doxorubicin can be decreased when combined with Sulfisoxazole.Approved, Investigational
DoxylamineThe risk or severity of QTc prolongation can be increased when Doxylamine is combined with Sulfisoxazole.Approved, Vet Approved
DronabinolThe serum concentration of Dronabinol can be increased when it is combined with Sulfisoxazole.Approved, Illicit
DronedaroneSulfisoxazole may increase the QTc-prolonging activities of Dronedarone.Approved
DroperidolSulfisoxazole may increase the QTc-prolonging activities of Droperidol.Approved, Vet Approved
DulaglutideDulaglutide may increase the hypoglycemic activities of Sulfisoxazole.Approved, Investigational
DuloxetineDuloxetine may increase the hypoglycemic activities of Sulfisoxazole.Approved
DutasterideThe metabolism of Dutasteride can be decreased when combined with Sulfisoxazole.Approved, Investigational
EfavirenzThe metabolism of Efavirenz can be decreased when combined with Sulfisoxazole.Approved, Investigational
ElbasvirThe metabolism of Elbasvir can be decreased when combined with Sulfisoxazole.Approved
EletriptanThe serum concentration of Eletriptan can be increased when it is combined with Sulfisoxazole.Approved, Investigational
EliglustatThe serum concentration of Eliglustat can be increased when it is combined with Sulfisoxazole.Approved
ElvitegravirThe metabolism of Elvitegravir can be decreased when combined with Sulfisoxazole.Approved
EmpagliflozinEmpagliflozin may increase the hypoglycemic activities of Sulfisoxazole.Approved
EnalaprilThe metabolism of Enalapril can be decreased when combined with Sulfisoxazole.Approved, Vet Approved
EnasidenibThe metabolism of Enasidenib can be decreased when combined with Sulfisoxazole.Approved, Investigational
EnglitazoneEnglitazone may increase the hypoglycemic activities of Sulfisoxazole.Experimental
EnoxacinEnoxacin may increase the hypoglycemic activities of Sulfisoxazole.Approved, Investigational
EnzalutamideThe metabolism of Enzalutamide can be decreased when combined with Sulfisoxazole.Approved
EpinastineThe metabolism of Epinastine can be decreased when combined with Sulfisoxazole.Approved, Investigational
EplerenoneThe serum concentration of Eplerenone can be increased when it is combined with Sulfisoxazole.Approved
EpoprostenolThe metabolism of Epoprostenol can be decreased when combined with Sulfisoxazole.Approved
ErgocalciferolThe metabolism of Ergocalciferol can be decreased when combined with Sulfisoxazole.Approved, Nutraceutical
Ergoloid mesylateThe metabolism of Ergoloid mesylate can be decreased when combined with Sulfisoxazole.Approved
ErgonovineThe risk or severity of adverse effects can be increased when Ergonovine is combined with Sulfisoxazole.Approved
ErgotamineThe risk or severity of adverse effects can be increased when Ergotamine is combined with Sulfisoxazole.Approved
EribulinEribulin may increase the QTc-prolonging activities of Sulfisoxazole.Approved, Investigational
ErlotinibThe metabolism of Erlotinib can be decreased when combined with Sulfisoxazole.Approved, Investigational
ErythromycinErythromycin may increase the QTc-prolonging activities of Sulfisoxazole.Approved, Investigational, Vet Approved
EscitalopramSulfisoxazole may increase the QTc-prolonging activities of Escitalopram.Approved, Investigational
EsomeprazoleThe metabolism of Esomeprazole can be decreased when combined with Sulfisoxazole.Approved, Investigational
EstazolamThe metabolism of Estazolam can be decreased when combined with Sulfisoxazole.Approved, Illicit
EstradiolThe therapeutic efficacy of Sulfisoxazole can be decreased when used in combination with Estradiol.Approved, Investigational, Vet Approved
Estradiol acetateThe metabolism of Estradiol acetate can be decreased when combined with Sulfisoxazole.Approved, Investigational, Vet Approved
Estradiol benzoateThe metabolism of Estradiol benzoate can be decreased when combined with Sulfisoxazole.Approved, Investigational, Vet Approved
Estradiol cypionateThe metabolism of Estradiol cypionate can be decreased when combined with Sulfisoxazole.Approved, Investigational, Vet Approved
Estradiol dienanthateThe metabolism of Estradiol dienanthate can be decreased when combined with Sulfisoxazole.Approved, Investigational, Vet Approved
Estradiol valerateThe metabolism of Estradiol valerate can be decreased when combined with Sulfisoxazole.Approved, Investigational, Vet Approved
EstramustineThe metabolism of Estramustine can be decreased when combined with Sulfisoxazole.Approved, Investigational
Estrogens, esterifiedThe metabolism of Estrogens, esterified can be decreased when combined with Sulfisoxazole.Approved
EstroneThe metabolism of Estrone can be decreased when combined with Sulfisoxazole.Approved
Estrone sulfateThe metabolism of Estrone sulfate can be decreased when combined with Sulfisoxazole.Approved
EszopicloneThe metabolism of Eszopiclone can be decreased when combined with Sulfisoxazole.Approved, Investigational
Ethinyl EstradiolThe therapeutic efficacy of Sulfisoxazole can be decreased when used in combination with Ethinyl Estradiol.Approved
Ethyl biscoumacetateSulfisoxazole may increase the anticoagulant activities of Ethyl biscoumacetate.Withdrawn
EthylmorphineThe metabolism of Ethylmorphine can be decreased when combined with Sulfisoxazole.Approved, Illicit
EtizolamThe metabolism of Etizolam can be decreased when combined with Sulfisoxazole.Approved
EtodolacThe metabolism of Etodolac can be decreased when combined with Sulfisoxazole.Approved, Investigational, Vet Approved
EtonogestrelThe metabolism of Etonogestrel can be decreased when combined with Sulfisoxazole.Approved, Investigational
EtoperidoneEtoperidone may increase the hypoglycemic activities of Sulfisoxazole.Withdrawn
EtoposideThe metabolism of Etoposide can be decreased when combined with Sulfisoxazole.Approved
EtoricoxibThe metabolism of Etoricoxib can be decreased when combined with Sulfisoxazole.Approved, Investigational
EtravirineThe metabolism of Etravirine can be decreased when combined with Sulfisoxazole.Approved
EverolimusThe therapeutic efficacy of Sulfisoxazole can be decreased when used in combination with Everolimus.Approved
ExemestaneThe metabolism of Exemestane can be decreased when combined with Sulfisoxazole.Approved, Investigational
ExenatideExenatide may increase the hypoglycemic activities of Sulfisoxazole.Approved, Investigational
EzogabineEzogabine may increase the QTc-prolonging activities of Sulfisoxazole.Approved, Investigational
FamciclovirThe metabolism of Famciclovir can be decreased when combined with Sulfisoxazole.Approved, Investigational
FamotidineThe risk or severity of QTc prolongation can be increased when Famotidine is combined with Sulfisoxazole.Approved
FelbamateThe metabolism of Felbamate can be decreased when combined with Sulfisoxazole.Approved
FenofibrateThe metabolism of Fenofibrate can be decreased when combined with Sulfisoxazole.Approved
FesoterodineThe metabolism of Fesoterodine can be decreased when combined with Sulfisoxazole.Approved
FinasterideThe metabolism of Finasteride can be decreased when combined with Sulfisoxazole.Approved
FingolimodThe metabolism of Fingolimod can be decreased when combined with Sulfisoxazole.Approved, Investigational
FlecainideSulfisoxazole may increase the QTc-prolonging activities of Flecainide.Approved, Withdrawn
FleroxacinFleroxacin may increase the hypoglycemic activities of Sulfisoxazole.Approved
FlibanserinThe risk or severity of adverse effects can be increased when Sulfisoxazole is combined with Flibanserin.Approved, Investigational
FloxuridineThe metabolism of Sulfisoxazole can be decreased when combined with Floxuridine.Approved
FluconazoleThe metabolism of Sulfisoxazole can be decreased when combined with Fluconazole.Approved, Investigational
FluindioneSulfisoxazole may increase the anticoagulant activities of Fluindione.Approved, Investigational
FlumequineFlumequine may increase the hypoglycemic activities of Sulfisoxazole.Withdrawn
FlunisolideThe metabolism of Flunisolide can be decreased when combined with Sulfisoxazole.Approved, Investigational
FlunitrazepamThe metabolism of Flunitrazepam can be decreased when combined with Sulfisoxazole.Approved, Illicit
FluorometholoneThe metabolism of Fluorometholone can be decreased when combined with Sulfisoxazole.Approved, Investigational
FluorouracilThe metabolism of Sulfisoxazole can be decreased when combined with Fluorouracil.Approved
FluoxetineThe risk or severity of QTc prolongation can be increased when Sulfisoxazole is combined with Fluoxetine.Approved, Vet Approved
FluoxymesteroneFluoxymesterone may increase the hypoglycemic activities of Sulfisoxazole.Approved, Illicit
FlupentixolSulfisoxazole may increase the QTc-prolonging activities of Flupentixol.Approved, Investigational, Withdrawn
FlurazepamThe metabolism of Flurazepam can be decreased when combined with Sulfisoxazole.Approved, Illicit, Investigational
FlurbiprofenThe metabolism of Flurbiprofen can be decreased when combined with Sulfisoxazole.Approved, Investigational
FlutamideThe metabolism of Flutamide can be decreased when combined with Sulfisoxazole.Approved, Investigational
Fluticasone furoateThe metabolism of Fluticasone furoate can be decreased when combined with Sulfisoxazole.Approved
FluvoxamineFluvoxamine may increase the hypoglycemic activities of Sulfisoxazole.Approved, Investigational
FormoterolThe metabolism of Formoterol can be decreased when combined with Sulfisoxazole.Approved, Investigational
