Identification

Name
Erythromycin
Accession Number
DB00199  (APRD00953)
Type
Small Molecule
Groups
Approved, Vet Approved
Description

Erythromycin is a macrolide antibiotic produced by Saccharopolyspora erythraea (formerly Streptomyces erythraeus). It inhibits bacterial protein synthesis by binding to bacterial 50S ribosomal subunits; binding inhibits peptidyl transferase activity and interferes with translocation of amino acids during translation and assembly of proteins. Erythromycin may be bacteriostatic or bactericidal depending on the organism and drug concentration.

Structure
Thumb
Synonyms
  • 3''-O-demethylerythromycin
  • Abomacetin
  • Eritromicina
  • Erythromycin A
  • Erythromycin C
  • érythromycine
  • Erythromycinum
External IDs
NSC-55929
Product Ingredients
IngredientUNIICASInChI Key
Erythromycin estolateXRJ2P631HP3521-62-8AWMFUEJKWXESNL-JZBHMOKNSA-N
Erythromycin ethylsuccinate1014KSJ86F1264-62-6NSYZCCDSJNWWJL-YXOIYICCSA-N
Erythromycin gluceptate2AY21R0U6423067-13-2ZXBDZLHAHGPXIG-VTXLJDRKSA-N
Erythromycin lactobionate33H58I7GLQ3847-29-8NNRXCKZMQLFUPL-WBMZRJHASA-N
Erythromycin phosphateI8T8KU14X74501-00-2VUEMAFLGEMYXIH-YZPBMOCRSA-N
Erythromycin stearateLXW024X05M643-22-1YAVZHCFFUATPRK-YZPBMOCRSA-N
Erythromycin sulfateKVW9N83AME7184-72-7XTSSJGRRFMNXGO-YZPBMOCRSA-N
Erythromycin thiocyanateY7A95YRI887704-67-8WVRRTEYLDPNZHR-YZPBMOCRSA-N
Product Images
Prescription Products
NameDosageStrengthRouteLabellerMarketing StartMarketing End
Alti-erythromycin Tab 250mg USPTablet, delayed release250 mgOralAltimed Pharma Inc.1985-12-311999-09-17Canada
E.E.sGranule, for suspension200 mg/5mLOralArbor Pharmaceuticals2011-04-18Not applicableUs
E.E.sGranule, for suspension200 mg/5mLOralArbor Pharmaceuticals2011-04-18Not applicableUs
E.E.sGranule, for suspension200 mg/5mLOralA S Medication Solutions2011-04-182017-06-20Us
Ees 600 Tablets 600mgTablet600 mgOralAmdipharm Limited1983-12-312017-06-13Canada
Ees-200Powder, for suspension40 mgOralAmdipharm Limited1962-12-312017-06-22Canada
Ees-200 Chewable Tbs (eryped)Tablet200 mgOralAbbott1964-12-311997-08-18Canada
Ees-400Powder, for suspension400 mgOralAmdipharm Limited1978-12-312017-06-22Canada
Emycin Ect 250mgTablet, delayed release250 mgOralUpjohn1969-12-311996-09-10Canada
Ery-PedSuspension200 mg/5mLOralArbor Pharmaceuticals2011-07-05Not applicableUs
Generic Prescription Products
NameDosageStrengthRouteLabellerMarketing StartMarketing End
E.E.s 400Tablet400 mg/1OralArbor Pharmaceuticals2011-05-03Not applicableUs
E.E.S.Tablet, film coated400 mg/1OralPd Rx Pharmaceuticals, Inc.2010-12-162017-02-07Us
E.E.S.Tablet, film coated400 mg/1OralPd Rx Pharmaceuticals, Inc.2010-12-162017-02-17Us
ErySolution.8 mL/100mLTopicalPerrigo New York Inc.2008-07-07Not applicableUs
Ery-tabTablet, delayed release333 mg/1OralStat Rx USA2011-04-18Not applicableUs24338 0124 13 nlmimage10 86404302
Ery-tabTablet, delayed release333 mg/1OralA S Medication Solutions2011-04-182017-06-20Us
Ery-tabTablet, delayed release333 mg/1OralCarilion Materials Management2011-04-18Not applicableUs
Ery-tabTablet, delayed release333 mg/1OralRebel Distributors1972-07-11Not applicableUs
Ery-tabTablet, delayed release500 mg/1OralPd Rx Pharmaceuticals, Inc.2011-04-18Not applicableUs
Ery-TabTablet333 mg/1OralRemedy Repack2011-08-192016-11-09Us
International/Other Brands
Eryc (Hospira) / Ilosone (Cipa) / Staticin (Westwood) / T-stat (Westwood)
Mixture Products
NameIngredientsDosageRouteLabellerMarketing StartMarketing End
AktipakErythromycin (30 mg/g) + Benzoyl peroxide (50 mg/g)GelTopicalCutanea Life Sciences, Inc.2017-04-10Not applicableUs
BenzamycinErythromycin + Benzoyl peroxideKitDermik Laboratories1985-01-012016-01-31Us
BenzamycinErythromycin (30 mg) + Benzoyl peroxide (50 mg)GelTopicalValeant Canada Lp Valeant Canada S.E.C.1996-11-05Not applicableCanada
BenzamycinErythromycin + Benzoyl peroxideKitValeant Pharmaceuticals North America1984-10-26Not applicableUs
ErysolErythromycin (2 %) + Avobenzone (2 %) + Ethanol (75 %) + Octinoxate (7.5 %)GelTopicalGlaxosmithkline Inc1994-12-312015-02-03Canada
Erythromycin and Benzoyl PeroxideErythromycin + Benzoyl peroxideKitOceanside Pharmaceuticals1984-10-26Not applicableUs
Erythromycin and Benzoyl PeroxideErythromycin + Benzoyl peroxideKitTopicalSandoz2004-03-29Not applicableUs
Erythromycin and Benzoyl PeroxideErythromycin (30 mg/g) + Benzoyl peroxide (50 mg/g)GelTopicalLyne Laboratories, Inc.2015-12-01Not applicableUs
Erythromycin and Benzoyl PeroxideErythromycin + Benzoyl peroxideKitOceanside Pharmaceuticals1984-10-26Not applicableUs
Erythromycin and Benzoyl PeroxideErythromycin (30 mg/g) + Benzoyl peroxide (50 mg/g)GelTopicalRising Pharmaceuticals2016-10-18Not applicableUs
Categories
UNII
63937KV33D
CAS number
114-07-8
Weight
Average: 733.9268
Monoisotopic: 733.461241235
Chemical Formula
C37H67NO13
InChI Key
ULGZDMOVFRHVEP-RWJQBGPGSA-N
InChI
InChI=1S/C37H67NO13/c1-14-25-37(10,45)30(41)20(4)27(39)18(2)16-35(8,44)32(51-34-28(40)24(38(11)12)15-19(3)47-34)21(5)29(22(6)33(43)49-25)50-26-17-36(9,46-13)31(42)23(7)48-26/h18-26,28-32,34,40-42,44-45H,14-17H2,1-13H3/t18-,19-,20+,21+,22-,23+,24+,25-,26+,28-,29+,30-,31+,32-,34+,35-,36-,37-/m1/s1
IUPAC Name
(3R,4S,5S,6R,7R,9R,11R,12R,13S,14R)-6-{[(2S,3R,4S,6R)-4-(dimethylamino)-3-hydroxy-6-methyloxan-2-yl]oxy}-14-ethyl-7,12,13-trihydroxy-4-{[(2R,4R,5S,6S)-5-hydroxy-4-methoxy-4,6-dimethyloxan-2-yl]oxy}-3,5,7,9,11,13-hexamethyl-1-oxacyclotetradecane-2,10-dione
SMILES

Pharmacology

Indication

For use in the treatment of infections caused by susceptible strains of microorganisms in the following diseases: respiratory tract infections (upper and lower) of mild to moderate degree, pertussis (whooping cough), as adjunct to antitoxin in infections due to Corynebacterium diphtheriae, in the treatment of infections due to Corynebacterium minutissimum, intestinal amebiasis caused by Entamoeba histolytica, acute pelvic inflammatory disease caused by Neisseria gonorrhoeae, skin and soft tissue infections of mild to moderate severity caused by Streptococcus pyogenes and Staphylococcus aureus, primary syphilis caused by Treponema pallidum, infections caused by Chlamydia trachomatis, nongonococcal urethritis caused by Ureaplasma urealyticum, and Legionnaires' disease caused by Legionella pneumophila.

Structured Indications
Pharmacodynamics

Erythromycin is produced by a strain of Streptomyces erythraeus and belongs to the macrolide group of antibiotics. After absorption, erythromycin diffuses readily into most body fluids. In the absence of meningeal inflammation, low concentrations are normally achieved in the spinal fluid, but the passage of the drug across the blood-brain barrier increases in meningitis. Erythromycin is excreted in breast milk. The drug crosses the placental barrier with fetal serum drug levels reaching 5 - 20% of maternal serum concentrations. Erythromycin is not removed by peritoneal dialysis or hemodialysis.

Mechanism of action

Erythromycin acts by penetrating the bacterial cell membrane and reversibly binding to the 50 S subunit of bacterial ribosomes or near the “P” or donor site so that binding of tRNA (transfer RNA) to the donor site is blocked. Translocation of peptides from the “A” or acceptor site to the “P” or donor site is prevented, and subsequent protein synthesis is inhibited. Erythromycin is effective only against actively dividing organisms. The exact mechanism by which erythmromycin reduces lesions of acne vulgaris is not fully known: however, the effect appears to be due in part to the antibacterial activity of the drug.

TargetActionsOrganism
A23S rRNA
inhibitor
Enteric bacteria and other eubacteria
NMotilin receptor
agonist
Human
NPotassium voltage-gated channel subfamily H member 2
inhibitor
Human
NSerum albumin
binder
Human
Absorption

Orally administered erythromycin base and its salts are readily absorbed in the microbiologically active form. Topical application of the ophthalmic ointment to the eye may result in absorption into the cornea and aqueous humor.

Volume of distribution
Not Available
Protein binding

Erythromycin is largely bound to plasma proteins, ranging from 75 - 95% binding depending on the form.

Metabolism

Hepatic. Extensively metabolized - after oral administration, less than 5% of the administered dose can be recovered in the active form in the urine. Erythromycin is partially metabolized by CYP3A4 resulting in numerous drug interactions.

Route of elimination
Not Available
Half life

0.8 - 3 hours

Clearance
Not Available
Toxicity

Symptoms of overdose include diarrhea, nausea, stomach cramps, and vomiting.

