
Accession Number
DB00544  (APRD00516, EXPT03204)
Small Molecule

A pyrimidine analog that is an antineoplastic antimetabolite. It interferes with DNA synthesis by blocking the thymidylate synthetase conversion of deoxyuridylic acid to thymidylic acid.

  • 5-Fluoracil
  • 5-Fluoropyrimidine-2,4-dione
  • 5-Fluorouracil
  • 5-Fluracil
  • 5-FU
  • Fluoro Uracil
  • Fluorouracil
  • Fluorouracilo
  • Fluorouracilum
  • Fluouracil
External IDs
NSC-19893 / RO 2-9757
Prescription Products
NameDosageStrengthRouteLabellerMarketing StartMarketing End
AdrucilSolution50 mgIntravenousPfizer Canada Ulc1995-12-312004-04-08Canada
Adrucil Inj 50mg/mlLiquidIntravenousAdria Laboratories Of Canada Ltd.1978-12-311996-09-10Canada
CaracCream5 mg/1gTopicalBausch Health Americas, Inc.2013-06-28Not applicableUs
CaracCream5 mg/1gTopicalDermik Laboratories2000-10-272015-11-30Us
EfudexCream2 g/40gTopicalPhysicians Total Care, Inc.1970-07-292011-09-30Us
EfudexSolution0.5 g/10mLTopicalBausch Health US LLC1970-07-292008-02-28Us
EfudexCream5 %TopicalValeant Canada Lp Valeant Canada S.E.C.1975-12-31Not applicableCanada
EfudexCream2 g/40gTopicalBausch Health US LLC1970-07-29Not applicableUs
EfudexSolution1.25 g/10mLTopicalBausch Health US LLC1970-07-292010-01-31Us
FluoroplexCream10 mg/1gTopicalAlmirall, LLC1993-12-03Not applicableUs
Additional Data Available
  • Application Number
    Application Number

    A unique ID assigned by the FDA when a product is submitted for approval by the labeller.

    Learn more
  • Product Code
    Product Code

    A governmentally-recognized ID which uniquely identifies the product within its regulatory market.

    Learn more
Generic Prescription Products
NameDosageStrengthRouteLabellerMarketing StartMarketing End
AdrucilInjection, solution5 g/100mLIntravenousTeva Parenteral Medicines, Inc.2003-10-012020-10-31Us
AdrucilInjection, solution2.5 g/50mLIntravenousTeva Parenteral Medicines, Inc.2003-10-01Not applicableUs
AdrucilInjection, solution50 mg/1mLIntravenousTeva Parenteral Medicines, Inc.2003-10-01Not applicableUs
FluorouracilCream50 mg/1gTopicalPhysicians Total Care, Inc.2011-09-06Not applicableUs
FluorouracilSolution20 mg/1mLTopicalSolubiomix2003-11-052017-10-10Us
FluorouracilCream50 mg/1gTopicalSpear Dermatology Products2008-04-112022-08-31Us
FluorouracilInjection, solution50 mg/1mLIntravenousGland Pharma Limited2017-11-07Not applicableUs
FluorouracilInjection, solution50 mg/1mLIntravenousSandoz2011-05-02Not applicableUs
FluorouracilInjection, solution50 mg/1mLIntravenousGland Pharma Limited2017-11-07Not applicableUs
FluorouracilCream50 mg/1gTopicalA-S Medication Solutions2010-03-05Not applicableUs
Additional Data Available
  • Application Number
    Application Number

    A unique ID assigned by the FDA when a product is submitted for approval by the labeller.

    Learn more
  • Product Code
    Product Code

    A governmentally-recognized ID which uniquely identifies the product within its regulatory market.

    Learn more
Mixture Products
NameIngredientsDosageRouteLabellerMarketing StartMarketing End
ActikerallFluorouracil (0.5 %) + Salicylic acid (10 %)SolutionTopicalCipher Pharmaceuticals Inc.2016-02-19Not applicableCanada
Unapproved/Other Products
NameIngredientsDosageRouteLabellerMarketing StartMarketing End
FluoracFluorouracil (5 g/100g) + Diclofenac sodium (1 g/100g)CreamTopicalBurke Therapeutics, LLC2015-01-222015-09-14Us
VerrunexFluorouracil (0.5 g/0.5g) + Salicylic acid (1.2 g/1.2g)KitTopicalAccumix Pharmaceuticals2014-12-152015-07-17Us
International/Other Brands
Carzonal (Tobishi) / Efudix (Meda) / Efurix (Valeant) / Ftoruracil (Verofarm)
CAS number
Average: 130.0772
Monoisotopic: 130.017855555
Chemical Formula
InChI Key



For the topical treatment of multiple actinic or solar keratoses. In the 5% strength it is also useful in the treatment of superficial basal cell carcinomas when conventional methods are impractical, such as with multiple lesions or difficult treatment sites. Fluorouracil injection is indicated in the palliative management of some types of cancer, including colon, esophageal, gastric, rectum, breast, biliary tract, stomach, head and neck, cervical, pancreas, renal cell, and carcinoid.

Associated Conditions

Fluorouracil is an antineoplastic anti-metabolite. Anti-metabolites masquerade as purine or pyrimidine - which become the building blocks of DNA. They prevent these substances from becoming incorporated into DNA during the "S" phase (of the cell cycle), stopping normal development and division. Fluorouracil blocks an enzyme which converts the cytosine nucleotide into the deoxy derivative. In addition, DNA synthesis is further inhibited because Fluorouracil blocks the incorporation of the thymidine nucleotide into the DNA strand.

Mechanism of action

The precise mechanism of action has not been fully determined, but the main mechanism of fluorouracil is thought to be the binding of the deoxyribonucleotide of the drug (FdUMP) and the folate cofactor, N5–10-methylenetetrahydrofolate, to thymidylate synthase (TS) to form a covalently bound ternary complex. This results in the inhibition of the formation of thymidylate from uracil, which leads to the inhibition of DNA and RNA synthesis and cell death. Fluorouracil can also be incorporated into RNA in place of uridine triphosphate (UTP), producing a fraudulent RNA and interfering with RNA processing and protein synthesis.

AThymidylate synthase
incorporation into and destabilization
incorporation into and destabilization
Additional Data Available
Adverse Effects

Comprehensive structured data on known drug adverse effects with statistical prevalence. MedDRA and ICD10 ids are provided for adverse effect conditions and symptoms.

Learn more
Additional Data Available

Structured data covering drug contraindications. Each contraindication describes a scenario in which the drug is not to be used. Includes restrictions on co-administration, contraindicated populations, and more.

Learn more
Additional Data Available
Blackbox Warnings

Structured data representing warnings from the black box section of drug labels. These warnings cover important and dangerous risks, contraindications, or adverse effects.

Learn more


Volume of distribution
Not Available
Protein binding



Hepatic. The catabolic metabolism of fluorouracil results in degradation products ( e.g., CO2, urea and α-fluoro-ß-alanine) which are inactive.

Route of elimination

Seven percent to 20% of the parent drug is excreted unchanged in the urine in 6 hours; of this over 90% is excreted in the first hour. The remaining percentage of the administered dose is metabolized, primarily in the liver.

Half life

10-20 minutes

Not Available

LD50=230mg/kg (orally in mice)

Affected organisms
  • Humans and other mammals
Capecitabine Action PathwayDrug action
Fluorouracil Action PathwayDrug action
Capecitabine Metabolism PathwayDrug metabolism
Fluorouracil Metabolism PathwayDrug metabolism
Pharmacogenomic Effects/ADRs
Interacting Gene/EnzymeAllele nameGenotype(s)Defining Change(s)Type(s)DescriptionDetails
Thymidylate synthaseTSER*2Not Available(CCGCGCCACTTCGCCTGCCTCCGTCCCG)2/3/4ADR Directly StudiedPatients with this genotype have increased risk of severe neutropenia or severe diarrhea with [drug; fluorouracil].Details
Dihydropyrimidine dehydrogenase [NADP(+)]---(G;G) / (A;G)C allele / G alleleADR Directly StudiedPatients with this genotype have reduced metabolism of fluorouracil and increased risk of toxicity.Details
Glutathione S-transferase P---(A;A) / (A;G)A alleleADR Directly StudiedPatients with this genotype have increased risk of toxicity with fluorouracilDetails
Dihydropyrimidine dehydrogenase [NADP(+)]---(A;A) / (A;G)A alleleADR Directly StudiedPatients with this genotype have reduced metabolism of fluorouracil and increased risk of toxicity.Details
Dihydropyrimidine dehydrogenase [NADP(+)]---(A;A) / (A;T)T > AADR Directly StudiedPatients with this genotype have reduced metabolism of fluorouracil and increased risk of toxicity.Details
Dihydropyrimidine dehydrogenase [NADP(+)]DPYD*2A(A;A) / (A;G)G > AADR Directly StudiedThe presence of this genotype in DPYD is associated with an increased risk of drug-related toxicity from fluorouracil therapy.Details
Dihydropyrimidine dehydrogenase [NADP(+)]DPYD*13(C;C) / (A;C)A > CADR Directly StudiedThe presence of this genotype in DPYD is associated with an increased risk of drug-related toxicity from fluorouracil therapy.Details
Dihydropyrimidine dehydrogenase [NADP(+)]---(A;A) / (A;T)T > AADR Directly StudiedThe presence of this genotype in DPYD is associated with an increased risk of drug-related toxicity from fluorouracil therapy.Details
Dihydropyrimidine dehydrogenase [NADP(+)]DPYD*4(G;G) / (A:G)G > AADR Directly StudiedThe presence of this genotype in DPYD may be associated with an increased risk of drug-related toxicity from fluorouracil therapy.Details
Dihydropyrimidine dehydrogenase [NADP(+)]DPYD*5(G;G) / (A;G)A > GADR Directly StudiedThe presence of this genotype in DPYD may be associated with an increased risk of drug-related toxicity from fluorouracil therapy.Details
Dihydropyrimidine dehydrogenase [NADP(+)]DPYD*6(A;A) / (A;G)G > AADR Directly StudiedThe presence of this genotype in DPYD may be associated with an increased risk of drug-related toxicity from fluorouracil therapy.Details
Dihydropyrimidine dehydrogenase [NADP(+)]DPYD*9A(C;C) / (C;T)T > CADR Directly StudiedThe presence of this genotype in DPYD may be associated with an increased risk of drug-related toxicity from fluorouracil therapy.Details


Drug Interactions
This information should not be interpreted without the help of a healthcare provider. If you believe you are experiencing an interaction, contact a healthcare provider immediately. The absence of an interaction does not necessarily mean no interactions exist.
(6R)-Folinic acidThe risk or severity of adverse effects can be increased when (6R)-Folinic acid is combined with Fluorouracil.
(6S)-5,6,7,8-tetrahydrofolic acidThe risk or severity of adverse effects can be increased when (6S)-5,6,7,8-tetrahydrofolic acid is combined with Fluorouracil.
(R)-warfarinThe metabolism of (R)-warfarin can be decreased when combined with Fluorouracil.
(S)-WarfarinThe metabolism of (S)-Warfarin can be decreased when combined with Fluorouracil.
2-MethoxyethanolThe risk or severity of adverse effects can be increased when Fluorouracil is combined with 2-Methoxyethanol.
4-hydroxycoumarinThe risk or severity of bleeding can be increased when Fluorouracil is combined with 4-hydroxycoumarin.
5-methyltetrahydrofolic acidThe risk or severity of adverse effects can be increased when 5-methyltetrahydrofolic acid is combined with Fluorouracil.
6-O-benzylguanineThe metabolism of 6-O-benzylguanine can be decreased when combined with Fluorouracil.
8-azaguanineThe metabolism of 8-azaguanine can be decreased when combined with Fluorouracil.
8-chlorotheophyllineThe metabolism of 8-chlorotheophylline can be decreased when combined with Fluorouracil.
Additional Data Available
  • Extended Description
    Extended Description

    Extended description of the mechanism of action and particular properties of each drug interaction.

    Learn more
  • Severity

    A severity rating for each drug interaction, from minor to major.

    Learn more
  • Evidence Level
    Evidence Level

    A rating for the strength of the evidence supporting each drug interaction.

    Learn more
  • Action

    An effect category for each drug interaction. Know how this interaction affects the subject drug.

    Learn more
Food Interactions
No interactions found.


Synthesis Reference

Leroy B. Townsend, Robert A. Earl, Steven J. Manning, "Method of synthesizing 1-(tetrahydro-2-furanyl)-5-fluorouracil." U.S. Patent US3960864, issued October, 1969.

General References
  1. Longley DB, Harkin DP, Johnston PG: 5-fluorouracil: mechanisms of action and clinical strategies. Nat Rev Cancer. 2003 May;3(5):330-8. [PubMed:12724731]
  2. Petty RD, Cassidy J: Novel fluoropyrimidines: improving the efficacy and tolerability of cytotoxic therapy. Curr Cancer Drug Targets. 2004 Mar;4(2):191-204. [PubMed:15032669]
External Links
Human Metabolome Database
KEGG Compound
PubChem Compound
PubChem Substance
Therapeutic Targets Database
PDBe Ligand
RxList Drug Page Drug Page
ATC Codes
L01BC52 — Fluorouracil, combinationsL01BC02 — Fluorouracil
AHFS Codes
  • 10:00.00 — Antineoplastic Agents
  • 84:92.00 — Misc. Skin and Mucous Membrane Agents
PDB Entries
1h7x / 1rxc / 1upf / 3kvr / 3kvv / 3nai / 3nbq / 4e1v / 4o0o / 4txn
show 7 more
FDA label
Download (378 KB)
Download (74 KB)