FosamprenavirThe metabolism of Fosamprenavir can be decreased when combined with Sulfisoxazole.Approved
FoscarnetFoscarnet may increase the QTc-prolonging activities of Sulfisoxazole.Approved
FosnetupitantThe metabolism of Fosnetupitant can be decreased when combined with Sulfisoxazole.Approved
FosphenytoinThe metabolism of Sulfisoxazole can be increased when combined with Fosphenytoin.Approved, Investigational
FostamatinibThe metabolism of Fostamatinib can be decreased when combined with Sulfisoxazole.Approved, Investigational
FulvestrantThe metabolism of Fulvestrant can be decreased when combined with Sulfisoxazole.Approved, Investigational
FurazolidoneFurazolidone may increase the hypoglycemic activities of Sulfisoxazole.Approved, Investigational, Vet Approved
FurosemideThe therapeutic efficacy of Sulfisoxazole can be increased when used in combination with Furosemide.Approved, Vet Approved
Gadobenic acidSulfisoxazole may increase the QTc-prolonging activities of Gadobenic acid.Approved, Investigational
GalantamineThe metabolism of Galantamine can be decreased when combined with Sulfisoxazole.Approved
GarenoxacinGarenoxacin may increase the hypoglycemic activities of Sulfisoxazole.Investigational
GatifloxacinGatifloxacin may increase the hypoglycemic activities of Sulfisoxazole.Approved, Investigational
GavestinelThe metabolism of Gavestinel can be decreased when combined with Sulfisoxazole.Investigational
GefitinibThe metabolism of Gefitinib can be decreased when combined with Sulfisoxazole.Approved, Investigational
GemfibrozilThe metabolism of Sulfisoxazole can be decreased when combined with Gemfibrozil.Approved
GemifloxacinSulfisoxazole may increase the QTc-prolonging activities of Gemifloxacin.Approved, Investigational
GlibornurideGlibornuride may increase the hypoglycemic activities of Sulfisoxazole.Investigational, Withdrawn
GliclazideThe metabolism of Gliclazide can be decreased when combined with Sulfisoxazole.Approved
GlimepirideThe therapeutic efficacy of Glimepiride can be increased when used in combination with Sulfisoxazole.Approved
GlipizideThe therapeutic efficacy of Glipizide can be increased when used in combination with Sulfisoxazole.Approved, Investigational
GliquidoneGliquidone may increase the hypoglycemic activities of Sulfisoxazole.Approved, Investigational
GlisoxepideSulfisoxazole may increase the hypoglycemic activities of Glisoxepide.Investigational
GLPG-0492GLPG-0492 may increase the hypoglycemic activities of Sulfisoxazole.Investigational
GlyburideThe therapeutic efficacy of Glyburide can be increased when used in combination with Sulfisoxazole.Approved
GoserelinThe risk or severity of QTc prolongation can be increased when Goserelin is combined with Sulfisoxazole.Approved
GranisetronSulfisoxazole may increase the QTc-prolonging activities of Granisetron.Approved, Investigational
GrazoprevirThe metabolism of Grazoprevir can be decreased when combined with Sulfisoxazole.Approved
GrepafloxacinThe metabolism of Grepafloxacin can be decreased when combined with Sulfisoxazole.Approved, Investigational, Withdrawn
GuacetisalGuacetisal may increase the hypoglycemic activities of Sulfisoxazole.Experimental
GusperimusGusperimus may increase the hypoglycemic activities of Sulfisoxazole.Investigational
HalofantrineThe serum concentration of Halofantrine can be increased when it is combined with Sulfisoxazole.Approved
HaloperidolThe metabolism of Haloperidol can be decreased when combined with Sulfisoxazole.Approved
HalothaneThe metabolism of Halothane can be decreased when combined with Sulfisoxazole.Approved, Vet Approved
HarmalineHarmaline may increase the hypoglycemic activities of Sulfisoxazole.Experimental
Hemoglobin crosfumarilHemoglobin crosfumaril may increase the hypoglycemic activities of Sulfisoxazole.Experimental
HexobarbitalThe metabolism of Hexobarbital can be decreased when combined with Sulfisoxazole.Approved
HistrelinHistrelin may increase the QTc-prolonging activities of Sulfisoxazole.Approved
HydracarbazineHydracarbazine may increase the hypoglycemic activities of Sulfisoxazole.Experimental
HydrochlorothiazideThe therapeutic efficacy of Sulfisoxazole can be decreased when used in combination with Hydrochlorothiazide.Approved, Vet Approved
HydrocortisoneThe therapeutic efficacy of Sulfisoxazole can be decreased when used in combination with Hydrocortisone.Approved, Vet Approved
HydromorphoneThe metabolism of Hydromorphone can be decreased when combined with Sulfisoxazole.Approved, Illicit
Hydroxyprogesterone caproateThe metabolism of Hydroxyprogesterone caproate can be decreased when combined with Sulfisoxazole.Approved, Investigational
HydroxyzineThe risk or severity of QTc prolongation can be increased when Hydroxyzine is combined with Sulfisoxazole.Approved
IbandronateThe risk or severity of QTc prolongation can be increased when Ibandronate is combined with Sulfisoxazole.Approved, Investigational
IbrutinibThe serum concentration of Ibrutinib can be increased when it is combined with Sulfisoxazole.Approved
IbutilideSulfisoxazole may increase the QTc-prolonging activities of Ibutilide.Approved
IcotinibThe metabolism of Icotinib can be decreased when combined with Sulfisoxazole.Approved, Investigational
IdarubicinThe metabolism of Idarubicin can be decreased when combined with Sulfisoxazole.Approved
IfosfamideThe serum concentration of the active metabolites of Ifosfamide can be reduced when Ifosfamide is used in combination with Sulfisoxazole resulting in a loss in efficacy.Approved
IloperidoneSulfisoxazole may increase the QTc-prolonging activities of Iloperidone.Approved
ImatinibThe serum concentration of Imatinib can be increased when it is combined with Sulfisoxazole.Approved
ImidafenacinThe metabolism of Imidafenacin can be decreased when combined with Sulfisoxazole.Approved, Investigational
ImipramineThe metabolism of Imipramine can be decreased when combined with Sulfisoxazole.Approved
ImiquimodThe metabolism of Imiquimod can be decreased when combined with Sulfisoxazole.Approved, Investigational
IndacaterolThe metabolism of Indacaterol can be decreased when combined with Sulfisoxazole.Approved
IndalpineIndalpine may increase the hypoglycemic activities of Sulfisoxazole.Investigational, Withdrawn
IndapamideThe metabolism of Indapamide can be decreased when combined with Sulfisoxazole.Approved
IndinavirThe metabolism of Indinavir can be decreased when combined with Sulfisoxazole.Approved
IndisulamThe metabolism of Indisulam can be decreased when combined with Sulfisoxazole.Investigational
IndomethacinThe metabolism of Indomethacin can be decreased when combined with Sulfisoxazole.Approved, Investigational
Insulin AspartSulfisoxazole may increase the hypoglycemic activities of Insulin Aspart.Approved
Insulin DetemirSulfisoxazole may increase the hypoglycemic activities of Insulin Detemir.Approved
Insulin GlargineThe therapeutic efficacy of Insulin Glargine can be increased when used in combination with Sulfisoxazole.Approved
Insulin GlulisineSulfisoxazole may increase the hypoglycemic activities of Insulin Glulisine.Approved
Insulin HumanThe therapeutic efficacy of Insulin Human can be increased when used in combination with Sulfisoxazole.Approved, Investigational
Insulin LisproThe therapeutic efficacy of Insulin Lispro can be increased when used in combination with Sulfisoxazole.Approved
Insulin PorkInsulin Pork may increase the hypoglycemic activities of Sulfisoxazole.Approved
IpecacThe metabolism of Ipecac can be decreased when combined with Sulfisoxazole.Approved, Withdrawn
IproclozideIproclozide may increase the hypoglycemic activities of Sulfisoxazole.Withdrawn
IproniazidIproniazid may increase the hypoglycemic activities of Sulfisoxazole.Withdrawn
IrbesartanThe metabolism of Irbesartan can be decreased when combined with Sulfisoxazole.Approved, Investigational
IsavuconazoleThe metabolism of Isavuconazole can be decreased when combined with Sulfisoxazole.Approved, Investigational
IsavuconazoniumThe metabolism of Isavuconazonium can be decreased when combined with Sulfisoxazole.Approved, Investigational
IsocarboxazidIsocarboxazid may increase the hypoglycemic activities of Sulfisoxazole.Approved
IsofluraneIsoflurane may increase the QTc-prolonging activities of Sulfisoxazole.Approved, Vet Approved
Isosorbide MononitrateThe metabolism of Isosorbide Mononitrate can be decreased when combined with Sulfisoxazole.Approved
IsradipineThe risk or severity of QTc prolongation can be increased when Isradipine is combined with Sulfisoxazole.Approved, Investigational
ItraconazoleThe metabolism of Itraconazole can be decreased when combined with Sulfisoxazole.Approved, Investigational
IvabradineThe serum concentration of Ivabradine can be increased when it is combined with Sulfisoxazole.Approved
IvacaftorThe serum concentration of Ivacaftor can be increased when it is combined with Sulfisoxazole.Approved
IvermectinThe metabolism of Ivermectin can be decreased when combined with Sulfisoxazole.Approved, Investigational, Vet Approved
IxabepiloneThe metabolism of Ixabepilone can be decreased when combined with Sulfisoxazole.Approved, Investigational
IxazomibThe metabolism of Ixazomib can be decreased when combined with Sulfisoxazole.Approved, Investigational
KetamineThe metabolism of Ketamine can be decreased when combined with Sulfisoxazole.Approved, Vet Approved
KetazolamThe metabolism of Ketazolam can be decreased when combined with Sulfisoxazole.Approved