Affected organisms
  • Enteric bacteria and other eubacteria
  • Streptococcus pyogenes
  • Haemophilus influenzae
  • Staphylococcus aureus
Pathways
PathwayCategory
Erythromycin Action PathwayDrug action
Pharmacogenomic Effects/ADRs
Interacting Gene/EnzymeAllele nameGenotype(s)Defining Change(s)Type(s)DescriptionDetails
Glucose-6-phosphate 1-dehydrogenaseVilleurbanneNot Available1000_1002delACCADR InferredIncreased risk of dose-related hemolysis.Details
Glucose-6-phosphate 1-dehydrogenaseTorunNot Available1006A->GADR InferredIncreased risk of dose-related hemolysis.Details
Glucose-6-phosphate 1-dehydrogenaseSunderlandNot Available105_107delCATADR InferredIncreased risk of dose-related hemolysis.Details
Glucose-6-phosphate 1-dehydrogenaseIwatsukiNot Available1081G->AADR InferredIncreased risk of dose-related hemolysis.Details
Glucose-6-phosphate 1-dehydrogenaseSerresNot Available1082C->TADR InferredIncreased risk of dose-related hemolysis.Details
Glucose-6-phosphate 1-dehydrogenaseTondelaNot Available1084_1101delCTGAACGAGCGCAAGGCCADR InferredIncreased risk of dose-related hemolysis.Details
Glucose-6-phosphate 1-dehydrogenaseLoma LindaNot Available1089C->AADR InferredIncreased risk of dose-related hemolysis.Details
Glucose-6-phosphate 1-dehydrogenaseAachenNot Available1089C->GADR InferredIncreased risk of dose-related hemolysis.Details
Glucose-6-phosphate 1-dehydrogenaseTenriNot Available1096A->GADR InferredIncreased risk of dose-related hemolysis.Details
Glucose-6-phosphate 1-dehydrogenaseMontpellierNot Available1132G>AADR InferredIncreased risk of dose-related hemolysis.Details
Glucose-6-phosphate 1-dehydrogenaseCalvo MackennaNot Available1138A->GADR InferredIncreased risk of dose-related hemolysis.Details
Glucose-6-phosphate 1-dehydrogenaseRileyNot Available1139T->CADR InferredIncreased risk of dose-related hemolysis.Details
Glucose-6-phosphate 1-dehydrogenaseOlomoucNot Available1141T->CADR InferredIncreased risk of dose-related hemolysis.Details
Glucose-6-phosphate 1-dehydrogenaseTomahNot Available1153T->CADR InferredIncreased risk of dose-related hemolysis.Details
Glucose-6-phosphate 1-dehydrogenaseLynwoodNot Available1154G->TADR InferredIncreased risk of dose-related hemolysis.Details
Glucose-6-phosphate 1-dehydrogenaseMadridNot Available1155C->GADR InferredIncreased risk of dose-related hemolysis.Details
Glucose-6-phosphate 1-dehydrogenaseIowa, Walter Reed, SpringfieldNot Available1156A->GADR InferredIncreased risk of dose-related hemolysis.Details
Glucose-6-phosphate 1-dehydrogenaseBeverly Hills, Genova, Iwate, Niigata, YamaguchiNot Available1160G->AADR InferredIncreased risk of dose-related hemolysis.Details
Glucose-6-phosphate 1-dehydrogenaseHartfordNot Available1162A->GADR InferredIncreased risk of dose-related hemolysis.Details
Glucose-6-phosphate 1-dehydrogenasePrahaNot Available1166A->GADR InferredIncreased risk of dose-related hemolysis.Details
Glucose-6-phosphate 1-dehydrogenaseKrakowNot Available1175T>CADR InferredIncreased risk of dose-related hemolysis.Details
Glucose-6-phosphate 1-dehydrogenaseWisconsinNot Available1177C->GADR InferredIncreased risk of dose-related hemolysis.Details
Glucose-6-phosphate 1-dehydrogenaseNashville, Anaheim, PorticiNot Available1178G->AADR InferredIncreased risk of dose-related hemolysis.Details
Glucose-6-phosphate 1-dehydrogenaseAlhambraNot Available1180G->CADR InferredIncreased risk of dose-related hemolysis.Details
Glucose-6-phosphate 1-dehydrogenaseBariNot Available1187C->TADR InferredIncreased risk of dose-related hemolysis.Details
Glucose-6-phosphate 1-dehydrogenasePuerto LimonNot Available1192G->AADR InferredIncreased risk of dose-related hemolysis.Details
Glucose-6-phosphate 1-dehydrogenaseCovao do LoboNot Available1205C>AADR InferredIncreased risk of dose-related hemolysis.Details
Glucose-6-phosphate 1-dehydrogenaseClinicNot Available1215G->AADR InferredIncreased risk of dose-related hemolysis.Details
Glucose-6-phosphate 1-dehydrogenaseUtrechtNot Available1225C->TADR InferredIncreased risk of dose-related hemolysis.Details
Glucose-6-phosphate 1-dehydrogenaseSuwalkiNot Available1226C->GADR InferredIncreased risk of dose-related hemolysis.Details
Glucose-6-phosphate 1-dehydrogenaseRiversideNot Available1228G->TADR InferredIncreased risk of dose-related hemolysis.Details
Glucose-6-phosphate 1-dehydrogenaseJapan, ShinagawaNot Available1229G->AADR InferredIncreased risk of dose-related hemolysis.Details
Glucose-6-phosphate 1-dehydrogenaseKawasakiNot Available1229G->CADR InferredIncreased risk of dose-related hemolysis.Details
Glucose-6-phosphate 1-dehydrogenaseMunichNot Available1231A->GADR InferredIncreased risk of dose-related hemolysis.Details
Glucose-6-phosphate 1-dehydrogenaseGeorgiaNot Available1284C->AADR InferredIncreased risk of dose-related hemolysis.Details
Glucose-6-phosphate 1-dehydrogenaseSumareNot Available1292T->GADR InferredIncreased risk of dose-related hemolysis.Details
Glucose-6-phosphate 1-dehydrogenaseTelti/KobeNot Available1318C->TADR InferredIncreased risk of dose-related hemolysis.Details
Glucose-6-phosphate 1-dehydrogenaseSantiago de Cuba, MoriokaNot Available1339G->AADR InferredIncreased risk of dose-related hemolysis.Details
Glucose-6-phosphate 1-dehydrogenaseHarimaNot Available1358T->AADR InferredIncreased risk of dose-related hemolysis.Details
Glucose-6-phosphate 1-dehydrogenaseFiguera da FozNot Available1366G->CADR InferredIncreased risk of dose-related hemolysis.Details
Glucose-6-phosphate 1-dehydrogenaseAmiensNot Available1367A>TADR InferredIncreased risk of dose-related hemolysis.Details
Glucose-6-phosphate 1-dehydrogenaseBangkok NoiNot Available1376G->T, 1502T->GADR InferredIncreased risk of dose-related hemolysis.Details
Glucose-6-phosphate 1-dehydrogenaseFukayaNot Available1462G->AADR InferredIncreased risk of dose-related hemolysis.Details
Glucose-6-phosphate 1-dehydrogenaseCampinasNot Available1463G->TADR InferredIncreased risk of dose-related hemolysis.Details
Glucose-6-phosphate 1-dehydrogenaseBuenos AiresNot Available1465C>TADR InferredIncreased risk of dose-related hemolysis.Details
Glucose-6-phosphate 1-dehydrogenaseArakawaNot Available1466C->TADR InferredIncreased risk of dose-related hemolysis.Details
Glucose-6-phosphate 1-dehydrogenaseBrightonNot Available1488_1490delGAAADR InferredIncreased risk of dose-related hemolysis.Details
Glucose-6-phosphate 1-dehydrogenaseKozukataNot Available159G->CADR InferredIncreased risk of dose-related hemolysis.Details
Glucose-6-phosphate 1-dehydrogenaseAmsterdamNot Available180_182delTCTADR InferredIncreased risk of dose-related hemolysis.Details
Glucose-6-phosphate 1-dehydrogenaseNo nameNot Available202G->A, 376A->G, 1264C>GADR InferredIncreased risk of dose-related hemolysis.Details
Glucose-6-phosphate 1-dehydrogenaseSwanseaNot Available224T->CADR InferredIncreased risk of dose-related hemolysis.Details
Glucose-6-phosphate 1-dehydrogenaseUrayasuNot Available281_283delAGAADR InferredIncreased risk of dose-related hemolysis.Details
Glucose-6-phosphate 1-dehydrogenaseVancouverNot Available317C->G544C->T592C->TADR InferredIncreased risk of dose-related hemolysis.Details
Glucose-6-phosphate 1-dehydrogenaseMt SinaiNot Available376A->G, 1159C->TADR InferredIncreased risk of dose-related hemolysis.Details
Glucose-6-phosphate 1-dehydrogenasePlymouthNot Available488G->AADR InferredIncreased risk of dose-related hemolysis.Details
Glucose-6-phosphate 1-dehydrogenaseVolendamNot Available514C->TADR InferredIncreased risk of dose-related hemolysis.Details
Glucose-6-phosphate 1-dehydrogenaseShinshuNot Available527A->GADR InferredIncreased risk of dose-related hemolysis.Details
Glucose-6-phosphate 1-dehydrogenaseChikugoNot Available535A->TADR InferredIncreased risk of dose-related hemolysis.Details
Glucose-6-phosphate 1-dehydrogenaseTsukuiNot Available561_563delCTCADR InferredIncreased risk of dose-related hemolysis.Details
Glucose-6-phosphate 1-dehydrogenasePedoplis-CkaroNot Available573C>GADR InferredIncreased risk of dose-related hemolysis.Details
Glucose-6-phosphate 1-dehydrogenaseSantiagoNot Available593G->CADR InferredIncreased risk of dose-related hemolysis.Details
Glucose-6-phosphate 1-dehydrogenaseMinnesota, Marion, Gastonia, LeJeuneNot Available637G->TADR InferredIncreased risk of dose-related hemolysis.Details
Glucose-6-phosphate 1-dehydrogenaseCincinnatiNot Available637G->T, 1037A->TADR InferredIncreased risk of dose-related hemolysis.Details
Glucose-6-phosphate 1-dehydrogenaseHarilaouNot Available648T->GADR InferredIncreased risk of dose-related hemolysis.Details
Glucose-6-phosphate 1-dehydrogenaseNorth DallasNot Available683_685delACAADR InferredIncreased risk of dose-related hemolysis.Details
Glucose-6-phosphate 1-dehydrogenaseAsahikawaNot Available695G->AADR InferredIncreased risk of dose-related hemolysis.Details
Glucose-6-phosphate 1-dehydrogenaseDurhamNot Available713A->GADR InferredIncreased risk of dose-related hemolysis.Details
Glucose-6-phosphate 1-dehydrogenaseStonybrookNot Available724_729delGGCACTADR InferredIncreased risk of dose-related hemolysis.Details
Glucose-6-phosphate 1-dehydrogenaseWayneNot Available769C->GADR InferredIncreased risk of dose-related hemolysis.Details
Glucose-6-phosphate 1-dehydrogenaseAveiroNot Available806G->AADR InferredIncreased risk of dose-related hemolysis.Details
Glucose-6-phosphate 1-dehydrogenaseCleveland CorumNot Available820G->AADR InferredIncreased risk of dose-related hemolysis.Details
Glucose-6-phosphate 1-dehydrogenaseLilleNot Available821A>TADR InferredIncreased risk of dose-related hemolysis.Details
Glucose-6-phosphate 1-dehydrogenaseBangkokNot Available825G>CADR InferredIncreased risk of dose-related hemolysis.Details
Glucose-6-phosphate 1-dehydrogenaseSugaoNot Available826C->TADR InferredIncreased risk of dose-related hemolysis.Details
Glucose-6-phosphate 1-dehydrogenaseLa JollaNot Available832T->CADR InferredIncreased risk of dose-related hemolysis.Details
Glucose-6-phosphate 1-dehydrogenaseWexhamNot Available833C->TADR InferredIncreased risk of dose-related hemolysis.Details
Glucose-6-phosphate 1-dehydrogenasePiotrkowNot Available851T>CADR InferredIncreased risk of dose-related hemolysis.Details
Glucose-6-phosphate 1-dehydrogenaseWest VirginiaNot Available910G->TADR InferredIncreased risk of dose-related hemolysis.Details
Glucose-6-phosphate 1-dehydrogenaseOmiyaNot Available921G->CADR InferredIncreased risk of dose-related hemolysis.Details
Glucose-6-phosphate 1-dehydrogenaseNaraNot Available953_976delCCACCAAAGGGTACCTGGAC GACCADR InferredIncreased risk of dose-related hemolysis.Details
Glucose-6-phosphate 1-dehydrogenaseManhattanNot Available962G->AADR InferredIncreased risk of dose-related hemolysis.Details
Glucose-6-phosphate 1-dehydrogenaseRehevotNot Available964T->CADR InferredIncreased risk of dose-related hemolysis.Details
Glucose-6-phosphate 1-dehydrogenaseHoniaraNot Available99A->G / 1360C->TADR InferredIncreased risk of dose-related hemolysis.Details
Glucose-6-phosphate 1-dehydrogenaseTokyo, FukushimaNot Available1246G->AADR InferredIncreased risk of dose-related hemolysis.Details
Glucose-6-phosphate 1-dehydrogenaseChathamNot Available1003G->AADR InferredIncreased risk of dose-related hemolysis.Details
Glucose-6-phosphate 1-dehydrogenaseFushanNot Available1004C->AADR InferredIncreased risk of dose-related hemolysis.Details
Glucose-6-phosphate 1-dehydrogenasePartenopeNot Available1052G->TADR InferredIncreased risk of dose-related hemolysis.Details
Glucose-6-phosphate 1-dehydrogenaseIerapetraNot Available1057C->TADR InferredIncreased risk of dose-related hemolysis.Details
Glucose-6-phosphate 1-dehydrogenaseAnadiaNot Available1193A->GADR InferredIncreased risk of dose-related hemolysis.Details
Glucose-6-phosphate 1-dehydrogenaseAbenoNot Available1220A->CADR InferredIncreased risk of dose-related hemolysis.Details
Glucose-6-phosphate 1-dehydrogenaseSurabayaNot Available1291G->AADR InferredIncreased risk of dose-related hemolysis.Details
Glucose-6-phosphate 1-dehydrogenasePawneeNot Available1316G->CADR InferredIncreased risk of dose-related hemolysis.Details
Glucose-6-phosphate 1-dehydrogenaseS. AntiocoNot Available1342A->GADR InferredIncreased risk of dose-related hemolysis.Details
Glucose-6-phosphate 1-dehydrogenaseCassanoNot Available1347G->CADR InferredIncreased risk of dose-related hemolysis.Details
Glucose-6-phosphate 1-dehydrogenaseHermoupolisNot Available1347G->C / 1360C->TADR InferredIncreased risk of dose-related hemolysis.Details
Glucose-6-phosphate 1-dehydrogenaseUnion,Maewo, Chinese-2, KaloNot Available1360C->TADR InferredIncreased risk of dose-related hemolysis.Details
Glucose-6-phosphate 1-dehydrogenaseAndalusNot Available1361G->AADR InferredIncreased risk of dose-related hemolysis.Details
Glucose-6-phosphate 1-dehydrogenaseCosenzaNot Available1376G->CADR InferredIncreased risk of dose-related hemolysis.Details
Glucose-6-phosphate 1-dehydrogenaseCanton, Taiwan- Hakka, Gifu-like, Agrigento-likeNot Available1376G->TADR InferredIncreased risk of dose-related hemolysis.Details
Glucose-6-phosphate 1-dehydrogenaseFloresNot Available1387C->AADR InferredIncreased risk of dose-related hemolysis.Details
Glucose-6-phosphate 1-dehydrogenaseKaiping, Anant, Dhon, Sapporo-like, WoseraNot Available1388G->AADR InferredIncreased risk of dose-related hemolysis.Details
Glucose-6-phosphate 1-dehydrogenaseKamogawaNot Available169C->TADR InferredIncreased risk of dose-related hemolysis.Details
Glucose-6-phosphate 1-dehydrogenaseCostanzoNot Available179T>CADR InferredIncreased risk of dose-related hemolysis.Details
Glucose-6-phosphate 1-dehydrogenaseAmazoniaNot Available185C->AADR InferredIncreased risk of dose-related hemolysis.Details
Glucose-6-phosphate 1-dehydrogenaseSongklanagarindNot Available196T->AADR InferredIncreased risk of dose-related hemolysis.Details
Glucose-6-phosphate 1-dehydrogenaseHechiNot Available202G->A / 871G->AADR InferredIncreased risk of dose-related hemolysis.Details
Glucose-6-phosphate 1-dehydrogenaseNamouruNot Available208T->CADR InferredIncreased risk of dose-related hemolysis.Details
Glucose-6-phosphate 1-dehydrogenaseBao LocNot Available352T>CADR InferredIncreased risk of dose-related hemolysis.Details
Glucose-6-phosphate 1-dehydrogenaseCrispimNot Available375G->T, 379G->T383T->C384C>TADR InferredIncreased risk of dose-related hemolysis.Details
Glucose-6-phosphate 1-dehydrogenaseAcrokorinthosNot Available376A->G / 463C->GADR InferredIncreased risk of dose-related hemolysis.Details
Glucose-6-phosphate 1-dehydrogenaseSanta MariaNot Available376A->G / 542A->TADR InferredIncreased risk of dose-related hemolysis.Details
Glucose-6-phosphate 1-dehydrogenaseAnanindeuaNot Available376A->G / 871G->AADR InferredIncreased risk of dose-related hemolysis.Details
Glucose-6-phosphate 1-dehydrogenaseVanua LavaNot Available383T->CADR InferredIncreased risk of dose-related hemolysis.Details
Glucose-6-phosphate 1-dehydrogenaseValladolidNot Available406C->TADR InferredIncreased risk of dose-related hemolysis.Details
Glucose-6-phosphate 1-dehydrogenaseBelemNot Available409C->TADR InferredIncreased risk of dose-related hemolysis.Details
Glucose-6-phosphate 1-dehydrogenaseLiuzhouNot Available442G->AADR InferredIncreased risk of dose-related hemolysis.Details
Glucose-6-phosphate 1-dehydrogenaseShenzenNot Available473G>AADR InferredIncreased risk of dose-related hemolysis.Details
Glucose-6-phosphate 1-dehydrogenaseTaipei “Chinese- 3”Not Available493A->GADR InferredIncreased risk of dose-related hemolysis.Details
Glucose-6-phosphate 1-dehydrogenaseToledoNot Available496C>TADR InferredIncreased risk of dose-related hemolysis.Details
Glucose-6-phosphate 1-dehydrogenaseNaoneNot Available497G->AADR InferredIncreased risk of dose-related hemolysis.Details
Glucose-6-phosphate 1-dehydrogenaseNankangNot Available517T->CADR InferredIncreased risk of dose-related hemolysis.Details
Glucose-6-phosphate 1-dehydrogenaseMiaoliNot Available519C->GADR InferredIncreased risk of dose-related hemolysis.Details
Glucose-6-phosphate 1-dehydrogenaseMediterranean, Dallas, Panama‚ Sassari, Cagliari, BirminghamNot Available563C->TADR InferredIncreased risk of dose-related hemolysis.Details
Glucose-6-phosphate 1-dehydrogenaseCoimbra ShundeNot Available592C->TADR InferredIncreased risk of dose-related hemolysis.Details
Glucose-6-phosphate 1-dehydrogenaseNilgiriNot Available593G>AADR InferredIncreased risk of dose-related hemolysis.Details
Glucose-6-phosphate 1-dehydrogenaseRadlowoNot Available679C->TADR InferredIncreased risk of dose-related hemolysis.Details
Glucose-6-phosphate 1-dehydrogenaseRoubaixNot Available811G>CADR InferredIncreased risk of dose-related hemolysis.Details
Glucose-6-phosphate 1-dehydrogenaseHaikouNot Available835A->GADR InferredIncreased risk of dose-related hemolysis.Details
Glucose-6-phosphate 1-dehydrogenaseChinese-1Not Available835A->TADR InferredIncreased risk of dose-related hemolysis.Details
Glucose-6-phosphate 1-dehydrogenaseMizushimaNot Available848A>GADR InferredIncreased risk of dose-related hemolysis.Details
Glucose-6-phosphate 1-dehydrogenaseOsakaNot Available853C->TADR InferredIncreased risk of dose-related hemolysis.Details
Glucose-6-phosphate 1-dehydrogenaseViangchan, JammuNot Available871G->AADR InferredIncreased risk of dose-related hemolysis.Details
Glucose-6-phosphate 1-dehydrogenaseSeoulNot Available916G->AADR InferredIncreased risk of dose-related hemolysis.Details
Glucose-6-phosphate 1-dehydrogenaseLudhianaNot Available929G->AADR InferredIncreased risk of dose-related hemolysis.Details
Glucose-6-phosphate 1-dehydrogenaseFarroupilhaNot Available977C->AADR InferredIncreased risk of dose-related hemolysis.Details
Glucose-6-phosphate 1-dehydrogenaseChinese-5Not Available1024C->TADR InferredIncreased risk of dose-related hemolysis.Details
Glucose-6-phosphate 1-dehydrogenaseRignanoNot Available130G>AADR InferredIncreased risk of dose-related hemolysis.Details
Glucose-6-phosphate 1-dehydrogenaseOrissaNot Available131C->GADR InferredIncreased risk of dose-related hemolysis.Details
Glucose-6-phosphate 1-dehydrogenaseG6PDNiceNot Available1380G>CADR InferredIncreased risk of dose-related hemolysis.Details
Glucose-6-phosphate 1-dehydrogenaseKamiube, KeelungNot Available1387C->TADR InferredIncreased risk of dose-related hemolysis.Details
Glucose-6-phosphate 1-dehydrogenaseNeapolisNot Available1400C->GADR InferredIncreased risk of dose-related hemolysis.Details
Glucose-6-phosphate 1-dehydrogenaseAuresNot Available143T->CADR InferredIncreased risk of dose-related hemolysis.Details
Glucose-6-phosphate 1-dehydrogenaseSplitNot Available1442C->GADR InferredIncreased risk of dose-related hemolysis.Details
Glucose-6-phosphate 1-dehydrogenaseKambosNot Available148C->TADR InferredIncreased risk of dose-related hemolysis.Details
Glucose-6-phosphate 1-dehydrogenasePalestrinaNot Available170G>AADR InferredIncreased risk of dose-related hemolysis.Details
Glucose-6-phosphate 1-dehydrogenaseMetapontoNot Available172G->AADR InferredIncreased risk of dose-related hemolysis.Details
Glucose-6-phosphate 1-dehydrogenaseMusashinoNot Available185C->TADR InferredIncreased risk of dose-related hemolysis.Details
Glucose-6-phosphate 1-dehydrogenaseAsahiNot Available202G->AADR InferredIncreased risk of dose-related hemolysis.Details
Glucose-6-phosphate 1-dehydrogenaseA- (202), Ferrara INot Available202G->A / 376A->GADR InferredIncreased risk of dose-related hemolysis.Details
Glucose-6-phosphate 1-dehydrogenaseMurcia OristanoNot Available209A->GADR InferredIncreased risk of dose-related hemolysis.Details
Glucose-6-phosphate 1-dehydrogenaseUbe KonanNot Available241C->TADR InferredIncreased risk of dose-related hemolysis.Details
Glucose-6-phosphate 1-dehydrogenaseLagosantoNot Available242G->AADR InferredIncreased risk of dose-related hemolysis.Details
Glucose-6-phosphate 1-dehydrogenaseGuangzhouNot Available274C->TADR InferredIncreased risk of dose-related hemolysis.Details
Glucose-6-phosphate 1-dehydrogenaseHammersmithNot Available323T->AADR InferredIncreased risk of dose-related hemolysis.Details
Glucose-6-phosphate 1-dehydrogenaseSinnaiNot Available34G->TADR InferredIncreased risk of dose-related hemolysis.Details
Glucose-6-phosphate 1-dehydrogenaseA- (680)Not Available376A->G / 680G->TADR InferredIncreased risk of dose-related hemolysis.Details
Glucose-6-phosphate 1-dehydrogenaseA- (968), Betica,Selma, GuantanamoNot Available376A->G / 968T->CADR InferredIncreased risk of dose-related hemolysis.Details
Glucose-6-phosphate 1-dehydrogenaseSalerno PyrgosNot Available383T>GADR InferredIncreased risk of dose-related hemolysis.Details
Glucose-6-phosphate 1-dehydrogenaseQuing YanNot Available392G->TADR InferredIncreased risk of dose-related hemolysis.Details
Glucose-6-phosphate 1-dehydrogenaseLagesNot Available40G->AADR InferredIncreased risk of dose-related hemolysis.Details
Glucose-6-phosphate 1-dehydrogenaseIleshaNot Available466G->AADR InferredIncreased risk of dose-related hemolysis.Details
Glucose-6-phosphate 1-dehydrogenaseMahidolNot Available487G->AADR InferredIncreased risk of dose-related hemolysis.Details
Glucose-6-phosphate 1-dehydrogenaseMalagaNot Available542A->TADR InferredIncreased risk of dose-related hemolysis.Details
Glucose-6-phosphate 1-dehydrogenaseSibariNot Available634A->GADR InferredIncreased risk of dose-related hemolysis.Details
Glucose-6-phosphate 1-dehydrogenaseMexico CityNot Available680G->AADR InferredIncreased risk of dose-related hemolysis.Details
Glucose-6-phosphate 1-dehydrogenaseNanningNot Available703C->TADR InferredIncreased risk of dose-related hemolysis.Details
Glucose-6-phosphate 1-dehydrogenaseSeattle, Lodi, Modena, Ferrara II, Athens-likeNot Available844G->CADR InferredIncreased risk of dose-related hemolysis.Details
Glucose-6-phosphate 1-dehydrogenaseBajo MaumereNot Available844G->TADR InferredIncreased risk of dose-related hemolysis.Details
Glucose-6-phosphate 1-dehydrogenaseMontalbanoNot Available854G->AADR InferredIncreased risk of dose-related hemolysis.Details
Glucose-6-phosphate 1-dehydrogenaseKalyan-Kerala, Jamnaga, RohiniNot Available949G->AADR InferredIncreased risk of dose-related hemolysis.Details
Glucose-6-phosphate 1-dehydrogenaseGaoheNot Available95A->GADR InferredIncreased risk of dose-related hemolysis.Details