Clinical Trials

Clinical Trials
0Active Not RecruitingTreatmentBreast Cancer / Pregnancy1
0Active Not RecruitingTreatmentCarcinoma of the Anal Canal1
0CompletedPreventionGastro-esophageal Junction Cancer / Malignant Neoplasm of Stomach1
0CompletedTreatmentAcinar Cell Adenocarcinoma of the Pancreas / Duct Cell Adenocarcinoma of the Pancreas / Recurrent Pancreatic Cancer / Stage II Pancreatic Cancer / Stage III Pancreatic Cancer1
0CompletedTreatmentActinic Keratosis (AK)1
0CompletedTreatmentAdenocarcinoma of the Pancreas / Recurrent Pancreatic Carcinoma / Stage III Pancreatic Cancer / Stage IV Pancreatic Cancer / Unresectable Pancreatic Carcinoma1
0CompletedTreatmentResectable Pancreatic Cancers1
0Not Yet RecruitingTreatmentActinic Keratosis (AK)1
0RecruitingTreatmentBorderline Pancreatic Inoperable Cancer / Locally Advanced Pancreatic Cancer / Malignant Neoplasm of Pancreas1
0RecruitingTreatmentCervical Intraepithelial Neoplasia Grade 2/3 / Cervical Squamous Cell Carcinoma In Situ / Cervical Squamous Intraepithelial Neoplasia 2 / High Grade Cervical Intraepithelial Neoplasia / P16 Positive Neoplastic Cells Present1
0RecruitingTreatmentClinical Stage II Esophageal Adenocarcinoma AJCC v8 / Clinical Stage II Gastroesophageal Junction Adenocarcinoma AJCC v8 / Clinical Stage IIA Esophageal Adenocarcinoma AJCC v8 / Clinical Stage IIA Gastroesophageal Junction Adenocarcinoma AJCC v8 / Clinical Stage IIB Esophageal Adenocarcinoma AJCC v8 / Clinical Stage IIB Gastroesophageal Junction Adenocarcinoma AJCC v8 / Clinical Stage III Esophageal Adenocarcinoma AJCC v8 / Clinical Stage III Gastroesophageal Junction Adenocarcinoma AJCC v8 / Pathologic Stage IB Esophageal Adenocarcinoma AJCC v8 / Pathologic Stage IB Gastroesophageal Junction Adenocarcinoma AJCC v8 / Pathologic Stage IC Esophageal Adenocarcinoma AJCC v8 / Pathologic Stage IC Gastroesophageal Junction Adenocarcinoma AJCC v8 / Pathologic Stage II Esophageal Adenocarcinoma AJCC v8 / Pathologic Stage II Gastroesophageal Junction Adenocarcinoma AJCC v8 / Pathologic Stage IIA Esophageal Adenocarcinoma AJCC v8 / Pathologic Stage IIA Gastroesophageal Junction Adenocarcinoma AJCC v8 / Pathologic Stage IIB Esophageal Adenocarcinoma AJCC v8 / Pathologic Stage IIB Gastroesophageal Junction Adenocarcinoma AJCC v8 / Pathologic Stage III Esophageal Adenocarcinoma AJCC v8 / Pathologic Stage III Gastroesophageal Junction Adenocarcinoma AJCC v8 / Pathologic Stage IIIA Esophageal Adenocarcinoma AJCC v8 / Pathologic Stage IIIA Gastroesophageal Junction Adenocarcinoma AJCC v8 / Pathologic Stage IIIB Esophageal Adenocarcinoma AJCC v8 / Pathologic Stage IIIB Gastroesophageal Junction Adenocarcinoma AJCC v81
0RecruitingTreatmentGastrointestinal Cancers1
1Active Not RecruitingTreatmentAcinar Cell Adenocarcinoma of the Pancreas / Adenocarcinoma of the Gallbladder / Adenocarcinoma of Unknown Primary / Adult Primary Cholangiocellular Carcinoma / Advanced Adult Primary Liver Cancer / Advanced Gastric Cancer / Cholangiocarcinoma of the Extrahepatic Bile Duct / Cholangiocarcinoma of the Gallbladder / Diffuse Adenocarcinoma of the Stomach / Duct Cell Adenocarcinoma of the Pancreas / Intestinal Adenocarcinoma of the Stomach / Localized Unresectable Adult Primary Liver Cancer / Metastatic Carcinoma of Unknown Primary / Metastatic Extrahepatic Bile Duct Cancer / Mixed Adenocarcinoma of the Stomach / Mucinous Adenocarcinoma of the Colon / Mucinous Adenocarcinoma of the Rectum / Newly Diagnosed Carcinoma of Unknown Primary / Signet Ring Adenocarcinoma of the Colon / Signet Ring Adenocarcinoma of the Rectum / Stage III Pancreatic Cancer / Stage IIIA Colon Cancer / Stage IIIA Gallbladder Cancer / Stage IIIA Gastric Cancer / Stage IIIA Rectal Cancer / Stage IIIB Colon Cancer / Stage IIIB Gallbladder Cancer / Stage IIIB Gastric Cancer / Stage IIIB Rectal Cancer / Stage IIIC Colon Cancer / Stage IIIC Gastric Cancer / Stage IIIC Rectal Cancer / Stage IV Pancreatic Cancer / Stage IVA Colon Cancer / Stage IVA Gallbladder Cancer / Stage IVA Rectal Cancer / Stage IVB Colon Cancer / Stage IVB Gallbladder Cancer / Stage IVB Rectal Cancer / Unresectable Extrahepatic Bile Duct Cancer1
1Active Not RecruitingTreatmentAcinar Cell Adenocarcinoma of the Pancreas / Duct Cell Adenocarcinoma of the Pancreas / Recurrent Pancreatic Cancer / Stage IV Pancreatic Cancer1
1Active Not RecruitingTreatmentAdenocarcinoma of the Rectum / Cancer of Rectum / Cancer of the Rectum / Rectal Carcinoma / Rectum Cancer / Rectum Neoplasms1
1Active Not RecruitingTreatmentAdvanced Solid Tumor Malignancies1
1Active Not RecruitingTreatmentAdvanced Solid Tumors1
1Active Not RecruitingTreatmentAdvanced Solid Tumours1
1Active Not RecruitingTreatmentBreast Cancer / Carcinoma, Colorectal / Carcinoma, Pancreatic / Lung Cancer Non-Small Cell Cancer (NSCLC) / Melanoma / Ovarian Cancer / Prostate Cancer / Renal Cell Adenocarcinoma / Tumors, Solid1
1Active Not RecruitingTreatmentBreast Cancer / Neoplasms Metastasis / Neoplasms, Colorectal1
1Active Not RecruitingTreatmentCancer of Colon / Cancer of Pancreas / Colon Carcinoma / Colorectal Cancers / Malignant Neoplasm of Large Intestine / Malignant Neoplasm of Pancreas / Malignant Tumor of Colon / Neoplasms, Pancreatic1
1Active Not RecruitingTreatmentColorectal Cancers1
1Active Not RecruitingTreatmentColorectal Cancers / Metastatic Cancers1
1Active Not RecruitingTreatmentMalignancies1
1Active Not RecruitingTreatmentMalignant Neoplasm of Pancreas2
1Active Not RecruitingTreatmentMucinous Adenocarcinoma of the Colon / Mucinous Adenocarcinoma of the Rectum / Recurrent Colon Cancer / Recurrent Rectal Cancer / Signet Ring Adenocarcinoma of the Colon / Signet Ring Adenocarcinoma of the Rectum / Stage IIIA Colon Cancer / Stage IIIA Rectal Cancer / Stage IIIB Colon Cancer / Stage IIIB Rectal Cancer / Stage IIIC Colon Cancer / Stage IIIC Rectal Cancer / Stage IVA Colon Cancer / Stage IVA Rectal Cancer / Stage IVB Colon Cancer / Stage IVB Rectal Cancer1
1Active Not RecruitingTreatmentMucinous Adenocarcinoma of the Rectum / Rectal Adenocarcinoma / Recurrent Rectal Cancer / Signet Ring Adenocarcinoma of the Rectum / Stage IIA Rectal Cancer / Stage IIA to IIIC Rectal Cancer / Stage IIB Rectal Cancer / Stage IIC Rectal Cancer / Stage IIIA Rectal Cancer / Stage IIIB Rectal Cancer / Stage IIIC Rectal Cancer1
1Active Not RecruitingTreatmentNeoplasms / Solid Cancers1
1Active Not RecruitingTreatmentPancreatic Adenocarcinoma Metastatic1
1Active Not RecruitingTreatmentRecurrent Rectal Cancer / Stage IIA Rectal Cancer / Stage IIB Rectal Cancer / Stage IIC Rectal Cancer / Stage IIIA Rectal Cancer / Stage IIIB Rectal Cancer / Stage IIIC Rectal Cancer1
1Active Not RecruitingTreatmentTumors, Solid1
1CompletedDiagnosticRecurrent or Metastatic Colorectal Cancer1
1CompletedTreatmentAbdominal wall neoplasm / Carcinoma, Squamous Cell of Head and Neck / Esophageal Squamous Cell Carcinoma (ESCC) / Esophagogastric Junction Neoplasms / Fallopian Tube Neoplasms / Neoplasms, Ovarian / Pancreatic Ductal Carcinoma / Small Cell Lung Cancer (SCLC) / Stomach Neoplasms / Triple Negative Breast Neoplasms1
1CompletedTreatmentAdenocarcinoma of the Esophagus / Adenocarcinoma of the Stomach / Adenocarcinomas of the Gastroesophageal Junction / Malignant Neoplasm of Stomach Stage II / Squamous Cell Carcinoma of the Esophagus / Stage II Esophageal Cancer / Stage III Esophageal Cancer / Stage III Gastric Cancer1
1CompletedTreatmentAdenocarcinoma of the Pancreas1
1CompletedTreatmentAdenocarcinoma of the Pancreas / Stage III Pancreatic Cancer1
1CompletedTreatmentAdenocarcinoma of the Rectum / Mucinous Adenocarcinoma of the Rectum / Signet Ring Adenocarcinoma of the Rectum / Stage IIA Rectal Cancer / Stage IIB Rectal Cancer / Stage IIC Rectal Cancer / Stage IIIA Rectal Cancer / Stage IIIB Rectal Cancer / Stage IIIC Rectal Cancer1
1CompletedTreatmentAdenocarcinoma of the Rectum / Stage II Rectal Cancer / Stage III Rectal Cancer1
1CompletedTreatmentAdenocarcinomas / Colorectal / Metastatic1
1CompletedTreatmentAdenocarcinomas / Malignant Neoplasm of Pancreas / Neoplasms, Pancreatic1
1CompletedTreatmentAdvanced Cancers2
1CompletedTreatmentAdvanced Colorectal Carcinoma1
1CompletedTreatmentAdvanced Relapsed Tumors / Refractory Solid Tumors1
1CompletedTreatmentAdvanced Solid Tumors2
1CompletedTreatmentAdvanced Solid Tumors / Liver Cancer1
1CompletedTreatmentAdvanced Solid Tumors / Metastatic Colorectal Cancer (MCRC)1
1CompletedTreatmentAdvanced Solid Tumors / Metastatic Colorectal Cancer (MCRC) / Pancreatic Cancer Metastatic1
1CompletedTreatmentBreast Cancer1
1CompletedTreatmentBreast Cancer / Colorectal Cancers / Head and Neck Carcinoma / Lung Cancers / Prostate Cancer1
1CompletedTreatmentBreast Cancer / Lung Cancers / Malignant Neoplasm of Colon / Malignant Neoplasm of Stomach / Ovarian Cancer / Tumors, Solid1
1CompletedTreatmentCancer of Pancreas / Cancer of the Pancreas / Malignant Neoplasm of Pancreas / Neoplasms, Pancreatic / Pancreas Neoplasms1
1CompletedTreatmentCancer of the Gallbladder / Cancer, Anal / Carcinoid tumour of the gastrointestinal tract / Carcinoma of the Appendix / Colorectal Cancers / Esophageal Cancers / Extrahepatic Bile Duct Cancer / Gastrointestinal Stromal Tumors / Liver Cancer / Malignant Neoplasm of Pancreas / Malignant Neoplasm of Stomach / Small Intestine Cancer1
1CompletedTreatmentCancer of the Gallbladder / Colorectal Cancers / Esophageal Cancers / Extrahepatic Bile Duct Cancer / Liver Cancer / Lung Cancers / Malignant Lymphomas / Malignant Neoplasm of Pancreas / Small Intestine Cancer / Unspecified Adult Solid Tumor, Protocol Specific1
1CompletedTreatmentCancer, Advanced1
1CompletedTreatmentCarcinoma, Colorectal1
1CompletedTreatmentCentral Nervous System Malignancies / Ependymomas1
1CompletedTreatmentChildhood Central Nervous System Choriocarcinoma / Childhood Central Nervous System Embryonal Tumor / Childhood Central Nervous System Germ Cell Tumor / Childhood Central Nervous System Germinoma / Childhood Central Nervous System Mixed Germ Cell Tumor / Childhood Central Nervous System Teratoma / Childhood Central Nervous System Yolk Sac Tumor / Recurrent Childhood Brain Stem Glioma / Recurrent Childhood Central Nervous System Embryonal Tumor / Unspecified Childhood Solid Tumor, Protocol Specific1
1CompletedTreatmentChronic Myeloproliferative Disorders / Leukemias / Malignant Lymphomas / Multiple Myeloma and Plasma Cell Neoplasm / Myelodysplastic Syndromes / Precancerous Conditions / Unspecified Adult Solid Tumor, Protocol Specific1
1CompletedTreatmentColorectal Cancers10
1CompletedTreatmentColorectal Cancers / Diarrhea / Neutropenia1
1CompletedTreatmentColorectal Cancers / Esophageal Cancers / Gastrointestinal Stromal Tumors (GISTs) / Malignant Neoplasm of Pancreas / Malignant Neoplasm of Stomach / Rectal Carcinoma1
1CompletedTreatmentColorectal Cancers / Lung Cancers1
1CompletedTreatmentColorectal Cancers / Metastatic Cancers1
1CompletedTreatmentColorectal Cancers / Neoplasms, Colorectal1
1CompletedTreatmentColorectal Liver Metastases1
1CompletedTreatmentDuct Cell Adenocarcinoma of the Pancreas / Stage III Pancreatic Cancer / Stage IV Pancreatic Cancer1
1CompletedTreatmentEsophageal Cancers1
1CompletedTreatmentEsophageal Cancers / Liver Cancer / Malignant Neoplasm of Stomach1
1CompletedTreatmentEsophagus Disorders / Squamous Carcinoma of Esophagus1
1CompletedTreatmentGastro-Intestinal Cancer1
1CompletedTreatmentGastrointestinal Tumors1
1CompletedTreatmentHead and Neck Carcinoma1
1CompletedTreatmentKRAS Mutant Metastatic Colorectal Cancer1
1CompletedTreatmentMalignant Digestive System Neoplasm1
1CompletedTreatmentMalignant Lymphomas / Neoplasms1
1CompletedTreatmentMalignant Lymphomas / Unspecified Adult Solid Tumor, Protocol Specific1
1CompletedTreatmentMalignant Neoplasm of Colon / Rectal Carcinoma1
1CompletedTreatmentMalignant Neoplasm of Pancreas1
1CompletedTreatmentMalignant Neoplasm of Stomach1
1CompletedTreatmentMetastatic Colon Cancer / Recurrent Colon Cancer / Recurrent Rectal Cancer / Stage III Colon Cancer / Stage III Rectal Cancer / Stage IV Rectal Cancer / Unspecified Adult Solid Tumor, Protocol Specific1
1CompletedTreatmentMetastatic Colon Cancer / Recurrent Colon Cancer / Recurrent Rectal Cancer / Stage IV Rectal Cancer1
1CompletedTreatmentMetastatic Colorectal Cancer (MCRC)4
1CompletedTreatmentMetastatic Squamous Neck Cancer With Occult Primary Squamous Cell Carcinoma / Recurrent Adenoid Cystic Carcinoma of the Oral Cavity / Recurrent Basal Cell Carcinoma of the Lip / Recurrent Esthesioneuroblastoma of the Paranasal Sinus and Nasal Cavity / Recurrent Inverted Papilloma of the Paranasal Sinus and Nasal Cavity / Recurrent Lymphoepithelioma of the Nasopharynx / Recurrent Lymphoepithelioma of the Oropharynx / Recurrent Metastatic Squamous Neck Cancer With Occult Primary / Recurrent Midline Lethal Granuloma of the Paranasal Sinus and Nasal Cavity / Recurrent Mucoepidermoid Carcinoma of the Oral Cavity / Recurrent Salivary Gland Cancer / Recurrent Squamous Cell Carcinoma of the Hypopharynx / Recurrent Squamous Cell Carcinoma of the Larynx / Recurrent Squamous Cell Carcinoma of the Lip and Oral Cavity / Recurrent Squamous Cell Carcinoma of the Nasopharynx / Recurrent Squamous Cell Carcinoma of the Oropharynx / Recurrent Squamous Cell Carcinoma of the Paranasal Sinus and Nasal Cavity / Recurrent Verrucous Carcinoma of the Larynx / Recurrent Verrucous Carcinoma of the Oral Cavity / Stage III Adenoid Cystic Carcinoma of the Oral Cavity / Stage III Basal Cell Carcinoma of the Lip / Stage III Esthesioneuroblastoma of the Paranasal Sinus and Nasal Cavity / Stage III Inverted Papilloma of the Paranasal Sinus and Nasal Cavity / Stage III Lymphoepithelioma of the Nasopharynx / Stage III Lymphoepithelioma of the Oropharynx / Stage III Midline Lethal Granuloma of the Paranasal Sinus and Nasal Cavity / Stage III Mucoepidermoid Carcinoma of the Oral Cavity / Stage III Salivary Gland Cancer / Stage III Squamous Cell Carcinoma of the Hypopharynx / Stage III Squamous Cell Carcinoma of the Larynx / Stage III Squamous Cell Carcinoma of the Lip and Oral Cavity / Stage III Squamous Cell Carcinoma of the Nasopharynx / Stage III Squamous Cell Carcinoma of the Oropharynx / Stage III Squamous Cell Carcinoma of the Paranasal Sinus and Nasal Cavity / Stage III Verrucous Carcinoma of the Larynx / Stage III Verrucous Carcinoma of the Oral Cavity / Stage IV Adenoid Cystic Carcinoma of the Oral Cavity / Stage IV Basal Cell Carcinoma of the Lip / Stage IV Esthesioneuroblastoma of the Paranasal Sinus and Nasal Cavity / Stage IV Inverted Papilloma of the Paranasal Sinus and Nasal Cavity / Stage IV Lymphoepithelioma of the Nasopharynx / Stage IV Lymphoepithelioma of the Oropharynx / Stage IV Midline Lethal Granuloma of the Paranasal Sinus and Nasal Cavity / Stage IV Mucoepidermoid Carcinoma of the Oral Cavity / Stage IV Salivary Gland Cancer / Stage IV Squamous Cell Carcinoma of the Hypopharynx / Stage IV Squamous Cell Carcinoma of the Larynx / Stage IV Squamous Cell Carcinoma of the Lip and Oral Cavity / Stage IV Squamous Cell Carcinoma of the Nasopharynx / Stage IV Squamous Cell Carcinoma of the Oropharynx / Stage IV Squamous Cell Carcinoma of the Paranasal Sinus and Nasal Cavity / Stage IV Verrucous Carcinoma of the Larynx / Stage IV Verrucous Carcinoma of the Oral Cavity / Untreated Metastatic Squamous Neck Cancer With Occult Primary1
1CompletedTreatmentMucinous Adenocarcinoma of the Colon / Mucinous Adenocarcinoma of the Rectum / Recurrent Colon Cancer / Recurrent Rectal Cancer / Signet Ring Adenocarcinoma of the Colon / Signet Ring Adenocarcinoma of the Rectum / Stage IIIA Colon Cancer / Stage IIIA Rectal Cancer / Stage IIIB Colon Cancer / Stage IIIB Rectal Cancer / Stage IIIC Colon Cancer / Stage IIIC Rectal Cancer / Stage IVA Colon Cancer / Stage IVA Rectal Cancer / Stage IVB Colon Cancer / Stage IVB Rectal Cancer1
1CompletedTreatmentNeoplams, Advanced / Neoplasms, Advanced1
1CompletedTreatmentNeoplasms Malignant1
1CompletedTreatmentNeoplasms, Head and Neck1
1CompletedTreatmentNeoplasms, Pancreatic2
1CompletedTreatmentPancreatic Cancer Metastatic1
1CompletedTreatmentPeritoneal Cavity Cancer1
1CompletedTreatmentRectal Carcinoma1
1CompletedTreatmentRecurrent Colon Cancer / Recurrent Rectal Cancer / Stage IVA Colon Cancer / Stage IVA Rectal Cancer / Stage IVB Colon Cancer / Stage IVB Rectal Cancer1
1CompletedTreatmentRecurrent Colon Carcinoma / Recurrent Rectal Carcinoma / Stage IVA Colon Cancer / Stage IVA Rectal Cancer / Stage IVB Colon Cancer / Stage IVB Rectal Cancer1
1CompletedTreatmentSquamous Cell Carcinoma of the Head and Neck (SCCHN)1
1CompletedTreatmentStomach Neoplasms1
1CompletedTreatmentTumors, Solid3
1CompletedTreatmentUnspecified Adult Solid Tumor, Protocol Specific15
1Not Yet RecruitingTreatmentLiver Cancer1
1Not Yet RecruitingTreatmentLocally Advanced Pancreatic Ductal Adenocarcinoma / Metastatic Pancreatic Ductal Adenocarcinoma1
1Not Yet RecruitingTreatmentTumors, Solid1
1RecruitingPreventionAdvanced Colorectal Carcinoma / Metastatic Colorectal Carcinoma / Stage IV Colorectal Cancer AJCC v8 / Stage IVA Colorectal Cancer AJCC v8 / Stage IVB Colorectal Cancer AJCC v8 / Stage IVC Colorectal Cancer AJCC v81
1RecruitingTreatmentAdenocarcinoma of the Pancreas2
1RecruitingTreatmentAdvanced Cancers / Advanced Malignant Neoplasm / Recurrent Malignant Neoplasm / Refractory Malignant Neoplasm1
1RecruitingTreatmentAdvanced Solid Tumors1
1RecruitingTreatmentAdvanced Solid Tumors Cancer / Malignancies, Hematologic / Tumors, Solid1
1RecruitingTreatmentAdvanced Solid Tumors / Advanced/Metastatic Colorectal Cancer1
1RecruitingTreatmentBreast Cancer1
1RecruitingTreatmentBreast Cancer / Leukemia Acute Myeloid Leukemia (AML) / Malignant Neoplasm of Pancreas / Prostate Cancer1
1RecruitingTreatmentCancer of the Pancreas / Malignant Neoplasm of Pancreas1
1RecruitingTreatmentCancer, Advanced / Neoplasms1
1RecruitingTreatmentCarcinoma, Colorectal / Colorectal Cancers / Gastrointestinal Cancers / Malignant Neoplasm of Pancreas / Malignant Neoplasm of Stomach / Neoplasm, Gastric / Neoplasms, Colorectal / Neoplasms, Gastrointestinal / Neoplasms, Pancreatic1
1RecruitingTreatmentColorectal Cancers2
1RecruitingTreatmentColorectal Cancers / Gastroesophageal Cancer (GC) / Renal Cell Adenocarcinoma1
1RecruitingTreatmentGastric Adenocarcinoma1
1RecruitingTreatmentGastroesophageal Cancer (GC)1
1RecruitingTreatmentHead and Neck Carcinoma1
1RecruitingTreatmentInflammatory carcinoma of the breast1
1RecruitingTreatmentLocally Advanced Esophageal Squamous Cell Carcinoma1
1RecruitingTreatmentMalignancies / Neoplasms1
1RecruitingTreatmentMetastatic Colorectal Cancer (MCRC)1
1RecruitingTreatmentNeoadjuvant Therapy in Rectal Cancer1
1RecruitingTreatmentNeoplasms, Head and Neck1
1RecruitingTreatmentRectal Adenocarcinoma / Stage III Rectal Cancer AJCC v7 / Stage IIIA Rectal Cancer AJCC v7 / Stage IIIB Rectal Cancer AJCC v7 / Stage IIIC Rectal Cancer AJCC v7 / Stage IV Rectal Cancer AJCC v7 / Stage IVA Rectal Cancer AJCC v7 / Stage IVB Rectal Cancer AJCC v71
1RecruitingTreatmentRecurrent Salivary Gland Cancer / Recurrent Squamous Cell Carcinoma of the Hypopharynx / Recurrent Squamous Cell Carcinoma of the Larynx / Recurrent Squamous Cell Carcinoma of the Lip and Oral Cavity / Recurrent Squamous Cell Carcinoma of the Nasopharynx / Recurrent Squamous Cell Carcinoma of the Oropharynx / Recurrent Squamous Cell Carcinoma of the Paranasal Sinus and Nasal Cavity / Recurrent Verrucous Carcinoma of the Larynx / Recurrent Verrucous Carcinoma of the Oral Cavity / Salivary Gland Squamous Cell Carcinoma / Tongue Cancer1
1RecruitingTreatmentSquamous Cell Carcinoma (SCC)1
1RecruitingTreatmentTumors, Solid1
1TerminatedTreatmentAdenocarcinomas / Esophageal Cancers / Neoplasms, Esophageal / Squamous Cell Carcinoma (SCC)1
1TerminatedTreatmentAdvanced Colorectal Cancer1
1TerminatedTreatmentCancer, Anal1
1TerminatedTreatmentColorectal Cancers2
1TerminatedTreatmentEsophageal Cancers / Malignant Neoplasm of Stomach1
1TerminatedTreatmentMetastatic Colon Cancer / Recurrent Colon Cancer / Recurrent Rectal Cancer / Stage IV Rectal Cancer1
1TerminatedTreatmentMetastatic Colorectal Cancer (MCRC)1
1TerminatedTreatmentMucinous Adenocarcinoma of the Rectum / Stage IIA Rectal Cancer / Stage IIB Rectal Cancer / Stage IIC Rectal Cancer / Stage IIIB Rectal Cancer / Stage IIIC Rectal Cancer1
1TerminatedTreatmentTumors, Solid2
1Unknown StatusTreatmentCancer of the Esophagus, Gastroesophageal Junction or Stomach1
1Unknown StatusTreatmentColorectal Cancers / Renal Cancers1
1Unknown StatusTreatmentEsophageal Cancers1
1Unknown StatusTreatmentHead and Neck Carcinoma1
1WithdrawnBasic ScienceAdvanced Adenocarcinoma of the Colon or Rectum1
1WithdrawnTreatmentHead and Neck Carcinoma / Lip and Oral Cavity Cancer / Oropharyngeal Cancers1
1WithdrawnTreatmentStage IVA Colorectal Cancer / Stage IVB Colorectal Cancer1
1, 2Active Not RecruitingTreatmentAdenocarcinoma (PDAC) / Advanced or Metastatic Colorectal Cancer (CRC) / Advanced or Metastatic Solid Tumor That Progressed on Previous Therapy With a Programmed Cell Death Ligand 1 (PD-L1) Inhibitor / Advanced or Metastatic Solid Tumor That Progressed on Previous Therapy With a Programmed Cell Death Protein 1 (PD-1) Inhibitor / Advanced or Metastatic Solid Tumors / Advanced or Metastatic Squamous Cell Carcinoma of the Head and Neck (SCCHN) / Advanced or Metastatic Urothelial Carcinoma (UC) / Colorectal Cancer (CRC) / Head and Neck Carcinoma / Lung Cancers / Non-Small Cell Lung Cancer (NSCLC; Squamous or Nonsquamous) / Pancreatic Ductal Adenocarcinoma (PDAC) / Tumors, Solid / UC (Urothelial Cancer)1
1, 2Active Not RecruitingTreatmentAdenocarcinomas of the Gastroesophageal Junction / Biliary System Disorder / BRCA1 Gene Mutation / Brca2 Gene Mutation / Homologous Recombination Deficiency / Metastatic Biliary Tract Carcinoma / Metastatic Colorectal Carcinoma / Metastatic Gastroesophageal Junction Adenocarcinoma / PALB2 Gene Mutation / Pancreatic Adenocarcinoma Metastatic / Stage IV Colorectal Cancer AJCC v7 / Stage IV Pancreatic Cancer AJCC v6 and v7 / Stage IVA Colorectal Cancer AJCC v7 / Stage IVB Colorectal Cancer AJCC v71
1, 2Active Not RecruitingTreatmentAdvanced Gastrointestinal Cancers1
1, 2Active Not RecruitingTreatmentEsophageal Cancers2
1, 2Active Not RecruitingTreatmentHead and Neck Squamous Cell Carcinoma (HNSCC) / Human Papillomavirus Infections / Salivary Gland Squamous Cell Carcinoma / Stage IVA Hypopharyngeal Squamous Cell Carcinoma / Stage IVA Laryngeal Squamous Cell Carcinoma / Stage IVA Lip and Oral Cavity Squamous Cell Carcinoma / Stage IVA Major Salivary Gland Carcinoma / Stage IVA Nasal Cavity and Paranasal Sinus Squamous Cell Carcinoma / Stage IVA Oropharyngeal Carcinoma / Stage IVA Oropharyngeal Carcinoma AJCC v7 / Stage IVA Oropharyngeal Squamous Cell Carcinoma / Stage IVB Hypopharyngeal Squamous Cell Carcinoma / Stage IVB Laryngeal Squamous Cell Carcinoma / Stage IVB Lip and Oral Cavity Squamous Cell Carcinoma / Stage IVB Major Salivary Gland Carcinoma / Stage IVB Nasal Cavity and Paranasal Sinus Squamous Cell Carcinoma / Stage IVB Oropharyngeal Carcinoma / Stage IVB Oropharyngeal Carcinoma AJCC v7 / Stage IVB Oropharyngeal Squamous Cell Carcinoma / Tongue Carcinoma1
1, 2Active Not RecruitingTreatmentMalignant Neoplasm of Pancreas5
1, 2Active Not RecruitingTreatmentMCRC / Metastatic Colorectal Cancer (MCRC)1
1, 2Active Not RecruitingTreatmentNeoplasms, Colorectal1
1, 2Active Not RecruitingTreatmentPancreatic Adenocarcinoma Metastatic1
1, 2Active Not RecruitingTreatmentPancreatic Adenocarcinoma Metastatic / Recurrent Pancreatic Carcinoma / Stage III Pancreatic Cancer / Stage IV Pancreatic Cancer1
1, 2Active Not RecruitingTreatmentPancreatic Cancer Metastatic1
1, 2Active Not RecruitingTreatmentSquamous Cell Carcinoma (SCC)1
1, 2Active Not RecruitingTreatmentStomach Neoplasms1
1, 2Active Not RecruitingTreatmentTriple Negative Breast Cancer (TNBC)1
1, 2CompletedTreatmentAdenocarcinoma of the Pancreas / Adenocarcinoma of Unknown Primary / Adult Cholangiocarcinoma / Advanced Gastric Cancer / Carcinoma of Gallbladder / Gastric Adenocarcinoma / Malignant Gastrointestinal Neoplasm / Pancreatic Adenocarcinoma Metastatic / Stage III Ampulla of Vater Cancer / Stage III Pancreatic Cancer / Stage IIIA Gallbladder Cancer / Stage IIIA Gastric Cancer / Stage IIIB Gallbladder Cancer / Stage IIIB Gastric Cancer / Stage IV Ampulla of Vater Cancer / Stage IV Gallbladder Cancer / Stage IV Pancreatic Cancer1
1, 2CompletedTreatmentAdenocarcinoma of the Esophagus / Adenocarcinomas of the Gastroesophageal Junction / Advanced Gastric Cancer / Diffuse Adenocarcinoma of the Stomach / Intestinal Adenocarcinoma of the Stomach / Mixed Adenocarcinoma of the Stomach / Recurrent Esophageal Cancer / Recurrent Gastric Cancer / Stage IV Esophageal Cancer1
1, 2CompletedTreatmentAdenocarcinoma of the Rectum / Rectal Carcinoma1
1, 2CompletedTreatmentAdenocarcinoma of the Rectum / Stage II Rectal Cancer / Stage III Rectal Cancer1
1, 2CompletedTreatmentAdenocarcinomas / Malignant Neoplasm of Colon / Metastasis / Rectal Carcinoma1
1, 2CompletedTreatmentAdvanced Colorectal Carcinoma1
1, 2CompletedTreatmentAdvanced Squamous Cell Carcinoma / Squamous Cell Carcinoma of the Head and Neck (SCCHN) / SSCHN1