KetobemidoneThe metabolism of Ketobemidone can be decreased when combined with Sulfisoxazole.Approved, Investigational
KetoconazoleThe metabolism of Ketoconazole can be decreased when combined with Sulfisoxazole.Approved, Investigational
KetoprofenThe metabolism of Ketoprofen can be decreased when combined with Sulfisoxazole.Approved, Vet Approved
LacosamideThe serum concentration of Lacosamide can be increased when it is combined with Sulfisoxazole.Approved
LanreotideSulfisoxazole may increase the hypoglycemic activities of Lanreotide.Approved
LansoprazoleThe metabolism of Lansoprazole can be decreased when combined with Sulfisoxazole.Approved, Investigational
LapatinibThe metabolism of Lapatinib can be decreased when combined with Sulfisoxazole.Approved, Investigational
LaquinimodThe metabolism of Laquinimod can be decreased when combined with Sulfisoxazole.Investigational
LeflunomideThe metabolism of Leflunomide can be decreased when combined with Sulfisoxazole.Approved, Investigational
LenvatinibSulfisoxazole may increase the QTc-prolonging activities of Lenvatinib.Approved, Investigational
LesinuradThe metabolism of Lesinurad can be decreased when combined with Sulfisoxazole.Approved, Investigational
LetrozoleThe metabolism of Letrozole can be decreased when combined with Sulfisoxazole.Approved, Investigational
LeuprolideThe risk or severity of QTc prolongation can be increased when Leuprolide is combined with Sulfisoxazole.Approved, Investigational
LevobupivacaineThe metabolism of Levobupivacaine can be decreased when combined with Sulfisoxazole.Approved, Investigational
LevocetirizineThe metabolism of Levocetirizine can be decreased when combined with Sulfisoxazole.Approved
LevofloxacinSulfisoxazole may increase the QTc-prolonging activities of Levofloxacin.Approved, Investigational
Levomethadyl AcetateThe metabolism of Levomethadyl Acetate can be decreased when combined with Sulfisoxazole.Approved, Investigational
LevomilnacipranThe metabolism of Levomilnacipran can be decreased when combined with Sulfisoxazole.Approved, Investigational
LevonorgestrelThe therapeutic efficacy of Sulfisoxazole can be decreased when used in combination with Levonorgestrel.Approved, Investigational
LevothyroxineThe metabolism of Levothyroxine can be decreased when combined with Sulfisoxazole.Approved
LicofeloneThe metabolism of Licofelone can be decreased when combined with Sulfisoxazole.Investigational
LinagliptinLinagliptin may increase the hypoglycemic activities of Sulfisoxazole.Approved
LiraglutideLiraglutide may increase the hypoglycemic activities of Sulfisoxazole.Approved
LisurideThe risk or severity of adverse effects can be increased when Lisuride is combined with Sulfisoxazole.Approved, Investigational
Lithium cationLithium may increase the QTc-prolonging activities of Sulfisoxazole.Experimental
LobeglitazoneThe metabolism of Sulfisoxazole can be decreased when combined with Lobeglitazone.Approved, Investigational
LomefloxacinLomefloxacin may increase the hypoglycemic activities of Sulfisoxazole.Approved, Investigational
LomitapideThe serum concentration of Lomitapide can be increased when it is combined with Sulfisoxazole.Approved, Investigational
LopinavirSulfisoxazole may increase the QTc-prolonging activities of Lopinavir.Approved
LoratadineThe risk or severity of QTc prolongation can be increased when Sulfisoxazole is combined with Loratadine.Approved, Investigational
LorcaserinThe metabolism of Lorcaserin can be decreased when combined with Sulfisoxazole.Approved
LornoxicamThe metabolism of Lornoxicam can be decreased when combined with Sulfisoxazole.Approved, Investigational
LorpiprazoleThe metabolism of Lorpiprazole can be decreased when combined with Sulfisoxazole.Approved
LovastatinThe serum concentration of Lovastatin can be increased when it is combined with Sulfisoxazole.Approved, Investigational
LumacaftorThe serum concentration of Sulfisoxazole can be decreased when it is combined with Lumacaftor.Approved
LumefantrineSulfisoxazole may increase the QTc-prolonging activities of Lumefantrine.Approved
LumiracoxibThe metabolism of Lumiracoxib can be decreased when combined with Sulfisoxazole.Approved, Investigational
LurasidoneThe serum concentration of Lurasidone can be increased when it is combined with Sulfisoxazole.Approved, Investigational
Lysergic Acid DiethylamideThe risk or severity of adverse effects can be increased when Lysergic Acid Diethylamide is combined with Sulfisoxazole.Illicit, Investigational, Withdrawn
MacimorelinThe metabolism of Macimorelin can be decreased when combined with Sulfisoxazole.Approved, Investigational
MacitentanThe metabolism of Macitentan can be decreased when combined with Sulfisoxazole.Approved
MaprotilineMaprotiline may increase the QTc-prolonging activities of Sulfisoxazole.Approved, Investigational
MaravirocThe metabolism of Maraviroc can be decreased when combined with Sulfisoxazole.Approved, Investigational
MebanazineMebanazine may increase the hypoglycemic activities of Sulfisoxazole.Withdrawn
MebendazoleThe metabolism of Mebendazole can be decreased when combined with Sulfisoxazole.Approved, Vet Approved
MecamylamineThe risk or severity of adverse effects can be increased when Sulfisoxazole is combined with Mecamylamine.Approved, Investigational
MecaserminSulfisoxazole may increase the hypoglycemic activities of Mecasermin.Approved, Investigational
Medical CannabisThe metabolism of Medical Cannabis can be decreased when combined with Sulfisoxazole.Experimental, Investigational
Medroxyprogesterone acetateThe metabolism of Medroxyprogesterone acetate can be decreased when combined with Sulfisoxazole.Approved, Investigational
Mefenamic acidThe metabolism of Mefenamic acid can be decreased when combined with Sulfisoxazole.Approved
MefloquineThe metabolism of Mefloquine can be decreased when combined with Sulfisoxazole.Approved, Investigational
MelatoninThe metabolism of Melatonin can be decreased when combined with Sulfisoxazole.Approved, Nutraceutical, Vet Approved
MeloxicamThe metabolism of Meloxicam can be decreased when combined with Sulfisoxazole.Approved, Vet Approved
MephenytoinThe metabolism of Mephenytoin can be decreased when combined with Sulfisoxazole.Investigational, Withdrawn
MepyramineThe risk or severity of QTc prolongation can be increased when Mepyramine is combined with Sulfisoxazole.Approved, Vet Approved
MesalazineMesalazine may increase the hypoglycemic activities of Sulfisoxazole.Approved
MesteroloneMesterolone may increase the hypoglycemic activities of Sulfisoxazole.Experimental
MestranolThe metabolism of Mestranol can be decreased when combined with Sulfisoxazole.Approved
MetahexamideSulfisoxazole may increase the hypoglycemic activities of Metahexamide.Experimental
MetergolineThe risk or severity of adverse effects can be increased when Metergoline is combined with Sulfisoxazole.Experimental
MetforminThe therapeutic efficacy of Metformin can be increased when used in combination with Sulfisoxazole.Approved
MethadoneThe metabolism of Methadone can be decreased when combined with Sulfisoxazole.Approved
MethaqualoneThe metabolism of Methaqualone can be decreased when combined with Sulfisoxazole.Illicit, Withdrawn
MethenamineThe risk or severity of adverse effects can be increased when Methenamine is combined with Sulfisoxazole.Approved, Vet Approved
MethotrexateThe risk or severity of adverse effects can be increased when Sulfisoxazole is combined with Methotrexate.Approved
MethotrimeprazineMethotrimeprazine may increase the QTc-prolonging activities of Sulfisoxazole.Approved, Investigational
MethoxyfluraneThe metabolism of Methoxyflurane can be decreased when combined with Sulfisoxazole.Approved, Investigational, Vet Approved
Methyl salicylateMethyl salicylate may increase the hypoglycemic activities of Sulfisoxazole.Approved, Vet Approved
Methylene blueMethylene blue may increase the hypoglycemic activities of Sulfisoxazole.Approved, Investigational
MethylergometrineThe risk or severity of adverse effects can be increased when Methylergometrine is combined with Sulfisoxazole.Approved
MethylprednisoloneThe therapeutic efficacy of Sulfisoxazole can be decreased when used in combination with Methylprednisolone.Approved, Vet Approved
MethyltestosteroneThe metabolism of Methyltestosterone can be decreased when combined with Sulfisoxazole.Approved
MethysergideThe risk or severity of adverse effects can be increased when Methysergide is combined with Sulfisoxazole.Approved
MetoclopramideThe risk or severity of QTc prolongation can be increased when Metoclopramide is combined with Sulfisoxazole.Approved, Investigational
MetronidazoleThe metabolism of Metronidazole can be decreased when combined with Sulfisoxazole.Approved
MevastatinThe serum concentration of Mevastatin can be increased when it is combined with Sulfisoxazole.Experimental
MexiletineThe metabolism of Mexiletine can be decreased when combined with Sulfisoxazole.Approved, Investigational
MianserinThe metabolism of Mianserin can be decreased when combined with Sulfisoxazole.Approved, Investigational
MidazolamThe metabolism of Midazolam can be decreased when combined with Sulfisoxazole.Approved, Illicit
MidecamycinThe metabolism of Midecamycin can be decreased when combined with Sulfisoxazole.Approved
MidostaurinThe metabolism of Sulfisoxazole can be decreased when combined with Midostaurin.Approved, Investigational
MifepristoneMifepristone may increase the QTc-prolonging activities of Sulfisoxazole.Approved, Investigational