Interactions

Drug Interactions
DrugInteractionDrug group
AbirateroneThe metabolism of Abiraterone can be decreased when combined with Erythromycin.Approved
AcebutololThe serum concentration of Acebutolol can be decreased when it is combined with Erythromycin.Approved
AcenocoumarolThe serum concentration of Acenocoumarol can be increased when it is combined with Erythromycin.Approved
AcetaminophenThe metabolism of Acetaminophen can be decreased when combined with Erythromycin.Approved
AcetyldigitoxinThe serum concentration of Acetyldigitoxin can be increased when it is combined with Erythromycin.Approved
AcetyldigoxinThe serum concentration of Acetyldigoxin can be increased when it is combined with Erythromycin.Experimental
Acetylsalicylic acidThe serum concentration of Acetylsalicylic acid can be decreased when it is combined with Erythromycin.Approved, Vet Approved
AdinazolamThe metabolism of Adinazolam can be decreased when combined with Erythromycin.Approved
AfatinibThe serum concentration of Afatinib can be decreased when it is combined with Erythromycin.Approved
AlbendazoleThe metabolism of Albendazole can be decreased when combined with Erythromycin.Approved, Vet Approved
AlclometasoneThe metabolism of Alclometasone can be decreased when combined with Erythromycin.Approved
AldosteroneThe serum concentration of Erythromycin can be decreased when it is combined with Aldosterone.Experimental
AlectinibThe serum concentration of Erythromycin can be increased when it is combined with Alectinib.Approved
AlfentanilThe serum concentration of Alfentanil can be increased when it is combined with Erythromycin.Approved, Illicit
AlfuzosinAlfuzosin may increase the QTc-prolonging activities of Erythromycin.Approved, Investigational
AliskirenThe metabolism of Aliskiren can be decreased when combined with Erythromycin.Approved, Investigational
AlitretinoinThe serum concentration of Alitretinoin can be decreased when it is combined with Erythromycin.Approved, Investigational
AllylestrenolThe metabolism of Allylestrenol can be decreased when combined with Erythromycin.Approved
AlmotriptanThe metabolism of Almotriptan can be decreased when combined with Erythromycin.Approved, Investigational
AlogliptinThe metabolism of Alogliptin can be decreased when combined with Erythromycin.Approved
AlosetronThe metabolism of Alosetron can be decreased when combined with Erythromycin.Approved, Withdrawn
AlprazolamThe serum concentration of Alprazolam can be increased when it is combined with Erythromycin.Approved, Illicit, Investigational
AmantadineAmantadine may increase the QTc-prolonging activities of Erythromycin.Approved
AmbrisentanThe metabolism of Ambrisentan can be decreased when combined with Erythromycin.Approved, Investigational
AmbroxolThe metabolism of Ambroxol can be decreased when combined with Erythromycin.Approved
Ambroxol acefyllinateThe metabolism of Ambroxol acefyllinate can be decreased when combined with Erythromycin.Experimental
Aminohippuric acidThe serum concentration of Erythromycin can be increased when it is combined with Aminohippuric acid.Approved
AminophenazoneThe metabolism of Aminophenazone can be decreased when combined with Erythromycin.Approved, Withdrawn
AminophyllineThe metabolism of Aminophylline can be decreased when combined with Erythromycin.Approved
AmiodaroneThe metabolism of Erythromycin can be decreased when combined with Amiodarone.Approved, Investigational
AmitriptylineAmitriptyline may increase the QTc-prolonging activities of Erythromycin.Approved
AmlodipineThe metabolism of Amlodipine can be decreased when combined with Erythromycin.Approved
AmoxapineAmoxapine may increase the QTc-prolonging activities of Erythromycin.Approved
AmprenavirThe metabolism of Amprenavir can be decreased when combined with Erythromycin.Approved
AmrinoneThe metabolism of Amrinone can be decreased when combined with Erythromycin.Approved
AmsacrineThe serum concentration of Erythromycin can be increased when it is combined with Amsacrine.Approved
AnagrelideErythromycin may increase the QTc-prolonging activities of Anagrelide.Approved
AntipyrineThe metabolism of Antipyrine can be decreased when combined with Erythromycin.Approved
ApixabanThe serum concentration of Apixaban can be increased when it is combined with Erythromycin.Approved
ApomorphineApomorphine may increase the QTc-prolonging activities of Erythromycin.Approved, Investigational
ApremilastThe metabolism of Apremilast can be decreased when combined with Erythromycin.Approved, Investigational
AprepitantThe serum concentration of Erythromycin can be increased when it is combined with Aprepitant.Approved, Investigational
ArformoterolArformoterol may increase the QTc-prolonging activities of Erythromycin.Approved, Investigational
ArgatrobanThe metabolism of Argatroban can be decreased when combined with Erythromycin.Approved, Investigational
AripiprazoleThe serum concentration of Aripiprazole can be increased when it is combined with Erythromycin.Approved, Investigational
Arsenic trioxideThe serum concentration of Arsenic trioxide can be decreased when it is combined with Erythromycin.Approved, Investigational
ArtemetherThe metabolism of Artemether can be decreased when combined with Erythromycin.Approved
AsenapineThe metabolism of Asenapine can be decreased when combined with Erythromycin.Approved
AstemizoleThe metabolism of Astemizole can be decreased when combined with Erythromycin.Approved, Withdrawn
AtazanavirThe metabolism of Erythromycin can be decreased when combined with Atazanavir.Approved, Investigational
AtenololThe serum concentration of Atenolol can be decreased when it is combined with Erythromycin.Approved
AtomoxetineAtomoxetine may increase the QTc-prolonging activities of Erythromycin.Approved
AtorvastatinThe serum concentration of Atorvastatin can be increased when it is combined with Erythromycin.Approved
AvanafilThe serum concentration of Avanafil can be increased when it is combined with Erythromycin.Approved
AxitinibThe metabolism of Axitinib can be decreased when combined with Erythromycin.Approved, Investigational
AzelastineThe metabolism of Azelastine can be decreased when combined with Erythromycin.Approved
AzelnidipineThe metabolism of Azelnidipine can be decreased when combined with Erythromycin.Approved
AzimilideThe metabolism of Azimilide can be decreased when combined with Erythromycin.Investigational
AzithromycinErythromycin may increase the QTc-prolonging activities of Azithromycin.Approved
BanoxantroneThe metabolism of Banoxantrone can be decreased when combined with Erythromycin.Investigational
BarnidipineThe serum concentration of Barnidipine can be increased when it is combined with Erythromycin.Approved
BCG vaccineThe therapeutic efficacy of BCG vaccine can be decreased when used in combination with Erythromycin.Investigational
BedaquilineErythromycin may increase the QTc-prolonging activities of Bedaquiline.Approved
BelinostatThe serum concentration of Belinostat can be decreased when it is combined with Erythromycin.Approved, Investigational
BencyclaneThe metabolism of Bencyclane can be decreased when combined with Erythromycin.Experimental
BenidipineThe metabolism of Benidipine can be decreased when combined with Erythromycin.Approved
BenzocaineThe serum concentration of Erythromycin can be increased when it is combined with Benzocaine.Approved
BenzphetamineThe metabolism of Benzphetamine can be decreased when combined with Erythromycin.Approved, Illicit
Benzyl alcoholThe metabolism of Benzyl alcohol can be decreased when combined with Erythromycin.Approved
BepridilThe metabolism of Bepridil can be decreased when combined with Erythromycin.Approved, Withdrawn
BetamethasoneThe serum concentration of Betamethasone can be decreased when it is combined with Erythromycin.Approved, Vet Approved
BexaroteneThe metabolism of Bexarotene can be decreased when combined with Erythromycin.Approved, Investigational
BezafibrateThe metabolism of Bezafibrate can be decreased when combined with Erythromycin.Approved
BicalutamideThe metabolism of Bicalutamide can be decreased when combined with Erythromycin.Approved
BiperidenThe serum concentration of Erythromycin can be increased when it is combined with Biperiden.Approved
BisoprololThe metabolism of Bisoprolol can be decreased when combined with Erythromycin.Approved
BoceprevirThe metabolism of Erythromycin can be decreased when combined with Boceprevir.Withdrawn
BortezomibBortezomib may increase the QTc-prolonging activities of Erythromycin.Approved, Investigational
BosentanThe serum concentration of Bosentan can be increased when it is combined with Erythromycin.Approved, Investigational
BosutinibThe serum concentration of Bosutinib can be increased when it is combined with Erythromycin.Approved
Brentuximab vedotinThe serum concentration of Brentuximab vedotin can be decreased when it is combined with Erythromycin.Approved
BrexpiprazoleThe serum concentration of Brexpiprazole can be increased when it is combined with Erythromycin.Approved
BrinzolamideThe metabolism of Brinzolamide can be decreased when combined with Erythromycin.Approved
BrivaracetamThe metabolism of Brivaracetam can be decreased when combined with Erythromycin.Approved, Investigational
BromazepamThe metabolism of Bromazepam can be decreased when combined with Erythromycin.Approved, Illicit
BromocriptineThe serum concentration of Bromocriptine can be increased when it is combined with Erythromycin.Approved, Investigational
BrompheniramineThe metabolism of Brompheniramine can be decreased when combined with Erythromycin.Approved
BudesonideThe serum concentration of Budesonide can be increased when it is combined with Erythromycin.Approved
BupivacaineThe metabolism of Bupivacaine can be decreased when combined with Erythromycin.Approved, Investigational
BuprenorphineThe metabolism of Buprenorphine can be decreased when combined with Erythromycin.Approved, Illicit, Investigational, Vet Approved
BupropionThe metabolism of Bupropion can be decreased when combined with Erythromycin.Approved
BuserelinBuserelin may increase the QTc-prolonging activities of Erythromycin.Approved
BuspironeThe metabolism of Buspirone can be decreased when combined with Erythromycin.Approved, Investigational
BusulfanThe metabolism of Busulfan can be decreased when combined with Erythromycin.Approved, Investigational
CabazitaxelThe metabolism of Cabazitaxel can be decreased when combined with Erythromycin.Approved
CabergolineThe serum concentration of Cabergoline can be increased when it is combined with Erythromycin.Approved
CabozantinibThe metabolism of Cabozantinib can be decreased when combined with Erythromycin.Approved
CaffeineThe metabolism of Caffeine can be decreased when combined with Erythromycin.Approved
CalcitriolThe metabolism of Calcitriol can be decreased when combined with Erythromycin.Approved, Nutraceutical
CamptothecinThe serum concentration of Camptothecin can be decreased when it is combined with Erythromycin.Experimental
CanagliflozinThe metabolism of Canagliflozin can be decreased when combined with Erythromycin.Approved
Candesartan cilexetilThe serum concentration of Erythromycin can be increased when it is combined with Candesartan.Approved
CaptoprilThe serum concentration of Erythromycin can be increased when it is combined with Captopril.Approved
CarbamazepineThe metabolism of Carbamazepine can be decreased when combined with Erythromycin.Approved, Investigational
CarbinoxamineThe metabolism of Carbinoxamine can be decreased when combined with Erythromycin.Approved
CarboxyamidotriazoleThe metabolism of Carboxyamidotriazole can be decreased when combined with Erythromycin.Investigational
CarfilzomibThe serum concentration of Carfilzomib can be decreased when it is combined with Erythromycin.Approved
CariprazineThe metabolism of Cariprazine can be decreased when combined with Erythromycin.Approved
CaroverineThe metabolism of Caroverine can be decreased when combined with Erythromycin.Experimental
CarvedilolThe metabolism of Carvedilol can be decreased when combined with Erythromycin.Approved, Investigational
CaspofunginThe serum concentration of Erythromycin can be increased when it is combined with Caspofungin.Approved
CelecoxibThe metabolism of Celecoxib can be decreased when combined with Erythromycin.Approved, Investigational
CeliprololThe metabolism of Celiprolol can be decreased when combined with Erythromycin.Approved, Investigational
CephalexinThe metabolism of Cephalexin can be decreased when combined with Erythromycin.Approved, Vet Approved
CeritinibThe serum concentration of Erythromycin can be increased when it is combined with Ceritinib.Approved
CerivastatinThe metabolism of Cerivastatin can be decreased when combined with Erythromycin.Withdrawn
CevimelineThe metabolism of Cevimeline can be decreased when combined with Erythromycin.Approved
Chenodeoxycholic acidThe metabolism of Chenodeoxycholic acid can be decreased when combined with Erythromycin.Approved
ChlordiazepoxideThe metabolism of Chlordiazepoxide can be decreased when combined with Erythromycin.Approved, Illicit
ChloroquineErythromycin may increase the QTc-prolonging activities of Chloroquine.Approved, Vet Approved
ChlorphenamineThe metabolism of Chlorphenamine can be decreased when combined with Erythromycin.Approved
ChlorpromazineErythromycin may increase the QTc-prolonging activities of Chlorpromazine.Approved, Vet Approved
ChlorpropamideThe serum concentration of Erythromycin can be increased when it is combined with Chlorpropamide.Approved
ChlorprothixeneThe serum concentration of Erythromycin can be increased when it is combined with Chlorprothixene.Approved, Withdrawn
ChlorzoxazoneThe metabolism of Chlorzoxazone can be decreased when combined with Erythromycin.Approved
CholecalciferolThe metabolism of Cholecalciferol can be decreased when combined with Erythromycin.Approved, Nutraceutical
CholesterolThe serum concentration of Erythromycin can be increased when it is combined with Cholesterol.Experimental
Cholic AcidThe serum concentration of Erythromycin can be decreased when it is combined with Cholic Acid.Approved
CiclesonideThe metabolism of Ciclesonide can be decreased when combined with Erythromycin.Approved, Investigational
CilazaprilThe serum concentration of Erythromycin can be increased when it is combined with Cilazapril.Approved
CilnidipineThe metabolism of Cilnidipine can be decreased when combined with Erythromycin.Approved
CilostazolThe serum concentration of Cilostazol can be increased when it is combined with Erythromycin.Approved
CimetidineThe serum concentration of Erythromycin can be decreased when it is combined with Cimetidine.Approved
CinacalcetThe metabolism of Cinacalcet can be decreased when combined with Erythromycin.Approved
CinnarizineThe metabolism of Cinnarizine can be decreased when combined with Erythromycin.Approved
CiprofloxacinErythromycin may increase the QTc-prolonging activities of Ciprofloxacin.Approved, Investigational
CisaprideThe metabolism of Cisapride can be decreased when combined with Erythromycin.Approved, Investigational, Withdrawn
CisplatinThe serum concentration of Cisplatin can be decreased when it is combined with Erythromycin.Approved
CitalopramThe metabolism of Citalopram can be decreased when combined with Erythromycin.Approved
ClarithromycinErythromycin may increase the QTc-prolonging activities of Clarithromycin.Approved
ClemastineThe metabolism of Erythromycin can be decreased when combined with Clemastine.Approved
ClindamycinThe therapeutic efficacy of Clindamycin can be decreased when used in combination with Erythromycin.Approved, Vet Approved
ClobazamThe metabolism of Clobazam can be decreased when combined with Erythromycin.Approved, Illicit
ClofazimineThe metabolism of Clofazimine can be decreased when combined with Erythromycin.Approved, Investigational
ClofibrateThe metabolism of Clofibrate can be decreased when combined with Erythromycin.Approved
clomethiazoleThe metabolism of clomethiazole can be decreased when combined with Erythromycin.Investigational
ClomifeneThe serum concentration of Clomifene can be decreased when it is combined with Erythromycin.Approved, Investigational
ClomipramineClomipramine may increase the QTc-prolonging activities of Erythromycin.Approved, Vet Approved
ClonazepamThe metabolism of Clonazepam can be decreased when combined with Erythromycin.Approved, Illicit
ClonidineThe metabolism of Clonidine can be decreased when combined with Erythromycin.Approved
ClopidogrelErythromycin may decrease the antiplatelet activities of Clopidogrel.Approved, Nutraceutical
ClorazepateThe metabolism of Clorazepate can be decreased when combined with Erythromycin.Approved, Illicit
ClotiazepamThe metabolism of Clotiazepam can be decreased when combined with Erythromycin.Approved, Illicit
ClotrimazoleThe metabolism of Erythromycin can be decreased when combined with Clotrimazole.Approved, Vet Approved
ClozapineThe metabolism of Clozapine can be decreased when combined with Erythromycin.Approved
CobicistatThe metabolism of Erythromycin can be decreased when combined with Cobicistat.Approved
CobimetinibThe serum concentration of Cobimetinib can be increased when it is combined with Erythromycin.Approved
CocaineThe metabolism of Cocaine can be decreased when combined with Erythromycin.Approved, Illicit
CodeineThe metabolism of Codeine can be decreased when combined with Erythromycin.Approved, Illicit
ColchicineThe serum concentration of Colchicine can be increased when it is combined with Erythromycin.Approved
ColforsinThe serum concentration of Erythromycin can be increased when it is combined with Colforsin.Experimental
ConivaptanThe serum concentration of Erythromycin can be increased when it is combined with Conivaptan.Approved, Investigational
Conjugated estrogensThe metabolism of Conjugated estrogens can be decreased when combined with Erythromycin.Approved
CopanlisibThe metabolism of Copanlisib can be decreased when combined with Erythromycin.Approved
Cortisone acetateThe metabolism of Cortisone acetate can be decreased when combined with Erythromycin.Approved
CrizotinibErythromycin may increase the QTc-prolonging activities of Crizotinib.Approved
CyclobenzaprineThe metabolism of Cyclobenzaprine can be decreased when combined with Erythromycin.Approved
CyclophosphamideThe metabolism of Cyclophosphamide can be decreased when combined with Erythromycin.Approved, Investigational
CyclosporineThe metabolism of Cyclosporine can be decreased when combined with Erythromycin.Approved, Investigational, Vet Approved
CymarinThe serum concentration of Cymarin can be increased when it is combined with Erythromycin.Experimental
CytarabineThe metabolism of Cytarabine can be decreased when combined with Erythromycin.Approved, Investigational
Dabigatran etexilateThe serum concentration of the active metabolites of Dabigatran etexilate can be increased when Dabigatran etexilate is used in combination with Erythromycin.Approved
DabrafenibThe serum concentration of Erythromycin can be decreased when it is combined with Dabrafenib.Approved
DaclatasvirThe metabolism of Daclatasvir can be decreased when combined with Erythromycin.Approved
DactinomycinThe serum concentration of Dactinomycin can be decreased when it is combined with Erythromycin.Approved
DantroleneThe metabolism of Dantrolene can be decreased when combined with Erythromycin.Approved
DapagliflozinThe metabolism of Dapagliflozin can be decreased when combined with Erythromycin.Approved
DapoxetineThe serum concentration of Dapoxetine can be increased when it is combined with Erythromycin.Investigational
DapsoneThe metabolism of Dapsone can be decreased when combined with Erythromycin.Approved, Investigational
DarifenacinThe metabolism of Darifenacin can be decreased when combined with Erythromycin.Approved, Investigational
DarodipineThe metabolism of Darodipine can be decreased when combined with Erythromycin.Experimental
DarunavirThe metabolism of Erythromycin can be decreased when combined with Darunavir.Approved
DasabuvirThe metabolism of Dasabuvir can be decreased when combined with Erythromycin.Approved
DasatinibThe serum concentration of Erythromycin can be increased when it is combined with Dasatinib.Approved, Investigational
DaunorubicinThe metabolism of Daunorubicin can be decreased when combined with Erythromycin.Approved
DebrisoquinThe serum concentration of Debrisoquin can be decreased when it is combined with Erythromycin.Approved
DeferasiroxThe serum concentration of Erythromycin can be decreased when it is combined with Deferasirox.Approved, Investigational
DeflazacortThe metabolism of Deflazacort can be decreased when combined with Erythromycin.Approved
DegarelixDegarelix may increase the QTc-prolonging activities of Erythromycin.Approved
DelavirdineThe metabolism of Delavirdine can be decreased when combined with Erythromycin.Approved
DesfluraneDesflurane may increase the QTc-prolonging activities of Erythromycin.Approved
DesipramineDesipramine may increase the QTc-prolonging activities of Erythromycin.Approved
DeslanosideThe serum concentration of Deslanoside can be increased when it is combined with Erythromycin.Approved
DesloratadineThe serum concentration of Erythromycin can be increased when it is combined with Desloratadine.Approved, Investigational
DesvenlafaxineThe metabolism of Desvenlafaxine can be decreased when combined with Erythromycin.Approved
DeutetrabenazineThe metabolism of Deutetrabenazine can be decreased when combined with Erythromycin.Approved, Investigational
DexamethasoneThe metabolism of Dexamethasone can be decreased when combined with Erythromycin.Approved, Investigational, Vet Approved