1, 2CompletedTreatmentCarcinoma of Head and/or Neck / Squamous Cell Carcinoma (SCC)1
1, 2CompletedTreatmentCarcinoma of Unknown Primary / Head and Neck Carcinoma1
1, 2CompletedTreatmentCarcinoma, Squamous Cell of Head and Neck1
1, 2CompletedTreatmentCervical Cancers1
1, 2CompletedTreatmentColorectal Cancers7
1, 2CompletedTreatmentColorectal Cancers / Renal Cancers1
1, 2CompletedTreatmentEsophageal Cancers4
1, 2CompletedTreatmentGastroesophageal Cancer (GC) / Malignant Solid Tumours1
1, 2CompletedTreatmentGastrointestinal Diseases1
1, 2CompletedTreatmentHead and Neck Carcinoma4
1, 2CompletedTreatmentHepatocellular,Carcinoma1
1, 2CompletedTreatmentLocally Advanced Unresectable or Stage IV Colorectal Cancer1
1, 2CompletedTreatmentMalignant Neoplasm of Stomach / Unspecified Adult Solid Tumor, Protocol Specific1
1, 2CompletedTreatmentMetastatic Colorectal Cancer (MCRC)2
1, 2CompletedTreatmentNeoplasms Metastasis / Neoplasms, Gastrointestinal1
1, 2CompletedTreatmentOropharynx Cancers / Squamous Cell Carcinoma of the Oral Cavity1
1, 2CompletedTreatmentRenal Cancers1
1, 2CompletedTreatmentRenal Cell Carcinoma Recurrent / Stage IV Renal Cell Cancer1
1, 2CompletedTreatmentSquamous Cell Cancer1
1, 2Not Yet RecruitingTreatmentCancer of Colon / Cancer of Liver / Cancer of Pancreas / Cancer of Rectum / Cancer of the Gallbladder / Glioblastoma Multiforme (GBM) / Multiple Myeloma (MM)1
1, 2Not Yet RecruitingTreatmentMetastatic Colorectal Cancer (MCRC)1
1, 2Not Yet RecruitingTreatmentMetastatic Colorectal Cancer (MCRC) / Tumors, Solid1
1, 2Not Yet RecruitingTreatmentPeritoneal Carcinosis1
1, 2RecruitingTreatmentAdenocarcinoma of the Pancreas1
1, 2RecruitingTreatmentAdenocarcinomas of the Gastroesophageal Junction / Gastric Cardia Adenocarcinoma / Malignant Neoplasm of Stomach Stage II / Stage IB Gastric Cancer / Stage IB Gastric Cancer AJCC v7 / Stage II Gastric Cancer AJCC v7 / Stage IIA Gastric Cancer / Stage IIA Gastric Cancer AJCC v7 / Stage IIB Gastric Cancer / Stage IIB Gastric Cancer AJCC v7 / Stage IIIA Gastric Cancer / Stage IIIA Gastric Cancer AJCC v7 / Stage IIIB Gastric Cancer / Stage IIIB Gastric Cancer AJCC v71
1, 2RecruitingTreatmentAdenocarcinomas / Neoplasms, Gastrointestinal1
1, 2RecruitingTreatmentAdvanced Solid Tumors1
1, 2RecruitingTreatmentAdvanced or Metastatic Biliary Tract Cancer (BTC) / Advanced or Metastatic Endometrial Cancer / Advanced or Metastatic Gastroesophageal Cancer (GC) / Advanced or Metastatic Microsatellite Stable Colorectal Cancer (MSS-CRC) / Advanced or Metastatic Solid Tumors / Biliary Tract Cancer (BTC) / Colorectal Cancer (CRC) / Endometrial Cancer / Gastroesophageal Cancer (GC) / Ovarian Cancer / Recurrent Ovarian Carcinoma / Tumors, Solid1
1, 2RecruitingTreatmentBiliary Tract Cancer1
1, 2RecruitingTreatmentBorderline Resectable Pancreatic Adenocarcinoma / Resectable Pancreatic Ductal Adenocarcinoma1
1, 2RecruitingTreatmentClinical Stage 0 Gastric Cancer AJCC v8 / Clinical Stage 0 Gastroesophageal Junction Adenocarcinoma AJCC v8 / Clinical Stage I Gastric Cancer AJCC v8 / Clinical Stage I Gastroesophageal Junction Adenocarcinoma AJCC v8 / Clinical Stage IIB Gastric Cancer AJCC v8 / Clinical Stage IIB Gastroesophageal Junction Adenocarcinoma AJCC v8 / Clinical Stage III Gastroesophageal Junction Adenocarcinoma AJCC v8 / Clinical Stage IVA Gastric Cancer AJCC v8 / Clinical Stage IVA Gastroesophageal Junction Adenocarcinoma AJCC v8 / Gastric Adenocarcinoma / Localized Gastric Carcinoma / Localized Gastroesophageal Junction Adenocarcinoma / Pathologic Stage 0 Gastric Cancer AJCC v8 / Pathologic Stage 0 Gastroesophageal Junction Adenocarcinoma AJCC v8 / Pathologic Stage I Gastric Cancer AJCC v8 / Pathologic Stage IA Gastric Cancer AJCC v8 / Pathologic Stage IA Gastroesophageal Junction Adenocarcinoma AJCC v8 / Pathologic Stage IB Gastric Cancer AJCC v8 / Pathologic Stage IB Gastroesophageal Junction Adenocarcinoma AJCC v8 / Pathologic Stage IC Gastroesophageal Junction Adenocarcinoma AJCC v8 / Pathologic Stage II Gastroesophageal Junction Adenocarcinoma AJCC v8 / Pathologic Stage IIA Gastric Cancer AJCC v8 / Pathologic Stage IIA Gastroesophageal Junction Adenocarcinoma AJCC v8 / Pathologic Stage IIB Gastric Cancer AJCC v8 / Pathologic Stage IIB Gastroesophageal Junction Adenocarcinoma AJCC v8 / Pathologic Stage IIIA Gastric Cancer AJCC v8 / Pathologic Stage IIIB Gastroesophageal Junction Adenocarcinoma AJCC v8 / Pathologic Stage IVA Gastroesophageal Junction Adenocarcinoma AJCC v81
1, 2RecruitingTreatmentColorectal Cancers / Malignant Neoplasm of Pancreas1
1, 2RecruitingTreatmentDigestive Cancers1
1, 2RecruitingTreatmentGastric Adenocarcinoma or Gastroesophageal Junction Adenocarcinoma1
1, 2RecruitingTreatmentKRAS Gene Mutation / Metastatic Colorectal Cancer (MCRC)1
1, 2RecruitingTreatmentMalignant Neoplasm of Pancreas1
1, 2RecruitingTreatmentMetastatic Microsatellite-stable Colorectal Cancer1
1, 2RecruitingTreatmentPancreatic Adenocarcinoma Metastatic1
1, 2RecruitingTreatmentRectal Carcinoma2
1, 2TerminatedTreatmentAdenocarcinoma of the Esophagus / Adenocarcinomas of the Gastroesophageal Junction / Advanced Gastric Cancer / Diffuse Adenocarcinoma of the Stomach / Intestinal Adenocarcinoma of the Stomach / Mixed Adenocarcinoma of the Stomach / Recurrent Esophageal Cancer / Recurrent Gastric Cancer / Squamous Cell Carcinoma of the Esophagus / Stage III Esophageal Cancer / Stage IIIA Gastric Cancer / Stage IIIB Gastric Cancer / Stage IIIC Gastric Cancer / Stage IV Esophageal Cancer1
1, 2TerminatedTreatmentMalignant Neoplasm of Pancreas2
1, 2TerminatedTreatmentMalignant Neoplasm of Pancreas / Pancreatic Ductal Adenocarcinoma1
1, 2TerminatedTreatmentMetastatic Cancers1
1, 2TerminatedTreatmentMetastatic Colorectal Cancer (MCRC)2
1, 2TerminatedTreatmentMetastatic Colorectal Carcinoma1
1, 2TerminatedTreatmentMucinous Adenocarcinoma of the Colon / Mucinous Adenocarcinoma of the Rectum / Recurrent Colon Cancer / Recurrent Rectal Cancer / Signet Ring Adenocarcinoma of the Colon / Signet Ring Adenocarcinoma of the Rectum / Stage IVA Colon Cancer / Stage IVA Rectal Cancer / Stage IVB Colon Cancer / Stage IVB Rectal Cancer1
1, 2TerminatedTreatmentSubjects With Resectable Local or Locally Advanced, Non-Metastatic (T2-T4, N0-N3, M0; Stages II and III) and Histologically-Confirmed Intestinal GC1
1, 2Unknown StatusTreatmentAdenocarcinoma Of Esophagus / Adenocarcinomas of the Gastroesophageal Junction / Gastric Adenocarcinoma1
1, 2Unknown StatusTreatmentAdenocarcinoma of the Pancreas / Malignant Neoplasm of Pancreas1
1, 2Unknown StatusTreatmentAdvanced Colorectal Cancer1
1, 2Unknown StatusTreatmentAdvanced Gastric Cancer1
1, 2Unknown StatusTreatmentBreast Cancer1
1, 2Unknown StatusTreatmentColorectal Cancers2
1, 2Unknown StatusTreatmentEsophageal Cancers2
1, 2Unknown StatusTreatmentMalignant Neoplasm of Colon / Rectal Carcinoma1
1, 2WithdrawnTreatmentAdenocarcinoma of the Esophagus / Adenocarcinomas of the Gastroesophageal Junction / Advanced Gastric Cancer / Diffuse Adenocarcinoma of the Stomach / Gastrointestinal Cancers / Intestinal Adenocarcinoma of the Stomach / Mixed Adenocarcinoma of the Stomach / Stage IIIA Esophageal Cancer / Stage IIIA Gastric Cancer / Stage IIIB Esophageal Cancer / Stage IIIB Gastric Cancer / Stage IIIC Esophageal Cancer / Stage IIIC Gastric Cancer / Stage IV Esophageal Cancer1
1, 2WithdrawnTreatmentAdenocarcinoma of the Esophagus / Adenocarcinomas of the Gastroesophageal Junction / Squamous Cell Carcinoma of the Esophagus1
1, 2WithdrawnTreatmentAdenocarcinoma of the Pancreas / Colon Adenocarcinoma / Pancreatic Adenocarcinoma Metastatic / Pancreatic Ductal Adenocarcinoma / Rectal Adenocarcinoma / Stage III Pancreatic Cancer / Stage IIIA Colon Cancer / Stage IIIA Rectal Cancer / Stage IIIB Colon Cancer / Stage IIIB Rectal Cancer / Stage IIIC Colon Cancer / Stage IIIC Rectal Cancer / Stage IV Pancreatic Cancer / Stage IVA Colon Cancer / Stage IVA Rectal Cancer / Stage IVB Colon Cancer / Stage IVB Rectal Cancer1
1, 2WithdrawnTreatmentColorectal Cancers2
1, 2WithdrawnTreatmentColorectal Cancers / Liver Cancer / Metastasis1
1, 2WithdrawnTreatmentHead and Neck Squamous Cell Carcinoma (HNSCC)1
1, 2WithdrawnTreatmentHepatocellular Carcinoma Non-resectable / Recurrent Hepatocellular Carcinoma1
1, 2WithdrawnTreatmentLung Cancer Non-Small Cell Cancer (NSCLC)1
1, 2WithdrawnTreatmentMalignant Neoplasm of Pancreas1
1, 2WithdrawnTreatmentMelanoma1
1, 2WithdrawnTreatmentNeuroendocrine Carcinoma of the Skin1
1, 2WithdrawnTreatmentNon-Hodgkin's Lymphoma (NHL)1
1, 2WithdrawnTreatmentOvarian Cancer1
1, 2WithdrawnTreatmentTriple Negative Breast Cancer (TNBC)1
2Active Not RecruitingTreatmentAdenocarcinoma of the Pancreas1
2Active Not RecruitingTreatmentAdenocarcinoma of the Pancreas / Resectable Pancreatic Cancers / Resectable Pancreatic Carcinoma2
2Active Not RecruitingTreatmentAdenocarcinomas of the Gastroesophageal Junction / Esophageal Cancers1
2Active Not RecruitingTreatmentAdenocarcinomas of the Gastroesophageal Junction / Esophageal Cancers / Malignant Neoplasm of Stomach1
2Active Not RecruitingTreatmentAdenocarcinomas of the Gastroesophageal Junction / Gastric Adenocarcinoma1
2Active Not RecruitingTreatmentAdult Cholangiocarcinoma / Advanced Adult Hepatocellular Carcinoma / BCLC Stage C Adult Hepatocellular Carcinoma / BCLC Stage D Adult Hepatocellular Carcinoma / Hilar Cholangiocarcinoma / Localized Non-Resectable Adult Liver Carcinoma / Recurrent Adult Liver Carcinoma / Recurrent Childhood Liver Cancer / Recurrent Extrahepatic Bile Duct Carcinoma / Recurrent Gallbladder Carcinoma / Stage II Gallbladder Cancer / Stage III Childhood Hepatocellular Carcinoma / Stage IIIA Gallbladder Cancer / Stage IIIB Gallbladder Cancer / Stage IV Childhood Hepatocellular Carcinoma / Stage IV Distal Bile Duct Cancer / Stage IVA Gallbladder Cancer / Stage IVB Gallbladder Cancer / Unresectable Extrahepatic Bile Duct Carcinoma1
2Active Not RecruitingTreatmentAdvanced Pancreatic Cancer1
2Active Not RecruitingTreatmentAdvanced Solid Tumors / Carcinoids / Colorectal Cancers / Locally Advanced / Lung Cancer Non-Small Cell Cancer (NSCLC) / Malignant Lymphomas / Metastatic Cancers / Sarcomas / Tumors, Solid1
2Active Not RecruitingTreatmentAnal Basaloid Carcinoma / Anal Canal Cloacogenic Carcinoma / Anal Squamous Cell Carcinoma / Metastatic Anal Canal Carcinoma / Recurrent Anal Canal Carcinoma / Stage IIIB Anal Canal Cancer / Stage IV Anal Canal Cancer1
2Active Not RecruitingTreatmentAnal Canal Carcinoma1
2Active Not RecruitingTreatmentBladder Carcinoma Infiltrating the Muscle of the Bladder Wall / Stage II Bladder Cancer AJCC v8 / Stage II Renal Pelvis Cancer AJCC v8 / Stage II Ureter Cancer AJCC v8 / Stage II Urethral Cancer AJCC v8 / Stage III Bladder Cancer AJCC v8 / Stage III Renal Pelvis Cancer AJCC v8 / Stage III Ureter Cancer AJCC v8 / Stage III Urethral Cancer AJCC v8 / Stage IIIA Bladder Cancer AJCC v8 / Stage IIIB Bladder Cancer AJCC v8 / Urethral Urothelial Carcinoma1
2Active Not RecruitingTreatmentBreast Cancer6
2Active Not RecruitingTreatmentCancer (Advanced Stage)1
2Active Not RecruitingTreatmentCancer, Anal1
2Active Not RecruitingTreatmentCancer, Bladder2
2Active Not RecruitingTreatmentCancer, Bladder / Urachal Cancer / Urethral Cancer1
2Active Not RecruitingTreatmentCarcinoma, Colorectal / Metastatic Colorectal Cancer (MCRC) / Neoplasms Metastasis / Neoplasms, Colorectal1
2Active Not RecruitingTreatmentCarcinoma, Squamous Cell of Head and Neck1
2Active Not RecruitingTreatmentChemoradiation / Neoplasms, Esophageal1
2Active Not RecruitingTreatmentColorectal Cancers5
2Active Not RecruitingTreatmentColorectal Cancers / Metastatic Cancers1
2Active Not RecruitingTreatmentElderly Metastatic Colorectal Cancer Patients1
2Active Not RecruitingTreatmentHER2 Positive Breast Cancers1
2Active Not RecruitingTreatmentHead and Neck Carcinoma1
2Active Not RecruitingTreatmentHead and Neck Squamous Cell Carcinoma (HNSCC)1
2Active Not RecruitingTreatmentHepatocellular Cancer1
2Active Not RecruitingTreatmentHepatocellular,Carcinoma1
2Active Not RecruitingTreatmentHuman Papilloma Virus Infection / Stage III Squamous Cell Carcinoma of the Oropharynx / Stage IVA Squamous Cell Carcinoma of the Oropharynx / Stage IVB Squamous Cell Carcinoma of the Oropharynx1
2Active Not RecruitingTreatmentMalignancies1
2Active Not RecruitingTreatmentMalignant Neoplasm of Colon1
2Active Not RecruitingTreatmentMalignant Neoplasm of Esophagus / Malignant Neoplasm of Stomach1
2Active Not RecruitingTreatmentMalignant Neoplasm of Pancreas3
2Active Not RecruitingTreatmentMalignant Neoplasm of Stomach1
2Active Not RecruitingTreatmentMetastatic Biliary Tract Cancer1
2Active Not RecruitingTreatmentMetastatic Colon Cancer / Mucinous Adenocarcinoma of the Colon / Mucinous Adenocarcinoma of the Rectum / Recurrent Colon Cancer / Recurrent Rectal Cancer / Signet Ring Adenocarcinoma of the Colon / Signet Ring Adenocarcinoma of the Rectum / Stage IV Rectal Cancer1
2Active Not RecruitingTreatmentMetastatic Colon Cancer / Mucinous Adenocarcinoma of the Colon / Mucinous Adenocarcinoma of the Rectum / Signet Ring Adenocarcinoma of the Colon / Signet Ring Adenocarcinoma of the Rectum / Stage IV Rectal Cancer1
2Active Not RecruitingTreatmentMetastatic Colorectal Cancer (MCRC)5
2Active Not RecruitingTreatmentMucinous Adenocarcinoma of the Rectum / Signet Ring Adenocarcinoma of the Rectum / Stage IIA Rectal Cancer / Stage IIB Rectal Cancer / Stage IIC Rectal Cancer / Stage IIIA Rectal Cancer / Stage IIIB Rectal Cancer / Stage IIIC Rectal Cancer1
2Active Not RecruitingTreatmentNeoplasms, Breast1
2Active Not RecruitingTreatmentNeoplasms, Esophageal / Stomach Neoplasms1
2Active Not RecruitingTreatmentNeoplasms, Head and Neck1
2Active Not RecruitingTreatmentPancreatic Adenocarcinoma Metastatic / Recurrent Pancreatic Carcinoma / Stage IV Pancreatic Cancer / Stage IV Pancreatic Cancer AJCC v6 and v71
2Active Not RecruitingTreatmentPancreatic Cancer Metastatic4
2Active Not RecruitingTreatmentRectal Cancer Stage II / Rectal Cancer Stage III / Rectal Neoplasms1
2Active Not RecruitingTreatmentRectal Carcinoma1
2Active Not RecruitingTreatmentResectable Pancreatic Ductal Adenocarcinoma1
2Active Not RecruitingTreatmentSinonasal Tumors1
2Active Not RecruitingTreatmentSquamous Cell Carcinoma (SCC) / Squamous Cell Carcinoma of Skin1
2Active Not RecruitingTreatmentSquamous Cell Carcinoma of the Hypopharynx Stage III / Squamous Cell Carcinoma of the Hypopharynx Stage IV / Squamous Cell Carcinoma of the Larynx Stage III / Squamous Cell Carcinoma of the Larynx Stage IV / Squamous Cell Carcinoma of the Oral Cavity Stage III / Squamous Cell Carcinoma of the Oral Cavity Stage IV / Squamous Cell Carcinoma of the Oropharynx Stage III / Squamous Cell Carcinoma of the Oropharynx Stage IV1
2Active Not RecruitingTreatmentStage II Lymphoepithelioma of the Nasopharynx / Stage II Squamous Cell Carcinoma of the Nasopharynx / Stage III Lymphoepithelioma of the Nasopharynx / Stage III Squamous Cell Carcinoma of the Nasopharynx / Stage IV Lymphoepithelioma of the Nasopharynx / Stage IV Squamous Cell Carcinoma of the Nasopharynx1
2Active Not RecruitingTreatmentUnresectable Sinonasal Tumors1
2Active Not RecruitingTreatmentMCRC1
2CompletedNot AvailableBreast Cancer1
2CompletedDiagnosticColorectal Cancers1
2CompletedDiagnosticUpper Gastrointestinal Tumours1
2CompletedOtherMetastatic Colorectal Adenocarcinoma1
2CompletedOtherTumors, Solid1
2CompletedScreeningColorectal Cancers1
2CompletedSupportive CareColorectal Cancers1
2CompletedSupportive CareColorectal Cancers / Nausea and vomiting1
2CompletedSupportive CareExtrahepatic Bile Duct Cancer / Nausea / Stage II Pancreatic Cancer / Stage III Pancreatic Cancer / Stage IV Pancreatic Cancer / Vomiting1
2CompletedTreatmentAbdominal wall neoplasm / Colonic Neoplasms / Mesothelioma / Neoplasms, Abdominal1
2CompletedTreatmentAcinar Cell Adenocarcinoma of the Pancreas / Duct Cell Adenocarcinoma of the Pancreas / Recurrent Pancreatic Cancer / Stage IV Pancreatic Cancer1
2CompletedTreatmentAdenocarcinoma Of Esophagus / Adenocarcinoma of GE Junction / Adenocarcinoma of Stomach1
2CompletedTreatmentAdenocarcinoma Of Esophagus / Gastric Adenocarcinoma1
2CompletedTreatmentAdenocarcinoma of Colon / Adenocarcinoma of Rectum / Metastatic Disease1
2CompletedTreatmentAdenocarcinoma of the Colon / Adenocarcinoma of the Rectum / Advanced Colorectal Cancer1
2CompletedTreatmentAdenocarcinoma of the Colon / Adenocarcinoma of the Rectum / Metastatic Colon Cancer / Recurrent Colon Cancer / Recurrent Rectal Cancer / Stage IV Rectal Cancer1
2CompletedTreatmentAdenocarcinoma of the Esophagus or Esophagogastric Junction1
2CompletedTreatmentAdenocarcinoma of the Esophagus / Adenocarcinomas of the Gastroesophageal Junction / Diffuse Adenocarcinoma of the Stomach / Intestinal Adenocarcinoma of the Stomach / Mixed Adenocarcinoma of the Stomach / Squamous Cell Carcinoma of the Esophagus / Stage IA Esophageal Cancer / Stage IA Gastric Cancer / Stage IB Esophageal Cancer / Stage IB Gastric Cancer / Stage IIA Esophageal Cancer / Stage IIA Gastric Cancer / Stage IIB Esophageal Cancer / Stage IIB Gastric Cancer / Stage IIIA Esophageal Cancer / Stage IIIA Gastric Cancer / Stage IIIB Esophageal Cancer / Stage IIIB Gastric Cancer / Stage IIIC Esophageal Cancer / Stage IIIC Gastric Cancer1
2CompletedTreatmentAdenocarcinoma of the Pancreas2
2CompletedTreatmentAdenocarcinoma of the Pancreas / Resectable Pancreatic Cancers / Resectable Pancreatic Carcinoma / Stage I Pancreatic Cancer / Stage IA Pancreatic Cancer / Stage IB Pancreatic Cancer / Stage II Pancreatic Cancer / Stage IIA Pancreatic Cancer / Stage IIB Pancreatic Cancer / Stage III Pancreatic Cancer1
2CompletedTreatmentAdenocarcinoma of the Pancreas / Stage II Pancreatic Cancer / Stage III Pancreatic Cancer1
2CompletedTreatmentAdenocarcinoma of the Pancreas / Stage III Pancreatic Cancer / Stage IVA Pancreatic Cancer1
2CompletedTreatmentAdenocarcinoma of the Rectum / Metastatic Colon Cancer / Mucinous Adenocarcinoma of the Colon / Recurrent Colon Cancer / Recurrent Rectal Cancer / Signet Ring Adenocarcinoma of the Colon / Stage IV Rectal Cancer1
2CompletedTreatmentAdenocarcinoma of the Stomach / Adenocarcinomas of the Gastroesophageal Junction / Advanced Gastric Cancer / Recurrent Gastric Cancer / Stage IIIA Gastric Cancer / Stage IIIB Gastric Cancer / Stage IIIC Gastric Cancer1
2CompletedTreatmentAdenocarcinomas of the Gastroesophageal Junction / Esophageal Cancers / Malignant Neoplasm of Stomach1
2CompletedTreatmentAdenocarcinomas of the Gastroesophageal Junction / Malignant Neoplasm of Stomach4
2CompletedTreatmentAdenocarcinomas / Neoplasms, Esophageal / Stomach Neoplasms1
2CompletedTreatmentAdult Primary Cholangiocellular Carcinoma / Advanced Adult Primary Liver Cancer / Cholangiocarcinoma of the Extrahepatic Bile Duct / Cholangiocarcinoma of the Gallbladder / Localized Unresectable Adult Primary Liver Cancer / Periampullary Adenocarcinoma / Recurrent Adult Primary Liver Cancer / Recurrent Extrahepatic Bile Duct Cancer / Recurrent Gallbladder Cancer / Unresectable Extrahepatic Bile Duct Cancer / Unresectable Gallbladder Cancer1
2CompletedTreatmentAdvanced Colorectal Cancer1
2CompletedTreatmentAdvanced Gastric Cancer2
2CompletedTreatmentAdvanced Pancreatic Carcinoma1
2CompletedTreatmentAnal Squamous Cell Carcinoma1
2CompletedTreatmentBasal Cell Carcinoma (BCC) / Metastatic Colorectal Cancer (MCRC) / Ovarian Cancer1
2CompletedTreatmentBiliary Cancer / Malignant Neoplasm of Pancreas1
2CompletedTreatmentBiliary Tract Cancer1
2CompletedTreatmentBiopsy / Colorectal Cancers / Non Resectable Metastasis / Reference Lesion / Thymidylate Synthase Quantitation1
2CompletedTreatmentBreast Cancer6
2CompletedTreatmentBreast Cancer / Neoplasms, Breast1
2CompletedTreatmentCancer of Pancreas / Chemotherapy Effect / SBRT / Unresectable Pancreatic Cancer1
2CompletedTreatmentCancer of the Gallbladder / Extrahepatic Bile Duct Cancer / Liver Cancer1
2CompletedTreatmentCancer of the Larynx / Cancer of the Oral Cavity / Cancer of the Pharynx / Head and Neck Carcinoma / Nose Neoplasms / Paranasal Sinus Neoplasms1
2CompletedTreatmentCancer of the Rectum / Colorectal Cancers / Rectal Carcinoma1
2CompletedTreatmentCancer, Anal2
2CompletedTreatmentCancer, Bladder1
2CompletedTreatmentCancer, Bladder / Transitional Cell Cancer of the Renal Pelvis and Ureter / Urethral Cancer1
2CompletedTreatmentCarcinoid tumour of the gastrointestinal tract / Extrahepatic Bile Duct Cancer / Liver Cancer / Malignant Neoplasm of Pancreas / Malignant Neoplasm of Stomach / Small Intestine Cancer1
2CompletedTreatmentCarcinoid tumour of the gastrointestinal tract / Islet Cell Tumor / Neoplastic Syndrome1
2CompletedTreatmentCarcinoid tumour of the gastrointestinal tract / Lung Cancers1
2CompletedTreatmentCarcinoma NOS / Colorectal Cancers / Gastrointestinal Cancers / Malignancies / Malignant Neoplasm of Colon / Metastases / Metastatic Cancers / Metastatic Colorectal Cancer (MCRC) / Oncology / Rectal Carcinoma1
2CompletedTreatmentCarcinoma NOS / Nasopharyngeal Neoplasms1
2CompletedTreatmentCarcinoma of Head/Neck / Squamous Cell Carcinoma (SCC)1
2CompletedTreatmentCarcinoma of Larynx / Squamous Cell Carcinoma of the Hypopharynx1
2CompletedTreatmentCarcinoma of Unknown Primary / Colorectal Cancers / Unspecified Adult Solid Tumor, Protocol Specific / Unspecified Childhood Solid Tumor, Protocol Specific1
2CompletedTreatmentCarcinoma, Colorectal1
2CompletedTreatmentCarcinoma, Squamous Cell of Head and Neck1
2CompletedTreatmentColorectal Cancer (CRC)1
2CompletedTreatmentColorectal Cancer Stage II1
2CompletedTreatmentColorectal Cancers51
2CompletedTreatmentColorectal Cancers / Hepatic Metastases3
2CompletedTreatmentColorectal Cancers / Liver Metastasis1
2CompletedTreatmentColorectal Cancers / Malignancies / Malignant Neoplasm of Colon / Metastatic Cancers / Metastatic Colorectal Cancer (MCRC) / Oncology / Rectal Carcinoma1
2CompletedTreatmentColorectal Cancers / Malignancies / Malignant Neoplasm of Colon / Metastatic Cancers / Metastatic Colorectal Cancer (MCRC) / Rectal Carcinoma1
2CompletedTreatmentColorectal Cancers / Malignant Neoplasm of Colon / Metastatic Colorectal Cancer (MCRC) / Rash / Skin Toxicities1
2CompletedTreatmentColorectal Cancers / Metastatic Cancers7
2CompletedTreatmentColorectal Cancers / Neoplasms, Colorectal2
2CompletedTreatmentColorectal Cancers / Rectal Carcinoma1
2CompletedTreatmentColorectal / Malignancies1
2CompletedTreatmentDeep Regional Hyperthermia / Hyperthermia / Hyperthermic Chemoradiotherapy / Hyperthermic Radiochemotherapy / Locally Advanced Rectal Cancer / Rectal Carcinoma1
2CompletedTreatmentEctropion / Skin Neoplasms1
2CompletedTreatmentEndometrial Cancer1
2CompletedTreatmentEsophageal Cancers8
2CompletedTreatmentEsophageal Cancers / Gastroesophageal Cancer (GC)1
2CompletedTreatmentEsophageal Cancers / Head and Neck Carcinoma1
2CompletedTreatmentEsophageal Cancers / Malignant Neoplasm of Stomach9
2CompletedTreatmentEsophageal Carcinoma1
2CompletedTreatmentEsophagus Cancer1
2CompletedTreatmentGastric Adenocarcinoma1
2CompletedTreatmentGastric Adenocarcinoma With Peritoneal Carcinomatosis / Siewert Type II Adenocarcinoma of Esophagogastric Junction With Peritoneal Carcinomatosis / Siewert Type III Adenocarcinoma of Esophagogastric Junction With Peritoneal Carcinomatosis1
2CompletedTreatmentGastric Adenocarcinoma / Malignant Neoplasm of Stomach1
2CompletedTreatmentGastroesophageal Cancer (GC) / Malignant Neoplasm of Stomach1
2CompletedTreatmentGastroesophageal Cancer (GC) / Malignant Neoplasm of Stomach / Metastatic Esophageal Cancer1
2CompletedTreatmentGastrointestinal Cancer Metastatic / Non Small Cell Lung Cancer Metastatic / Renal Cell Cancer Metastatic1
2CompletedTreatmentHead and Neck1
2CompletedTreatmentHead and Neck Carcinoma14
2CompletedTreatmentHead and Neck Carcinoma / Oral Complications of Radiation Therapy / Radiation Toxicity1
2CompletedTreatmentHead and Neck Squamous Cell Carcinoma (HNSCC)2
2CompletedTreatmentHepatic Metastases / Metastatic Colorectal Cancer (MCRC)1
2CompletedTreatmentHypopharyngeal Cancer1
2CompletedTreatmentIndividualized Chemotherapy1
2CompletedTreatmentIslet Cell Adenoma / Neoplasms Metastasis / Zollinger-Ellison Syndrome1
2CompletedTreatmentLiver Cancer / Malignant Neoplasm of Pancreas1
2CompletedTreatmentLiver Only Metastasis From KRAS Exon 2 Wild Type (Under Protocol 1.0-1.2 Edition) and RAS Wild Type (Under Protocol 2.0 Edition) Colorectal Cancer1
2CompletedTreatmentLocally Advanced Resectable Oral Cavity Squamous Cell Cancer1
2CompletedTreatmentLocally Advanced or Metastatic Adenoca of the Biliary Tract1
2CompletedTreatmentMalignancies / Metastatic Colorectal Cancer (MCRC)1
2CompletedTreatmentMalignant Lymphomas1
2CompletedTreatmentMalignant Neoplasm of Colon1
2CompletedTreatmentMalignant Neoplasm of Colon / Rectal Carcinoma2
2CompletedTreatmentMalignant Neoplasm of Pancreas17
2CompletedTreatmentMalignant Neoplasm of Stomach12
2CompletedTreatmentMalignant Neoplasm of Stomach / Peritoneal Carcinomatosis1
2CompletedTreatmentMetastatic Adenocarcinoma of Gastric Cardia / Metastatic Adenocarcinoma of the Esophagus / Unresectable Adenocarcinoma of Gastric Cardia / Unresectable Adenocarcinoma of the Esophagus1