MifepristoneThe serum concentration of Sulfisoxazole can be increased when it is combined with Mifepristone.Approved, Investigational
MiglitolMiglitol may increase the hypoglycemic activities of Sulfisoxazole.Approved
MiglustatMiglustat may increase the hypoglycemic activities of Sulfisoxazole.Approved
MilnacipranMilnacipran may increase the hypoglycemic activities of Sulfisoxazole.Approved, Investigational
MinaprineMinaprine may increase the hypoglycemic activities of Sulfisoxazole.Approved
MirabegronThe metabolism of Mirabegron can be decreased when combined with Sulfisoxazole.Approved
MirtazapineThe metabolism of Mirtazapine can be decreased when combined with Sulfisoxazole.Approved
MitiglinideMitiglinide may increase the hypoglycemic activities of Sulfisoxazole.Approved, Investigational
MoclobemideThe metabolism of Moclobemide can be decreased when combined with Sulfisoxazole.Approved, Investigational
ModafinilThe metabolism of Modafinil can be decreased when combined with Sulfisoxazole.Approved, Investigational
MoexiprilMoexipril may increase the QTc-prolonging activities of Sulfisoxazole.Approved
MontelukastThe metabolism of Montelukast can be decreased when combined with Sulfisoxazole.Approved
MorphineThe metabolism of Morphine can be decreased when combined with Sulfisoxazole.Approved, Investigational
MoxifloxacinThe therapeutic efficacy of Sulfisoxazole can be increased when used in combination with Moxifloxacin.Approved, Investigational
Mycophenolate mofetilThe metabolism of Mycophenolate mofetil can be decreased when combined with Sulfisoxazole.Approved, Investigational
NabiloneThe metabolism of Sulfisoxazole can be decreased when combined with Nabilone.Approved, Investigational
NabiximolsThe metabolism of Nabiximols can be decreased when combined with Sulfisoxazole.Approved, Investigational
Nalidixic AcidNalidixic Acid may increase the hypoglycemic activities of Sulfisoxazole.Approved, Investigational
NaloxegolThe serum concentration of Naloxegol can be increased when it is combined with Sulfisoxazole.Approved
NaloxoneThe metabolism of Naloxone can be decreased when combined with Sulfisoxazole.Approved, Vet Approved
NandroloneNandrolone may increase the hypoglycemic activities of Sulfisoxazole.Experimental, Investigational
Nandrolone decanoateNandrolone decanoate may increase the hypoglycemic activities of Sulfisoxazole.Approved, Illicit
NateglinideThe metabolism of Nateglinide can be decreased when combined with Sulfisoxazole.Approved, Investigational
NefazodoneThe metabolism of Nefazodone can be decreased when combined with Sulfisoxazole.Approved, Withdrawn
NelfinavirThe metabolism of Nelfinavir can be decreased when combined with Sulfisoxazole.Approved
NemonoxacinNemonoxacin may increase the hypoglycemic activities of Sulfisoxazole.Investigational
NeratinibThe metabolism of Neratinib can be decreased when combined with Sulfisoxazole.Approved, Investigational
NetupitantThe metabolism of Netupitant can be decreased when combined with Sulfisoxazole.Approved, Investigational
NevirapineThe metabolism of Nevirapine can be decreased when combined with Sulfisoxazole.Approved
NialamideNialamide may increase the hypoglycemic activities of Sulfisoxazole.Withdrawn
NicardipineThe risk or severity of QTc prolongation can be increased when Nicardipine is combined with Sulfisoxazole.Approved, Investigational
NicergolineThe risk or severity of adverse effects can be increased when Nicergoline is combined with Sulfisoxazole.Approved, Investigational
NiclosamideThe metabolism of Niclosamide can be decreased when combined with Sulfisoxazole.Approved, Investigational, Vet Approved
NicotineThe risk or severity of adverse effects can be increased when Sulfisoxazole is combined with Nicotine.Approved
NilotinibSulfisoxazole may increase the QTc-prolonging activities of Nilotinib.Approved, Investigational
NitrazepamThe metabolism of Nitrazepam can be decreased when combined with Sulfisoxazole.Approved
NitroaspirinNitroaspirin may increase the hypoglycemic activities of Sulfisoxazole.Investigational
NorethisteroneThe metabolism of Norethisterone can be decreased when combined with Sulfisoxazole.Approved
NorfloxacinNorfloxacin may increase the QTc-prolonging activities of Sulfisoxazole.Approved
NorgestrelThe metabolism of Norgestrel can be decreased when combined with Sulfisoxazole.Approved
NortriptylineThe metabolism of Nortriptyline can be decreased when combined with Sulfisoxazole.Approved
OctamoxinOctamoxin may increase the hypoglycemic activities of Sulfisoxazole.Withdrawn
OctreotideOctreotide may increase the QTc-prolonging activities of Sulfisoxazole.Approved, Investigational
OdanacatibThe metabolism of Odanacatib can be decreased when combined with Sulfisoxazole.Investigational
OfloxacinSulfisoxazole may increase the QTc-prolonging activities of Ofloxacin.Approved
OlanzapineOlanzapine may increase the QTc-prolonging activities of Sulfisoxazole.Approved, Investigational
OlaparibThe serum concentration of Olaparib can be increased when it is combined with Sulfisoxazole.Approved
OlodaterolThe metabolism of Olodaterol can be decreased when combined with Sulfisoxazole.Approved
OlopatadineThe metabolism of Olopatadine can be decreased when combined with Sulfisoxazole.Approved
OlsalazineOlsalazine may increase the hypoglycemic activities of Sulfisoxazole.Approved
OndansetronThe risk or severity of QTc prolongation can be increased when Sulfisoxazole is combined with Ondansetron.Approved
OpiumThe metabolism of Opium can be decreased when combined with Sulfisoxazole.Approved, Illicit
OrphenadrineThe metabolism of Orphenadrine can be decreased when combined with Sulfisoxazole.Approved
OspemifeneThe serum concentration of Ospemifene can be increased when it is combined with Sulfisoxazole.Approved, Investigational
OxandroloneOxandrolone may increase the hypoglycemic activities of Sulfisoxazole.Approved, Investigational
OxaprozinThe metabolism of Oxaprozin can be decreased when combined with Sulfisoxazole.Approved
OxazepamThe metabolism of Oxazepam can be decreased when combined with Sulfisoxazole.Approved
Oxolinic acidOxolinic acid may increase the hypoglycemic activities of Sulfisoxazole.Experimental
OxybutyninThe metabolism of Oxybutynin can be decreased when combined with Sulfisoxazole.Approved, Investigational
OxymetholoneOxymetholone may increase the hypoglycemic activities of Sulfisoxazole.Approved, Illicit
OxytocinOxytocin may increase the QTc-prolonging activities of Sulfisoxazole.Approved, Vet Approved
PaclitaxelThe metabolism of Paclitaxel can be decreased when combined with Sulfisoxazole.Approved, Vet Approved
PalbociclibThe metabolism of Palbociclib can be decreased when combined with Sulfisoxazole.Approved, Investigational
PaliperidoneSulfisoxazole may increase the QTc-prolonging activities of Paliperidone.Approved
PalonosetronThe metabolism of Palonosetron can be decreased when combined with Sulfisoxazole.Approved, Investigational
PanobinostatSulfisoxazole may increase the QTc-prolonging activities of Panobinostat.Approved, Investigational
PantoprazoleThe metabolism of Pantoprazole can be decreased when combined with Sulfisoxazole.Approved
ParamethadioneThe metabolism of Paramethadione can be decreased when combined with Sulfisoxazole.Approved
ParamethasoneThe metabolism of Paramethasone can be decreased when combined with Sulfisoxazole.Approved
ParecoxibThe serum concentration of Parecoxib can be increased when it is combined with Sulfisoxazole.Approved
PargylinePargyline may increase the hypoglycemic activities of Sulfisoxazole.Approved
ParicalcitolThe metabolism of Paricalcitol can be decreased when combined with Sulfisoxazole.Approved, Investigational
ParitaprevirThe metabolism of Paritaprevir can be decreased when combined with Sulfisoxazole.Approved, Investigational
ParoxetineThe risk or severity of QTc prolongation can be increased when Paroxetine is combined with Sulfisoxazole.Approved, Investigational
PasireotidePasireotide may increase the QTc-prolonging activities of Sulfisoxazole.Approved
PazopanibSulfisoxazole may increase the QTc-prolonging activities of Pazopanib.Approved
PazufloxacinPazufloxacin may increase the hypoglycemic activities of Sulfisoxazole.Investigational
PefloxacinPefloxacin may increase the hypoglycemic activities of Sulfisoxazole.Approved
PegvisomantPegvisomant may increase the hypoglycemic activities of Sulfisoxazole.Approved
PentamidineSulfisoxazole may increase the QTc-prolonging activities of Pentamidine.Approved, Investigational
PerampanelThe metabolism of Perampanel can be decreased when combined with Sulfisoxazole.Approved
PerflutrenSulfisoxazole may increase the QTc-prolonging activities of Perflutren.Approved
PergolideThe risk or severity of adverse effects can be increased when Pergolide is combined with Sulfisoxazole.Approved, Investigational, Vet Approved, Withdrawn
PermethrinThe metabolism of Permethrin can be decreased when combined with Sulfisoxazole.Approved, Investigational
PerospironeThe metabolism of Perospirone can be decreased when combined with Sulfisoxazole.Approved
PerphenazineThe metabolism of Perphenazine can be decreased when combined with Sulfisoxazole.Approved
PethidineThe metabolism of Pethidine can be decreased when combined with Sulfisoxazole.Approved
PhenacetinThe metabolism of Phenacetin can be decreased when combined with Sulfisoxazole.Withdrawn
PhenelzinePhenelzine may increase the hypoglycemic activities of Sulfisoxazole.Approved