Dexchlorpheniramine maleateThe metabolism of Dexchlorpheniramine maleate can be decreased when combined with Erythromycin.Approved
DexlansoprazoleThe metabolism of Dexlansoprazole can be decreased when combined with Erythromycin.Approved
DextromethorphanThe metabolism of Dextromethorphan can be decreased when combined with Erythromycin.Approved
DextropropoxypheneThe metabolism of Dextropropoxyphene can be decreased when combined with Erythromycin.Approved, Illicit, Withdrawn
DiazepamThe metabolism of Diazepam can be decreased when combined with Erythromycin.Approved, Illicit, Vet Approved
DiclofenacThe metabolism of Diclofenac can be decreased when combined with Erythromycin.Approved, Vet Approved
DienogestThe metabolism of Dienogest can be decreased when combined with Erythromycin.Approved
DiethylstilbestrolThe serum concentration of Diethylstilbestrol can be decreased when it is combined with Erythromycin.Approved
DigitoxinThe metabolism of Digitoxin can be decreased when combined with Erythromycin.Approved
DigoxinThe metabolism of Digoxin can be decreased when combined with Erythromycin.Approved
DihydrocodeineThe metabolism of Dihydrocodeine can be decreased when combined with Erythromycin.Approved, Illicit
DihydroergocornineThe risk or severity of adverse effects can be increased when Dihydroergocornine is combined with Erythromycin.Approved
DihydroergocristineThe risk or severity of adverse effects can be increased when Dihydroergocristine is combined with Erythromycin.Experimental
DihydroergocryptineThe risk or severity of adverse effects can be increased when Dihydroergocryptine is combined with Erythromycin.Experimental
DihydroergotamineThe serum concentration of Dihydroergotamine can be increased when it is combined with Erythromycin.Approved
DihydrotestosteroneThe serum concentration of Dihydrotestosterone can be decreased when it is combined with Erythromycin.Illicit
DiltiazemThe metabolism of Diltiazem can be decreased when combined with Erythromycin.Approved
DiphenhydramineDiphenhydramine may increase the QTc-prolonging activities of Erythromycin.Approved
DipyridamoleThe serum concentration of Dipyridamole can be decreased when it is combined with Erythromycin.Approved
DisopyramideErythromycin may increase the QTc-prolonging activities of Disopyramide.Approved
DisulfiramThe metabolism of Disulfiram can be decreased when combined with Erythromycin.Approved
DocetaxelThe metabolism of Docetaxel can be decreased when combined with Erythromycin.Approved, Investigational
DofetilideThe serum concentration of Dofetilide can be increased when it is combined with Erythromycin.Approved
DolasetronErythromycin may increase the QTc-prolonging activities of Dolasetron.Approved
DomperidoneThe serum concentration of Domperidone can be increased when it is combined with Erythromycin.Approved, Investigational, Vet Approved
DonepezilThe metabolism of Donepezil can be decreased when combined with Erythromycin.Approved
DorzolamideThe metabolism of Dorzolamide can be decreased when combined with Erythromycin.Approved
DotarizineThe metabolism of Dotarizine can be decreased when combined with Erythromycin.Investigational
DoxazosinThe serum concentration of Erythromycin can be increased when it is combined with Doxazosin.Approved
DoxepinDoxepin may increase the QTc-prolonging activities of Erythromycin.Approved
DoxofyllineThe serum concentration of Doxofylline can be increased when it is combined with Erythromycin.Approved
DoxorubicinThe serum concentration of Doxorubicin can be increased when it is combined with Erythromycin.Approved, Investigational
DoxorubicinThe metabolism of Doxorubicin can be decreased when combined with Erythromycin.Approved, Investigational
DoxycyclineThe metabolism of Erythromycin can be decreased when combined with Doxycycline.Approved, Investigational, Vet Approved
DronabinolThe serum concentration of Dronabinol can be increased when it is combined with Erythromycin.Approved, Illicit
DronedaroneThe metabolism of Dronedarone can be decreased when combined with Erythromycin.Approved
DroperidolErythromycin may increase the QTc-prolonging activities of Droperidol.Approved, Vet Approved
DutasterideThe metabolism of Dutasteride can be decreased when combined with Erythromycin.Approved, Investigational
EdoxabanThe serum concentration of Edoxaban can be increased when it is combined with Erythromycin.Approved
EfavirenzThe metabolism of Efavirenz can be decreased when combined with Erythromycin.Approved, Investigational
EfonidipineThe metabolism of Efonidipine can be decreased when combined with Erythromycin.Approved
ElbasvirThe serum concentration of Elbasvir can be increased when it is combined with Erythromycin.Approved
EletriptanThe serum concentration of Eletriptan can be increased when it is combined with Erythromycin.Approved, Investigational
EliglustatThe serum concentration of Eliglustat can be increased when it is combined with Erythromycin.Approved
EltrombopagThe serum concentration of Erythromycin can be increased when it is combined with Eltrombopag.Approved
ElvitegravirThe metabolism of Elvitegravir can be decreased when combined with Erythromycin.Approved
EnalaprilThe metabolism of Enalapril can be decreased when combined with Erythromycin.Approved, Vet Approved
EnasidenibThe metabolism of Enasidenib can be decreased when combined with Erythromycin.Approved
EnzalutamideThe serum concentration of Erythromycin can be decreased when it is combined with Enzalutamide.Approved
EperisoneThe metabolism of Eperisone can be decreased when combined with Erythromycin.Approved, Investigational
EpinastineThe metabolism of Epinastine can be decreased when combined with Erythromycin.Approved, Investigational
EplerenoneThe serum concentration of Eplerenone can be increased when it is combined with Erythromycin.Approved
ErgocalciferolThe metabolism of Ergocalciferol can be decreased when combined with Erythromycin.Approved, Nutraceutical
Ergoloid mesylateThe serum concentration of Ergoloid mesylate can be increased when it is combined with Erythromycin.Approved
ErgonovineThe serum concentration of Ergonovine can be increased when it is combined with Erythromycin.Approved
ErgotamineThe serum concentration of Ergotamine can be increased when it is combined with Erythromycin.Approved
EribulinEribulin may increase the QTc-prolonging activities of Erythromycin.Approved, Investigational
ErlotinibThe metabolism of Erlotinib can be decreased when combined with Erythromycin.Approved, Investigational
EscitalopramThe metabolism of Escitalopram can be decreased when combined with Erythromycin.Approved, Investigational
EsomeprazoleThe metabolism of Esomeprazole can be decreased when combined with Erythromycin.Approved, Investigational
EstazolamThe serum concentration of Estazolam can be increased when it is combined with Erythromycin.Approved, Illicit
EstradiolThe metabolism of Estradiol can be decreased when combined with Erythromycin.Approved, Investigational, Vet Approved
Estradiol valerate/DienogestThe metabolism of Estradiol valerate/Dienogest can be decreased when combined with Erythromycin.Approved
EstramustineThe metabolism of Estramustine can be decreased when combined with Erythromycin.Approved
EstriolThe serum concentration of Estriol can be decreased when it is combined with Erythromycin.Approved, Vet Approved
Estrogens, esterifiedThe metabolism of Estrogens, esterified can be decreased when combined with Erythromycin.Approved
EstroneThe metabolism of Estrone can be decreased when combined with Erythromycin.Approved
Estrone sulfateThe metabolism of Estrone sulfate can be decreased when combined with Erythromycin.Approved
EszopicloneThe metabolism of Eszopiclone can be decreased when combined with Erythromycin.Approved
EthanolThe metabolism of Ethanol can be decreased when combined with Erythromycin.Approved
Ethinyl EstradiolThe metabolism of Ethinyl Estradiol can be decreased when combined with Erythromycin.Approved
EthosuximideThe metabolism of Ethosuximide can be decreased when combined with Erythromycin.Approved
EthylmorphineThe metabolism of Ethylmorphine can be decreased when combined with Erythromycin.Approved, Illicit
EtizolamThe metabolism of Etizolam can be decreased when combined with Erythromycin.Approved
EtonogestrelThe metabolism of Etonogestrel can be decreased when combined with Erythromycin.Approved, Investigational
EtoposideThe metabolism of Etoposide can be decreased when combined with Erythromycin.Approved
EtoricoxibThe metabolism of Etoricoxib can be decreased when combined with Erythromycin.Approved, Investigational
EtravirineThe metabolism of Etravirine can be decreased when combined with Erythromycin.Approved
EverolimusThe serum concentration of Everolimus can be increased when it is combined with Erythromycin.Approved
ExemestaneThe metabolism of Exemestane can be decreased when combined with Erythromycin.Approved, Investigational
EzetimibeThe serum concentration of Ezetimibe can be decreased when it is combined with Erythromycin.Approved
EzogabineEzogabine may increase the QTc-prolonging activities of Erythromycin.Approved
FamciclovirThe metabolism of Famciclovir can be decreased when combined with Erythromycin.Approved
FamotidineFamotidine may increase the QTc-prolonging activities of Erythromycin.Approved
FelbamateFelbamate may increase the QTc-prolonging activities of Erythromycin.Approved
FelodipineThe metabolism of Felodipine can be decreased when combined with Erythromycin.Approved, Investigational
FendilineThe metabolism of Fendiline can be decreased when combined with Erythromycin.Withdrawn
FenofibrateThe metabolism of Fenofibrate can be decreased when combined with Erythromycin.Approved
FentanylThe serum concentration of Fentanyl can be increased when it is combined with Erythromycin.Approved, Illicit, Investigational, Vet Approved
FesoterodineThe metabolism of Fesoterodine can be decreased when combined with Erythromycin.Approved
FexofenadineThe serum concentration of Fexofenadine can be increased when it is combined with Erythromycin.Approved
FidaxomicinThe serum concentration of Fidaxomicin can be decreased when it is combined with Erythromycin.Approved
FinasterideThe metabolism of Finasteride can be decreased when combined with Erythromycin.Approved
FingolimodFingolimod may increase the QTc-prolonging activities of Erythromycin.Approved, Investigational
FlecainideErythromycin may increase the QTc-prolonging activities of Flecainide.Approved, Withdrawn
FlibanserinThe serum concentration of Flibanserin can be increased when it is combined with Erythromycin.Approved
FluconazoleFluconazole may increase the QTc-prolonging activities of Erythromycin.Approved
FlunarizineThe metabolism of Flunarizine can be decreased when combined with Erythromycin.Approved
FlunisolideThe metabolism of Flunisolide can be decreased when combined with Erythromycin.Approved, Investigational
FlunitrazepamThe metabolism of Flunitrazepam can be decreased when combined with Erythromycin.Approved, Illicit
FluorometholoneThe metabolism of Fluorometholone can be decreased when combined with Erythromycin.Approved
FluoxetineThe metabolism of Fluoxetine can be decreased when combined with Erythromycin.Approved, Vet Approved
FlupentixolThe serum concentration of Erythromycin can be increased when it is combined with Flupentixol.Approved, Withdrawn
FluphenazineThe serum concentration of Erythromycin can be increased when it is combined with Fluphenazine.Approved
FlurazepamThe metabolism of Flurazepam can be decreased when combined with Erythromycin.Approved, Illicit
FlutamideThe metabolism of Flutamide can be decreased when combined with Erythromycin.Approved
Fluticasone furoateThe metabolism of Fluticasone furoate can be decreased when combined with Erythromycin.Approved
Fluticasone propionateThe metabolism of Fluticasone propionate can be decreased when combined with Erythromycin.Approved
FluvastatinThe metabolism of Fluvastatin can be decreased when combined with Erythromycin.Approved
FluvoxamineThe metabolism of Erythromycin can be decreased when combined with Fluvoxamine.Approved, Investigational
FormoterolFormoterol may increase the QTc-prolonging activities of Erythromycin.Approved, Investigational
FosamprenavirThe metabolism of Fosamprenavir can be decreased when combined with Erythromycin.Approved
FosaprepitantThe serum concentration of Erythromycin can be increased when it is combined with Fosaprepitant.Approved
FoscarnetFoscarnet may increase the QTc-prolonging activities of Erythromycin.Approved
FosphenytoinThe metabolism of Erythromycin can be increased when combined with Fosphenytoin.Approved
FulvestrantThe metabolism of Fulvestrant can be decreased when combined with Erythromycin.Approved, Investigational
Fusidic AcidThe serum concentration of Erythromycin can be increased when it is combined with Fusidic Acid.Approved
GabapentinThe metabolism of Gabapentin can be decreased when combined with Erythromycin.Approved, Investigational
Gadobenic acidErythromycin may increase the QTc-prolonging activities of Gadobenic acid.Approved
GalantamineGalantamine may increase the QTc-prolonging activities of Erythromycin.Approved
GallopamilThe metabolism of Gallopamil can be decreased when combined with Erythromycin.Investigational
GefitinibThe metabolism of Gefitinib can be decreased when combined with Erythromycin.Approved, Investigational
GemcitabineThe serum concentration of Gemcitabine can be decreased when it is combined with Erythromycin.Approved
GemfibrozilThe metabolism of Gemfibrozil can be decreased when combined with Erythromycin.Approved
GemifloxacinErythromycin may increase the QTc-prolonging activities of Gemifloxacin.Approved, Investigational
GenisteinThe serum concentration of Erythromycin can be increased when it is combined with Genistein.Investigational
GitoformateThe serum concentration of Gitoformate can be increased when it is combined with Erythromycin.Experimental
GlecaprevirThe serum concentration of Glecaprevir can be decreased when it is combined with Erythromycin.Approved
GlipizideThe metabolism of Glipizide can be decreased when combined with Erythromycin.Approved
GlyburideThe metabolism of Glyburide can be decreased when combined with Erythromycin.Approved
GlycerinThe serum concentration of Erythromycin can be increased when it is combined with Glycerin.Approved, Investigational
GoserelinGoserelin may increase the QTc-prolonging activities of Erythromycin.Approved
Gramicidin DThe serum concentration of Erythromycin can be increased when it is combined with Gramicidin D.Approved
GranisetronErythromycin may increase the QTc-prolonging activities of Granisetron.Approved, Investigational
GrazoprevirThe serum concentration of Grazoprevir can be decreased when it is combined with Erythromycin.Approved
GrepafloxacinThe metabolism of Grepafloxacin can be decreased when combined with Erythromycin.Withdrawn
GuanfacineThe metabolism of Guanfacine can be decreased when combined with Erythromycin.Approved, Investigational
HalofantrineThe serum concentration of Halofantrine can be increased when it is combined with Erythromycin.Approved
HaloperidolErythromycin may increase the QTc-prolonging activities of Haloperidol.Approved
HalothaneThe metabolism of Halothane can be decreased when combined with Erythromycin.Approved, Vet Approved
HexobarbitalThe metabolism of Hexobarbital can be decreased when combined with Erythromycin.Approved
HistamineThe metabolism of Histamine can be decreased when combined with Erythromycin.Approved, Investigational
HistrelinHistrelin may increase the QTc-prolonging activities of Erythromycin.Approved
HydrocodoneThe serum concentration of Hydrocodone can be increased when it is combined with Erythromycin.Approved, Illicit
HydrocortisoneThe metabolism of Hydrocortisone can be decreased when combined with Erythromycin.Approved, Vet Approved
HydromorphoneThe metabolism of Hydromorphone can be decreased when combined with Erythromycin.Approved, Illicit
Hydroxyprogesterone caproateThe metabolism of Hydroxyprogesterone caproate can be decreased when combined with Erythromycin.Approved
HydroxyzineHydroxyzine may increase the QTc-prolonging activities of Erythromycin.Approved
IbandronateIbandronate may increase the QTc-prolonging activities of Erythromycin.Approved, Investigational
IbrutinibThe serum concentration of Ibrutinib can be increased when it is combined with Erythromycin.Approved
IbuprofenThe serum concentration of Ibuprofen can be decreased when it is combined with Erythromycin.Approved
IbutilideErythromycin may increase the QTc-prolonging activities of Ibutilide.Approved
IcotinibThe metabolism of Icotinib can be decreased when combined with Erythromycin.Approved, Investigational
IdelalisibThe serum concentration of Erythromycin can be increased when it is combined with Idelalisib.Approved
IfosfamideThe serum concentration of the active metabolites of Ifosfamide can be reduced when Ifosfamide is used in combination with Erythromycin resulting in a loss in efficacy.Approved
IloperidoneThe metabolism of Iloperidone can be decreased when combined with Erythromycin.Approved
ImatinibThe serum concentration of Imatinib can be increased when it is combined with Erythromycin.Approved
ImidafenacinThe metabolism of Imidafenacin can be decreased when combined with Erythromycin.Approved
ImipramineImipramine may increase the QTc-prolonging activities of Erythromycin.Approved
ImiquimodThe metabolism of Imiquimod can be decreased when combined with Erythromycin.Approved, Investigational
IndacaterolIndacaterol may increase the QTc-prolonging activities of Erythromycin.Approved
IndapamideIndapamide may increase the QTc-prolonging activities of Erythromycin.Approved
IndinavirThe metabolism of Erythromycin can be decreased when combined with Indinavir.Approved
IndomethacinThe serum concentration of Indomethacin can be decreased when it is combined with Erythromycin.Approved, Investigational
Inotuzumab ozogamicinThe serum concentration of Inotuzumab ozogamicin can be decreased when it is combined with Erythromycin.Approved
Ipratropium bromideThe metabolism of Ipratropium bromide can be decreased when combined with Erythromycin.Approved
IrinotecanThe metabolism of Irinotecan can be decreased when combined with Erythromycin.Approved, Investigational
IsavuconazoniumThe metabolism of Isavuconazonium can be decreased when combined with Erythromycin.Approved, Investigational
IsofluraneIsoflurane may increase the QTc-prolonging activities of Erythromycin.Approved, Vet Approved
Isosorbide DinitrateThe metabolism of Isosorbide Dinitrate can be decreased when combined with Erythromycin.Approved
Isosorbide MononitrateThe metabolism of Isosorbide Mononitrate can be decreased when combined with Erythromycin.Approved
IsradipineThe metabolism of Isradipine can be decreased when combined with Erythromycin.Approved
ItraconazoleThe metabolism of Erythromycin can be decreased when combined with Itraconazole.Approved, Investigational
IvabradineThe serum concentration of Ivabradine can be increased when it is combined with Erythromycin.Approved
IvacaftorThe serum concentration of Ivacaftor can be increased when it is combined with Erythromycin.Approved
IvermectinThe metabolism of Ivermectin can be decreased when combined with Erythromycin.Approved, Vet Approved
IxabepiloneThe metabolism of Ixabepilone can be decreased when combined with Erythromycin.Approved, Investigational
IxazomibThe metabolism of Ixazomib can be decreased when combined with Erythromycin.Approved
KetamineThe metabolism of Ketamine can be decreased when combined with Erythromycin.Approved, Vet Approved
KetazolamThe metabolism of Ketazolam can be decreased when combined with Erythromycin.Approved
KetobemidoneThe metabolism of Ketobemidone can be decreased when combined with Erythromycin.Approved
KetoconazoleThe metabolism of Erythromycin can be decreased when combined with Ketoconazole.Approved, Investigational
LacidipineThe metabolism of Lacidipine can be decreased when combined with Erythromycin.Approved
LamivudineThe serum concentration of Lamivudine can be decreased when it is combined with Erythromycin.Approved, Investigational
LamotrigineThe metabolism of Lamotrigine can be decreased when combined with Erythromycin.Approved, Investigational
Lanatoside CThe serum concentration of Lanatoside C can be increased when it is combined with Erythromycin.Experimental
LansoprazoleThe metabolism of Lansoprazole can be decreased when combined with Erythromycin.Approved, Investigational
LapatinibLapatinib may increase the QTc-prolonging activities of Erythromycin.Approved, Investigational
LaquinimodThe metabolism of Laquinimod can be decreased when combined with Erythromycin.Investigational
LedipasvirThe serum concentration of Ledipasvir can be increased when it is combined with Erythromycin.Approved
LenalidomideThe serum concentration of Lenalidomide can be decreased when it is combined with Erythromycin.Approved
LenvatinibErythromycin may increase the QTc-prolonging activities of Lenvatinib.Approved
LercanidipineThe metabolism of Lercanidipine can be decreased when combined with Erythromycin.Approved, Investigational
LetrozoleThe metabolism of Letrozole can be decreased when combined with Erythromycin.Approved, Investigational
LeuprolideLeuprolide may increase the QTc-prolonging activities of Erythromycin.Approved, Investigational
LevetiracetamThe serum concentration of Levetiracetam can be decreased when it is combined with Erythromycin.Approved, Investigational
LevobupivacaineThe metabolism of Levobupivacaine can be decreased when combined with Erythromycin.Approved