2CompletedTreatmentMetastatic Colorectal Cancer (MCRC)18
2CompletedTreatmentMetastatic Colorectal Cancer (MCRC) / Recurrent Colorectal Cancer1
2CompletedTreatmentMetastatic Gastric Cancers1
2CompletedTreatmentNasopharyngeal Carcinoma3
2CompletedTreatmentNasopharyngeal Neoplasms2
2CompletedTreatmentNeoplasms, Breast1
2CompletedTreatmentNeoplasms, Colorectal4
2CompletedTreatmentNeoplasms, Esophageal2
2CompletedTreatmentNeoplasms, Esophageal / Stomach Neoplasms2
2CompletedTreatmentNeoplasms, Head and Neck1
2CompletedTreatmentNeuroendocrine Carcinoma of the Skin1
2CompletedTreatmentNeuroendocrine Tumors1
2CompletedTreatmentPancreatic Acinar Cell Carcinoma / Pancreatic Ductal Adenocarcinoma / Recurrent Pancreatic Carcinoma / Stage IV Pancreatic Cancer1
2CompletedTreatmentPancreatic Adenocarcinoma Metastatic1
2CompletedTreatmentPancreatic Cancer Metastatic3
2CompletedTreatmentRectal Adenocarcinoma / Stage II Rectal Cancer / Stage II Rectal Cancer AJCC v7 / Stage III Rectal Cancer / Stage III Rectal Cancer AJCC v71
2CompletedTreatmentRectal Carcinoma6
2CompletedTreatmentRectal Neoplasms1
2CompletedTreatmentRectum Cancer1
2CompletedTreatmentRecurrent Extragonadal Seminoma / Recurrent Malignant Extragonadal Germ Cell Tumor / Recurrent Malignant Extragonadal Non-Seminomatous Germ Cell Tumor / Recurrent Malignant Testicular Germ Cell Tumor / Recurrent Ovarian Germ Cell Tumor / Stage III Testicular Cancer / Stage IV Extragonadal Non-Seminomatous Germ Cell Tumor / Stage IV Extragonadal Seminoma / Stage IV Ovarian Germ Cell Tumor1
2CompletedTreatmentSquamous Cell Carcinoma of the Head and Neck (SCCHN)1
2CompletedTreatmentSquamous Neck Carcinoma of the Head and Neck Cancer (SCCHN)1
2CompletedTreatmentStage II Nasopharyngeal Keratinizing Squamous Cell Carcinoma AJCC v7 / Stage II Squamous Cell Carcinoma of the Nasopharynx / Stage III Lymphoepithelioma of the Nasopharynx / Stage III Nasopharyngeal Keratinizing Squamous Cell Carcinoma AJCC v7 / Stage III Nasopharyngeal Undifferentiated Carcinoma AJCC v7 / Stage III Squamous Cell Carcinoma of the Nasopharynx / Stage IV Lymphoepithelioma of the Nasopharynx / Stage IV Nasopharyngeal Keratinizing Squamous Cell Carcinoma AJCC v7 / Stage IV Nasopharyngeal Undifferentiated Carcinoma AJCC v7 / Stage IV Squamous Cell Carcinoma of the Nasopharynx1
2CompletedTreatmentStage IV Colorectal Cancer1
2CompletedTreatmentStomach Neoplasms3
2CompletedTreatmentTransitional Cell Carcinoma1
2CompletedTreatmentTumors, Solid1
2CompletedTreatmentUnresectable Biliary Tract Cancer1
2CompletedTreatmentUnresectable or Metastatic Colorectal Cancer1
2CompletedTreatmentUntreated Metastatic Colorectal Cancer1
2CompletedTreatmentWomen With Primary Breast Cancer1
2Enrolling by InvitationTreatmentEsophageal Cancers / Radiotherapy Side Effect1
2Enrolling by InvitationTreatmentMalignant Neoplasm of Pancreas1
2Enrolling by InvitationTreatmentRectal Carcinoma1
2Not Yet RecruitingTreatmentADCC / Colorectal Cancers1
2Not Yet RecruitingTreatmentAdenocarcinoma Of Esophagus / Gastric Adenocarcinoma1
2Not Yet RecruitingTreatmentAdenocarcinoma of the Pancreas / Malignant Neoplasm of Pancreas1
2Not Yet RecruitingTreatmentBiliary Tract Cancer2
2Not Yet RecruitingTreatmentBladder Urothelial Carcinoma / Stage III Bladder Cancer AJCC v8 / Stage IIIA Bladder Cancer AJCC v8 / Stage IIIB Bladder Cancer AJCC v81
2Not Yet RecruitingTreatmentCholangiocarcinomas / Intrahepatic Cholangiocarcinoma / Liver Cancer / Unresectable Cholangiocarcinoma1
2Not Yet RecruitingTreatmentColorectal Adenocarcinoma / Stage IVA Colorectal Cancer / Stage IVB Colorectal Cancer1
2Not Yet RecruitingTreatmentColorectal Cancers1
2Not Yet RecruitingTreatmentLiver Metastasis Colon Cancer1
2Not Yet RecruitingTreatmentMalignant Neoplasm of Colon1
2Not Yet RecruitingTreatmentMalignant Neoplasm of Nasopharynx / Nasopharyngeal Carcinoma / Nasopharynx Cancer1
2Not Yet RecruitingTreatmentMalignant Neoplasm of Pancreas1
2Not Yet RecruitingTreatmentMalignant Neoplasm of Stomach1
2Not Yet RecruitingTreatmentMetastatic Colorectal Cancer (MCRC)3
2Not Yet RecruitingTreatmentMetastatic Small Intestinal Adenocarcinoma / Stage III Small Intestinal Adenocarcinoma AJCC v8 / Stage IIIA Small Intestinal Adenocarcinoma AJCC v8 / Stage IIIB Small Intestinal Adenocarcinoma AJCC v8 / Stage IV Small Intestinal Adenocarcinoma AJCC v81
2Not Yet RecruitingTreatmentMicrosatellite-stable Colorectal Cancer1
2Not Yet RecruitingTreatmentNasopharyngeal Carcinoma1
2Not Yet RecruitingTreatmentNeoplasms, Colorectal1
2Not Yet RecruitingTreatmentPancreatic Adenocarcinoma Metastatic / Stage IV Pancreatic Cancer AJCC v81
2Not Yet RecruitingTreatmentPenile Carcinoma1
2Not Yet RecruitingTreatmentStage II Breast Cancer / Stage III Breast Cancer1
2Not Yet RecruitingTreatmentUnresectable Metastatic Right-sided Colon Cancer Starting First-line Combination Chemotherapy / Unresectable Metastatic Right-sided Colon Cancer, Stage IV1
2RecruitingTreatmentAcinar Cell Adenocarcinoma of the Pancreas / Duct Cell Adenocarcinoma of the Pancreas / Stage I Pancreatic Cancer / Stage IIA Pancreatic Cancer / Stage IIB Pancreatic Cancer1
2RecruitingTreatmentAdenocarcinoma Metastatic / Adenocarcinoma of the Biliary Tract / Adenocarinoma Locally Advanced / Biliary Tract Cancer / Extrahepatic Bile Duct Carcinoma / Intrahepatic Cholangiocarcinoma / Non-Resectable Hepatocellular Carcinoma1
2RecruitingTreatmentAdenocarcinoma Of Esophagus / Adenocarcinomas of the Gastroesophageal Junction / Gastric Adenocarcinoma / Metastatic Esophagogastric Adenocarcinoma / Neoplasm, Gastric / Neoplasms, Esophageal / Unresectable, Locally Advanced or Metastatic, Adenocarcinoma of the Stomach, or of the Gastro Esophageal Junction1
2RecruitingTreatmentAdenocarcinoma Of Esophagus / Gastric Adenocarcinoma / HER-2 Gene Amplification / Metastasis1
2RecruitingTreatmentAdenocarcinoma of the Esophagus / Adenocarcinoma of the Gastric Cardia / Adenocarcinomas of the Gastroesophageal Junction / Stage IIIA Esophageal Cancer / Stage IIIB Esophageal Cancer / Stage IIIC Esophageal Cancer1
2RecruitingTreatmentAdenocarcinoma of the Pancreas1
2RecruitingTreatmentAdenocarcinoma of the Pancreas / Cancer of Pancreas / Neoplasms, Pancreatic / Pancreatic Cancer Non-resectable / Pancreatic Cancer Resectable / Pancreatic Cancer, Adult / Pancreatic Ductal Adenocarcinoma (PDAC)1
2RecruitingTreatmentAdenocarcinoma of the Pancreas / Cancer of Pancreas / Resectable Pancreatic Cancers1
2RecruitingTreatmentAdenocarcinoma of the Pancreas / Recurrent Pancreatic Carcinoma / Stage I Pancreatic Cancer / Stage I Pancreatic Cancer AJCC v6 and v7 / Stage IA Pancreatic Cancer / Stage IA Pancreatic Cancer AJCC v6 and v7 / Stage IB Pancreatic Cancer / Stage IB Pancreatic Cancer AJCC v6 and v7 / Stage II Pancreatic Cancer / Stage II Pancreatic Cancer AJCC v6 and v7 / Stage IIA Pancreatic Cancer / Stage IIA Pancreatic Cancer AJCC v6 and v7 / Stage IIB Pancreatic Cancer / Stage IIB Pancreatic Cancer AJCC v6 and v7 / Stage III Pancreatic Cancer / Stage III Pancreatic Cancer AJCC v6 and v7 / Stage IV Pancreatic Cancer / Stage IV Pancreatic Cancer AJCC v6 and v71
2RecruitingTreatmentAdenocarcinoma of the Pancreas / Stage IIA Pancreatic Cancer / Stage IIB Pancreatic Cancer / Stage III Pancreatic Cancer1
2RecruitingTreatmentAdenocarcinomas of the Gastroesophageal Junction / Malignant Neoplasm of Stomach2
2RecruitingTreatmentAdvanced Biliary Tract Cancer1
2RecruitingTreatmentAdvanced Esophageal Carcinoma1
2RecruitingTreatmentAdvanced Rectal Cancer1
2RecruitingTreatmentAnal Basaloid Carcinoma / Anal Canal Cloacogenic Carcinoma / Anal Canal Squamous Cell Carcinoma / Anal Margin Squamous Cell Carcinoma / Stage I Anal Cancer AJCC v8 / Stage IIA Anal Cancer AJCC v81
2RecruitingTreatmentAnal Canal Squamous Cell Carcinoma / Stage I Anal Cancer AJCC v8 / Stage II Anal Cancer AJCC v8 / Stage IIA Anal Cancer AJCC v8 / Stage IIB Anal Cancer AJCC v8 / Stage III Anal Cancer AJCC v8 / Stage IIIA Anal Cancer AJCC v8 / Stage IIIB Anal Cancer AJCC v8 / Stage IIIC Anal Cancer AJCC v81
2RecruitingTreatmentBreast Cancer1
2RecruitingTreatmentCancer, Anal / Stage II Anal Cancer / Stage III Anal Cancer1
2RecruitingTreatmentChildren / Nasopharyngeal Carcinoma1
2RecruitingTreatmentCholangiocarcinoma Advanced / Cholangiocarcinoma Metastatic / Cholangiocarcinoma Non-resectable / Cholangiocarcinoma of the Gallbladder1
2RecruitingTreatmentCholangiocarcinomas / Colorectal Cancers1
2RecruitingTreatmentColo-rectal Cancer / Hepatic Metastases1
2RecruitingTreatmentColonic Neoplasms / Neoplasms Metastasis / Neoplasms, Colorectal / Rectal Neoplasms1
2RecruitingTreatmentColorectal Cancers3
2RecruitingTreatmentColorectal neoplasms malignant / Metastatic Colorectal Cancer (MCRC)1
2RecruitingTreatmentConcurrent Chemoradiotherapy / Neoplasms, Esophageal / Squamous Cell Carcinoma (SCC)1
2RecruitingTreatmentDocetaxel, Oxaliplatin and Fluorouracil1
2RecruitingTreatmentDrug Therapy / Radiations / Rectal Neoplasms1
2RecruitingTreatmentEpidermal Growth Factor Receptor (EGFR) Protein Overexpression / Malignant Neoplasm of Cardio-esophageal Junction of Stomach / Malignant Neoplasm of Stomach1
2RecruitingTreatmentEsophageal Cancers1
2RecruitingTreatmentEsophageal Cancers / Gastric Adenocarcinoma / Malignant Neoplasm of Stomach / Malignant Neoplasms of Digestive Organs / Oligometastasis / Stage IV Esophageal Adenocarcinoma AJCC v7 / Stage IV Esophageal Cancer AJCC v7 / Stage IV Gastric Cancer AJCC v71
2RecruitingTreatmentEsophageal Cancers / Malignant Neoplasm of Stomach1
2RecruitingTreatmentEsophageal Carcinoma1
2RecruitingTreatmentEsophageal Squamous Cell Carcinoma (ESCC)3
2RecruitingTreatmentGastric Adenocarcinoma / Malignant Neoplasm of Stomach1
2RecruitingTreatmentGastro-esophageal Junction (GEJ) Cancer / Malignant Neoplasm of Stomach / Pharmacokinetics of Fluorouracil Bolus (5-FU) / Pharmacokinetics of IMAB362 / Pharmacokinetics of Oxaliplatin / Pharmacokinetics of Zolbetuximab1
2RecruitingTreatmentGastro-esophageal Junction Adenocarcinoma / Malignant Neoplasm of Stomach1
2RecruitingTreatmentHER2-expressing Gastroesophageal Adenocarcinoma1
2RecruitingTreatmentHNSCC / HPV-Related Squamous Cell Carcinoma1
2RecruitingTreatmentHNSCC / HPV-Related Squamous Cell Carcinoma / Human Papilloma Virus (HPV) / Squamous Cell Carcinoma (SCC) / Squamous Cell Carcinoma of the Head and Neck (SCCHN)1
2RecruitingTreatmentHead and Neck Carcinoma1
2RecruitingTreatmentHepatocellular Carcinoma Non-resectable1
2RecruitingTreatmentIncurable Colorectal Cancer / RAS-wild-type1
2RecruitingTreatmentLiver Metastasis / Lung Metastasis / Rectal Carcinoma1
2RecruitingTreatmentLocally Advanced Cancer / Metastatic Cancers / Pancreatic Ductal Adenocarcinoma1
2RecruitingTreatmentLocally Advanced Digestive System Neuroendocrine Carcinoma / Locally Advanced Pancreatic Neuroendocrine Carcinoma / Metastatic Digestive System Neuroendocrine Carcinoma / Metastatic Pancreatic Neuroendocrine Carcinoma / Refractory Digestive System Neuroendocrine Carcinoma / Refractory Pancreatic Neuroendocrine Carcinoma / Unresectable Digestive System Neuroendocrine Carcinoma / Unresectable Pancreatic Neuroendocrine Carcinoma1
2RecruitingTreatmentLocally Advanced Head and Neck Carcinoma / Recurrent Head and Neck Carcinoma1
2RecruitingTreatmentLocally Advanced Nasal Cavity and Paranasal Sinus Squamous Cell Carcinoma / Nasal Cavity and Paranasal Sinus Poorly Differentiated Carcinoma / Paranasal Sinus Neoplasms / Sinonasal Undifferentiated Carcinoma / Squamous Cell Carcinoma (SCC) / Stage II Nasal Cavity and Paranasal Sinus Cancer AJCC v8 / Stage III Nasal Cavity and Paranasal Sinus Cancer AJCC v8 / Stage IVA Nasal Cavity and Paranasal Sinus Cancer AJCC v8 / Stage IVB Nasal Cavity and Paranasal Sinus Cancer AJCC v81
2RecruitingTreatmentLocally Advanced Rectal Cancer (LARC)1
2RecruitingTreatmentMetastatic Colorectal Cancer (MCRC) / MSI1
2RecruitingTreatmentMalignant Digestive System Neoplasm1
2RecruitingTreatmentMalignant Neoplasm of Pancreas1
2RecruitingTreatmentMetastatic Colorectal Cancer (MCRC)13
2RecruitingTreatmentMetastatic Malignant Neoplasm in the Liver / Stage IV Colorectal Cancer AJCC v8 / Stage IVA Colorectal Cancer AJCC v8 / Stage IVB Colorectal Cancer AJCC v8 / Stage IVC Colorectal Cancer AJCC v81
2RecruitingTreatmentMetastatic Pancreatic Ductal Adenocarcinoma1
2RecruitingTreatmentNasopharyngeal Carcinoma2
2RecruitingTreatmentNeoadjuvant Chemotherapy / Pancreatic Adenocarcinoma Resectable1
2RecruitingTreatmentNeoplasm Neck1
2RecruitingTreatmentNeoplasms, Esophageal1
2RecruitingTreatmentNeoplasms, Esophageal / Squamous Cell Carcinoma (SCC)1
2RecruitingTreatmentNeoplasms, Pancreatic1
2RecruitingTreatmentNeuroendocrine Carcinomas3
2RecruitingTreatmentNeuroendocrine Carcinomas / Oncology1
2RecruitingTreatmentPancreatic Cancer Non-resectable1
2RecruitingTreatmentRas-mutated Metastatic Colorectal Cancer1
2RecruitingTreatmentRectal Adenocarcinoma1
2RecruitingTreatmentRectal Carcinoma5
2RecruitingTreatmentResectable Gastric and Gastroesophageal Junction Adenocarcinoma1
2RecruitingTreatmentSquamous Cell Carcinoma of the Anus1
2RecruitingTreatmentStage III Colon Cancer1
2RecruitingTreatmentStage III Esophageal Squamous Cell Carcinoma1
2SuspendedTreatmentMetastatic Gastro-esophageal Adenocarcinoma1
2SuspendedTreatmentRectal Adenocarcinoma / Stage II Rectal Cancer / Stage II Rectal Cancer AJCC v7 / Stage III Rectal Cancer / Stage III Rectal Cancer AJCC v71
2TerminatedTreatmentAbdominal wall neoplasm1
2TerminatedTreatmentAdenocarcinoma Of Esophagus / Adenocarcinoma of the Esophagus / Adenocarcinomas of the Gastroesophageal Junction / Stage II Esophageal Cancer / Stage IIA Esophageal Cancer / Stage IIB Esophageal Cancer1
2TerminatedTreatmentAdenocarcinoma of Ampulla / Ductal Adenocarcinoma of Pancreas1
2TerminatedTreatmentAdenocarcinoma of the Colon / Adenocarcinoma of the Rectum / Metastatic Colon Cancer / Mucinous Adenocarcinoma of the Colon / Mucinous Adenocarcinoma of the Rectum / Recurrent Colon Cancer / Recurrent Rectal Cancer / Signet Ring Adenocarcinoma of the Colon / Signet Ring Adenocarcinoma of the Rectum / Stage IV Rectal Cancer1
2TerminatedTreatmentAdenocarcinoma of the Distal Esophagus / Adenocarcinoma of the Proximal Stomach / Adenocarcinomas of the Gastroesophageal Junction / Gastroesophageal Adenocarcinoma1
2TerminatedTreatmentAdenocarcinoma of the Pancreas1
2TerminatedTreatmentAdenocarcinoma of the Pancreas / Poorly Differentiated Malignant Neoplasm / Resectable Pancreatic Cancers / Stage IA Pancreatic Cancer / Stage IB Pancreatic Cancer / Stage IIA Pancreatic Cancer / Stage IIB Pancreatic Cancer / Stage III Pancreatic Cancer / Undifferentiated Pancreatic Carcinoma1
2TerminatedTreatmentAdenocarcinomas of the Gastroesophageal Junction / Malignant Neoplasm of Stomach1
2TerminatedTreatmentBile Duct Carcinoma / Cancer of the Gallbladder / Cholangiocarcinomas / Hepatobiliary Neoplasms / Liver Cancer1
2TerminatedTreatmentBorderline Resectable Pancreatic Cancer1
2TerminatedTreatmentBreast Cancer2
2TerminatedTreatmentCancer of Larynx1
2TerminatedTreatmentCancer, Anal1
2TerminatedTreatmentCancer, Bladder1
2TerminatedTreatmentColorectal Cancers10
2TerminatedTreatmentColorectal Cancers / Metastases1
2TerminatedTreatmentColorectal Cancers / Metastatic Cancers1
2TerminatedTreatmentColorectal Liver Metastases1
2TerminatedTreatmentDiarrhea / Neoplasms, Colorectal1
2TerminatedTreatmentEsophageal Cancers3
2TerminatedTreatmentEsophageal Carcinoma1
2TerminatedTreatmentEsophageal Diseases1
2TerminatedTreatmentEsophageal Squamous Cell Carcinoma (ESCC)1
2TerminatedTreatmentExtrahepatic Bile Duct Cancer / Liver Cancer1
2TerminatedTreatmentHER2 Positive Esophagogastric Cancer1
2TerminatedTreatmentHead and Neck Carcinoma4
2TerminatedTreatmentHepatic Metastases / Recurrent Colon Cancer / Recurrent Rectal Cancer / Stage IVA Colon Cancer / Stage IVA Rectal Cancer / Stage IVB Colon Cancer / Stage IVB Rectal Cancer1
2TerminatedTreatmentHuman Papilloma Virus (HPV) / Squamous Cell Carcinoma of the Head and Neck (SCCHN)1
2TerminatedTreatmentLocalized Squamous Cell Carcinoma of the Esophagus1
2TerminatedTreatmentLoco-regional Esophageal Cancer1
2TerminatedTreatmentMalignant Neoplasm of Colon1
2TerminatedTreatmentMalignant Neoplasm of Pancreas3
2TerminatedTreatmentMalignant Neoplasm of Pancreas / Pancreatic Carcinoma Non-resectable1
2TerminatedTreatmentMalignant Neoplasm of Stomach2
2TerminatedTreatmentMetastatic Colon Cancer / Stage IV Rectal Cancer1
2TerminatedTreatmentMetastatic Colorectal Cancer (MCRC)4
2TerminatedTreatmentNeoplasm Metastases / Neoplasms, Colorectal1
2TerminatedTreatmentNeoplasms Metastasis / Neoplasms, Colorectal1
2TerminatedTreatmentNeoplasms, Breast1
2TerminatedTreatmentNeoplasms, Colorectal2
2TerminatedTreatmentOral Cancers / Squamous Cell Carcinoma (SCC)1
2TerminatedTreatmentRectal Adenocarcinoma1
2TerminatedTreatmentRectal Carcinoma2
2TerminatedTreatmentRectal Neoplasms1
2TerminatedTreatmentRecurrent Colorectal Carcinoma / Stage IVA Colorectal Cancer / Stage IVB Colorectal Cancer1
2TerminatedTreatmentStage IB Esophageal Adenocarcinoma / Stage IIA Esophageal Adenocarcinoma / Stage IIB Esophageal Adenocarcinoma / Stage IIIA Esophageal Adenocarcinoma / Stage IIIB Esophageal Adenocarcinoma / Stage IIIC Esophageal Adenocarcinoma1
2TerminatedTreatmentUterine Neoplasms1
2Unknown StatusPreventionAdvanced Gastric Cancer1
2Unknown StatusTreatmentAdenocarcinomas of the Gastroesophageal Junction / Gastric Junction Adenocarcinoma1
2Unknown StatusTreatmentAdenocarincoma of Pancreas / Stage III Pancreatic Cancer / Stage IVA Pancreatic Cancer / Stage IVB Pancreatic Cancer1
2Unknown StatusTreatmentAdvanced Gastric Cancer1
2Unknown StatusTreatmentBile Duct Carcinoma / Cancer of the Gallbladder1
2Unknown StatusTreatmentBiliary Tract Cancer1
2Unknown StatusTreatmentBreast Cancer6
2Unknown StatusTreatmentBreast Cancer / Cervical Cancers / Endometrial Cancer / Ovarian Cancer1
2Unknown StatusTreatmentCancer, Bladder / Transitional Cell Cancer of the Renal Pelvis and Ureter / Urethral Cancer1
2Unknown StatusTreatmentCarcinoma of the Appendix / Colorectal Cancers / Primary Peritoneal Cavity Cancer1
2Unknown StatusTreatmentCarcinoma, Colorectal1
2Unknown StatusTreatmentChemotherapeutic Agent Toxicity / Colorectal Cancers / Neurologic toxicity1
2Unknown StatusTreatmentColorectal Cancers10
2Unknown StatusTreatmentColorectal Cancers / Metastatic Cancers4
2Unknown StatusTreatmentColorectal Cancers / Metastatic Cancers / Primary Peritoneal Cavity Cancer1
2Unknown StatusTreatmentColorectal Cancers / Peritoneal Cavity Cancer1
2Unknown StatusTreatmentEarly Stage Hepatocellular Carcinoma1
2Unknown StatusTreatmentEsophageal Cancers2
2Unknown StatusTreatmentEsophageal Cancers / Malignant Neoplasm of Stomach1
2Unknown StatusTreatmentEsophageal Squamous Cell Carcinoma (ESCC)1
2Unknown StatusTreatmentExtrahepatic Bile Duct Cancer / Malignant Neoplasm of Pancreas1
2Unknown StatusTreatmentHead and Neck Carcinoma5
2Unknown StatusTreatmentLiver Cancer1
2Unknown StatusTreatmentLocally Advanced Pancreatic Cancer1
2Unknown StatusTreatmentMalignant Neoplasm of Pancreas3
2Unknown StatusTreatmentMalignant Neoplasm of Pancreas / Metastatic Cancers1
2Unknown StatusTreatmentMalignant Neoplasm of Stomach1
2Unknown StatusTreatmentMetastatic Breast Cancer1
2Unknown StatusTreatmentMetastatic Colorectal Cancer (MCRC)1
2Unknown StatusTreatmentNasopharyngeal Carcinoma3
2Unknown StatusTreatmentNeoplasms, Colorectal1
2Unknown StatusTreatmentOvarian Cancer1
2Unknown StatusTreatmentRenal Cancers1
2Unknown StatusTreatmentStomach Neoplasms2
2WithdrawnTreatmentAdenocarcinoma of the Colon / Adenocarcinoma of the Rectum1
2WithdrawnTreatmentAdenocarcinoma of the Colon / Adenocarcinoma of the Rectum / Recurrent Colon Cancer / Recurrent Rectal Cancer / Stage IVA Colon Cancer / Stage IVA Rectal Cancer / Stage IVB Colon Cancer / Stage IVB Rectal Cancer1
2WithdrawnTreatmentCancer of Head and Neck1
2WithdrawnTreatmentCancer of the Bile Duct / Cancer of the Gallbladder1
2WithdrawnTreatmentColorectal Adenocarcinoma Metastatic to the Liver1
2WithdrawnTreatmentColorectal Cancers3
2WithdrawnTreatmentColorectal Cancers / Metastatic Cancers1
2WithdrawnTreatmentColorectal Cancers / Metastatic Colorectal Cancer (MCRC)1
2WithdrawnTreatmentEsophagogastric Adenocarcinoma / Metastatic Disease / No Previous Chemotherapy for Metastatic Esophagogastric Cancer1
2WithdrawnTreatmentEsophagogastric Cancer1
2WithdrawnTreatmentHead and Neck Carcinoma1
2WithdrawnTreatmentHepatocellular,Carcinoma / Lung Metastasis1
2WithdrawnTreatmentMetastatic Colorectal Cancer (MCRC)3
2WithdrawnTreatmentMucinous Adenocarcinoma of the Colon / Mucinous Adenocarcinoma of the Rectum / Recurrent Colon Cancer / Recurrent Rectal Cancer / Signet Ring Adenocarcinoma of the Colon / Signet Ring Adenocarcinoma of the Rectum / Stage IVA Colon Cancer / Stage IVA Rectal Cancer / Stage IVB Colon Cancer / Stage IVB Rectal Cancer1
2WithdrawnTreatmentNeoplasms, Colorectal1
2WithdrawnTreatmentPancreatic Cancer Metastatic1
2WithdrawnTreatmentTriple Negative Breast Cancer (TNBC)1
2, 3Active Not RecruitingTreatmentColorectal Cancers2
2, 3Active Not RecruitingTreatmentGastroesophageal Junction Cancer / Malignant Neoplasm of Stomach1
2, 3Active Not RecruitingTreatmentMetastatic Colorectal Cancer (MCRC)1
2, 3Active Not RecruitingTreatmentRectal Carcinoma1
2, 3Active Not RecruitingTreatmentResectable Prancreas Carcinoma1
2, 3CompletedDiagnosticColorectal Cancers1
2, 3CompletedTreatmentAdenocarcinomas / Esophageal Cancers1
2, 3CompletedTreatmentCisplatin Adverse Reaction / Upper GI Cancer1
2, 3CompletedTreatmentColorectal Cancers2
2, 3CompletedTreatmentCancer treatment / Colorectal Cancers / Hepatic Metastases1
2, 3CompletedTreatmentEsophageal Cancers2
2, 3CompletedTreatmentMalignant Neoplasm of Pancreas1
2, 3CompletedTreatmentMalignant Neoplasm of Stomach2
2, 3CompletedTreatmentMetastatic Colorectal Cancer (MCRC)1
2, 3CompletedTreatmentNeoplasm Recurrence, Local / Neoplasms Metastasis / Neoplasms, Head and Neck1
2, 3CompletedTreatmentNeoplasms, Head and Neck1
2, 3Not Yet RecruitingNot AvailableNasopharyngeal Carcinoma1
2, 3Not Yet RecruitingTreatmentBreast Cancer / Neoadjuvant Chemotherapy / Pathological Complete Response1
2, 3Not Yet RecruitingTreatmentColorectal Cancers3
2, 3Not Yet RecruitingTreatmentMalignant Neoplasm of Colon1
2, 3Not Yet RecruitingTreatmentMalignant Tumor of Pancreas Metastatic to Liver1
2, 3RecruitingPreventionHepatocellular,Carcinoma1
2, 3RecruitingTreatmentAbdominal wall neoplasm / Carcinoma, Colorectal / Colorectal Adenocarcinoma / Colorectal Cancers / Colorectal neoplasms malignant / Colorectal Tumors / Malignant Peritoneal Neoplasm / Metastases to peritoneum / Neoplasms, Colorectal / Peritoneal Carcinomatosis / Peritoneal Diseases / Peritoneal Neoplasm Malignant Secondary / Peritoneal Neoplasm Malignant Secondary Carcinomatosis1
2, 3RecruitingTreatmentAdenocarcinoma Of Esophagus / Adenocarcinomas of the Gastroesophageal Junction / Esophageal Cancers1
2, 3RecruitingTreatmentAdvanced Gastric or EGJ Cancer1
2, 3RecruitingTreatmentChildhood Hepatocellular Carcinoma / Childhood Malignant Liver Neoplasm / Elevated Alpha-Fetoprotein / Fibrolamellar Carcinoma / Hepatoblastomas / Hepatocellular Malignant Neoplasm, Not Otherwise Specified / SMARCB1 Gene Mutation1
2, 3RecruitingTreatmentColon Adenocarcinoma / Stage IIA Colon Cancer AJCC v81
2, 3RecruitingTreatmentColorectal Cancer Stage IV / Metastasis1
2, 3RecruitingTreatmentColorectal Cancers1
2, 3RecruitingTreatmentEpstein-Barr Virus Infections / Stage II Nasopharyngeal Carcinoma / Stage III Nasopharyngeal Carcinoma / Stage IVA Nasopharyngeal Carcinoma / Stage IVB Nasopharyngeal Carcinoma1
2, 3RecruitingTreatmentMalignant Neoplasm of Stomach1
2, 3RecruitingTreatmentRectal Carcinoma1
2, 3TerminatedTreatmentCancer, Anal1
2, 3TerminatedTreatmentCarcinoid tumour of the gastrointestinal tract / Islet Cell Tumor / Lung Cancers / Neoplastic Syndrome / Neuroendocrine Tumors1
2, 3TerminatedTreatmentEsophageal Cancers1
2, 3Unknown StatusTreatmentColorectal Cancers1
2, 3Unknown StatusTreatmentMalignant Neoplasm of Pancreas1
2, 3WithdrawnTreatmentHepatocellular,Carcinoma2
3Active Not RecruitingNot AvailableBreast Cancer1
3Active Not RecruitingTreatmentAdenocarcinomas of the Gastroesophageal Junction / Metastatic Gastric Adenocarcinoma1
3Active Not RecruitingTreatmentAlpha Fetoprotein Increased / PRETEXT Stage 1 Hepatoblastoma / PRETEXT Stage 2 Hepatoblastoma / PRETEXT Stage 3 Hepatoblastoma / PRETEXT Stage 4 Hepatoblastoma1
3Active Not RecruitingTreatmentBRAF V600E-mutant Metastatic Colorectal Cancer1
3Active Not RecruitingTreatmentBreast Cancer9
3Active Not RecruitingTreatmentBreast Cancer / HER2 Positive1
3Active Not RecruitingTreatmentCRC1
3Active Not RecruitingTreatmentCarcinoma, Colorectal1
3Active Not RecruitingTreatmentCarcinoma, Squamous Cell of Head and Neck1
3Active Not RecruitingTreatmentColon Mucinous Adenocarcinoma / Colon Signet Ring Cell Adenocarcinoma / Lynch Syndrome / Stage IIA Colon Cancer / Stage IIA Colon Cancer AJCC v7 / Stage IIB Colon Cancer / Stage IIB Colon Cancer AJCC v7 / Stage IIC Colon Cancer / Stage IIC Colon Cancer AJCC v71
3Active Not RecruitingTreatmentColorectal Cancers6