PhenforminPhenformin may increase the hypoglycemic activities of Sulfisoxazole.Approved, Investigational, Withdrawn
PhenindioneSulfisoxazole may increase the anticoagulant activities of Phenindione.Approved, Investigational
PheniprazinePheniprazine may increase the hypoglycemic activities of Sulfisoxazole.Withdrawn
PheniramineThe risk or severity of QTc prolongation can be increased when Pheniramine is combined with Sulfisoxazole.Approved
PhenoxybenzamineThe metabolism of Phenoxybenzamine can be decreased when combined with Sulfisoxazole.Approved
PhenoxypropazinePhenoxypropazine may increase the hypoglycemic activities of Sulfisoxazole.Withdrawn
PhenprocoumonThe metabolism of Phenprocoumon can be decreased when combined with Sulfisoxazole.Approved, Investigational
Phenyl aminosalicylatePhenyl aminosalicylate may increase the hypoglycemic activities of Sulfisoxazole.Approved
PhenylbutazoneThe metabolism of Phenylbutazone can be decreased when combined with Sulfisoxazole.Approved, Vet Approved
PhenytoinThe metabolism of Sulfisoxazole can be increased when combined with Phenytoin.Approved, Vet Approved
PilocarpineThe metabolism of Pilocarpine can be decreased when combined with Sulfisoxazole.Approved, Investigational
PimecrolimusThe metabolism of Pimecrolimus can be decreased when combined with Sulfisoxazole.Approved, Investigational
PimozideThe serum concentration of Pimozide can be increased when it is combined with Sulfisoxazole.Approved
PinacidilThe metabolism of Pinacidil can be decreased when combined with Sulfisoxazole.Approved
PioglitazoneThe metabolism of Pioglitazone can be decreased when combined with Sulfisoxazole.Approved, Investigational
Pipemidic acidPipemidic acid may increase the hypoglycemic activities of Sulfisoxazole.Experimental
PiperaquineThe metabolism of Piperaquine can be decreased when combined with Sulfisoxazole.Approved, Investigational
PipotiazineThe metabolism of Pipotiazine can be decreased when combined with Sulfisoxazole.Approved, Investigational
PirlindolePirlindole may increase the hypoglycemic activities of Sulfisoxazole.Approved
PiroxicamThe metabolism of Piroxicam can be decreased when combined with Sulfisoxazole.Approved, Investigational
PitavastatinThe serum concentration of Pitavastatin can be increased when it is combined with Sulfisoxazole.Approved
PitolisantThe metabolism of Pitolisant can be decreased when combined with Sulfisoxazole.Approved, Investigational
PivhydrazinePivhydrazine may increase the hypoglycemic activities of Sulfisoxazole.Withdrawn
PodofiloxThe metabolism of Podofilox can be decreased when combined with Sulfisoxazole.Approved
PomalidomideThe metabolism of Pomalidomide can be decreased when combined with Sulfisoxazole.Approved
PonatinibThe metabolism of Ponatinib can be decreased when combined with Sulfisoxazole.Approved, Investigational
PosaconazoleThe metabolism of Posaconazole can be decreased when combined with Sulfisoxazole.Approved, Investigational, Vet Approved
PramlintidePramlintide may increase the hypoglycemic activities of Sulfisoxazole.Approved, Investigational
PrasteroneThe metabolism of Prasterone can be decreased when combined with Sulfisoxazole.Approved, Investigational, Nutraceutical
PrasugrelThe metabolism of Prasugrel can be decreased when combined with Sulfisoxazole.Approved
PravastatinThe serum concentration of Pravastatin can be increased when it is combined with Sulfisoxazole.Approved
PrazepamThe metabolism of Prazepam can be decreased when combined with Sulfisoxazole.Approved, Illicit
PraziquantelThe metabolism of Praziquantel can be decreased when combined with Sulfisoxazole.Approved, Investigational, Vet Approved
PrednisoloneThe therapeutic efficacy of Sulfisoxazole can be decreased when used in combination with Prednisolone.Approved, Vet Approved
PrednisoneThe metabolism of Prednisone can be decreased when combined with Sulfisoxazole.Approved, Vet Approved
PregabalinThe risk or severity of heart failure can be increased when Pregabalin is combined with Sulfisoxazole.Approved, Illicit, Investigational
PrimaquineSulfisoxazole may increase the QTc-prolonging activities of Primaquine.Approved
PrimidoneThe metabolism of Sulfisoxazole can be increased when combined with Primidone.Approved, Vet Approved
ProcainamideSulfisoxazole may increase the QTc-prolonging activities of Procainamide.Approved
ProcaineProcaine may increase the hypoglycemic activities of Sulfisoxazole.Approved, Investigational, Vet Approved
ProcarbazineProcarbazine may increase the hypoglycemic activities of Sulfisoxazole.Approved, Investigational
ProgesteroneThe metabolism of Progesterone can be decreased when combined with Sulfisoxazole.Approved, Vet Approved
ProguanilThe metabolism of Proguanil can be decreased when combined with Sulfisoxazole.Approved
PromazineThe metabolism of Promazine can be decreased when combined with Sulfisoxazole.Approved, Vet Approved
PromethazineThe risk or severity of QTc prolongation can be increased when Promethazine is combined with Sulfisoxazole.Approved, Investigational
PropafenoneThe risk or severity of QTc prolongation can be increased when Sulfisoxazole is combined with Propafenone.Approved
PropiverineThe metabolism of Propiverine can be decreased when combined with Sulfisoxazole.Approved, Investigational
PropofolThe metabolism of Propofol can be decreased when combined with Sulfisoxazole.Approved, Investigational, Vet Approved
ProtriptylineProtriptyline may increase the QTc-prolonging activities of Sulfisoxazole.Approved
PrulifloxacinPrulifloxacin may increase the hypoglycemic activities of Sulfisoxazole.Investigational
PyrazinamideThe metabolism of Pyrazinamide can be decreased when combined with Sulfisoxazole.Approved, Investigational
PyrimethamineThe metabolism of Sulfisoxazole can be decreased when combined with Pyrimethamine.Approved, Investigational, Vet Approved
QuazepamThe metabolism of Quazepam can be decreased when combined with Sulfisoxazole.Approved, Illicit
QuetiapineThe risk or severity of QTc prolongation can be increased when Sulfisoxazole is combined with Quetiapine.Approved
QuinacrineThe metabolism of Quinacrine can be decreased when combined with Sulfisoxazole.Approved, Investigational
QuinidineSulfisoxazole may increase the QTc-prolonging activities of Quinidine.Approved, Investigational
QuinineSulfisoxazole may increase the QTc-prolonging activities of Quinine.Approved
RabeprazoleThe metabolism of Rabeprazole can be decreased when combined with Sulfisoxazole.Approved, Investigational
RaloxifeneThe metabolism of Raloxifene can be decreased when combined with Sulfisoxazole.Approved, Investigational
RamelteonThe serum concentration of Ramelteon can be increased when it is combined with Sulfisoxazole.Approved, Investigational
RanolazineThe serum concentration of Ranolazine can be increased when it is combined with Sulfisoxazole.Approved, Investigational
RasagilineRasagiline may increase the hypoglycemic activities of Sulfisoxazole.Approved
ReboxetineThe metabolism of Reboxetine can be decreased when combined with Sulfisoxazole.Approved, Investigational
RegorafenibThe metabolism of Regorafenib can be decreased when combined with Sulfisoxazole.Approved
RepaglinideThe metabolism of Repaglinide can be decreased when combined with Sulfisoxazole.Approved, Investigational
RetapamulinThe metabolism of Retapamulin can be decreased when combined with Sulfisoxazole.Approved
RifabutinThe metabolism of Rifabutin can be decreased when combined with Sulfisoxazole.Approved, Investigational
RifapentineThe metabolism of Sulfisoxazole can be increased when combined with Rifapentine.Approved, Investigational
RilpivirineThe serum concentration of Rilpivirine can be increased when it is combined with Sulfisoxazole.Approved
RimonabantThe metabolism of Rimonabant can be decreased when combined with Sulfisoxazole.Approved, Investigational
RiociguatThe metabolism of Riociguat can be decreased when combined with Sulfisoxazole.Approved
RisperidoneThe metabolism of Risperidone can be decreased when combined with Sulfisoxazole.Approved, Investigational
RitonavirThe metabolism of Ritonavir can be decreased when combined with Sulfisoxazole.Approved, Investigational
RivaroxabanThe metabolism of Rivaroxaban can be decreased when combined with Sulfisoxazole.Approved
RofecoxibThe metabolism of Rofecoxib can be decreased when combined with Sulfisoxazole.Approved, Investigational, Withdrawn
RolapitantThe metabolism of Rolapitant can be decreased when combined with Sulfisoxazole.Approved, Investigational
RomidepsinThe metabolism of Romidepsin can be decreased when combined with Sulfisoxazole.Approved, Investigational
RopivacaineThe metabolism of Ropivacaine can be decreased when combined with Sulfisoxazole.Approved
RosiglitazoneThe therapeutic efficacy of Rosiglitazone can be increased when used in combination with Sulfisoxazole.Approved, Investigational
RosoxacinRosoxacin may increase the hypoglycemic activities of Sulfisoxazole.Approved, Investigational
RosuvastatinThe therapeutic efficacy of Sulfisoxazole can be increased when used in combination with Rosuvastatin.Approved
RotigotineThe metabolism of Rotigotine can be decreased when combined with Sulfisoxazole.Approved
RoxithromycinThe metabolism of Roxithromycin can be decreased when combined with Sulfisoxazole.Approved, Investigational, Withdrawn
RucaparibThe metabolism of Rucaparib can be decreased when combined with Sulfisoxazole.Approved, Investigational