LevocetirizineThe metabolism of Levocetirizine can be decreased when combined with Erythromycin.Approved
LevofloxacinErythromycin may increase the QTc-prolonging activities of Levofloxacin.Approved, Investigational
Levomethadyl AcetateThe metabolism of Levomethadyl Acetate can be decreased when combined with Erythromycin.Approved
LevomilnacipranThe metabolism of Levomilnacipran can be decreased when combined with Erythromycin.Approved
LevonorgestrelThe metabolism of Levonorgestrel can be decreased when combined with Erythromycin.Approved, Investigational
LevothyroxineThe metabolism of Levothyroxine can be decreased when combined with Erythromycin.Approved
LidocaineThe metabolism of Lidocaine can be decreased when combined with Erythromycin.Approved, Vet Approved
LidoflazineThe metabolism of Lidoflazine can be decreased when combined with Erythromycin.Experimental
LinagliptinThe serum concentration of Linagliptin can be decreased when it is combined with Erythromycin.Approved
LincomycinThe therapeutic efficacy of Erythromycin can be decreased when used in combination with Lincomycin.Approved, Vet Approved
LiothyronineThe serum concentration of Erythromycin can be decreased when it is combined with Liothyronine.Approved, Vet Approved
LiotrixThe serum concentration of Erythromycin can be decreased when it is combined with Liotrix.Approved
LisinoprilThe serum concentration of Erythromycin can be increased when it is combined with Lisinopril.Approved, Investigational
LisurideThe metabolism of Lisuride can be decreased when combined with Erythromycin.Approved
LithiumLithium may increase the QTc-prolonging activities of Erythromycin.Approved
LomitapideThe serum concentration of Lomitapide can be increased when it is combined with Erythromycin.Approved
LoperamideThe metabolism of Loperamide can be decreased when combined with Erythromycin.Approved
LopinavirThe metabolism of Erythromycin can be decreased when combined with Lopinavir.Approved
LoratadineThe metabolism of Loratadine can be decreased when combined with Erythromycin.Approved
LorcaserinThe metabolism of Lorcaserin can be decreased when combined with Erythromycin.Approved
LosartanThe metabolism of Losartan can be decreased when combined with Erythromycin.Approved
LovastatinThe serum concentration of Lovastatin can be increased when it is combined with Erythromycin.Approved, Investigational
LuliconazoleThe serum concentration of Erythromycin can be increased when it is combined with Luliconazole.Approved
LumacaftorThe serum concentration of Erythromycin can be decreased when it is combined with Lumacaftor.Approved
LumefantrineThe metabolism of Lumefantrine can be decreased when combined with Erythromycin.Approved
LurasidoneThe serum concentration of Lurasidone can be increased when it is combined with Erythromycin.Approved
Lysergic Acid DiethylamideThe risk or severity of adverse effects can be increased when Lysergic Acid Diethylamide is combined with Erythromycin.Illicit, Withdrawn
MacitentanThe metabolism of Macitentan can be decreased when combined with Erythromycin.Approved
Magnesium SulfateThe metabolism of Magnesium Sulfate can be decreased when combined with Erythromycin.Approved, Vet Approved
ManidipineThe metabolism of Manidipine can be decreased when combined with Erythromycin.Approved
MannitolThe serum concentration of Mannitol can be decreased when it is combined with Erythromycin.Approved, Investigational
MaprotilineMaprotiline may increase the QTc-prolonging activities of Erythromycin.Approved
MaravirocThe metabolism of Maraviroc can be decreased when combined with Erythromycin.Approved, Investigational
MebendazoleThe metabolism of Mebendazole can be decreased when combined with Erythromycin.Approved, Vet Approved
Medroxyprogesterone acetateThe metabolism of Medroxyprogesterone acetate can be decreased when combined with Erythromycin.Approved, Investigational
MefloquineMefloquine may increase the QTc-prolonging activities of Erythromycin.Approved
Megestrol acetateThe serum concentration of Erythromycin can be increased when it is combined with Megestrol acetate.Approved, Vet Approved
MeloxicamThe metabolism of Meloxicam can be decreased when combined with Erythromycin.Approved, Vet Approved
MeprobamateThe serum concentration of Erythromycin can be increased when it is combined with Meprobamate.Approved, Illicit
MequitazineErythromycin may increase the arrhythmogenic activities of Mequitazine.Approved
MetergolineThe risk or severity of adverse effects can be increased when Metergoline is combined with Erythromycin.Experimental
MethadoneErythromycin may increase the QTc-prolonging activities of Methadone.Approved
MethaqualoneThe metabolism of Methaqualone can be decreased when combined with Erythromycin.Illicit, Withdrawn
MethotrexateThe serum concentration of Methotrexate can be decreased when it is combined with Erythromycin.Approved
MethotrimeprazineMethotrimeprazine may increase the QTc-prolonging activities of Erythromycin.Approved
MethoxsalenThe metabolism of Methoxsalen can be decreased when combined with Erythromycin.Approved
MethoxyfluraneThe metabolism of Methoxyflurane can be decreased when combined with Erythromycin.Approved, Vet Approved
Methyl salicylateThe metabolism of Methyl salicylate can be decreased when combined with Erythromycin.Approved, Vet Approved
MethylergometrineThe serum concentration of Methylergometrine can be increased when it is combined with Erythromycin.Approved
MethylprednisoloneThe metabolism of Methylprednisolone can be decreased when combined with Erythromycin.Approved, Vet Approved
MethyltestosteroneThe metabolism of Methyltestosterone can be decreased when combined with Erythromycin.Approved
MethysergideThe risk or severity of adverse effects can be increased when Methysergide is combined with Erythromycin.Approved
MetildigoxinThe serum concentration of Metildigoxin can be increased when it is combined with Erythromycin.Experimental
MetoclopramideMetoclopramide may increase the QTc-prolonging activities of Erythromycin.Approved, Investigational
MetoprololThe serum concentration of Metoprolol can be decreased when it is combined with Erythromycin.Approved, Investigational
MetronidazoleMetronidazole may increase the QTc-prolonging activities of Erythromycin.Approved
MevastatinThe serum concentration of Mevastatin can be increased when it is combined with Erythromycin.Experimental
MexiletineThe metabolism of Mexiletine can be decreased when combined with Erythromycin.Approved
MianserinThe metabolism of Mianserin can be decreased when combined with Erythromycin.Approved
MibefradilThe metabolism of Mibefradil can be decreased when combined with Erythromycin.Withdrawn
MiconazoleThe metabolism of Miconazole can be decreased when combined with Erythromycin.Approved, Investigational, Vet Approved
MidazolamThe serum concentration of Midazolam can be increased when it is combined with Erythromycin.Approved, Illicit
MidostaurinThe metabolism of Midostaurin can be decreased when combined with Erythromycin.Approved
MifepristoneThe serum concentration of Erythromycin can be increased when it is combined with Mifepristone.Approved, Investigational
MirabegronMirabegron may increase the QTc-prolonging activities of Erythromycin.Approved
MirtazapineMirtazapine may increase the QTc-prolonging activities of Erythromycin.Approved
MitomycinThe serum concentration of Erythromycin can be increased when it is combined with Mitomycin.Approved
MitotaneThe serum concentration of Erythromycin can be decreased when it is combined with Mitotane.Approved
MitoxantroneThe serum concentration of Mitoxantrone can be decreased when it is combined with Erythromycin.Approved, Investigational
ModafinilThe metabolism of Modafinil can be decreased when combined with Erythromycin.Approved, Investigational
MoexiprilMoexipril may increase the QTc-prolonging activities of Erythromycin.Approved
MontelukastThe metabolism of Montelukast can be decreased when combined with Erythromycin.Approved
MorphineThe metabolism of Morphine can be decreased when combined with Erythromycin.Approved, Investigational
MoxifloxacinErythromycin may increase the QTc-prolonging activities of Moxifloxacin.Approved, Investigational
Mycophenolate mofetilThe metabolism of Mycophenolate mofetil can be decreased when combined with Erythromycin.Approved, Investigational
NadololThe serum concentration of Nadolol can be decreased when it is combined with Erythromycin.Approved
NaftopidilThe metabolism of Naftopidil can be decreased when combined with Erythromycin.Investigational
NaloxoneThe metabolism of Naloxone can be decreased when combined with Erythromycin.Approved, Vet Approved
NaltrexoneThe serum concentration of Erythromycin can be increased when it is combined with Naltrexone.Approved, Investigational, Vet Approved
NaringeninThe serum concentration of Erythromycin can be increased when it is combined with Naringenin.Experimental
NateglinideThe metabolism of Nateglinide can be decreased when combined with Erythromycin.Approved, Investigational
NefazodoneThe metabolism of Erythromycin can be decreased when combined with Nefazodone.Approved, Withdrawn
NelfinavirThe metabolism of Erythromycin can be decreased when combined with Nelfinavir.Approved
NeostigmineThe serum concentration of Erythromycin can be increased when it is combined with Neostigmine.Approved, Vet Approved
NeratinibThe metabolism of Neratinib can be decreased when combined with Erythromycin.Approved, Investigational
NetupitantThe serum concentration of Erythromycin can be increased when it is combined with Netupitant.Approved
NevirapineThe metabolism of Erythromycin can be increased when combined with Nevirapine.Approved
NicardipineThe metabolism of Nicardipine can be decreased when combined with Erythromycin.Approved
NicergolineThe risk or severity of adverse effects can be increased when Nicergoline is combined with Erythromycin.Approved
NicotineThe metabolism of Nicotine can be decreased when combined with Erythromycin.Approved
NifedipineThe metabolism of Nifedipine can be decreased when combined with Erythromycin.Approved
NiguldipineThe metabolism of Niguldipine can be decreased when combined with Erythromycin.Experimental
NilotinibThe metabolism of Nilotinib can be decreased when combined with Erythromycin.Approved, Investigational
NiludipineThe metabolism of Niludipine can be decreased when combined with Erythromycin.Experimental
NilvadipineThe metabolism of Nilvadipine can be decreased when combined with Erythromycin.Approved
NimesulideThe metabolism of Nimesulide can be decreased when combined with Erythromycin.Approved, Withdrawn
NimodipineThe serum concentration of Nimodipine can be increased when it is combined with Erythromycin.Approved
NintedanibThe serum concentration of Nintedanib can be increased when it is combined with Erythromycin.Approved
NisoldipineThe metabolism of Nisoldipine can be decreased when combined with Erythromycin.Approved
NitrazepamThe metabolism of Nitrazepam can be decreased when combined with Erythromycin.Approved
NitrendipineThe metabolism of Nitrendipine can be decreased when combined with Erythromycin.Approved
NizatidineThe serum concentration of Nizatidine can be decreased when it is combined with Erythromycin.Approved
NorethisteroneThe metabolism of Norethisterone can be decreased when combined with Erythromycin.Approved
NorfloxacinNorfloxacin may increase the QTc-prolonging activities of Erythromycin.Approved
NorgestrelThe metabolism of Norgestrel can be decreased when combined with Erythromycin.Approved
NortriptylineNortriptyline may increase the QTc-prolonging activities of Erythromycin.Approved
OctreotideOctreotide may increase the QTc-prolonging activities of Erythromycin.Approved, Investigational
OdanacatibThe metabolism of Odanacatib can be decreased when combined with Erythromycin.Investigational
OfloxacinErythromycin may increase the QTc-prolonging activities of Ofloxacin.Approved
OlanzapineOlanzapine may increase the QTc-prolonging activities of Erythromycin.Approved, Investigational
OlaparibThe serum concentration of Olaparib can be increased when it is combined with Erythromycin.Approved
OleandrinThe serum concentration of Oleandrin can be increased when it is combined with Erythromycin.Experimental
OlodaterolOlodaterol may increase the QTc-prolonging activities of Erythromycin.Approved
OlopatadineThe metabolism of Olopatadine can be decreased when combined with Erythromycin.Approved
OmbitasvirThe serum concentration of Ombitasvir can be decreased when it is combined with Erythromycin.Approved
OmeprazoleThe metabolism of Omeprazole can be decreased when combined with Erythromycin.Approved, Investigational, Vet Approved
OndansetronErythromycin may increase the QTc-prolonging activities of Ondansetron.Approved
OrphenadrineThe metabolism of Orphenadrine can be decreased when combined with Erythromycin.Approved
OsimertinibThe serum concentration of Erythromycin can be increased when it is combined with Osimertinib.Approved
OspemifeneThe metabolism of Ospemifene can be decreased when combined with Erythromycin.Approved
OtiloniumThe metabolism of Otilonium can be decreased when combined with Erythromycin.Experimental
OuabainThe serum concentration of Ouabain can be increased when it is combined with Erythromycin.Approved
OxazepamThe metabolism of Oxazepam can be decreased when combined with Erythromycin.Approved
OxybutyninThe metabolism of Oxybutynin can be decreased when combined with Erythromycin.Approved, Investigational
OxycodoneThe risk or severity of adverse effects can be increased when Erythromycin is combined with Oxycodone.Approved, Illicit, Investigational
OxymorphoneThe metabolism of Oxymorphone can be decreased when combined with Erythromycin.Approved, Investigational, Vet Approved
OxytocinOxytocin may increase the QTc-prolonging activities of Erythromycin.Approved, Vet Approved
P-NitrophenolThe serum concentration of Erythromycin can be increased when it is combined with P-Nitrophenol.Experimental
PaclitaxelThe metabolism of Paclitaxel can be decreased when combined with Erythromycin.Approved, Vet Approved
PalbociclibThe serum concentration of Erythromycin can be increased when it is combined with Palbociclib.Approved
PaliperidoneErythromycin may increase the QTc-prolonging activities of Paliperidone.Approved
Palmitic AcidThe serum concentration of Erythromycin can be increased when it is combined with Palmitic Acid.Experimental
PalonosetronThe metabolism of Palonosetron can be decreased when combined with Erythromycin.Approved, Investigational
PanobinostatErythromycin may increase the QTc-prolonging activities of Panobinostat.Approved, Investigational
PantoprazoleThe metabolism of Pantoprazole can be decreased when combined with Erythromycin.Approved
ParamethadioneThe metabolism of Paramethadione can be decreased when combined with Erythromycin.Approved
ParamethasoneThe metabolism of Paramethasone can be decreased when combined with Erythromycin.Approved
ParecoxibThe metabolism of Parecoxib can be decreased when combined with Erythromycin.Approved
ParicalcitolThe metabolism of Paricalcitol can be decreased when combined with Erythromycin.Approved, Investigational
ParitaprevirThe metabolism of Paritaprevir can be decreased when combined with Erythromycin.Approved
ParoxetineParoxetine may increase the QTc-prolonging activities of Erythromycin.Approved, Investigational
PasireotidePasireotide may increase the QTc-prolonging activities of Erythromycin.Approved
PazopanibThe serum concentration of Pazopanib can be increased when it is combined with Erythromycin.Approved
PentamidineErythromycin may increase the QTc-prolonging activities of Pentamidine.Approved
PentobarbitalThe metabolism of Erythromycin can be increased when combined with Pentobarbital.Approved, Vet Approved
PerampanelThe metabolism of Perampanel can be decreased when combined with Erythromycin.Approved
PerflutrenErythromycin may increase the QTc-prolonging activities of Perflutren.Approved
PergolideThe metabolism of Pergolide can be decreased when combined with Erythromycin.Approved, Vet Approved, Withdrawn
PerhexilineThe metabolism of Perhexiline can be decreased when combined with Erythromycin.Approved
PerindoprilThe serum concentration of Erythromycin can be increased when it is combined with Perindopril.Approved
PermethrinThe metabolism of Permethrin can be decreased when combined with Erythromycin.Approved, Investigational
PerospironeThe metabolism of Perospirone can be decreased when combined with Erythromycin.Approved
PerphenazineThe metabolism of Perphenazine can be decreased when combined with Erythromycin.Approved
PeruvosideThe serum concentration of Peruvoside can be increased when it is combined with Erythromycin.Experimental
PethidineThe metabolism of Pethidine can be decreased when combined with Erythromycin.Approved
PhenacetinThe metabolism of Phenacetin can be decreased when combined with Erythromycin.Withdrawn
PhenobarbitalThe metabolism of Erythromycin can be increased when combined with Phenobarbital.Approved
PhenoxybenzamineThe metabolism of Phenoxybenzamine can be decreased when combined with Erythromycin.Approved
PhenprocoumonThe serum concentration of Phenprocoumon can be increased when it is combined with Erythromycin.Approved
PhenytoinThe metabolism of Erythromycin can be increased when combined with Phenytoin.Approved, Vet Approved
PibrentasvirThe serum concentration of Pibrentasvir can be decreased when it is combined with Erythromycin.Approved
Picosulfuric acidThe therapeutic efficacy of Picosulfuric acid can be decreased when used in combination with Erythromycin.Approved
PilocarpineThe metabolism of Pilocarpine can be decreased when combined with Erythromycin.Approved
PimecrolimusThe metabolism of Pimecrolimus can be decreased when combined with Erythromycin.Approved, Investigational
PimozideThe serum concentration of Pimozide can be increased when it is combined with Erythromycin.Approved
PinacidilThe metabolism of Pinacidil can be decreased when combined with Erythromycin.Withdrawn
PinaveriumThe metabolism of Pinaverium can be decreased when combined with Erythromycin.Approved
PioglitazoneThe metabolism of Pioglitazone can be decreased when combined with Erythromycin.Approved, Investigational
PipotiazineThe metabolism of Pipotiazine can be decreased when combined with Erythromycin.Approved
PirlimycinThe therapeutic efficacy of Erythromycin can be decreased when used in combination with Pirlimycin.Vet Approved
PitavastatinThe serum concentration of Pitavastatin can be increased when it is combined with Erythromycin.Approved
Platelet Activating FactorThe serum concentration of Erythromycin can be decreased when it is combined with Platelet Activating Factor.Experimental
PodofiloxThe metabolism of Podofilox can be decreased when combined with Erythromycin.Approved
PomalidomideThe metabolism of Pomalidomide can be decreased when combined with Erythromycin.Approved
PonatinibThe metabolism of Ponatinib can be decreased when combined with Erythromycin.Approved
PosaconazoleThe metabolism of Erythromycin can be decreased when combined with Posaconazole.Approved, Investigational, Vet Approved
PrasteroneThe metabolism of Prasterone can be decreased when combined with Erythromycin.Approved, Nutraceutical
PrasugrelThe metabolism of Prasugrel can be decreased when combined with Erythromycin.Approved
PravastatinThe serum concentration of Pravastatin can be increased when it is combined with Erythromycin.Approved
PrazepamThe metabolism of Prazepam can be decreased when combined with Erythromycin.Approved, Illicit
PraziquantelThe metabolism of Praziquantel can be decreased when combined with Erythromycin.Approved, Vet Approved
PrazosinThe serum concentration of Prazosin can be decreased when it is combined with Erythromycin.Approved
PrednisoloneThe metabolism of Prednisolone can be decreased when combined with Erythromycin.Approved, Vet Approved
PrednisoneThe metabolism of Prednisone can be decreased when combined with Erythromycin.Approved, Vet Approved
PregabalinThe metabolism of Pregabalin can be decreased when combined with Erythromycin.Approved, Illicit, Investigational
PrenylamineThe metabolism of Prenylamine can be decreased when combined with Erythromycin.Withdrawn
PrimaquineErythromycin may increase the QTc-prolonging activities of Primaquine.Approved
PrimidoneThe metabolism of Erythromycin can be increased when combined with Primidone.Approved, Vet Approved
ProbenecidThe serum concentration of Erythromycin can be increased when it is combined with Probenecid.Approved
ProcainamideErythromycin may increase the QTc-prolonging activities of Procainamide.Approved
ProchlorperazineThe metabolism of Prochlorperazine can be decreased when combined with Erythromycin.Approved, Vet Approved
ProgesteroneThe metabolism of Progesterone can be decreased when combined with Erythromycin.Approved, Vet Approved
ProguanilThe metabolism of Proguanil can be decreased when combined with Erythromycin.Approved
PromazineErythromycin may increase the QTc-prolonging activities of Promazine.Approved, Vet Approved
PromethazinePromethazine may increase the QTc-prolonging activities of Erythromycin.Approved
PropafenoneThe serum concentration of Propafenone can be increased when it is combined with Erythromycin.Approved
PropofolPropofol may increase the QTc-prolonging activities of Erythromycin.Approved, Investigational, Vet Approved
Propoxyphene napsylateThe metabolism of Propoxyphene napsylate can be decreased when combined with Erythromycin.Approved
PropranololThe metabolism of Propranolol can be decreased when combined with Erythromycin.Approved, Investigational