3Active Not RecruitingTreatmentGastric Adenocarcinoma1
3Active Not RecruitingTreatmentGastroesophageal Junction Cancer / Malignant Neoplasm of Stomach1
3Active Not RecruitingTreatmentGlaucoma1
3Active Not RecruitingTreatmentHead and Neck Carcinoma1
3Active Not RecruitingTreatmentHead and Neck Carcinoma / Metastatic Head and Neck Squamous Cell Carcinoma / Recurrent Head and Neck Squamous Cell Carcinoma1
3Active Not RecruitingTreatmentLocal Advanced Esophageal Squamous Cell Carcinoma / Stage III Esophageal Squamous Cell Carcinoma1
3Active Not RecruitingTreatmentMalignant Neoplasm of Colon1
3Active Not RecruitingTreatmentMalignant Neoplasm of Stomach1
3Active Not RecruitingTreatmentMetastatic Colorectal Cancer (MCRC)1
3Active Not RecruitingTreatmentMetastatic Head and Neck Cancer / Recurrent Head and Neck Cancer1
3Active Not RecruitingTreatmentMetastatic Head and Neck Carcinoma / Recurrent Head and Neck Cancer / Recurrent Head and Neck Squamous Cell Carcinoma / Recurrent Hypopharyngeal Squamous Cell Carcinoma / Recurrent Laryngeal Squamous Cell Carcinoma / Recurrent Laryngeal Verrucous Carcinoma / Recurrent Lip and Oral Cavity Squamous Cell Carcinoma / Recurrent Metastatic Squamous Cell Carcinoma in the Neck With Occult Primary / Recurrent Nasal Cavity and Paranasal Sinus Squamous Cell Carcinoma / Recurrent Oral Cavity Verrucous Carcinoma / Recurrent Oropharyngeal Squamous Cell Carcinoma / Recurrent Salivary Gland Carcinoma / Salivary Gland Squamous Cell Carcinoma / Squamous Cell Carcinoma Metastatic in the Neck With Occult Primary / Stage IV Hypopharyngeal Squamous Cell Carcinoma / Stage IV Hypopharyngeal Squamous Cell Carcinoma AJCC v7 / Stage IV Major Salivary Gland Cancer AJCC v7 / Stage IV Major Salivary Gland Carcinoma / Stage IVA Laryngeal Squamous Cell Carcinoma / Stage IVA Laryngeal Squamous Cell Carcinoma AJCC v7 / Stage IVA Laryngeal Verrucous Carcinoma / Stage IVA Laryngeal Verrucous Carcinoma AJCC v7 / Stage IVA Lip and Oral Cavity Squamous Cell Carcinoma / Stage IVA Lip and Oral Cavity Squamous Cell Carcinoma AJCC v6 and v7 / Stage IVA Major Salivary Gland Cancer AJCC v7 / Stage IVA Major Salivary Gland Carcinoma / Stage IVA Nasal Cavity and Paranasal Sinus Squamous Cell Carcinoma / Stage IVA Nasal Cavity and Paranasal Sinus Squamous Cell Carcinoma AJCC v7 / Stage IVA Oral Cavity Cancer AJCC v6 and v7 / Stage IVA Oral Cavity Verrucous Carcinoma / Stage IVA Oropharyngeal Squamous Cell Carcinoma / Stage IVA Oropharyngeal Squamous Cell Carcinoma AJCC v7 / Stage IVB Laryngeal Squamous Cell Carcinoma / Stage IVB Laryngeal Squamous Cell Carcinoma AJCC v7 / Stage IVB Laryngeal Verrucous Carcinoma / Stage IVB Laryngeal Verrucous Carcinoma AJCC v7 / Stage IVB Lip and Oral Cavity Squamous Cell Carcinoma / Stage IVB Lip and Oral Cavity Squamous Cell Carcinoma AJCC v6 and v7 / Stage IVB Major Salivary Gland Cancer AJCC v7 / Stage IVB Major Salivary Gland Carcinoma / Stage IVB Nasal Cavity and Paranasal Sinus Squamous Cell Carcinoma / Stage IVB Nasal Cavity and Paranasal Sinus Squamous Cell Carcinoma AJCC v7 / Stage IVB Oral Cavity Cancer AJCC v6 and v7 / Stage IVB Oral Cavity Verrucous Carcinoma / Stage IVB Oropharyngeal Squamous Cell Carcinoma / Stage IVB Oropharyngeal Squamous Cell Carcinoma AJCC v7 / Stage IVC Laryngeal Squamous Cell Carcinoma / Stage IVC Laryngeal Squamous Cell Carcinoma AJCC v7 / Stage IVC Laryngeal Verrucous Carcinoma / Stage IVC Laryngeal Verrucous Carcinoma AJCC v7 / Stage IVC Lip and Oral Cavity Squamous Cell Carcinoma / Stage IVC Lip and Oral Cavity Squamous Cell Carcinoma AJCC v6 and v7 / Stage IVC Major Salivary Gland Cancer AJCC v7 / Stage IVC Major Salivary Gland Carcinoma / Stage IVC Nasal Cavity and Paranasal Sinus Squamous Cell Carcinoma / Stage IVC Nasal Cavity and Paranasal Sinus Squamous Cell Carcinoma AJCC v7 / Stage IVC Oral Cavity Cancer AJCC v6 and v7 / Stage IVC Oral Cavity Verrucous Carcinoma / Stage IVC Oropharyngeal Squamous Cell Carcinoma / Stage IVC Oropharyngeal Squamous Cell Carcinoma AJCC v7 / Tongue Carcinoma / Untreated Metastatic Squamous Cell Carcinoma to Neck With Occult Primary1
3Active Not RecruitingTreatmentNasopharyngeal Carcinoma3
3Active Not RecruitingTreatmentNasopharyngeal Neoplasms1
3Active Not RecruitingTreatmentNeoplasms, Esophageal1
3Active Not RecruitingTreatmentPancreatic Acinar Cell Carcinoma / Pancreatic Ductal Adenocarcinoma / Pancreatic Intraductal Papillary-Mucinous Neoplasm / Stage I Pancreatic Cancer AJCC v6 and v7 / Stage IA Pancreatic Cancer / Stage IA Pancreatic Cancer AJCC v6 and v7 / Stage IB Pancreatic Cancer / Stage IB Pancreatic Cancer AJCC v6 and v7 / Stage II Pancreatic Cancer AJCC v6 and v7 / Stage IIA Pancreatic Cancer / Stage IIA Pancreatic Cancer AJCC v6 and v7 / Stage IIB Pancreatic Cancer / Stage IIB Pancreatic Cancer AJCC v6 and v71
3Active Not RecruitingTreatmentSquamous Cell Carcinoma of the Head and Neck (SCCHN)2
3Active Not RecruitingTreatmentStage I Lymphoepithelioma of the Nasopharynx / Stage I Squamous Cell Carcinoma of the Nasopharynx / Stage II Lymphoepithelioma of the Nasopharynx / Stage II Squamous Cell Carcinoma of the Nasopharynx / Stage III Lymphoepithelioma of the Nasopharynx / Stage III Squamous Cell Carcinoma of the Nasopharynx / Stage IV Lymphoepithelioma of the Nasopharynx / Stage IV Squamous Cell Carcinoma of the Nasopharynx1
3Active Not RecruitingTreatmentUnresectable, Locally Advanced or Metastatic, Adenocarcinoma of the Stomach, or of the Gastro Esophageal Junction1
3Active Not RecruitingTreatmentVarious Advanced Cancer1
3CompletedPreventionCarcinoma, Colorectal / Metastases / Neoplasms, Colorectal1
3CompletedPreventionCervix, Dysplasia / Human Immunodeficiency Virus (HIV) Infections1
3CompletedPreventionChemotherapy Induced Neutropenia / Colorectal Cancers1
3CompletedSupportive CareBreast Cancer1
3CompletedSupportive CareGastroesophageal Cancer (GC) / Malignant Neoplasm of Stomach1
3CompletedTreatmentActinic Keratosis (AK)5
3CompletedTreatmentAdenocarcinoma of the Colon / Adenocarcinoma of the Rectum / Metastatic Colon Cancer / Recurrent Colon Cancer / Recurrent Rectal Cancer / Stage III Colon Cancer / Stage III Rectal Cancer / Stage IV Rectal Cancer1
3CompletedTreatmentAdenocarcinoma of the Colon / Adenocarcinoma of the Rectum / Metastatic Colon Cancer / Recurrent Colon Cancer / Recurrent Rectal Cancer / Stage IV Rectal Cancer1
3CompletedTreatmentAdenocarcinoma of the Colon / Colon Adenocarcinoma / Stage IIA Colon Cancer / Stage IIA Colon Cancer AJCC v7 / Stage IIB Colon Cancer / Stage IIB Colon Cancer AJCC v7 / Stage IIC Colon Cancer / Stage IIC Colon Cancer AJCC v7 / Stage IIIA Colon Cancer / Stage IIIA Colon Cancer AJCC v7 / Stage IIIB Colon Cancer / Stage IIIB Colon Cancer AJCC v7 / Stage IIIC Colon Cancer / Stage IIIC Colon Cancer AJCC v71
3CompletedTreatmentAdenocarcinoma of the Colon / Stage III Colon Cancer2
3CompletedTreatmentAdenocarcinoma of the Stomach / Adenocarcinomas of the Gastroesophageal Junction1
3CompletedTreatmentAmpullary Cancer / Biliary Tract Cancer / Cancer of the Gallbladder / Cholangiocarcinomas1
3CompletedTreatmentBreast Cancer33
3CompletedTreatmentBreast Cancer / Chemotherapy, Adjuvant1
3CompletedTreatmentCancer of the Larynx / Cancer of the Nasal Cavity / Cancer of the Oral Cavity / Cancer of the Pharynx / Paranasal Sinus Neoplasms1
3CompletedTreatmentCancer, Anal2
3CompletedTreatmentCancer, Bladder1
3CompletedTreatmentCervical Cancers2
3CompletedTreatmentChildhood Hepatoblastoma / Recurrent Childhood Liver Cancer / Stage I Childhood Liver Cancer1
3CompletedTreatmentColon Cancer Stage II1
3CompletedTreatmentColon Cancer Stage III1
3CompletedTreatmentColorectal Cancers38
3CompletedTreatmentColorectal Cancers / Metastasis1
3CompletedTreatmentColorectal Cancers / Metastatic Cancers3
3CompletedTreatmentCancer treatment / Colorectal Cancers / Metastatic Cancers1
3CompletedTreatmentColorectal Cancers / Primary Peritoneal Cavity Cancer1
3CompletedTreatmentColorectal Peritoneal Carcinomatosis1
3CompletedTreatmentDigestive System Neoplasms / Intestinal Neoplasms / Neoplasms Metastasis / Neoplasms, Colorectal / Neoplasms, Gastrointestinal1
3CompletedTreatmentDrug/Agent Toxicity by Tissue/Organ / Malignant Neoplasm of Pancreas1
3CompletedTreatmentEarly Breast Cancer2
3CompletedTreatmentEpidermal Growth Factor Receptor (EGFR) Expressing Metastatic Colorectal Cancer1
3CompletedTreatmentEsophageal Cancers5
3CompletedTreatmentEsophageal Cancers / Malignant Neoplasm of Stomach2
3CompletedTreatmentEsophageal Squamous Cell Carcinoma (ESCC)1
3CompletedTreatmentEsophagus Cancer1
3CompletedTreatmentGallbladder Neoplasms1
3CompletedTreatmentGastric Adenocarcinoma1
3CompletedTreatmentHead and Neck Carcinoma9
3CompletedTreatmentHead and Neck Squamous Cell Carcinoma (HNSCC)1
3CompletedTreatmentHepatic Metastases / Neoplasm Recurrence, Local / Neoplasms Metastasis / Neoplasms, Colorectal1
3CompletedTreatmentInoperable Gastric Cancer1
3CompletedTreatmentMalignant Neoplasm of Female Breast1
3CompletedTreatmentMalignant Neoplasm of Pancreas7
3CompletedTreatmentMalignant Neoplasm of Stomach7
3CompletedTreatmentMalignant Neoplasm of Stomach / Metastases1
3CompletedTreatmentMalignant Neoplasm of Stomach / Neoplasms Metastasis1
3CompletedTreatmentMetastatic Colorectal Cancer (MCRC)11
3CompletedTreatmentMetastatic Diffuse Gastric Cancer Including Carcinoma of the Gastro-esophageal Junction1
3CompletedTreatmentMucinous Adenocarcinoma of the Colon / Mucinous Adenocarcinoma of the Rectum / Recurrent Colon Cancer / Recurrent Rectal Cancer / Signet Ring Adenocarcinoma of the Colon / Signet Ring Adenocarcinoma of the Rectum / Stage IIIA Colon Cancer / Stage IIIA Rectal Cancer / Stage IIIB Colon Cancer / Stage IIIB Rectal Cancer / Stage IIIC Colon Cancer / Stage IIIC Rectal Cancer / Stage IVA Colon Cancer / Stage IVA Rectal Cancer / Stage IVB Colon Cancer / Stage IVB Rectal Cancer1
3CompletedTreatmentMucinous Adenocarcinoma of the Rectum / Rectal Mucinous Adenocarcinoma / Rectal Signet Ring Cell Adenocarcinoma / Recurrent Rectal Cancer / Recurrent Rectal Carcinoma / Signet Ring Adenocarcinoma of the Rectum / Stage IIA Rectal Cancer / Stage IIA Rectal Cancer AJCC v7 / Stage IIB Rectal Cancer / Stage IIB Rectal Cancer AJCC v7 / Stage IIC Rectal Cancer / Stage IIC Rectal Cancer AJCC v7 / Stage IIIA Rectal Cancer / Stage IIIA Rectal Cancer AJCC v7 / Stage IIIB Rectal Cancer / Stage IIIB Rectal Cancer AJCC v7 / Stage IIIC Rectal Cancer / Stage IIIC Rectal Cancer AJCC v7 / Stage IVA Rectal Cancer / Stage IVA Rectal Cancer AJCC v7 / Stage IVB Rectal Cancer / Stage IVB Rectal Cancer AJCC v71
3CompletedTreatmentNasopharyngeal Carcinoma1
3CompletedTreatmentNeoplasms Metastasis / Neoplasms, Colorectal1
3CompletedTreatmentNeoplasms, Breast1
3CompletedTreatmentNeoplasms, Colorectal2
3CompletedTreatmentNeoplasms, Head and Neck1
3CompletedTreatmentNeoplasms, Pancreatic2
3CompletedTreatmentPancreatic Cancer Metastatic1
3CompletedTreatmentPrimary Breast Cancer1
3CompletedTreatmentRectal Carcinoma1
3CompletedTreatmentRectal Neoplasms1
3CompletedTreatmentRenal Cancers2
3CompletedTreatmentSquamous Cell Carcinoma of the Head and Neck (SCCHN)1
3CompletedTreatmentSquamous Cell Head and Neck Carcinoma1
3CompletedTreatmentStage II Colon Cancer / Stage III Colon Cancer1
3CompletedTreatmentStomach Neoplasms1
3Enrolling by InvitationPreventionBrow Ptosis / Facial Scarring1
3Enrolling by InvitationTreatmentApatinib1
3Not Yet RecruitingTreatmentCarcinoma, Colorectal1
3Not Yet RecruitingTreatmentColorectal Cancers2
3Not Yet RecruitingTreatmentNasopharyngeal Carcinoma1
3Not Yet RecruitingTreatmentRectal Carcinoma1
3RecruitingPreventionHigh-risk for Proliferative Vitreoretinopathy (PVR) / Rhegmatogenous Retinal Detachments1
3RecruitingTreatmentAdenocarcinoma of the Oesophago-gastric Junction / Adenocarcinoma of the Oesophagus / Junctional Tumours / Malignant Neoplasm of Esophagus / Oesophageal Tumours1
3RecruitingTreatmentAdenocarcinoma of the Pancreas1
3RecruitingTreatmentAdenocarcinomas of the Gastroesophageal Junction / Esophageal Adenocarcinoma (UICC TNM7)1
3RecruitingTreatmentAnal Intraepithelial Neoplasia (AIN) / High-Grade Squamous Intraepithelial Lesions / Human Immunodeficiency Virus (HIV) Infections1
3RecruitingTreatmentAntineoplastic Agents1
3RecruitingTreatmentBladder Carcinoma Infiltrating the Muscle of the Bladder Wall / Bladder Urothelial Carcinoma / Stage II Bladder Cancer AJCC v8 / Stage III Bladder Cancer AJCC v8 / Stage IIIA Bladder Cancer AJCC v81
3RecruitingTreatmentCancer, Anal1
3RecruitingTreatmentCarcinoma NOS / Malignant Neoplasm of Pancreas1
3RecruitingTreatmentChemotherapy Effects / Esophagus Cancer1
3RecruitingTreatmentClinical Stage IV Esophageal Adenocarcinoma AJCC v8 / Clinical Stage IV Gastric Cancer AJCC v8 / Clinical Stage IVA Esophageal Adenocarcinoma AJCC v8 / Clinical Stage IVA Gastric Cancer AJCC v8 / Clinical Stage IVB Esophageal Adenocarcinoma AJCC v8 / Clinical Stage IVB Gastric Cancer AJCC v8 / Metastatic Esophageal Adenocarcinoma / Metastatic Gastric Adenocarcinoma / Oligometastatic Esophageal Adenocarcinoma / Oligometastatic Gastric Adenocarcinoma / Pathologic Stage IV Esophageal Adenocarcinoma AJCC v8 / Pathologic Stage IV Gastric Cancer AJCC v8 / Pathologic Stage IVA Esophageal Adenocarcinoma AJCC v8 / Pathologic Stage IVB Esophageal Adenocarcinoma AJCC v81
3RecruitingTreatmentColon Adenocarcinoma / DNA Repair Disorder / Lynch Syndrome / Microsatellite Instability / Stage III Colon Cancer AJCC v7 / Stage IIIA Colon Cancer / Stage IIIA Colon Cancer AJCC v7 / Stage IIIB Colon Cancer / Stage IIIB Colon Cancer AJCC v7 / Stage IIIC Colon Cancer / Stage IIIC Colon Cancer AJCC v71
3RecruitingTreatmentColon Cancer (High-risk Stage III: pT4N1 or pT1 to 4 N2) / Colon Cancer (High-risk Stage III; pT4N1 or pT1 to 4 N2)1
3RecruitingTreatmentColorectal Adenocarcinoma1
3RecruitingTreatmentColorectal Adenocarcinoma / High-Frequency Microsatellite Instability / Metastatic Colorectal Adenocarcinoma / Mismatch Repair Deficiency / Stage IV Colorectal Cancer / Stage IV Colorectal Cancer AJCC v7 / Stage IVA Colorectal Cancer / Stage IVA Colorectal Cancer AJCC v7 / Stage IVB Colorectal Cancer / Stage IVB Colorectal Cancer AJCC v71
3RecruitingTreatmentColorectal Adenocarcinoma / RAS Wild Type / Stage III Colorectal Cancer AJCC v7 / Stage IIIA Colorectal Cancer AJCC v7 / Stage IIIB Colorectal Cancer AJCC v7 / Stage IIIC Colorectal Cancer AJCC v7 / Stage IV Colorectal Cancer AJCC v7 / Stage IVA Colorectal Cancer AJCC v7 / Stage IVB Colorectal Cancer AJCC v71
3RecruitingTreatmentColorectal Cancers3
3RecruitingTreatmentColorectal Cancers / HAI / Hepatic Metastases1
3RecruitingTreatmentColorectal Cancers / Hepatic Metastases1
3RecruitingTreatmentColorectal Cancers / Liver Metastasis1
3RecruitingTreatmentDigestive System Neoplasms / Intestinal Neoplasms / Neoplasms Metastasis / Neoplasms, Colorectal / Neoplasms, Gastrointestinal1
3RecruitingTreatmentEffects of Chemotherapy / General Surgery / Local Neoplasm Recurrences / Metastasis / Neoplasms, Colorectal1
3RecruitingTreatmentEsophageal Adenocarcinoma (EAC) / Esophageal Squamous Cell Carcinoma (ESCC) / Siewert Type I Adenocarcinoma of the Esophagogastric Junction (EGJ)1
3RecruitingTreatmentEsophageal Squamous Cell Carcinoma (ESCC)1
3RecruitingTreatmentGastroesophageal Junction Cancer / Malignant Neoplasm of Stomach1
3RecruitingTreatmentHead and Neck Squamous Cell Cancer1
3RecruitingTreatmentHead and Neck Squamous Cell Carcinoma (HNSCC)1
3RecruitingTreatmentIntrahepatic Cholangiocarcinoma1
3RecruitingTreatmentLocally Advanced Unresectable Gastric Adenocarcinoma or Cancer / Locally Advanced Unresectable Gastroesophageal Junction (GEJ) Adenocarcinoma or Cancer / Metastatic Gastric Adenocarcinoma or Cancer / Metastatic Gastroesophageal Junction (GEJ) Adenocarcinoma1
3RecruitingTreatmentMalignant Neoplasm of Colon1
3RecruitingTreatmentMalignant Neoplasm of Stomach1
3RecruitingTreatmentMetastatic Adenocarcinoma of the Pancreas1
3RecruitingTreatmentMetastatic Colorectal Cancer (MCRC)7
3RecruitingTreatmentMetastatic Colorectal Cancer (MCRC) / Stage III Colorectal Cancer1
3RecruitingTreatmentNasopharyngeal Carcinoma1
3RecruitingTreatmentNasopharyngeal Carcinoma / Nasopharyngeal Diseases / Nasopharyngeal Neoplasms / Neoplasms, Head and Neck1
3RecruitingTreatmentPancreatic Adenocarcinoma Metastatic1
3RecruitingTreatmentPreviously Treated Metastatic Colorectal Cancer1
3RecruitingTreatmentSquamous Cell Carcinoma of the Head and Neck (SCCHN)1
3RecruitingTreatmentStage ⅡA Pancreatic Cancer / Stage ⅡB Pancreatic Cancer1
3RecruitingTreatmentStomach Neoplasms3
3RecruitingTreatmentUnresectable Locally Advanced, Recurrent or Metastatic Esophageal Squamous Cell Carcinoma1
3RecruitingTreatmentUrinary Bladder Neoplasms1
3SuspendedPreventionCancer, Anal / High-Grade Squamous Intraepithelial Lesions / Human Immunodeficiency Virus (HIV) Infections / Human Papilloma Virus Infection1
3SuspendedTreatmentBreast Cancer1
3SuspendedTreatmentMetastatic Colorectal Cancer (MCRC)1
3TerminatedTreatment2nd Line Metastatic Colorectal Cancer / Metastatic Colorectal Cancer (MCRC)1
3TerminatedTreatmentActinic Keratosis (AK) / Organ or Tissue Transplant; Complications1
3TerminatedTreatmentAdenocarcinoma of the Colon / Adenocarcinoma of the Rectum / Metastatic Colon Cancer / Recurrent Colon Cancer / Recurrent Rectal Cancer / Stage III Colon Cancer / Stage III Rectal Cancer / Stage IV Rectal Cancer1
3TerminatedTreatmentAdenocarcinoma of the Rectum / Stage II Rectal Cancer / Stage III Rectal Cancer1
3TerminatedTreatmentBiliary Tract Cancer1
3TerminatedTreatmentBreast Cancer2
3TerminatedTreatmentCognitive/Functional Effects / Colorectal Cancers / Neurologic toxicity1
3TerminatedTreatmentColorectal Cancers3
3TerminatedTreatmentEsophageal Squamous Cell Cancer1
3TerminatedTreatmentHead and Neck Carcinoma2
3TerminatedTreatmentLocally Advanced Malignant Neoplasm / Malignant Neoplasm of Pancreas / Pancreatic Carcinoma Non-resectable1
3TerminatedTreatmentMalignant Neoplasm of Stomach1
3TerminatedTreatmentMetastatic Colorectal Cancer (MCRC)1
3TerminatedTreatmentNeoplasms Metastasis / Neoplasms, Pancreatic1
3TerminatedTreatmentNeoplasms, Esophageal / Squamous Cell Cancer1
3TerminatedTreatmentRecurrent Colon Cancer / Recurrent Rectal Cancer / Stage IVA Colon Cancer / Stage IVA Rectal Cancer / Stage IVB Colon Cancer / Stage IVB Rectal Cancer1
3Unknown StatusDiagnosticBreast Cancer1
3Unknown StatusTreatmentBreast Cancer4
3Unknown StatusTreatmentBreast Cancer / Cardiac Toxicity / Perioperative/Postoperative Complications1
3Unknown StatusTreatmentCancer, Anal1
3Unknown StatusTreatmentCarcinoma of Unknown Primary2
3Unknown StatusTreatmentChemoradiation / Nasopharyngeal Carcinoma1
3Unknown StatusTreatmentColorectal Cancers15
3Unknown StatusTreatmentColorectal Cancers / Metastatic Cancers4
3Unknown StatusTreatmentEsophageal Cancers2
3Unknown StatusTreatmentEsophageal Cancers / Malignant Neoplasm of Stomach1
3Unknown StatusTreatmentEsophageal Carcinoma1
3Unknown StatusTreatmentHead and Neck Carcinoma3
3Unknown StatusTreatmentHepatocellular,Carcinoma1
3Unknown StatusTreatmentMalignant Neoplasm of Colon / Metastatic Colorectal Cancer (MCRC) / Rectal Carcinoma1
3Unknown StatusTreatmentMalignant Neoplasm of Pancreas2
3Unknown StatusTreatmentMetastatic Colorectal Cancer (MCRC)1
3Unknown StatusTreatmentNasopharyngeal Carcinoma1
3Unknown StatusTreatmentRectal Carcinoma1
3WithdrawnTreatmentEsophageal Cancers1
3WithdrawnTreatmentHead and Neck Carcinoma2
3WithdrawnTreatmentHead and Neck Carcinoma / Squamous Cell Carcinoma of the Head and Neck (SCCHN)1
3WithdrawnTreatmentLocalized Resectable Adult Primary Liver Cancer / Stage III Childhood Liver Cancer1
3WithdrawnTreatmentNeoplasms, Esophageal1
4Active Not RecruitingHealth Services ResearchMalignant Neoplasm of Colon / Unresectable Metastasis Originating in Colonic Cancer1
4Active Not RecruitingTreatmentActinic Keratosis (AK)1
4Active Not RecruitingTreatmentMalignant Neoplasm of Stomach / Stage IV Colorectal Cancer1
4Active Not RecruitingTreatmentMetastatic Colorectal Cancer (MCRC)1
4Active Not RecruitingTreatmentRecurrent Pterygium1
4CompletedNot AvailableEsophageal Cancers1
4CompletedPreventionBasal Cell Carcinoma (BCC) / Carcinoma NOS / Neoplasms, Basal Cell / Neoplasms, Squamous Cell / Skin Diseases / Skin Neoplasms / Squamous Cell Carcinoma (SCC)1
4CompletedTreatmentActinic Keratosis (AK)2
4CompletedTreatmentColorectal Cancers2
4CompletedTreatmentColorectal Cancers / Neoplasms, Colorectal1
4CompletedTreatmentGlaucoma / Trabeculectomy / Wound Healing1
4CompletedTreatmentMetastatic Colorectal Cancer (MCRC)1
4CompletedTreatmentStage-Ⅱ Colorectal Cancer1
4Not Yet RecruitingTreatmentAnal Tumor / Esophageal Cancers / Malignant Neoplasm of Colon / Malignant Neoplasm of Pancreas / Stomach Tumor1
4Not Yet RecruitingTreatmentPterygium of Conjunctiva and Cornea1
4RecruitingHealth Services ResearchOpen-angle Glaucoma (OAG)1
4RecruitingTreatmentAdenocarcinoma Of Esophagus / Gastric Adenocarcinoma / Stage IIB Gastric Cancer / Stage IIIA Esophageal Adenocarcinoma / Stage IIIA Gastric Cancer / Stage IIIB Esophageal Adenocarcinoma / Stage IIIB Gastric Cancer / Stage IIIC Esophageal Adenocarcinoma / Stage IIIC Gastric Cancer1
4RecruitingTreatmentAdvanced Adult Primary Liver Cancer1
4RecruitingTreatmentNeoplasms, Head and Neck1
4RecruitingTreatmentPhotosensitivity Disorders1
4RecruitingTreatmentSquamous Cell Carcinoma (SCC)1
4TerminatedTreatmentPlantar Warts1
4Unknown StatusTreatmentKeloid Scars1
4Unknown StatusTreatmentNeoplasms Metastasis / Neoplasms, Colorectal / Neoplasms, Hepatic1
Not AvailableActive Not RecruitingNot AvailableColorectal Cancers1
Not AvailableActive Not RecruitingNot AvailableMetastatic Colorectal Cancer (MCRC)1
Not AvailableActive Not RecruitingTreatmentLocalized Pancreas Cancer / Malignant Neoplasm of Pancreas / Non-metastatic Pancreas Cancer1
Not AvailableActive Not RecruitingTreatmentMalignant Neoplasm of Pancreas1
Not AvailableApproved for MarketingNot AvailableHepatocellular,Carcinoma / Injury; Blood Vessel, Hepatic, Artery1
Not AvailableApproved for MarketingNot AvailableMalignant Neoplasm of Pancreas1
Not AvailableCompletedNot AvailableActinic Keratosis (AK)1
Not AvailableCompletedNot AvailableBiomarkers / Chemotherapy Effect / Metastatic Colorectal Cancer (MCRC)1
Not AvailableCompletedNot AvailableCervical Cancers1
Not AvailableCompletedNot AvailableColorectal Cancers1
Not AvailableCompletedNot AvailableHead and Neck Squamous Cell Carcinoma (HNSCC)1
Not AvailableCompletedNot AvailableMetastatic Colorectal Cancer (MCRC)2
Not AvailableCompletedDiagnosticEsophageal Cancers / Malignant Neoplasm of Stomach1
Not AvailableCompletedTreatmentActinic Keratosis (AK)1
Not AvailableCompletedTreatmentBreast Cancer2
Not AvailableCompletedTreatmentColorectal Cancers4
Not AvailableCompletedTreatmentColorectal Cancers / Liver Metastasis1
Not AvailableCompletedTreatmentHead and Neck Carcinoma1
Not AvailableCompletedTreatmentKeratosis / Photo-aging1
Not AvailableCompletedTreatmentMetastatic Colorectal Cancer (MCRC)1
Not AvailableCompletedTreatmentNeoplasms1
Not AvailableCompletedTreatmentStomach Neoplasms1
Not AvailableEnrolling by InvitationNot AvailableTumors, Solid1
Not AvailableNot Yet RecruitingTreatmentAdvanced Gastric Cancer Adenocarcinoma of Esophagogastric Junction1
Not AvailableNot Yet RecruitingTreatmentHepatocellular,Carcinoma / Recurrences1
Not AvailableRecruitingNot AvailableBiliary Tract Cancer / Cancer of the Gallbladder / Colo-rectal Cancer / Esophageal Cancers / Liver Cancer / Malignant Neoplasm of Pancreas / Malignant Neoplasm of Stomach1
Not AvailableRecruitingNot AvailableMalignant Neoplasm of Pancreas / Periampullary Adenocarcinoma / Periampullary Cancer1
Not AvailableRecruitingNot AvailableMetastatic Colorectal Cancer (MCRC)1
Not AvailableRecruitingNot AvailableMetastatic Colorectal Cancer (MCRC) / RAS Wild-type1
Not AvailableRecruitingNot AvailableMetastatic Gastric Cancers1
Not AvailableRecruitingNot AvailablePancreatic Cancer Metastatic1
Not AvailableRecruitingTreatmentCervical Cancers / Uterine Malignancies1
Not AvailableRecruitingTreatmentEsophageal Cancers1
Not AvailableRecruitingTreatmentMalignant Neoplasm of Colon1
Not AvailableRecruitingTreatmentMetastatic Colorectal Cancer (MCRC)1
Not AvailableRecruitingTreatmentNeoplasms1
Not AvailableTerminatedTreatmentNasopharyngeal Neoplasms / Squamous Cell Carcinoma (SCC)1
Not AvailableUnknown StatusNot AvailableHepatocellular,Carcinoma1
Not AvailableUnknown StatusTreatmentBleb1
Not AvailableUnknown StatusTreatmentBreast Cancer2
Not AvailableUnknown StatusTreatmentEsophageal Cancers1
Not AvailableUnknown StatusTreatmentMalignant Neoplasm of Pancreas2
Not AvailableUnknown StatusTreatmentNasopharyngeal Neoplasms1
Not AvailableUnknown StatusTreatmentNasopharyngeal Neoplasms / Squamous Cell Carcinoma (SCC)1
Not AvailableUnknown StatusTreatmentNeoplasms, Esophageal1
Not AvailableUnknown StatusTreatmentPancreatitis,Acute Necrotizing1
Not AvailableWithdrawnTreatmentActinic Keratosis (AK)1
Not AvailableWithdrawnTreatmentBreast Cancer1
Not AvailableWithdrawnTreatmentRecurrent Colon Cancer / Recurrent Rectal Cancer / Stage IVA Colon Cancer / Stage IVA Rectal Cancer / Stage IVB Colon Cancer / Stage IVB Rectal Cancer1