RufloxacinRufloxacin may increase the hypoglycemic activities of Sulfisoxazole.Experimental
RupatadineThe metabolism of Rupatadine can be decreased when combined with Sulfisoxazole.Approved
RuxolitinibThe metabolism of Ruxolitinib can be decreased when combined with Sulfisoxazole.Approved
SafinamideThe metabolism of Safinamide can be decreased when combined with Sulfisoxazole.Approved, Investigational
SafrazineSafrazine may increase the hypoglycemic activities of Sulfisoxazole.Withdrawn
SalbutamolThe risk or severity of QTc prolongation can be increased when Salbutamol is combined with Sulfisoxazole.Approved, Vet Approved
Salicylic acidSalicylic acid may increase the hypoglycemic activities of Sulfisoxazole.Approved, Investigational, Vet Approved
SalmeterolThe risk or severity of QTc prolongation can be increased when Salmeterol is combined with Sulfisoxazole.Approved
SaquinavirSulfisoxazole may increase the QTc-prolonging activities of Saquinavir.Approved, Investigational
SaxagliptinThe therapeutic efficacy of Saxagliptin can be increased when used in combination with Sulfisoxazole.Approved
SecobarbitalThe metabolism of Sulfisoxazole can be increased when combined with Secobarbital.Approved, Vet Approved
SelegilineThe metabolism of Selegiline can be decreased when combined with Sulfisoxazole.Approved, Investigational, Vet Approved
SelexipagThe metabolism of Selexipag can be decreased when combined with Sulfisoxazole.Approved
SeratrodastThe metabolism of Seratrodast can be decreased when combined with Sulfisoxazole.Approved
SertindoleThe metabolism of Sertindole can be decreased when combined with Sulfisoxazole.Approved, Investigational, Withdrawn
SertralineThe metabolism of Sertraline can be decreased when combined with Sulfisoxazole.Approved
SevofluraneThe metabolism of Sevoflurane can be decreased when combined with Sulfisoxazole.Approved, Vet Approved
SibutramineThe metabolism of Sibutramine can be decreased when combined with Sulfisoxazole.Approved, Illicit, Investigational, Withdrawn
SildenafilThe metabolism of Sildenafil can be decreased when combined with Sulfisoxazole.Approved, Investigational
SilodosinThe metabolism of Silodosin can be decreased when combined with Sulfisoxazole.Approved
Silver sulfadiazineThe therapeutic efficacy of Sulfisoxazole can be increased when used in combination with Silver sulfadiazine.Approved, Vet Approved
SimvastatinThe serum concentration of Simvastatin can be increased when it is combined with Sulfisoxazole.Approved
SirolimusThe metabolism of Sirolimus can be decreased when combined with Sulfisoxazole.Approved, Investigational
SitafloxacinSitafloxacin may increase the hypoglycemic activities of Sulfisoxazole.Experimental, Investigational
SitagliptinThe therapeutic efficacy of Sitagliptin can be increased when used in combination with Sulfisoxazole.Approved, Investigational
SitaxentanThe metabolism of Sitaxentan can be decreased when combined with Sulfisoxazole.Approved, Investigational, Withdrawn
SolifenacinThe metabolism of Solifenacin can be decreased when combined with Sulfisoxazole.Approved
SonidegibThe serum concentration of Sonidegib can be increased when it is combined with Sulfisoxazole.Approved, Investigational
SorafenibThe metabolism of Sorafenib can be decreased when combined with Sulfisoxazole.Approved, Investigational
SotagliflozinSotagliflozin may increase the hypoglycemic activities of Sulfisoxazole.Investigational
SotalolSulfisoxazole may increase the QTc-prolonging activities of Sotalol.Approved
SparfloxacinSparfloxacin may increase the hypoglycemic activities of Sulfisoxazole.Approved, Investigational
SpiramycinThe metabolism of Spiramycin can be decreased when combined with Sulfisoxazole.Approved
StanoloneStanolone may increase the hypoglycemic activities of Sulfisoxazole.Illicit, Investigational
StanozololStanozolol may increase the hypoglycemic activities of Sulfisoxazole.Approved, Vet Approved
SufentanilThe metabolism of Sufentanil can be decreased when combined with Sulfisoxazole.Approved, Investigational
SulfadiazineThe metabolism of Sulfisoxazole can be decreased when combined with Sulfadiazine.Approved, Investigational, Vet Approved
SulfamethoxazoleThe metabolism of Sulfamethoxazole can be decreased when combined with Sulfisoxazole.Approved
SulfamoxoleThe metabolism of Sulfamoxole can be decreased when combined with Sulfisoxazole.Approved
SulfasalazineSulfasalazine may increase the hypoglycemic activities of Sulfisoxazole.Approved
SulfinpyrazoneThe metabolism of Sulfinpyrazone can be decreased when combined with Sulfisoxazole.Approved
SulodexideSulodexide may increase the hypoglycemic activities of Sulfisoxazole.Approved, Investigational
SumatriptanThe therapeutic efficacy of Sulfisoxazole can be increased when used in combination with Sumatriptan.Approved, Investigational
SunitinibThe metabolism of Sunitinib can be decreased when combined with Sulfisoxazole.Approved, Investigational
SuprofenThe metabolism of Suprofen can be decreased when combined with Sulfisoxazole.Approved, Withdrawn
SuvorexantThe serum concentration of Suvorexant can be increased when it is combined with Sulfisoxazole.Approved, Investigational
Synthetic Conjugated Estrogens, AThe metabolism of Synthetic Conjugated Estrogens, A can be decreased when combined with Sulfisoxazole.Approved
Synthetic Conjugated Estrogens, BThe metabolism of Synthetic Conjugated Estrogens, B can be decreased when combined with Sulfisoxazole.Approved
TacrolimusThe metabolism of Tacrolimus can be decreased when combined with Sulfisoxazole.Approved, Investigational
TadalafilThe metabolism of Tadalafil can be decreased when combined with Sulfisoxazole.Approved, Investigational
TamoxifenThe metabolism of Tamoxifen can be decreased when combined with Sulfisoxazole.Approved
TamsulosinThe metabolism of Tamsulosin can be decreased when combined with Sulfisoxazole.Approved, Investigational
TapentadolThe metabolism of Tapentadol can be decreased when combined with Sulfisoxazole.Approved
TasosartanThe metabolism of Tasosartan can be decreased when combined with Sulfisoxazole.Approved
Taurochenodeoxycholic acidThe metabolism of Taurochenodeoxycholic acid can be decreased when combined with Sulfisoxazole.Experimental
TelaprevirThe metabolism of Telaprevir can be decreased when combined with Sulfisoxazole.Approved, Withdrawn
TelavancinSulfisoxazole may increase the QTc-prolonging activities of Telavancin.Approved
TelithromycinSulfisoxazole may increase the QTc-prolonging activities of Telithromycin.Approved
TemafloxacinTemafloxacin may increase the hypoglycemic activities of Sulfisoxazole.Withdrawn
TemazepamThe metabolism of Temazepam can be decreased when combined with Sulfisoxazole.Approved, Investigational
TemsirolimusThe metabolism of Temsirolimus can be decreased when combined with Sulfisoxazole.Approved
TeniposideThe metabolism of Teniposide can be decreased when combined with Sulfisoxazole.Approved
TenoxicamThe metabolism of Tenoxicam can be decreased when combined with Sulfisoxazole.Approved
TerbutalineTerbutaline may increase the QTc-prolonging activities of Sulfisoxazole.Approved
TerfenadineThe metabolism of Terfenadine can be decreased when combined with Sulfisoxazole.Approved, Withdrawn
TergurideThe risk or severity of adverse effects can be increased when Terguride is combined with Sulfisoxazole.Experimental
TerodilineThe risk or severity of QTc prolongation can be increased when Sulfisoxazole is combined with Terodiline.Experimental
TesmilifeneThe metabolism of Tesmilifene can be decreased when combined with Sulfisoxazole.Investigational
TestosteroneThe metabolism of Testosterone can be decreased when combined with Sulfisoxazole.Approved, Investigational
Testosterone cypionateThe metabolism of Testosterone cypionate can be decreased when combined with Sulfisoxazole.Approved
Testosterone enanthateThe metabolism of Testosterone enanthate can be decreased when combined with Sulfisoxazole.Approved
Testosterone propionateThe metabolism of Testosterone propionate can be decreased when combined with Sulfisoxazole.Approved, Investigational, Vet Approved, Withdrawn
Testosterone undecanoateThe metabolism of Testosterone undecanoate can be decreased when combined with Sulfisoxazole.Approved, Investigational
TetrabenazineSulfisoxazole may increase the QTc-prolonging activities of Tetrabenazine.Approved, Investigational
TezacaftorThe metabolism of Tezacaftor can be decreased when combined with Sulfisoxazole.Approved, Investigational
ThalidomideThe metabolism of Thalidomide can be decreased when combined with Sulfisoxazole.Approved, Investigational, Withdrawn
TheophyllineThe metabolism of Theophylline can be decreased when combined with Sulfisoxazole.Approved
ThiamylalThe metabolism of Thiamylal can be decreased when combined with Sulfisoxazole.Approved, Vet Approved
ThiopentalThe therapeutic efficacy of Thiopental can be increased when used in combination with Sulfisoxazole.Approved, Vet Approved
ThioridazineSulfisoxazole may increase the QTc-prolonging activities of Thioridazine.Approved, Withdrawn
ThiotepaThe metabolism of Thiotepa can be decreased when combined with Sulfisoxazole.Approved, Investigational
ThiothixeneThiothixene may increase the QTc-prolonging activities of Sulfisoxazole.Approved
TiagabineThe metabolism of Tiagabine can be decreased when combined with Sulfisoxazole.Approved, Investigational
TicagrelorThe metabolism of Ticagrelor can be decreased when combined with Sulfisoxazole.Approved