ProscillaridinThe serum concentration of Proscillaridin can be increased when it is combined with Erythromycin.Experimental
ProtriptylineProtriptyline may increase the QTc-prolonging activities of Erythromycin.Approved
PrucaloprideThe serum concentration of Prucalopride can be increased when it is combined with Erythromycin.Approved
PyrazinamideThe metabolism of Pyrazinamide can be decreased when combined with Erythromycin.Approved
QuazepamThe serum concentration of Erythromycin can be increased when it is combined with Quazepam.Approved, Illicit
QuercetinThe serum concentration of Erythromycin can be increased when it is combined with Quercetin.Experimental
QuetiapineThe metabolism of Quetiapine can be decreased when combined with Erythromycin.Approved
QuinacrineThe metabolism of Quinacrine can be decreased when combined with Erythromycin.Approved
QuinineThe serum concentration of Quinine can be increased when it is combined with Erythromycin.Approved
RabeprazoleThe metabolism of Rabeprazole can be decreased when combined with Erythromycin.Approved, Investigational
RaloxifeneThe metabolism of Raloxifene can be decreased when combined with Erythromycin.Approved, Investigational
RamelteonThe metabolism of Ramelteon can be decreased when combined with Erythromycin.Approved, Investigational
RanitidineThe serum concentration of Ranitidine can be decreased when it is combined with Erythromycin.Approved
RanolazineThe serum concentration of Ranolazine can be increased when it is combined with Erythromycin.Approved, Investigational
ReboxetineThe metabolism of Reboxetine can be decreased when combined with Erythromycin.Approved, Investigational
RegorafenibThe metabolism of Regorafenib can be decreased when combined with Erythromycin.Approved
RepaglinideThe serum concentration of Repaglinide can be increased when it is combined with Erythromycin.Approved, Investigational
ReserpineThe serum concentration of Erythromycin can be decreased when it is combined with Reserpine.Approved
RetapamulinThe metabolism of Retapamulin can be decreased when combined with Erythromycin.Approved
RifabutinThe metabolism of Erythromycin can be increased when combined with Rifabutin.Approved
RifampicinThe metabolism of Erythromycin can be increased when combined with Rifampicin.Approved
RifapentineThe metabolism of Erythromycin can be increased when combined with Rifapentine.Approved
RifaximinThe serum concentration of Rifaximin can be increased when it is combined with Erythromycin.Approved, Investigational
RilpivirineThe serum concentration of Rilpivirine can be increased when it is combined with Erythromycin.Approved
RimonabantThe metabolism of Rimonabant can be decreased when combined with Erythromycin.Approved, Investigational
RiociguatThe metabolism of Riociguat can be decreased when combined with Erythromycin.Approved
RisedronateThe metabolism of Risedronate can be decreased when combined with Erythromycin.Approved, Investigational
RisperidoneRisperidone may increase the QTc-prolonging activities of Erythromycin.Approved, Investigational
RitonavirThe metabolism of Erythromycin can be decreased when combined with Ritonavir.Approved, Investigational
RivaroxabanThe serum concentration of Rivaroxaban can be increased when it is combined with Erythromycin.Approved
RofecoxibThe metabolism of Rofecoxib can be decreased when combined with Erythromycin.Investigational, Withdrawn
RolapitantThe metabolism of Rolapitant can be decreased when combined with Erythromycin.Approved
RomidepsinThe metabolism of Romidepsin can be decreased when combined with Erythromycin.Approved, Investigational
RopiniroleThe metabolism of Ropinirole can be decreased when combined with Erythromycin.Approved, Investigational
RopivacaineThe metabolism of Ropivacaine can be decreased when combined with Erythromycin.Approved
RosuvastatinThe metabolism of Rosuvastatin can be decreased when combined with Erythromycin.Approved
RotigotineThe metabolism of Rotigotine can be decreased when combined with Erythromycin.Approved
RoxithromycinThe metabolism of Roxithromycin can be decreased when combined with Erythromycin.Approved, Withdrawn
RucaparibThe metabolism of Rucaparib can be decreased when combined with Erythromycin.Approved, Investigational
RupatadineThe metabolism of Rupatadine can be decreased when combined with Erythromycin.Approved
RuxolitinibThe metabolism of Ruxolitinib can be decreased when combined with Erythromycin.Approved
SafinamideThe metabolism of Safinamide can be decreased when combined with Erythromycin.Approved
SalbutamolSalbutamol may increase the QTc-prolonging activities of Erythromycin.Approved, Vet Approved
Salicylic acidThe serum concentration of Salicylic acid can be decreased when it is combined with Erythromycin.Approved, Vet Approved
SalmeterolThe serum concentration of Salmeterol can be increased when it is combined with Erythromycin.Approved
SaquinavirErythromycin may increase the QTc-prolonging activities of Saquinavir.Approved, Investigational
SaxagliptinThe serum concentration of Saxagliptin can be increased when it is combined with Erythromycin.Approved
ScopolamineThe serum concentration of Erythromycin can be increased when it is combined with Scopolamine.Approved
SelegilineThe metabolism of Selegiline can be decreased when combined with Erythromycin.Approved, Investigational, Vet Approved
SelexipagThe metabolism of Selexipag can be decreased when combined with Erythromycin.Approved
SeratrodastThe metabolism of Seratrodast can be decreased when combined with Erythromycin.Approved
SertindoleThe metabolism of Sertindole can be decreased when combined with Erythromycin.Approved, Withdrawn
SertralineThe risk or severity of adverse effects can be increased when Erythromycin is combined with Sertraline.Approved
SevofluraneSevoflurane may increase the QTc-prolonging activities of Erythromycin.Approved, Vet Approved
SibutramineThe metabolism of Sibutramine can be decreased when combined with Erythromycin.Approved, Illicit, Investigational, Withdrawn
SildenafilThe serum concentration of Sildenafil can be increased when it is combined with Erythromycin.Approved, Investigational
SilodosinThe serum concentration of Silodosin can be increased when it is combined with Erythromycin.Approved
SiltuximabThe serum concentration of Erythromycin can be decreased when it is combined with Siltuximab.Approved
SimvastatinThe serum concentration of Simvastatin can be increased when it is combined with Erythromycin.Approved
SirolimusThe metabolism of Sirolimus can be decreased when combined with Erythromycin.Approved, Investigational
SitagliptinThe metabolism of Sitagliptin can be decreased when combined with Erythromycin.Approved, Investigational
SofosbuvirThe serum concentration of Sofosbuvir can be decreased when it is combined with Erythromycin.Approved
SolifenacinSolifenacin may increase the QTc-prolonging activities of Erythromycin.Approved
SonidegibThe serum concentration of Sonidegib can be increased when it is combined with Erythromycin.Approved, Investigational
SorafenibSorafenib may increase the QTc-prolonging activities of Erythromycin.Approved, Investigational
SotalolErythromycin may increase the QTc-prolonging activities of Sotalol.Approved
SparfloxacinThe serum concentration of Sparfloxacin can be decreased when it is combined with Erythromycin.Approved
SphingosineThe serum concentration of Sphingosine can be decreased when it is combined with Erythromycin.Experimental
SpiramycinThe metabolism of Spiramycin can be decreased when combined with Erythromycin.Approved
SpironolactoneThe serum concentration of Erythromycin can be increased when it is combined with Spironolactone.Approved
St. John's WortThe serum concentration of Erythromycin can be decreased when it is combined with St. John's Wort.Nutraceutical
StaurosporineThe serum concentration of Erythromycin can be increased when it is combined with Staurosporine.Experimental
StiripentolThe serum concentration of Erythromycin can be increased when it is combined with Stiripentol.Approved
StreptozocinThe serum concentration of Erythromycin can be decreased when it is combined with Streptozocin.Approved
SufentanilThe metabolism of Sufentanil can be decreased when combined with Erythromycin.Approved, Investigational
SulfadiazineThe metabolism of Sulfadiazine can be decreased when combined with Erythromycin.Approved, Vet Approved
SulfamethoxazoleSulfamethoxazole may increase the QTc-prolonging activities of Erythromycin.Approved
SulfinpyrazoneThe metabolism of Sulfinpyrazone can be decreased when combined with Erythromycin.Approved
SulfisoxazoleErythromycin may increase the QTc-prolonging activities of Sulfisoxazole.Approved, Vet Approved
SumatriptanThe serum concentration of Erythromycin can be increased when it is combined with Sumatriptan.Approved, Investigational
SunitinibSunitinib may increase the QTc-prolonging activities of Erythromycin.Approved, Investigational
SuvorexantThe serum concentration of Suvorexant can be increased when it is combined with Erythromycin.Approved
Synthetic Conjugated Estrogens, AThe metabolism of Synthetic Conjugated Estrogens, A can be decreased when combined with Erythromycin.Approved
Synthetic Conjugated Estrogens, BThe metabolism of Synthetic Conjugated Estrogens, B can be decreased when combined with Erythromycin.Approved
TacrineThe serum concentration of Erythromycin can be increased when it is combined with Tacrine.Withdrawn
TacrolimusThe serum concentration of Tacrolimus can be increased when it is combined with Erythromycin.Approved, Investigational
TadalafilThe metabolism of Tadalafil can be decreased when combined with Erythromycin.Approved, Investigational
TamoxifenTamoxifen may increase the QTc-prolonging activities of Erythromycin.Approved
TamsulosinThe metabolism of Tamsulosin can be decreased when combined with Erythromycin.Approved, Investigational
TasosartanThe metabolism of Tasosartan can be decreased when combined with Erythromycin.Approved
Taurochenodeoxycholic acidThe metabolism of Taurochenodeoxycholic acid can be decreased when combined with Erythromycin.Experimental
Taurocholic AcidThe serum concentration of Taurocholic Acid can be decreased when it is combined with Erythromycin.Experimental
Technetium Tc-99m sestamibiThe serum concentration of Technetium Tc-99m sestamibi can be decreased when it is combined with Erythromycin.Approved
TelaprevirThe serum concentration of Erythromycin can be increased when it is combined with Telaprevir.Withdrawn
TelavancinErythromycin may increase the QTc-prolonging activities of Telavancin.Approved
TelithromycinErythromycin may increase the QTc-prolonging activities of Telithromycin.Approved
TelmisartanThe serum concentration of Erythromycin can be increased when it is combined with Telmisartan.Approved, Investigational
TemazepamThe metabolism of Temazepam can be decreased when combined with Erythromycin.Approved
TemsirolimusThe risk or severity of adverse effects can be increased when Erythromycin is combined with Temsirolimus.Approved
TeniposideThe metabolism of Teniposide can be decreased when combined with Erythromycin.Approved
TerazosinThe serum concentration of Erythromycin can be increased when it is combined with Terazosin.Approved
TerbinafineThe metabolism of Terbinafine can be decreased when combined with Erythromycin.Approved, Investigational, Vet Approved
TerbutalineTerbutaline may increase the QTc-prolonging activities of Erythromycin.Approved
TerfenadineErythromycin may increase the QTc-prolonging activities of Terfenadine.Withdrawn
TergurideThe risk or severity of adverse effects can be increased when Terguride is combined with Erythromycin.Experimental
TeriflunomideThe serum concentration of Erythromycin can be increased when it is combined with Teriflunomide.Approved
TerodilineThe metabolism of Terodiline can be decreased when combined with Erythromycin.Experimental
TesmilifeneThe metabolism of Tesmilifene can be decreased when combined with Erythromycin.Investigational
TestosteroneThe metabolism of Testosterone can be decreased when combined with Erythromycin.Approved, Investigational
TetrabenazineErythromycin may increase the QTc-prolonging activities of Tetrabenazine.Approved
TetracyclineThe metabolism of Tetracycline can be decreased when combined with Erythromycin.Approved, Vet Approved
TetrahydropalmatineThe metabolism of Tetrahydropalmatine can be decreased when combined with Erythromycin.Investigational
TheophyllineThe metabolism of Theophylline can be decreased when combined with Erythromycin.Approved
ThioridazineErythromycin may increase the QTc-prolonging activities of Thioridazine.Withdrawn
ThiotepaThe metabolism of Thiotepa can be decreased when combined with Erythromycin.Approved
ThiothixeneThiothixene may increase the QTc-prolonging activities of Erythromycin.Approved
TiagabineThe metabolism of Tiagabine can be decreased when combined with Erythromycin.Approved
TicagrelorThe metabolism of Ticagrelor can be decreased when combined with Erythromycin.Approved
TiclopidineThe metabolism of Erythromycin can be decreased when combined with Ticlopidine.Approved
TimololThe serum concentration of Timolol can be decreased when it is combined with Erythromycin.Approved
TinidazoleThe metabolism of Tinidazole can be decreased when combined with Erythromycin.Approved, Investigational
TiotropiumThe metabolism of Tiotropium can be decreased when combined with Erythromycin.Approved
TipranavirThe metabolism of Tipranavir can be decreased when combined with Erythromycin.Approved, Investigational
TizanidineTizanidine may increase the QTc-prolonging activities of Erythromycin.Approved
TocilizumabThe serum concentration of Erythromycin can be decreased when it is combined with Tocilizumab.Approved
TofacitinibThe metabolism of Tofacitinib can be decreased when combined with Erythromycin.Approved, Investigational
Tolfenamic AcidThe metabolism of Tolfenamic Acid can be decreased when combined with Erythromycin.Approved
TolterodineTolterodine may increase the QTc-prolonging activities of Erythromycin.Approved, Investigational
TolvaptanThe serum concentration of Tolvaptan can be increased when it is combined with Erythromycin.Approved
TopotecanThe serum concentration of Topotecan can be increased when it is combined with Erythromycin.Approved, Investigational
ToremifeneThe metabolism of Toremifene can be decreased when combined with Erythromycin.Approved, Investigational
TrabectedinThe serum concentration of Trabectedin can be increased when it is combined with Erythromycin.Approved, Investigational
TramadolThe metabolism of Tramadol can be decreased when combined with Erythromycin.Approved, Investigational
TranilastThe metabolism of Tranilast can be decreased when combined with Erythromycin.Approved, Investigational
Trastuzumab emtansineThe metabolism of Trastuzumab emtansine can be decreased when combined with Erythromycin.Approved
TrazodoneTrazodone may increase the QTc-prolonging activities of Erythromycin.Approved, Investigational
TreprostinilTreprostinil may increase the QTc-prolonging activities of Erythromycin.Approved, Investigational
TretinoinThe metabolism of Tretinoin can be decreased when combined with Erythromycin.Approved, Investigational, Nutraceutical
TriamcinoloneThe metabolism of Triamcinolone can be decreased when combined with Erythromycin.Approved, Vet Approved
TriazolamThe serum concentration of Triazolam can be increased when it is combined with Erythromycin.Approved
TrifluoperazineThe serum concentration of Erythromycin can be increased when it is combined with Trifluoperazine.Approved
TriflupromazineThe serum concentration of Erythromycin can be increased when it is combined with Triflupromazine.Approved, Vet Approved
TrimethadioneThe metabolism of Trimethadione can be decreased when combined with Erythromycin.Approved
TrimethoprimTrimethoprim may increase the QTc-prolonging activities of Erythromycin.Approved, Vet Approved
TrimipramineTrimipramine may increase the QTc-prolonging activities of Erythromycin.Approved
TriptorelinTriptorelin may increase the QTc-prolonging activities of Erythromycin.Approved, Vet Approved
TroglitazoneThe metabolism of Troglitazone can be decreased when combined with Erythromycin.Withdrawn
TroleandomycinThe metabolism of Troleandomycin can be decreased when combined with Erythromycin.Approved
UbidecarenoneThe serum concentration of Ubidecarenone can be increased when it is combined with Erythromycin.Experimental
UdenafilThe metabolism of Udenafil can be decreased when combined with Erythromycin.Approved, Investigational
UlipristalThe serum concentration of Ulipristal can be increased when it is combined with Erythromycin.Approved
UmeclidiniumThe serum concentration of Umeclidinium can be decreased when it is combined with Erythromycin.Approved
ValbenazineThe metabolism of Valbenazine can be decreased when combined with Erythromycin.Approved, Investigational
ValdecoxibThe metabolism of Valdecoxib can be decreased when combined with Erythromycin.Investigational, Withdrawn
VandetanibThe metabolism of Vandetanib can be decreased when combined with Erythromycin.Approved
VanoxerineThe metabolism of Vanoxerine can be decreased when combined with Erythromycin.Investigational
VardenafilThe serum concentration of Vardenafil can be increased when it is combined with Erythromycin.Approved
VecuroniumThe serum concentration of Vecuronium can be decreased when it is combined with Erythromycin.Approved
VelpatasvirThe metabolism of Velpatasvir can be decreased when combined with Erythromycin.Approved
VemurafenibThe metabolism of Vemurafenib can be decreased when combined with Erythromycin.Approved
VenetoclaxThe metabolism of Venetoclax can be decreased when combined with Erythromycin.Approved
VenlafaxineVenlafaxine may increase the QTc-prolonging activities of Erythromycin.Approved
VerapamilThe metabolism of Verapamil can be decreased when combined with Erythromycin.Approved
VicrivirocThe metabolism of Vicriviroc can be decreased when combined with Erythromycin.Investigational
VilanterolVilanterol may increase the QTc-prolonging activities of Erythromycin.Approved
VilazodoneThe serum concentration of Vilazodone can be increased when it is combined with Erythromycin.Approved
VinblastineThe serum concentration of Vinblastine can be increased when it is combined with Erythromycin.Approved
VincamineThe serum concentration of Vincamine can be increased when it is combined with Erythromycin.Experimental
VincristineThe serum concentration of Vincristine can be decreased when it is combined with Erythromycin.Approved, Investigational
VincristineThe serum concentration of Vincristine can be increased when it is combined with Erythromycin.Approved, Investigational
VindesineThe serum concentration of Vindesine can be increased when it is combined with Erythromycin.Approved
VinflunineThe serum concentration of Vinflunine can be increased when it is combined with Erythromycin.Approved
VinorelbineThe serum concentration of Vinorelbine can be increased when it is combined with Erythromycin.Approved, Investigational
VinpocetineThe metabolism of Vinpocetine can be decreased when combined with Erythromycin.Investigational
VismodegibThe metabolism of Vismodegib can be decreased when combined with Erythromycin.Approved
VoriconazoleThe metabolism of Erythromycin can be decreased when combined with Voriconazole.Approved, Investigational
VorinostatVorinostat may increase the QTc-prolonging activities of Erythromycin.Approved, Investigational
VortioxetineThe metabolism of Vortioxetine can be decreased when combined with Erythromycin.Approved
VoxilaprevirThe metabolism of Voxilaprevir can be decreased when combined with Erythromycin.Approved
WarfarinThe serum concentration of Warfarin can be increased when it is combined with Erythromycin.Approved
XylometazolineThe metabolism of Xylometazoline can be decreased when combined with Erythromycin.Approved
YohimbineThe metabolism of Yohimbine can be decreased when combined with Erythromycin.Approved, Vet Approved
ZafirlukastThe serum concentration of Zafirlukast can be decreased when it is combined with Erythromycin.Approved, Investigational
ZalcitabineThe metabolism of Zalcitabine can be decreased when combined with Erythromycin.Approved
ZaleplonThe metabolism of Zaleplon can be decreased when combined with Erythromycin.Approved, Illicit, Investigational
ZiconotideThe metabolism of Ziconotide can be decreased when combined with Erythromycin.Approved
ZidovudineThe metabolism of Zidovudine can be decreased when combined with Erythromycin.Approved
ZileutonThe metabolism of Zileuton can be decreased when combined with Erythromycin.Approved, Investigational, Withdrawn
ZimelidineThe serum concentration of Erythromycin can be increased when it is combined with Zimelidine.Withdrawn
ZiprasidoneThe metabolism of Erythromycin can be decreased when combined with Ziprasidone.Approved
ZolpidemThe metabolism of Zolpidem can be decreased when combined with Erythromycin.Approved
ZomepiracThe metabolism of Zomepirac can be decreased when combined with Erythromycin.Withdrawn
ZonisamideThe metabolism of Zonisamide can be decreased when combined with Erythromycin.Approved, Investigational
ZopicloneThe serum concentration of Zopiclone can be increased when it is combined with Erythromycin.Approved
ZuclopenthixolThe serum concentration of Zuclopenthixol can be increased when it is combined with Erythromycin.Approved, Investigational
Food Interactions
  • Avoid alcohol.
  • Take on empty stomach: 1 hour before or 2 hours after meals.
  • Take with a full glass of water Avoid taking with grapefruit juice.