  • Sanofi aventis us llc
  • Valeant pharmaceuticals international
  • Allergan herbert skin care div allergan inc
  • Spear pharmaceuticals inc
  • Taro pharmaceutical industries ltd
  • Pharmacia and upjohn co
  • Teva parenteral medicines inc
  • Abic ltd
  • Abraxis pharmaceutical products
  • App pharmaceuticals llc
  • Bedford laboratories div ben venue laboratories inc
  • Bioniche pharma usa llc
  • Ebewe pharma ges mbh nfg kg
  • Marchar laboratories inc ltd
  • Smith and nephew solopak div smith and nephew
  • Watson laboratories inc
  • Elorac inc
  • Taro pharmaceuticals usa inc
  • Allergan Inc.
  • Amcol Health and Beauty Solutions
  • APP Pharmaceuticals
  • APPD
  • Baxter International Inc.
  • Bigmar Bioren Pharmaceuticals Sa
  • Contract Pharm
  • Creative Cosmetics Inc.
  • Dermik Labs
  • Dispensing Solutions
  • Ebewe Pharma
  • Generamedix Inc.
  • Hospira Inc.
  • Intas Pharmaceuticals Ltd.
  • Legacy Pharmaceuticals Packaging LLC
  • Medisca Inc.
  • Oceanside Pharmaceuticals Incorporated
  • Pharmacia Inc.
  • Physicians Total Care Inc.
  • Sanofi-Aventis Inc.
  • Sicor Pharmaceuticals
  • Solco Healthcare US LLC
  • Spear Dermatology Products Inc.
  • Synerx Pharma LLC
  • Taro Pharmaceuticals USA
  • Teva Pharmaceutical Industries Ltd.
  • Valeant Ltd.
Dosage forms
SolutionIntravenous50 mg
CreamTopical5 mg/1g
CreamTopical2 g/40g
CreamTopical5 %
SolutionTopical0.5 g/10mL
SolutionTopical1.25 g/10mL
CreamTopical10 mg/1g
CreamTopical50 mg/1g
InjectionIntravenous2.5 g/50mL
Injection, solutionIntravenous2.5 g/50mL
Injection, solutionIntravenous5 g/100mL
Injection, solutionIntravenous50 mg/1mL
SolutionTopical20 mg/1mL
SolutionTopical50 mg/1mL
CreamTopical0.04 g/1g
CreamTopical4 %
CreamTopical40 mg/1g
Unit descriptionCostUnit
Efudex 5% Cream 40 gm Tube478.39USD tube
Fluoroplex 1% Cream 30 gm Tube268.61USD tube
Fluorouracil 5% Cream 40 gm Tube249.98USD tube
Carac 0.5% Cream 30 gm Tube209.77USD tube
Efudex 5% Solution 10ml Bottle136.51USD bottle
Fluorouracil 5% Solution 10ml Bottle115.78USD bottle
Fluorouracil 2% Solution 10ml Bottle78.63USD bottle
Efudex 5% cream10.28USD g
Fluorouracil 5% cream9.62USD g
Fluorouracil powder8.45USD g
Fluoroplex 1% cream7.85USD g
Carac cream6.43USD g
Efudex 50 mg/g Cream0.9USD g
Fluorouracil 50 mg/ml Solution0.52USD ml
Adrucil 50 mg/ml vial0.4USD ml
Fluorouracil 5000 mg/100 ml0.28USD ml
DrugBank does not sell nor buy drugs. Pricing information is supplied for informational purposes only.
Patent NumberPediatric ExtensionApprovedExpires (estimated)
Additional Data Available
  • Filed On
    Filed On