TiclopidineThe metabolism of Ticlopidine can be decreased when combined with Sulfisoxazole.Approved
TinidazoleThe metabolism of Tinidazole can be decreased when combined with Sulfisoxazole.Approved, Investigational
TioclomarolSulfisoxazole may increase the anticoagulant activities of Tioclomarol.Experimental
TiotropiumThe metabolism of Tiotropium can be decreased when combined with Sulfisoxazole.Approved
TipranavirThe metabolism of Tipranavir can be decreased when combined with Sulfisoxazole.Approved, Investigational
TizanidineTizanidine may increase the QTc-prolonging activities of Sulfisoxazole.Approved, Investigational
TocofersolanThe metabolism of Tocofersolan can be decreased when combined with Sulfisoxazole.Approved
TocopherolThe metabolism of Tocopherol can be decreased when combined with Sulfisoxazole.Approved, Investigational
TofacitinibThe metabolism of Tofacitinib can be decreased when combined with Sulfisoxazole.Approved, Investigational
TolazamideSulfisoxazole may increase the hypoglycemic activities of Tolazamide.Approved, Investigational
TolbutamideThe metabolism of Sulfisoxazole can be decreased when combined with Tolbutamide.Approved, Investigational
ToloxatoneToloxatone may increase the hypoglycemic activities of Sulfisoxazole.Approved
TolterodineThe metabolism of Tolterodine can be decreased when combined with Sulfisoxazole.Approved, Investigational
TolvaptanThe serum concentration of Tolvaptan can be increased when it is combined with Sulfisoxazole.Approved
TopiroxostatThe metabolism of Sulfisoxazole can be decreased when combined with Topiroxostat.Approved, Investigational
TorasemideThe metabolism of Torasemide can be decreased when combined with Sulfisoxazole.Approved
ToremifeneSulfisoxazole may increase the QTc-prolonging activities of Toremifene.Approved, Investigational
TrabectedinThe metabolism of Trabectedin can be decreased when combined with Sulfisoxazole.Approved, Investigational
TranylcypromineTranylcypromine may increase the hypoglycemic activities of Sulfisoxazole.Approved, Investigational
Trastuzumab emtansineThe metabolism of Trastuzumab emtansine can be decreased when combined with Sulfisoxazole.Approved, Investigational
TrazodoneThe metabolism of Trazodone can be decreased when combined with Sulfisoxazole.Approved, Investigational
TreprostinilThe metabolism of Treprostinil can be decreased when combined with Sulfisoxazole.Approved, Investigational
TretinoinThe metabolism of Tretinoin can be decreased when combined with Sulfisoxazole.Approved, Investigational, Nutraceutical
TriamcinoloneThe metabolism of Triamcinolone can be decreased when combined with Sulfisoxazole.Approved, Vet Approved
TriazolamThe metabolism of Triazolam can be decreased when combined with Sulfisoxazole.Approved, Investigational
TrimethoprimThe metabolism of Trimethoprim can be decreased when combined with Sulfisoxazole.Approved, Vet Approved
TrimipramineThe metabolism of Trimipramine can be decreased when combined with Sulfisoxazole.Approved
TriptorelinTriptorelin may increase the QTc-prolonging activities of Sulfisoxazole.Approved, Vet Approved
TroglitazoneThe metabolism of Troglitazone can be decreased when combined with Sulfisoxazole.Investigational, Withdrawn
Trolamine salicylateTrolamine salicylate may increase the hypoglycemic activities of Sulfisoxazole.Approved
TroleandomycinThe metabolism of Troleandomycin can be decreased when combined with Sulfisoxazole.Approved
TrovafloxacinTrovafloxacin may increase the hypoglycemic activities of Sulfisoxazole.Approved, Investigational, Withdrawn
UdenafilThe metabolism of Udenafil can be decreased when combined with Sulfisoxazole.Approved, Investigational
UlipristalThe serum concentration of Ulipristal can be increased when it is combined with Sulfisoxazole.Approved
ValbenazineThe metabolism of Valbenazine can be decreased when combined with Sulfisoxazole.Approved, Investigational
ValdecoxibThe metabolism of Valdecoxib can be decreased when combined with Sulfisoxazole.Approved, Investigational, Withdrawn
Valproic AcidThe risk or severity of QTc prolongation can be increased when Sulfisoxazole is combined with Valproic Acid.Approved, Investigational
ValsartanThe metabolism of Valsartan can be decreased when combined with Sulfisoxazole.Approved, Investigational
VandetanibSulfisoxazole may increase the QTc-prolonging activities of Vandetanib.Approved
VanoxerineThe metabolism of Vanoxerine can be decreased when combined with Sulfisoxazole.Investigational
VardenafilThe metabolism of Vardenafil can be decreased when combined with Sulfisoxazole.Approved
VelpatasvirThe metabolism of Velpatasvir can be decreased when combined with Sulfisoxazole.Approved, Investigational
VemurafenibSulfisoxazole may increase the QTc-prolonging activities of Vemurafenib.Approved
VenetoclaxThe metabolism of Venetoclax can be decreased when combined with Sulfisoxazole.Approved, Investigational
VenlafaxineThe risk or severity of QTc prolongation can be increased when Venlafaxine is combined with Sulfisoxazole.Approved
VicrivirocThe metabolism of Vicriviroc can be decreased when combined with Sulfisoxazole.Investigational
VilanterolThe metabolism of Vilanterol can be decreased when combined with Sulfisoxazole.Approved
VilazodoneThe serum concentration of Vilazodone can be increased when it is combined with Sulfisoxazole.Approved
VildagliptinVildagliptin may increase the hypoglycemic activities of Sulfisoxazole.Approved, Investigational
VinblastineThe metabolism of Vinblastine can be decreased when combined with Sulfisoxazole.Approved
VincristineThe metabolism of Vincristine can be decreased when combined with Sulfisoxazole.Approved, Investigational
VindesineThe serum concentration of Vindesine can be increased when it is combined with Sulfisoxazole.Approved, Investigational
VinflunineThe metabolism of Vinflunine can be decreased when combined with Sulfisoxazole.Approved, Investigational
VinorelbineThe metabolism of Vinorelbine can be decreased when combined with Sulfisoxazole.Approved, Investigational
VismodegibThe metabolism of Vismodegib can be decreased when combined with Sulfisoxazole.Approved, Investigational
VogliboseVoglibose may increase the hypoglycemic activities of Sulfisoxazole.Approved, Investigational
VoriconazoleThe metabolism of Voriconazole can be decreased when combined with Sulfisoxazole.Approved, Investigational
VorinostatVorinostat may increase the QTc-prolonging activities of Sulfisoxazole.Approved, Investigational
VortioxetineThe metabolism of Vortioxetine can be decreased when combined with Sulfisoxazole.Approved, Investigational
VoxilaprevirThe metabolism of Voxilaprevir can be decreased when combined with Sulfisoxazole.Approved, Investigational
WarfarinThe metabolism of Warfarin can be decreased when combined with Sulfisoxazole.Approved
XimelagatranThe metabolism of Ximelagatran can be decreased when combined with Sulfisoxazole.Approved, Investigational, Withdrawn
YohimbineThe metabolism of Yohimbine can be decreased when combined with Sulfisoxazole.Approved, Investigational, Vet Approved
ZafirlukastThe metabolism of Zafirlukast can be decreased when combined with Sulfisoxazole.Approved, Investigational
ZalcitabineThe metabolism of Zalcitabine can be decreased when combined with Sulfisoxazole.Approved, Investigational
ZaleplonThe metabolism of Zaleplon can be decreased when combined with Sulfisoxazole.Approved, Illicit, Investigational
ZaltoprofenThe metabolism of Zaltoprofen can be decreased when combined with Sulfisoxazole.Approved, Investigational
ZileutonThe metabolism of Zileuton can be decreased when combined with Sulfisoxazole.Approved, Investigational, Withdrawn
ZimelidineZimelidine may increase the hypoglycemic activities of Sulfisoxazole.Withdrawn
ZiprasidoneSulfisoxazole may increase the QTc-prolonging activities of Ziprasidone.Approved
ZomepiracThe metabolism of Zomepirac can be decreased when combined with Sulfisoxazole.Withdrawn
ZopicloneThe serum concentration of Zopiclone can be increased when it is combined with Sulfisoxazole.Approved
ZotepineThe metabolism of Zotepine can be decreased when combined with Sulfisoxazole.Approved, Investigational, Withdrawn
ZuclopenthixolThe serum concentration of Zuclopenthixol can be increased when it is combined with Sulfisoxazole.Approved, Investigational
Food Interactions
Not Available


General References
Not Available
External Links
Human Metabolome Database
KEGG Compound
PubChem Compound
PubChem Substance
Therapeutic Targets Database
PA164748964 Drug Page
ATC Codes
J01EB05 — SulfafurazoleS01AB02 — SulfafurazoleG01AE10 — Combinations of sulfonamides
AHFS Codes
  • 08:12.20 — Sulfonamides
Download (72 KB)

Clinical Trials

Clinical Trials


  • Hoffmann la roche inc
  • Mk laboratories inc
  • Alra laboratories inc
  • Parke davis div warner lambert co
  • Barr laboratories inc
  • Heather drug co inc
  • Impax laboratories inc
  • Ivax pharmaceuticals inc sub teva pharmaceuticals usa
  • Lannett co inc
  • Lederle laboratories div american cyanamid co
  • Pharmeral inc
  • Purepac pharmaceutical co
  • Roxane laboratories inc
  • Sandoz inc
  • Valeant pharmaceuticals international
  • Vitarine pharmaceuticals inc
  • Watson laboratories inc
  • West ward pharmaceutical corp
  • Solvay pharmaceuticals
  • Sola barnes hind
  • Amend
  • Barr Pharmaceuticals
  • Dispensing Solutions
  • Duramed
  • Major Pharmaceuticals
  • Mississippi State Dept Health
  • Pharmaceutics International Inc.