References

Synthesis Reference

Takehiro Amano, Masami Goi, Kazuto Sekiuchi, Tomomichi Yoshida, Masahiro Hasegawa, "Process for preparing erythromycin A oxime or a salt thereof." U.S. Patent US5274085, issued October, 1966.

US5274085
General References
  1. Kanazawa S, Ohkubo T, Sugawara K: The effects of grapefruit juice on the pharmacokinetics of erythromycin. Eur J Clin Pharmacol. 2001 Jan-Feb;56(11):799-803. [PubMed:11294369]
  2. Ogwal S, Xide TU: Bioavailability and stability of erythromycin delayed release tablets. Afr Health Sci. 2001 Dec;1(2):90-6. [PubMed:12789122]
  3. Okudaira T, Kotegawa T, Imai H, Tsutsumi K, Nakano S, Ohashi K: Effect of the treatment period with erythromycin on cytochrome P450 3A activity in humans. J Clin Pharmacol. 2007 Jul;47(7):871-6. [PubMed:17585116]
External Links
Human Metabolome Database
HMDB14344
KEGG Drug
D00140
KEGG Compound
C01912
PubChem Compound
12560
PubChem Substance
46508487
ChemSpider
12041
BindingDB
50344942
ChEBI
42355
ChEMBL
CHEMBL532
Therapeutic Targets Database
DAP000111
PharmGKB
PA449493
HET
ERY
RxList
RxList Drug Page
Drugs.com
Drugs.com Drug Page
PDRhealth
PDRhealth Drug Page
Wikipedia
Erythromycin
ATC Codes
D10AF52 — Erythromycin, combinationsD10AF02 — ErythromycinJ01FA01 — ErythromycinS01AA17 — Erythromycin
AHFS Codes
  • 52:04.04 — Antibacterials
  • 84:04.04 — Antibiotics
  • 84:16.00 — Cell Stimulants and Proliferants
  • 08:12.12.04 — Erythromycins
  • 84:28.00 — Keratolytic Agents
  • 08:12.20 — Sulfonamides
PDB Entries
1jzy / 1yi2 / 2iyf / 2j0d / 3aoc / 3frq / 3j5l / 3j7z / 4m83 / 4v7u
show 12 more
FDA label
Download (149 KB)
MSDS
Download (73 KB)

Clinical Trials

Clinical Trials
PhaseStatusPurposeConditionsCount
0RecruitingTreatmentOsteomyelitis1
1CompletedNot AvailableCardiology: RR / QT1
1CompletedNot AvailableHealthy Volunteers1
1CompletedBasic ScienceDiabetes, Diabetes Mellitus Type 11
1CompletedBasic ScienceHealthy Volunteers1
1CompletedTreatmentB-Cell Chronic Lymphocytic Leukemia1
1CompletedTreatmentHealthy Volunteers / Impaired Renal Function1
1CompletedTreatmentHepatitis C Virus (HCV)1
1CompletedTreatmentHuman Immunodeficiency Virus (HIV) Infections1
1, 2TerminatedTreatmentAlbinism, Oculocutaneous / Hermansky-Pudlak Syndrome (HPS) / Metabolic Diseases / Platelet Storage Pool Deficiency / Pulmonary Fibrosis1
2CompletedPreventionMalignant Neoplasm of Stomach / Subtotal Gastrectomy1
2CompletedPreventionRas-wildtype Colorectal Cancer1
2CompletedTreatmentAspiration of Gastric Contents / Gastric Emptying1
2CompletedTreatmentBulimia Nervosa (BN) / Eating Disorders1
2CompletedTreatmentChlamydia Trachomatis Infection in Pregnancy1
2TerminatedTreatmentGastroparesis2
2, 3CompletedSupportive CareHealthy Volunteers1
2, 3Unknown StatusTreatmentChronic Obstructive Pulmonary Disease (COPD)1
3Active Not RecruitingTreatmentHaematemesis / Hemorrhage, Gastrointestinal1
3CompletedPreventionHuman Immunodeficiency Virus (HIV) Infections1
3CompletedTreatmentLung Cancer Non-Small Cell Cancer (NSCLC)1
3CompletedTreatmentPreterm Premature Rupture of the Membranes1
3RecruitingTreatmentPreterm Premature Rupture of Membranes (PPROM)1
3Unknown StatusTreatmentEpidermolysis Bullosa1
3WithdrawnPreventionPreterm Premature Ruptured Membranes1
4CompletedBasic ScienceHealthy Volunteers1
4CompletedTreatmentAcute Obliterating Bronchiolitis / Obliterative Bronchiolitis1
4CompletedTreatmentAsthma Bronchial1
4CompletedTreatmentHealthy Volunteers1
4CompletedTreatmentPancreatitis1
4CompletedTreatmentBacterial blepharitis1
4Enrolling by InvitationBasic ScienceBMI >30 kg/m2 / Healthy Volunteers1
4Not Yet RecruitingBasic ScienceHealthy Volunteers1
4Not Yet RecruitingTreatmentFAP-Familial Adenomatous Polyposis1
4Not Yet RecruitingTreatmentProphylaxis against postoperative nausea and vomiting1
4RecruitingPreventionAntibiotic Allergy / Antibiotic Side Effect / Eyelid Diseases / Eyelid; Wound / Infection, Postoperative Wound / Skin Cancer Face / Surgical Incision / Surgical Site Infections / Surgical Wound, Recent1
4Unknown StatusTreatmentFAP-Familial Adenomatous Polyposis1
Not AvailableActive Not RecruitingNot AvailableBronchiectasis1
Not AvailableCompletedNot AvailableHealthy Volunteers1
Not AvailableCompletedBasic SciencePregnancy1
Not AvailableCompletedDiagnosticColorectal Cancer Screening1
Not AvailableCompletedTreatmentLevodopa / Parkinson's Disease (PD)1
Not AvailableCompletedTreatmentVariceal Bleeding1
Not AvailableNot Yet RecruitingNot AvailableCommunity Acquired Pneumonia (CAP)1
Not AvailableNot Yet RecruitingNot AvailableNewborn; Infection1
Not AvailableNot Yet RecruitingSupportive CareSevere Stroke / Stroke, Acute / Swallowing Disorders1
Not AvailableRecruitingTreatmentLiver Cirrhosis1
Not AvailableTerminatedPreventionLength of Pregnancy Prolongation in Hours1
Not AvailableTerminatedTreatmentFeeding Disorder / Infants, Premature / Nutrition Disorder1
Not AvailableTerminatedTreatmentUpper Gastrointestinal Hemorrhage1
Not AvailableUnknown StatusTreatmentApnea / Bradycardia / Reflux, Gastroesophageal1
Not AvailableUnknown StatusTreatmentHepatic Encephalopathy / Liver Cirrhosis / Portal Hypertension1
Not AvailableUnknown StatusTreatmentPneumonia1

Pharmacoeconomics

Manufacturers
  • Hospira inc
  • Parke davis div warner lambert co
  • Warner chilcott inc
  • Abbott laboratories pharmaceutical products div
  • Barr laboratories inc
  • Stiefel laboratories inc
  • Altana inc
  • Merz pharmaceuticals llc
  • Perrigo co
  • Syosset laboratories inc
  • Akorn inc
  • Bausch and lomb pharmaceuticals inc
  • E fougera div altana inc
  • Pharmaderm div altana inc
  • Pharmafair inc
  • Dista products co div eli lilly and co
  • Dow pharmaceutical sciences inc
  • Paddock laboratories inc
  • Taro pharmaceuticals north america inc
  • Bioglan pharma inc
  • Alpharma us pharmaceuticals division
  • Eli lilly and co
  • Perrigo new york inc
  • Wockhardt eu operations (swiss) ag
  • Hi tech pharmacal co inc
  • Westwood squibb pharmaceuticals inc
  • Ivax pharmaceuticals inc sub teva pharmaceuticals usa
  • Orthoneutrogena
  • Versapharm inc
  • Ah robins co
  • Solvay pharmaceuticals
  • Watson laboratories inc
  • Life laboratories inc
  • Lilly research laboratories div eli lilly and co
  • Ross laboratories div abbott laboratories inc
  • Pharmacia and upjohn co
  • Naska pharmacal co inc div rugby darby group cosmetics
  • Wyeth ayerst laboratories
  • Abbott laboratories chemical and agricultural products div
  • Mylan pharmaceuticals inc
  • Elkins sinn div ah robins co inc
  • Abraxis pharmaceutical products
  • Baxter healthcare corp anesthesia and critical care
  • Teva parenteral medicines inc
  • Bristol laboratories inc div bristol myers co
  • Warner chilcott div warner lambert co
  • Lederle laboratories div american cyanamid co
  • Purepac pharmaceutical co
  • Bristol myers squibb co
  • Pfizer laboratories div pfizer inc
Packagers
Dosage forms
FormRouteStrength
Tablet, delayed releaseOral250 mg
Kit
Granule, for suspensionOral200 mg/5mL
TabletOral400 mg/1
Tablet, film coatedOral400 mg/1
Powder, for suspensionOral40 mg
TabletOral200 mg
Powder, for suspensionOral400 mg
SolutionTopical.8 mL/100mL
SuspensionOral200 mg/5mL
SuspensionOral400 mg/5mL
Tablet, delayed releaseOral250 mg/1
Tablet, delayed releaseOral333 mg/1
Tablet, delayed releaseOral500 mg/1
Capsule, delayed releaseOral250 mg
Capsule, delayed releaseOral333 mg
TabletOral600 mg
TabletOral250 mg
TabletOral500 mg
Powder, for solutionIntravenous1 g
Powder, for solutionIntravenous500 mg
Injection, powder, lyophilized, for solutionIntravenous500 mg/10mL
Injection, powder, lyophilized, for solutionIntravenous500 mg/100mL
LiquidOral50 mg
LiquidOral25 mg
TabletOral500 mg/1
Tablet, film coatedOral250 mg/1
Tablet, film coatedOral500 mg/1
Capsule, delayed releaseOral250 mg/1
Capsule, delayed release pelletsOral250 mg/1
GelTopical20 mg/g
OintmentOphthalmic5 mg/g
SolutionTopical20 mg/mL
SolutionTopical20 mg/1
GelTopical
KitTopical
Granule, for suspensionOral
CapsuleOral250 mg
SuspensionOral125 mg
OintmentOphthalmic.5 mg/g
OintmentOphthalmic.5 %
SuspensionOral250 mg
PowderOral400 mg
Powder, for solutionOral100 mg
Powder, for solutionOral200 mg
OintmentOphthalmic5 mg
TabletOral333 mg/1
TabletOral333 mg
Powder, for suspensionOral
SolutionTopical
LotionTopical
Lotion; swabTopical
Prices
Unit descriptionCostUnit
Benzamycin 5-3% Gel 46.6 gm Jar236.63USD jar
BenzamycinPak 60 5-3% Packets (2 Box Contains 60 Packets)142.45USD packet
Erythromycin 2% Gel 60 gm Tube46.8USD tube
Erycette 60 2% Pad Box30.99USD box
Erythromycin 2% Gel 30 gm Tube26.2USD tube
Erythromycin 2% Solution 60ml Bottle26.13USD bottle
Eryderm 2% Solution 60ml Bottle25.99USD bottle
Erythromycin 5 mg/gm Ointment Limited Supply Available.13.99USD tube
Benzamycin gel4.95USD g
Akne-mycin 2% ointment3.96USD g
PCE 500 mg Enteric Coated Tabs3.28USD tab
Pce 500 mg dispertab3.03USD tablet
PCE 333 mg Enteric Coated Tabs2.48USD tab
Erythromycin e.s. powder2.39USD g
Benzamycinpak gel2.37USD gel
Pce 333 mg dispertab2.3USD tablet
Romycin eye ointment1.98USD g
Erythromycin eye ointment1.44USD g
Pms-Erythromycin 0.5 % Ointment1.3USD g
Emgel 2% topical gel1.07USD g
Ery-Tab 500 mg Enteric Coated Tabs0.93USD tab
Ery-tab 500 mg tablet ec0.77USD tablet
Ery-Tab 333 mg Enteric Coated Tabs0.72USD tab
Erythro-rx powder0.72USD g
Erythromycin ec 500 mg tablet0.66USD tablet
Erythromycin Base 500 mg tablet0.61USD tablet
Eryc 333 mg Capsule (Enteric-Coated Pellet)0.6USD capsule
Apo-Erythro-S 500 mg Tablet0.57USD tablet
E-mycin 333 mg tablet ec0.54USD tablet
Eryc 250 mg Capsule (Enteric-Coated Pellet)0.54USD capsule
Erythromycin powder0.54USD g
Erythromycin 2% gel0.5USD g
Erythromycin Base 250 mg Enteric Coated Capsule0.5USD capsule
Erythromycin Base 250 mg tablet0.5USD tablet
Ery-tab ec 500 mg tablet0.46USD tablet
Apo-Erythro E-C 333 mg Capsule (Enteric-Coated Pellet)0.45USD capsule
Ery-Tab 250 mg Enteric Coated Tabs0.45USD tab
Erythromycin st 500 mg tablet0.44USD tablet
Apo-Erythro E-C 250 mg Capsule (Enteric-Coated Pellet)0.41USD capsule
Ery-tab 333 mg tablet ec0.4USD tablet
Apo-Erythro-Es 600 mg Tablet0.35USD tablet
Erythromycin 500 mg filmtab0.3USD tablet
Erythrocin 500 mg filmtab0.29USD tablet
Ery-tab 250 mg tablet ec0.27USD tablet
E.e.s. 400 filmtab0.25USD tablet
Erythromycin 250 mg filmtab0.25USD tablet
Erythromycin es 400 mg tablet0.25USD tablet
Apo-Erythro-S 250 mg Tablet0.22USD tablet
Apo-Erythro Base 250 mg Tablet0.19USD tablet
Erythrocin 250 mg filmtab0.16USD tablet
Novo-Rythro Ees 80 mg/ml Suspension0.15USD ml
Novo-Rythro Estolate 50 mg/ml Suspension0.13USD ml
Novo-Rythro Ees 40 mg/ml Suspension0.1USD ml
DrugBank does not sell nor buy drugs. Pricing information is supplied for informational purposes only.
Patents
Not Available

Properties

State
Solid
Experimental Properties
PropertyValueSource
melting point (°C)191 °CPhysProp
water solubility2000mg/L at 28°CEuropean Pharmacopeia
logP3.06MCFARLAND,JW ET AL. (1997)
Caco2 permeability-5.43ADME Research, USCD
pKa8.88 (at 25 °C)MCFARLAND,JW ET AL. (1997)
Predicted Properties
PropertyValueSource
Water Solubility0.459 mg/mLALOGPS
logP2.37ALOGPS
logP2.6ChemAxon
logS-3.2ALOGPS
pKa (Strongest Acidic)12.44ChemAxon
pKa (Strongest Basic)8.38ChemAxon
Physiological Charge1ChemAxon
Hydrogen Acceptor Count13ChemAxon
Hydrogen Donor Count5ChemAxon
Polar Surface Area193.91 Å2ChemAxon
Rotatable Bond Count7ChemAxon
Refractivity186.04 m3·mol-1ChemAxon
Polarizability78.21 Å3ChemAxon
Number of Rings3ChemAxon
Bioavailability0ChemAxon
Rule of FiveNoChemAxon
Ghose FilterNoChemAxon
Veber's RuleNoChemAxon
MDDR-like RuleYesChemAxon
Predicted ADMET features
PropertyValueProbability
Human Intestinal Absorption+0.5114
Blood Brain Barrier-0.9889
Caco-2 permeable-0.8957
P-glycoprotein substrateSubstrate0.8098
P-glycoprotein inhibitor IInhibitor0.8564
P-glycoprotein inhibitor IINon-inhibitor0.5963
Renal organic cation transporterNon-inhibitor0.9222
CYP450 2C9 substrateNon-substrate0.7898
CYP450 2D6 substrateNon-substrate0.9225
CYP450 3A4 substrateSubstrate0.6528
CYP450 1A2 substrateNon-inhibitor0.9045
CYP450 2C9 inhibitorNon-inhibitor0.907
CYP450 2D6 inhibitorNon-inhibitor0.923
CYP450 2C19 inhibitorNon-inhibitor0.9074
CYP450 3A4 inhibitorNon-inhibitor0.5744
CYP450 inhibitory promiscuityLow CYP Inhibitory Promiscuity0.9391
Ames testNon AMES toxic0.9133
CarcinogenicityNon-carcinogens0.9335
BiodegradationNot ready biodegradable1.0
Rat acute toxicity2.2296 LD50, mol/kg Not applicable
hERG inhibition (predictor I)Weak inhibitor0.9902
hERG inhibition (predictor II)Non-inhibitor0.8956
ADMET data is predicted using admetSAR, a free tool for evaluating chemical ADMET properties. (23092397)