    The date on which a patent was filed with the relevant government.

    Learn more


Experimental Properties
melting point (°C)282-283Heidelberger, C. and Duschinsky, R.; US. Patent 2,802,005; August 6, 1957. Heidelberger, C. and Duschinsky, R.; U.S.Patent 2,885,396; May 5, 1959.
water solubility1.11E+004 mg/L (at 22 °C)BURR,A & BUNDGAARD,H (1985)
logP-0.89HANSCH,C ET AL. (1995)
logS-1.07ADME Research, USCD
pKa8.02SANGSTER (1994)
Predicted Properties
Water Solubility5.86 mg/mLALOGPS
pKa (Strongest Acidic)7.76ChemAxon
pKa (Strongest Basic)-8ChemAxon
Physiological Charge0ChemAxon
Hydrogen Acceptor Count2ChemAxon
Hydrogen Donor Count2ChemAxon
Polar Surface Area58.2 Å2ChemAxon
Rotatable Bond Count0ChemAxon
Refractivity26.17 m3·mol-1ChemAxon
Polarizability9.46 Å3ChemAxon
Number of Rings1ChemAxon
Rule of FiveYesChemAxon
Ghose FilterNoChemAxon
Veber's RuleNoChemAxon
MDDR-like RuleNoChemAxon
Predicted ADMET features
Human Intestinal Absorption+0.9605
Blood Brain Barrier+0.9791
Caco-2 permeable-0.7583
P-glycoprotein substrateNon-substrate0.7752
P-glycoprotein inhibitor INon-inhibitor0.8991
P-glycoprotein inhibitor IINon-inhibitor1.0
Renal organic cation transporterNon-inhibitor0.9053
CYP450 2C9 substrateNon-substrate0.7898
CYP450 2D6 substrateNon-substrate0.9116
CYP450 3A4 substrateNon-substrate0.7558
CYP450 1A2 substrateNon-inhibitor0.9045
CYP450 2C9 inhibitorNon-inhibitor0.9658
CYP450 2D6 inhibitorNon-inhibitor0.9361
CYP450 2C19 inhibitorNon-inhibitor0.9688
CYP450 3A4 inhibitorNon-inhibitor0.9661
CYP450 inhibitory promiscuityLow CYP Inhibitory Promiscuity0.9839
Ames testNon AMES toxic0.8941
BiodegradationNot ready biodegradable0.922
Rat acute toxicity2.2529 LD50, mol/kg Not applicable
hERG inhibition (predictor I)Weak inhibitor0.9685
hERG inhibition (predictor II)Non-inhibitor0.9325
ADMET data is predicted using admetSAR, a free tool for evaluating chemical ADMET properties. (23092397)