  • Pharmedix
  • Physicians Total Care Inc.
  • Preferred Pharmaceuticals Inc.
  • Qualitest
  • United Research Laboratories Inc.
Dosage forms
Powder, for suspensionOral
TabletOral500 mg
Unit descriptionCostUnit
Sulfisoxazole crystals1.01USD g
Sulfazine EC 500 mg Enteric Coated Tabs0.42USD tab
Sulfazine ec 500 mg tablet0.38USD tablet
Sulfazine 500 mg tablet0.25USD tablet
DrugBank does not sell nor buy drugs. Pricing information is supplied for informational purposes only.
Not Available


Experimental Properties
melting point (°C)191 °CPhysProp
water solubility300 mg/L (at 37 °C)YALKOWSKY,SH & DANNENFELSER,RM (1992)
logP1.01HANSCH,C ET AL. (1995)
logS-2.91ADME Research, USCD
pKa5Not Available
Predicted Properties
Water Solubility0.313 mg/mLALOGPS
pKa (Strongest Acidic)5.8ChemAxon
pKa (Strongest Basic)2.17ChemAxon
Physiological Charge-1ChemAxon
Hydrogen Acceptor Count4ChemAxon
Hydrogen Donor Count2ChemAxon
Polar Surface Area98.22 Å2ChemAxon
Rotatable Bond Count2ChemAxon
Refractivity67.92 m3·mol-1ChemAxon
Polarizability26.93 Å3ChemAxon
Number of Rings2ChemAxon
Rule of FiveYesChemAxon
Ghose FilterYesChemAxon
Veber's RuleNoChemAxon
MDDR-like RuleNoChemAxon
Predicted ADMET features
Human Intestinal Absorption+0.9908
Blood Brain Barrier+0.9382
Caco-2 permeable-0.6046
P-glycoprotein substrateNon-substrate0.8891
P-glycoprotein inhibitor INon-inhibitor0.9357
P-glycoprotein inhibitor IINon-inhibitor0.9698
Renal organic cation transporterNon-inhibitor0.9322
CYP450 2C9 substrateNon-substrate0.8056
CYP450 2D6 substrateNon-substrate0.9116
CYP450 3A4 substrateNon-substrate0.7557
CYP450 1A2 substrateNon-inhibitor0.9621
CYP450 2C9 inhibitorNon-inhibitor0.9071
CYP450 2D6 inhibitorNon-inhibitor0.9358
CYP450 2C19 inhibitorNon-inhibitor0.9292
CYP450 3A4 inhibitorNon-inhibitor0.9386
CYP450 inhibitory promiscuityLow CYP Inhibitory Promiscuity0.8037
Ames testNon AMES toxic0.9133
BiodegradationNot ready biodegradable1.0
Rat acute toxicity1.4586 LD50, mol/kg Not applicable
hERG inhibition (predictor I)Weak inhibitor0.9896
hERG inhibition (predictor II)Non-inhibitor0.9442
ADMET data is predicted using admetSAR, a free tool for evaluating chemical ADMET properties. (23092397)


Mass Spec (NIST)
Download (8.71 KB)
SpectrumSpectrum TypeSplash Key
Predicted GC-MS Spectrum - GC-MSPredicted GC-MSNot Available
Predicted MS/MS Spectrum - 10V, Positive (Annotated)Predicted LC-MS/MSNot Available
Predicted MS/MS Spectrum - 20V, Positive (Annotated)Predicted LC-MS/MSNot Available
Predicted MS/MS Spectrum - 40V, Positive (Annotated)Predicted LC-MS/MSNot Available
Predicted MS/MS Spectrum - 10V, Negative (Annotated)Predicted LC-MS/MSNot Available
Predicted MS/MS Spectrum - 20V, Negative (Annotated)Predicted LC-MS/MSNot Available
Predicted MS/MS Spectrum - 40V, Negative (Annotated)Predicted LC-MS/MSNot Available
LC-MS/MS Spectrum - LC-ESI-qTof , PositiveLC-MS/MSNot Available
LC-MS/MS Spectrum - LC-ESI-QTOF , positiveLC-MS/MSsplash10-0a4i-3900000000-23eed4bc89bcf24079bd
MS/MS Spectrum - , positiveLC-MS/MSsplash10-0aor-1930000000-47a2d9042541d8f86f85
MS/MS Spectrum - , positiveLC-MS/MSsplash10-0a4i-2930000000-9fc0d3e8e143637637e8
MS/MS Spectrum - , positiveLC-MS/MSsplash10-0a4i-5911100000-18e92b64e6fb25ed4e6d


This compound belongs to the class of organic compounds known as aminobenzenesulfonamides. These are organic compounds containing a benzenesulfonamide moiety with an amine group attached to the benzene ring.
Organic compounds
Super Class
Benzene and substituted derivatives
Sub Class
Direct Parent
Alternative Parents
Benzenesulfonyl compounds / Aniline and substituted anilines / Organosulfonamides / Isoxazoles / Heteroaromatic compounds / Aminosulfonyl compounds / Oxacyclic compounds / Azacyclic compounds / Primary amines / Organopnictogen compounds
show 3 more
Aminobenzenesulfonamide / Benzenesulfonyl group / Aniline or substituted anilines / Organosulfonic acid amide / Azole / Isoxazole / Organic sulfonic acid or derivatives / Organosulfonic acid or derivatives / Sulfonyl / Aminosulfonyl compound
show 15 more
Molecular Framework
Aromatic heteromonocyclic compounds
External Descriptors
sulfonamide, isoxazoles, sulfonamide antibiotic (CHEBI:102484)


Escherichia coli (strain K12)
Pharmacological action
General Function
Metal ion binding
Specific Function
Catalyzes the condensation of para-aminobenzoate (pABA) with 6-hydroxymethyl-7,8-dihydropterin diphosphate (DHPt-PP) to form 7,8-dihydropteroate (H2Pte), the immediate precursor of folate derivatives.
Gene Name
Uniprot ID
Uniprot Name
Dihydropteroate synthase
Molecular Weight
30614.855 Da
  1. Imming P, Sinning C, Meyer A: Drugs, their targets and the nature and number of drug targets. Nat Rev Drug Discov. 2006 Oct;5(10):821-34. [PubMed:17016423]
  2. Jorgensen JH, Crawford SA, Fiebelkorn KR: Susceptibility of Neisseria meningitidis to 16 antimicrobial agents and characterization of resistance mechanisms affecting some agents. J Clin Microbiol. 2005 Jul;43(7):3162-71. [PubMed:16000430]
  3. Fiebelkorn KR, Crawford SA, Jorgensen JH: Mutations in folP associated with elevated sulfonamide MICs for Neisseria meningitidis clinical isolates from five continents. Antimicrob Agents Chemother. 2005 Feb;49(2):536-40. [PubMed:15673729]
  4. Hong YL, Hossler PA, Calhoun DH, Meshnick SR: Inhibition of recombinant Pneumocystis carinii dihydropteroate synthetase by sulfa drugs. Antimicrob Agents Chemother. 1995 Aug;39(8):1756-63. [PubMed:7486915]


Pharmacological action
General Function
Steroid hydroxylase activity
Specific Function
Cytochromes P450 are a group of heme-thiolate monooxygenases. In liver microsomes, this enzyme is involved in an NADPH-dependent electron transport pathway. It oxidizes a variety of structurally un...
Gene Name
Uniprot ID
Uniprot Name
Cytochrome P450 2C9
Molecular Weight
55627.365 Da
  1. Komatsu K, Ito K, Nakajima Y, Kanamitsu Si, Imaoka S, Funae Y, Green CE, Tyson CA, Shimada N, Sugiyama Y: Prediction of in vivo drug-drug interactions between tolbutamide and various sulfonamides in humans based on in vitro experiments. Drug Metab Dispos. 2000 Apr;28(4):475-81. [PubMed:10725317]
Pharmacological action
General Function
Vitamin d3 25-hydroxylase activity
Specific Function
Cytochromes P450 are a group of heme-thiolate monooxygenases. In liver microsomes, this enzyme is involved in an NADPH-dependent electron transport pathway. It performs a variety of oxidation react...
Gene Name
Uniprot ID
Uniprot Name
Cytochrome P450 3A4
Molecular Weight
57342.67 Da

Drug created on June 13, 2005 07:24 / Updated on August 15, 2018 09:38