Spectra

Mass Spec (NIST)
Not Available
Spectra
SpectrumSpectrum TypeSplash Key
Predicted GC-MS Spectrum - GC-MSPredicted GC-MSNot Available
Predicted MS/MS Spectrum - 10V, Positive (Annotated)Predicted LC-MS/MSNot Available
Predicted MS/MS Spectrum - 20V, Positive (Annotated)Predicted LC-MS/MSNot Available
Predicted MS/MS Spectrum - 40V, Positive (Annotated)Predicted LC-MS/MSNot Available
Predicted MS/MS Spectrum - 10V, Negative (Annotated)Predicted LC-MS/MSNot Available
Predicted MS/MS Spectrum - 20V, Negative (Annotated)Predicted LC-MS/MSNot Available
Predicted MS/MS Spectrum - 40V, Negative (Annotated)Predicted LC-MS/MSNot Available
MS/MS Spectrum - DI-ESI-Ion Trap , PositiveLC-MS/MSNot Available
MS/MS Spectrum - DI-ESI-Hybrid FT , PositiveLC-MS/MSNot Available
LC-MS/MS Spectrum - LC-ESI-QTOF , positiveLC-MS/MSsplash10-0a7i-0900070700-45f1a3bf3aac26069507
LC-MS/MS Spectrum - LC-ESI-QTOF , positiveLC-MS/MSsplash10-0a4i-0900020000-c282d6a703a3a812c91a
LC-MS/MS Spectrum - LC-ESI-QTOF , positiveLC-MS/MSsplash10-0a4i-0900000000-b11e26802dca28ea88f0
LC-MS/MS Spectrum - LC-ESI-QTOF , positiveLC-MS/MSsplash10-0a4i-0900000000-5ea1e94063a49c0d6ddb
LC-MS/MS Spectrum - LC-ESI-ITFT , positiveLC-MS/MSsplash10-004i-0000090000-f0fcdc5ed4d00170f2a3
LC-MS/MS Spectrum - LC-ESI-ITFT , positiveLC-MS/MSsplash10-001i-0200000900-439b7d31b57ea93dff40
LC-MS/MS Spectrum - LC-ESI-ITFT , positiveLC-MS/MSsplash10-0a59-4900000000-1cb488a53f50cba638cf
LC-MS/MS Spectrum - LC-ESI-ITFT , positiveLC-MS/MSsplash10-001i-9700000000-239fd7095409362c75bc
LC-MS/MS Spectrum - LC-ESI-ITFT , positiveLC-MS/MSsplash10-001i-9000000000-37757a9a6c61ec2bac1b
LC-MS/MS Spectrum - LC-ESI-ITFT , positiveLC-MS/MSsplash10-001i-9000000000-2d04ae69b21d82ee0763
LC-MS/MS Spectrum - LC-ESI-ITFT , positiveLC-MS/MSsplash10-001i-9000000000-2d04ae69b21d82ee0763
LC-MS/MS Spectrum - LC-ESI-ITFT , positiveLC-MS/MSsplash10-053r-0500000900-20a1c46dfdef404c9d3e
LC-MS/MS Spectrum - LC-ESI-ITFT , positiveLC-MS/MSsplash10-0a59-5900000000-c7e9166d7e79e23023a5
LC-MS/MS Spectrum - LC-ESI-ITFT , positiveLC-MS/MSsplash10-053r-9800000000-07e4c66bcd0be93f7c09
LC-MS/MS Spectrum - LC-ESI-ITFT , positiveLC-MS/MSsplash10-001i-9200000000-553fb27002eceacb9270
LC-MS/MS Spectrum - LC-ESI-ITFT , positiveLC-MS/MSsplash10-001i-9000000000-9725c29b26f7cbbef576
LC-MS/MS Spectrum - LC-ESI-ITFT , positiveLC-MS/MSsplash10-001i-9000000000-2d04ae69b21d82ee0763
LC-MS/MS Spectrum - LC-ESI-ITFT , positiveLC-MS/MSsplash10-004i-0000090100-c815622b0bac716ba224
LC-MS/MS Spectrum - LC-ESI-QTOF , positiveLC-MS/MSsplash10-001i-0000020900-78ac24c4a3447cf2cb78
LC-MS/MS Spectrum - LC-ESI-QTOF , positiveLC-MS/MSsplash10-004i-0000090400-0c8362975e5b8d5441bb
LC-MS/MS Spectrum - LC-ESI-QTOF , positiveLC-MS/MSsplash10-004i-0200090000-b4daabb8616be713f34c
LC-MS/MS Spectrum - LC-ESI-QTOF , positiveLC-MS/MSsplash10-0a4i-0900020000-595b522fe60bb668626a
LC-MS/MS Spectrum - LC-ESI-ITFT , positiveLC-MS/MSsplash10-004i-0041090000-e9aadb2dff7c545dfce4
LC-MS/MS Spectrum - LC-ESI-ITFT , positiveLC-MS/MSsplash10-004i-0020092000-6a2a3f6a74deed47dd72
LC-MS/MS Spectrum - LC-ESI-ITFT , positiveLC-MS/MSsplash10-056r-0070390000-4f9cd4f2a3b1e945ccfa
LC-MS/MS Spectrum - LC-ESI-ITFT , positiveLC-MS/MSsplash10-0fw9-0004960000-669f9bf82a144b4b5cdb

Taxonomy

Description
This compound belongs to the class of organic compounds known as aminoglycosides. These are molecules or a portion of a molecule composed of amino-modified sugars.
Kingdom
Organic compounds
Super Class
Organic oxygen compounds
Class
Organooxygen compounds
Sub Class
Carbohydrates and carbohydrate conjugates
Direct Parent
Aminoglycosides
Alternative Parents
Macrolides and analogues / O-glycosyl compounds / Monosaccharides / Oxanes / Tertiary alcohols / 1,2-aminoalcohols / Trialkylamines / Lactones / Cyclic ketones / Carboxylic acid esters
show 10 more
Substituents
Aminoglycoside core / Macrolide / Glycosyl compound / O-glycosyl compound / Oxane / Monosaccharide / Tertiary alcohol / 1,2-aminoalcohol / Amino acid or derivatives / Carboxylic acid ester
show 23 more
Molecular Framework
Aliphatic heteromonocyclic compounds
External Descriptors
erythromycin (CHEBI:42355) / Macrolides and lactone polyketides, Macrolides (C01912) / Macrolides and lactone polyketides (LMPK04000006)

Targets

1. 23S rRNA
Kind
Nucleotide
Organism
Enteric bacteria and other eubacteria
Pharmacological action
Yes
Actions
Inhibitor
References
  1. Moazed D, Noller HF: Chloramphenicol, erythromycin, carbomycin and vernamycin B protect overlapping sites in the peptidyl transferase region of 23S ribosomal RNA. Biochimie. 1987 Aug;69(8):879-84. [PubMed:3122849]
  2. Schlunzen F, Zarivach R, Harms J, Bashan A, Tocilj A, Albrecht R, Yonath A, Franceschi F: Structural basis for the interaction of antibiotics with the peptidyl transferase centre in eubacteria. Nature. 2001 Oct 25;413(6858):814-21. [PubMed:11677599]
  3. Garza-Ramos G, Xiong L, Zhong P, Mankin A: Binding site of macrolide antibiotics on the ribosome: new resistance mutation identifies a specific interaction of ketolides with rRNA. J Bacteriol. 2001 Dec;183(23):6898-907. [PubMed:11698379]
  4. Douthwaite S, Aagaard C: Erythromycin binding is reduced in ribosomes with conformational alterations in the 23 S rRNA peptidyl transferase loop. J Mol Biol. 1993 Aug 5;232(3):725-31. [PubMed:7689111]
  5. Wahab HA, Yam WK, Samian MR, Najimudin N: Refinement of a low-resolution crystal structure to better understand erythromycin interactions on large ribosomal subunit. J Biomol Struct Dyn. 2008 Aug;26(1):131-46. [PubMed:18533733]
Details
2. Motilin receptor
Kind
Protein
Organism
Human
Pharmacological action
No
Actions
Agonist
General Function
Growth hormone-releasing hormone receptor activity
Specific Function
Receptor for motilin.
Gene Name
MLNR
Uniprot ID
O43193
Uniprot Name
Motilin receptor
Molecular Weight
45343.725 Da
References
  1. Peeters T, Matthijs G, Depoortere I, Cachet T, Hoogmartens J, Vantrappen G: Erythromycin is a motilin receptor agonist. Am J Physiol. 1989 Sep;257(3 Pt 1):G470-4. [PubMed:2782416]
  2. Deloose E, Vos R, Janssen P, Van den Bergh O, Van Oudenhove L, Depoortere I, Tack J: The motilin receptor agonist erythromycin stimulates hunger and food intake through a cholinergic pathway. Am J Clin Nutr. 2016 Mar;103(3):730-7. doi: 10.3945/ajcn.115.113456. Epub 2016 Jan 27. [PubMed:26817505]
Kind
Protein
Organism
Human
Pharmacological action
No
Actions
Inhibitor
General Function
Voltage-gated potassium channel activity involved in ventricular cardiac muscle cell action potential repolarization
Specific Function
Pore-forming (alpha) subunit of voltage-gated inwardly rectifying potassium channel. Channel properties are modulated by cAMP and subunit assembly. Mediates the rapidly activating component of the ...
Gene Name
KCNH2
Uniprot ID
Q12809
Uniprot Name
Potassium voltage-gated channel subfamily H member 2
Molecular Weight
126653.52 Da
References
  1. Du LP, Tsai KC, Li MY, You QD, Xia L: The pharmacophore hypotheses of I(Kr) potassium channel blockers: novel class III antiarrhythmic agents. Bioorg Med Chem Lett. 2004 Sep 20;14(18):4771-7. [PubMed:15324906]
  2. Stanat SJ, Carlton CG, Crumb WJ Jr, Agrawal KC, Clarkson CW: Characterization of the inhibitory effects of erythromycin and clarithromycin on the HERG potassium channel. Mol Cell Biochem. 2003 Dec;254(1-2):1-7. [PubMed:14674677]
  3. Volberg WA, Koci BJ, Su W, Lin J, Zhou J: Blockade of human cardiac potassium channel human ether-a-go-go-related gene (HERG) by macrolide antibiotics. J Pharmacol Exp Ther. 2002 Jul;302(1):320-7. [PubMed:12065733]
Details
4. Serum albumin
Kind
Protein
Organism
Human
Pharmacological action
No
Actions
Binder
General Function
Toxic substance binding
Specific Function
Serum albumin, the main protein of plasma, has a good binding capacity for water, Ca(2+), Na(+), K(+), fatty acids, hormones, bilirubin and drugs. Its main function is the regulation of the colloid...
Gene Name
ALB
Uniprot ID
P02768
Uniprot Name
Serum albumin
Molecular Weight
69365.94 Da
References
  1. Baneres-Roquet F, Gualtieri M, Villain-Guillot P, Pugniere M, Leonetti JP: Use of a surface plasmon resonance method to investigate antibiotic and plasma protein interactions. Antimicrob Agents Chemother. 2009 Apr;53(4):1528-31. doi: 10.1128/AAC.00971-08. Epub 2009 Jan 21. [PubMed:19164148]
  2. Naik KM, Nandibewoor ST: Investigation into the interaction of methylparaben and erythromycin with human serum albumin using multispectroscopic methods. Luminescence. 2016 Mar;31(2):433-41. doi: 10.1002/bio.2979. Epub 2015 Aug 3. [PubMed:26239839]

Enzymes

Details
1. Cytochrome P450 3A4
Kind
Protein
Organism
Human
Pharmacological action
No
Actions
Substrate
Inhibitor
General Function
Vitamin d3 25-hydroxylase activity
Specific Function
Cytochromes P450 are a group of heme-thiolate monooxygenases. In liver microsomes, this enzyme is involved in an NADPH-dependent electron transport pathway. It performs a variety of oxidation react...
Gene Name
CYP3A4
Uniprot ID
P08684
Uniprot Name
Cytochrome P450 3A4
Molecular Weight
57342.67 Da
References
  1. Preissner S, Kroll K, Dunkel M, Senger C, Goldsobel G, Kuzman D, Guenther S, Winnenburg R, Schroeder M, Preissner R: SuperCYP: a comprehensive database on Cytochrome P450 enzymes including a tool for analysis of CYP-drug interactions. Nucleic Acids Res. 2010 Jan;38(Database issue):D237-43. doi: 10.1093/nar/gkp970. Epub 2009 Nov 24. [PubMed:19934256]
  2. Ekins S, Bravi G, Wikel JH, Wrighton SA: Three-dimensional-quantitative structure activity relationship analysis of cytochrome P-450 3A4 substrates. J Pharmacol Exp Ther. 1999 Oct;291(1):424-33. [PubMed:10490933]
  3. Drug Interactions: Cytochrome P450 Drug Interaction Table [Link]
Kind
Protein
Organism
Human
Pharmacological action
No
Actions
Substrate
Inhibitor
General Function
Oxygen binding
Specific Function
Cytochromes P450 are a group of heme-thiolate monooxygenases. In liver microsomes, this enzyme is involved in an NADPH-dependent electron transport pathway. It oxidizes a variety of structurally un...
Gene Name
CYP3A7
Uniprot ID
P24462
Uniprot Name
Cytochrome P450 3A7
Molecular Weight
57525.03 Da
References
  1. Drug Interactions: Cytochrome P450 Drug Interaction Table [Link]
Kind
Protein
Organism
Human
Pharmacological action
No
Actions
Inhibitor
General Function
Oxidoreductase activity, acting on paired donors, with incorporation or reduction of molecular oxygen, reduced flavin or flavoprotein as one donor, and incorporation of one atom of oxygen
Specific Function
Cytochromes P450 are a group of heme-thiolate monooxygenases. In liver microsomes, this enzyme is involved in an NADPH-dependent electron transport pathway. It oxidizes a variety of structurally un...
Gene Name
CYP1A2
Uniprot ID
P05177
Uniprot Name
Cytochrome P450 1A2
Molecular Weight
58293.76 Da
References
  1. Preissner S, Kroll K, Dunkel M, Senger C, Goldsobel G, Kuzman D, Guenther S, Winnenburg R, Schroeder M, Preissner R: SuperCYP: a comprehensive database on Cytochrome P450 enzymes including a tool for analysis of CYP-drug interactions. Nucleic Acids Res. 2010 Jan;38(Database issue):D237-43. doi: 10.1093/nar/gkp970. Epub 2009 Nov 24. [PubMed:19934256]
Kind
Protein
Organism
Human
Pharmacological action
No
Actions
Substrate
General Function
Steroid hydroxylase activity
Specific Function
Cytochromes P450 are a group of heme-thiolate monooxygenases. In liver microsomes, this enzyme is involved in an NADPH-dependent electron transport pathway. It oxidizes a variety of structurally un...
Gene Name
CYP2B6
Uniprot ID
P20813
Uniprot Name
Cytochrome P450 2B6
Molecular Weight
56277.81 Da
References
  1. Preissner S, Kroll K, Dunkel M, Senger C, Goldsobel G, Kuzman D, Guenther S, Winnenburg R, Schroeder M, Preissner R: SuperCYP: a comprehensive database on Cytochrome P450 enzymes including a tool for analysis of CYP-drug interactions. Nucleic Acids Res. 2010 Jan;38(Database issue):D237-43. doi: 10.1093/nar/gkp970. Epub 2009 Nov 24. [PubMed:19934256]

Transporters

Kind
Protein
Organism
Human
Pharmacological action
No
Actions
Inhibitor
General Function
Xenobiotic-transporting atpase activity
Specific Function
Energy-dependent efflux pump responsible for decreased drug accumulation in multidrug-resistant cells.
Gene Name
ABCB1
Uniprot ID
P08183
Uniprot Name
Multidrug resistance protein 1
Molecular Weight
141477.255 Da
References
  1. Schuetz EG, Beck WT, Schuetz JD: Modulators and substrates of P-glycoprotein and cytochrome P4503A coordinately up-regulate these proteins in human colon carcinoma cells. Mol Pharmacol. 1996 Feb;49(2):311-8. [PubMed:8632764]
  2. Polli JW, Wring SA, Humphreys JE, Huang L, Morgan JB, Webster LO, Serabjit-Singh CS: Rational use of in vitro P-glycoprotein assays in drug discovery. J Pharmacol Exp Ther. 2001 Nov;299(2):620-8. [PubMed:11602674]
  3. Ekins S, Kim RB, Leake BF, Dantzig AH, Schuetz EG, Lan LB, Yasuda K, Shepard RL, Winter MA, Schuetz JD, Wikel JH, Wrighton SA: Three-dimensional quantitative structure-activity relationships of inhibitors of P-glycoprotein. Mol Pharmacol. 2002 May;61(5):964-73. [PubMed:11961113]
  4. Takano M, Hasegawa R, Fukuda T, Yumoto R, Nagai J, Murakami T: Interaction with P-glycoprotein and transport of erythromycin, midazolam and ketoconazole in Caco-2 cells. Eur J Pharmacol. 1998 Oct 9;358(3):289-94. [PubMed:9822896]
  5. Schwarz UI, Gramatte T, Krappweis J, Oertel R, Kirch W: P-glycoprotein inhibitor erythromycin increases oral bioavailability of talinolol in humans. Int J Clin Pharmacol Ther. 2000 Apr;38(4):161-7. [PubMed:10783825]
  6. Terashi K, Oka M, Soda H, Fukuda M, Kawabata S, Nakatomi K, Shiozawa K, Nakamura T, Tsukamoto K, Noguchi Y, Suenaga M, Tei C, Kohno S: Interactions of ofloxacin and erythromycin with the multidrug resistance protein (MRP) in MRP-overexpressing human leukemia cells. Antimicrob Agents Chemother. 2000 Jun;44(6):1697-700. [PubMed:10817732]
Kind
Protein
Organism
Human
Pharmacological action
No
Actions
Substrate
General Function
Sodium-independent organic anion transmembrane transporter activity
Specific Function
Mediates the Na(+)-independent uptake of organic anions such as pravastatin, taurocholate, methotrexate, dehydroepiandrosterone sulfate, 17-beta-glucuronosyl estradiol, estrone sulfate, prostagland...
Gene Name
SLCO1B1
Uniprot ID
Q9Y6L6
Uniprot Name
Solute carrier organic anion transporter family member 1B1
Molecular Weight
76447.99 Da
References
  1. Sun H, Huang Y, Frassetto L, Benet LZ: Effects of uremic toxins on hepatic uptake and metabolism of erythromycin. Drug Metab Dispos. 2004 Nov;32(11):1239-46. Epub 2004 Jul 30. [PubMed:15286055]

Drug created on June 13, 2005 07:24 / Updated on October 21, 2017 19:20