Mass Spec (NIST)
Download (7.93 KB)
SpectrumSpectrum TypeSplash Key
Predicted GC-MS Spectrum - GC-MSPredicted GC-MSNot Available
GC-MS Spectrum - EI-BGC-MSsplash10-001i-9800000000-a3301f9fea9145d07480
GC-MS Spectrum - CI-BGC-MSsplash10-001i-0900000000-76691bd3cba2765d3687
GC-MS Spectrum - CI-BGC-MSsplash10-001i-0900000000-d801d8209e9a5aa4830b
GC-MS Spectrum - CI-BGC-MSsplash10-0002-0900000000-7521695ae4a96b4a5a98
Mass Spectrum (Electron Ionization)MSsplash10-001i-9400000000-b8247c8f5c45b12efaa6
Predicted MS/MS Spectrum - 10V, Positive (Annotated)Predicted LC-MS/MSsplash10-001i-1900000000-3fa9b91447db7dc7ba77
Predicted MS/MS Spectrum - 20V, Positive (Annotated)Predicted LC-MS/MSsplash10-01q9-9800000000-32bf878787078ce9d817
Predicted MS/MS Spectrum - 40V, Positive (Annotated)Predicted LC-MS/MSsplash10-03di-9000000000-3ef559051a5b99c94b29
Predicted MS/MS Spectrum - 10V, Negative (Annotated)Predicted LC-MS/MSsplash10-004i-4900000000-82764fbca3290816328d
Predicted MS/MS Spectrum - 20V, Negative (Annotated)Predicted LC-MS/MSsplash10-000f-9100000000-2da5eb3c925c027b5022
Predicted MS/MS Spectrum - 40V, Negative (Annotated)Predicted LC-MS/MSsplash10-0006-9000000000-1cf432837297c55833a5
LC-MS/MS Spectrum - LC-ESI-ITFT , negativeLC-MS/MSsplash10-004i-0900000000-c639ed1b5365f368b59c
LC-MS/MS Spectrum - LC-ESI-ITFT , negativeLC-MS/MSsplash10-004i-0900000000-1a7a70df49a360e1458c
LC-MS/MS Spectrum - LC-ESI-ITFT , negativeLC-MS/MSsplash10-004i-0900000000-d89f2d944fe1cac39f55
LC-MS/MS Spectrum - LC-ESI-ITFT , negativeLC-MS/MSsplash10-004i-0900000000-50b33770c08680863cf6
LC-MS/MS Spectrum - LC-ESI-ITFT , negativeLC-MS/MSsplash10-004i-0900000000-cd5bef421a05073cb1f3
LC-MS/MS Spectrum - LC-ESI-ITFT , negativeLC-MS/MSsplash10-004i-3900000000-ec9c9e1dfc9a16f625a2
LC-MS/MS Spectrum - LC-ESI-ITFT , negativeLC-MS/MSsplash10-004i-0900000000-df98a4532ca49a0a0436
LC-MS/MS Spectrum - LC-ESI-ITFT , negativeLC-MS/MSsplash10-004i-0900000000-50b33770c08680863cf6
LC-MS/MS Spectrum - LC-ESI-ITFT , negativeLC-MS/MSsplash10-004i-0900000000-50b33770c08680863cf6
LC-MS/MS Spectrum - LC-ESI-ITFT , negativeLC-MS/MSsplash10-004i-0900000000-df98a4532ca49a0a0436
LC-MS/MS Spectrum - LC-ESI-ITFT , negativeLC-MS/MSsplash10-004i-0900000000-b117f5fa58c8f98b5c15
LC-MS/MS Spectrum - LC-ESI-ITFT , negativeLC-MS/MSsplash10-0a4i-9000000000-f3e71a41b6d4417d33fd
LC-MS/MS Spectrum - LC-ESI-ITFT , positiveLC-MS/MSsplash10-001i-9200000000-29362607b7c48b82973c
LC-MS/MS Spectrum - LC-ESI-ITFT , positiveLC-MS/MSsplash10-001i-0900000000-693d492f316b0c7d5ed5
LC-MS/MS Spectrum - LC-ESI-ITFT , positiveLC-MS/MSsplash10-001i-1900000000-0c0ee9469bf49688c5d2
LC-MS/MS Spectrum - LC-ESI-ITFT , positiveLC-MS/MSsplash10-001i-1900000000-0cecca0d265e958e19d7
LC-MS/MS Spectrum - LC-ESI-ITFT , positiveLC-MS/MSsplash10-03e9-1900000000-46f20f71dbc96630cee7
LC-MS/MS Spectrum - LC-ESI-ITFT , positiveLC-MS/MSsplash10-03di-1900000000-4330f38956afe6c47636
LC-MS/MS Spectrum - LC-ESI-ITFT , positiveLC-MS/MSsplash10-03di-2900000000-f935071622b89177697b
LC-MS/MS Spectrum - LC-ESI-ITFT , positiveLC-MS/MSsplash10-001i-1900000000-0c8117152496e5ab5079
LC-MS/MS Spectrum - LC-ESI-ITFT , positiveLC-MS/MSsplash10-001i-2900000000-266589a25e715aef690b
LC-MS/MS Spectrum - LC-ESI-ITFT , positiveLC-MS/MSsplash10-001i-2900000000-7e7fde9573014635482d
LC-MS/MS Spectrum - LC-ESI-ITFT , positiveLC-MS/MSsplash10-01q9-3900000000-50eaff02ec3eceb8cb1c
LC-MS/MS Spectrum - LC-ESI-ITFT , positiveLC-MS/MSsplash10-03di-2900000000-09de643cc91751ca7a60
LC-MS/MS Spectrum - LC-ESI-ITFT , positiveLC-MS/MSsplash10-03di-4900000000-7904c5572d0bc60f8d35
LC-MS/MS Spectrum - LC-ESI-ITFT , positiveLC-MS/MSsplash10-001i-9000000000-a0c3963f64cbd8167800
1H NMR Spectrum1D NMRNot Applicable


This compound belongs to the class of organic compounds known as halopyrimidines. These are aromatic compounds containing a halogen atom linked to a pyrimidine ring. Pyrimidine is a 6-membered ring consisting of four carbon atoms and two nitrogen centers at the 1- and 3- ring positions.
Organic compounds
Super Class
Organoheterocyclic compounds
Sub Class
Pyrimidines and pyrimidine derivatives
Direct Parent
Alternative Parents
Hydroxypyrimidines / Aryl fluorides / Heteroaromatic compounds / Azacyclic compounds / Organopnictogen compounds / Organooxygen compounds / Organonitrogen compounds / Organofluorides / Hydrocarbon derivatives
Hydroxypyrimidine / Halopyrimidine / Aryl halide / Aryl fluoride / Heteroaromatic compound / Azacycle / Organic nitrogen compound / Organic oxygen compound / Organopnictogen compound / Hydrocarbon derivative
Molecular Framework
Aromatic heteromonocyclic compounds
External Descriptors
organofluorine compound, nucleobase analogue (CHEBI:46345) / a uracil analogue (CPD0-1327)


Pharmacological action
General Function
Thymidylate synthase activity
Specific Function
Contributes to the de novo mitochondrial thymidylate biosynthesis pathway.
Gene Name
Uniprot ID
Uniprot Name
Thymidylate synthase
Molecular Weight
35715.65 Da
  1. Formentini A, Sander S, Denzer S, Straeter J, Henne-Bruns D, Kornmann M: Thymidylate synthase expression in resectable and unresectable pancreatic cancer: role as predictive or prognostic marker? Int J Colorectal Dis. 2007 Jan;22(1):49-55. Epub 2006 Mar 15. [PubMed:16538493]
  2. Huang CL, Yokomise H, Fukushima M, Kinoshita M: Tailor-made chemotherapy for non-small cell lung cancer patients. Future Oncol. 2006 Apr;2(2):289-99. [PubMed:16563096]
  3. Fernandez-Contreras ME, Sanchez-Prudencio S, Sanchez-Hernandez JJ, Garcia de Paredes ML, Gisbert JP, Roda-Navarro P, Gamallo C: Thymidylate synthase expression pattern, expression level and single nucleotide polymorphism are predictors for disease-free survival in patients of colorectal cancer treated with 5-fluorouracil. Int J Oncol. 2006 May;28(5):1303-10. [PubMed:16596248]
  4. Garcia V, Garcia JM, Pena C, Silva J, Dominguez G, Hurtado A, Alonso I, Rodriguez R, Provencio M, Bonilla F: Thymidylate synthase messenger RNA expression in plasma from patients with colon cancer: prognostic potential. Clin Cancer Res. 2006 Apr 1;12(7 Pt 1):2095-100. [PubMed:16609021]
  5. Ploylearmsaeng SA, Fuhr U, Jetter A: How may anticancer chemotherapy with fluorouracil be individualised? Clin Pharmacokinet. 2006;45(6):567-92. [PubMed:16719540]
  6. Chen X, Ji ZL, Chen YZ: TTD: Therapeutic Target Database. Nucleic Acids Res. 2002 Jan 1;30(1):412-5. [PubMed:11752352]
  7. Rustum YM: Thymidylate synthase: a critical target in cancer therapy? Front Biosci. 2004 Sep 1;9:2467-73. [PubMed:15353299]
  8. Singh V, Brecik M, Mukherjee R, Evans JC, Svetlikova Z, Blasko J, Surade S, Blackburn J, Warner DF, Mikusova K, Mizrahi V: The complex mechanism of antimycobacterial action of 5-fluorouracil. Chem Biol. 2015 Jan 22;22(1):63-75. doi: 10.1016/j.chembiol.2014.11.006. Epub 2014 Dec 24. [PubMed:25544046]
Pharmacological action
Incorporation into and destabilization
DNA is the molecule of heredity, as it is responsible for the genetic propagation of most inherited traits. It is a polynucleic acid that carries genetic information on cell growth, division, and function. DNA consists of two long strands of nucleotides twisted into a double helix and held together by hydrogen bonds. The sequence of nucleotides determines hereditary characteristics. Each strand serves as the template for subsequent DNA replication and as a template for mRNA production, leading to protein synthesis via ribosomes.
  1. Wyatt MD, Wilson DM 3rd: Participation of DNA repair in the response to 5-fluorouracil. Cell Mol Life Sci. 2009 Mar;66(5):788-99. doi: 10.1007/s00018-008-8557-5. [PubMed:18979208]
  2. Ghoshal K, Jacob ST: An alternative molecular mechanism of action of 5-fluorouracil, a potent anticancer drug. Biochem Pharmacol. 1997 Jun 1;53(11):1569-75. [PubMed:9264308]
  3. Longley DB, Harkin DP, Johnston PG: 5-fluorouracil: mechanisms of action and clinical strategies. Nat Rev Cancer. 2003 May;3(5):330-8. [PubMed:12724731]
  4. Petty RD, Cassidy J: Novel fluoropyrimidines: improving the efficacy and tolerability of cytotoxic therapy. Curr Cancer Drug Targets. 2004 Mar;4(2):191-204. [PubMed:15032669]
  5. Singh V, Brecik M, Mukherjee R, Evans JC, Svetlikova Z, Blasko J, Surade S, Blackburn J, Warner DF, Mikusova K, Mizrahi V: The complex mechanism of antimycobacterial action of 5-fluorouracil. Chem Biol. 2015 Jan 22;22(1):63-75. doi: 10.1016/j.chembiol.2014.11.006. Epub 2014 Dec 24. [PubMed:25544046]
Pharmacological action
Incorporation into and destabilization
  1. Wyatt MD, Wilson DM 3rd: Participation of DNA repair in the response to 5-fluorouracil. Cell Mol Life Sci. 2009 Mar;66(5):788-99. doi: 10.1007/s00018-008-8557-5. [PubMed:18979208]
  2. Ghoshal K, Jacob ST: An alternative molecular mechanism of action of 5-fluorouracil, a potent anticancer drug. Biochem Pharmacol. 1997 Jun 1;53(11):1569-75. [PubMed:9264308]
  3. Longley DB, Harkin DP, Johnston PG: 5-fluorouracil: mechanisms of action and clinical strategies. Nat Rev Cancer. 2003 May;3(5):330-8. [PubMed:12724731]
  4. Petty RD, Cassidy J: Novel fluoropyrimidines: improving the efficacy and tolerability of cytotoxic therapy. Curr Cancer Drug Targets. 2004 Mar;4(2):191-204. [PubMed:15032669]
  5. Singh V, Brecik M, Mukherjee R, Evans JC, Svetlikova Z, Blasko J, Surade S, Blackburn J, Warner DF, Mikusova K, Mizrahi V: The complex mechanism of antimycobacterial action of 5-fluorouracil. Chem Biol. 2015 Jan 22;22(1):63-75. doi: 10.1016/j.chembiol.2014.11.006. Epub 2014 Dec 24. [PubMed:25544046]


Pharmacological action
General Function
Steroid hydroxylase activity
Specific Function
Cytochromes P450 are a group of heme-thiolate monooxygenases. In liver microsomes, this enzyme is involved in an NADPH-dependent electron transport pathway. It oxidizes a variety of structurally un...
Gene Name
Uniprot ID
Uniprot Name
Cytochrome P450 2C9
Molecular Weight
55627.365 Da
  1. Gunes A, Coskun U, Boruban C, Gunel N, Babaoglu MO, Sencan O, Bozkurt A, Rane A, Hassan M, Zengil H, Yasar U: Inhibitory effect of 5-fluorouracil on cytochrome P450 2C9 activity in cancer patients. Basic Clin Pharmacol Toxicol. 2006 Feb;98(2):197-200. doi: 10.1111/j.1742-7843.2006.pto_304.x. [PubMed:16445595]
  2. Brown MC: An adverse interaction between warfarin and 5-fluorouracil: A case report and review of the literature. Chemotherapy. 1999 Sep-Oct;45(5):392-5. doi: 10.1159/000007230. [PubMed:10473927]
  3. Gilbar PJ, Brodribb TR: Phenytoin and fluorouracil interaction. Ann Pharmacother. 2001 Nov;35(11):1367-70. doi: 10.1345/aph.1A051. [PubMed:11724084]
  4. Karadag O, Babaoglu MO, Altundag K, Elkiran T, Yasar U, Bozkurt A: 5-Fluorouracil-induced coronary spasm: may inhibition of hyperpolarization factors produced by CYP2C enzymes be the cause? Oncology. 2004;66(6):510-1. doi: 10.1159/000079506. [PubMed:15452381]
Pharmacological action
Curator comments
Data is limited to a in vitro study.
General Function
Oxidoreductase activity, acting on paired donors, with incorporation or reduction of molecular oxygen, reduced flavin or flavoprotein as one donor, and incorporation of one atom of oxygen
Specific Function
Cytochromes P450 are a group of heme-thiolate monooxygenases. In liver microsomes, this enzyme is involved in an NADPH-dependent electron transport pathway. It oxidizes a variety of structurally un...
Gene Name
Uniprot ID
Uniprot Name
Cytochrome P450 1A2
Molecular Weight
58293.76 Da
  1. Komatsu T, Yamazaki H, Shimada N, Nakajima M, Yokoi T: Roles of cytochromes P450 1A2, 2A6, and 2C8 in 5-fluorouracil formation from tegafur, an anticancer prodrug, in human liver microsomes. Drug Metab Dispos. 2000 Dec;28(12):1457-63. [PubMed:11095583]
  2. Yamazaki H, Komatsu T, Takemoto K, Shimada N, Nakajima M, Yokoi T: Rat cytochrome p450 1A and 3A enzymes involved in bioactivation of tegafur to 5-fluorouracil and autoinduced by tegafur in liver microsomes. Drug Metab Dispos. 2001 Jun;29(6):794-7. [PubMed:11353746]
Pharmacological action
General Function
Transferase activity, transferring pentosyl groups
Specific Function
May have a role in maintaining the integrity of the blood vessels. Has growth promoting activity on endothelial cells, angiogenic activity in vivo and chemotactic activity on endothelial cells in v...
Gene Name
Uniprot ID
Uniprot Name
Thymidine phosphorylase
Molecular Weight
49954.965 Da
  1. Scartozzi M, Maccaroni E, Giampieri R, Pistelli M, Bittoni A, Del Prete M, Berardi R, Cascinu S: 5-Fluorouracil pharmacogenomics: still rocking after all these years? Pharmacogenomics. 2011 Feb;12(2):251-65. doi: 10.2217/pgs.10.167. [PubMed:21332317]
Pharmacological action
General Function
Protein homodimerization activity
Specific Function
Involved in pyrimidine base degradation. Catalyzes the reduction of uracil and thymine. Also involved the degradation of the chemotherapeutic drug 5-fluorouracil.
Gene Name
Uniprot ID
Uniprot Name
Dihydropyrimidine dehydrogenase [NADP(+)]
Molecular Weight
111400.32 Da
  1. Ho DH, Townsend L, Luna MA, Bodey GP: Distribution and inhibition of dihydrouracil dehydrogenase activities in human tissues using 5-fluorouracil as a substrate. Anticancer Res. 1986 Jul-Aug;6(4):781-4. [PubMed:3752956]
  2. Keizer HJ, De Bruijn EA, Tjaden UR, De Clercq E: Inhibition of fluorouracil catabolism in cancer patients by the antiviral agent (E)-5-(2-bromovinyl)-2'-deoxyuridine. J Cancer Res Clin Oncol. 1994;120(9):545-9. [PubMed:8045919]
Pharmacological action
General Function
Uridine phosphorylase activity
Specific Function
Catalyzes the reversible phosphorylytic cleavage of uridine and deoxyuridine to uracil and ribose- or deoxyribose-1-phosphate (PubMed:7488099). The produced molecules are then utilized as carbon an...
Gene Name
Uniprot ID
Uniprot Name
Uridine phosphorylase 1
Molecular Weight
33934.005 Da
  1. Yan R, Wan L, Pizzorno G, Cao D: Uridine phosphorylase in breast cancer: a new prognostic factor? Front Biosci. 2006 Sep 1;11:2759-66. [PubMed:16720348]
Pharmacological action
General Function
Uridine phosphorylase activity
Specific Function
Catalyzes the reversible phosphorylytic cleavage of uridine and deoxyuridine to uracil and ribose- or deoxyribose-1-phosphate. The produced molecules are then utilized as carbon and energy sources ...
Gene Name
Uniprot ID
Uniprot Name
Uridine phosphorylase 2
Molecular Weight
35526.93 Da
  1. Yan R, Wan L, Pizzorno G, Cao D: Uridine phosphorylase in breast cancer: a new prognostic factor? Front Biosci. 2006 Sep 1;11:2759-66. [PubMed:16720348]
Pharmacological action
General Function
Steroid hydroxylase activity
Specific Function
Exhibits a high coumarin 7-hydroxylase activity. Can act in the hydroxylation of the anti-cancer drugs cyclophosphamide and ifosphamide. Competent in the metabolic activation of aflatoxin B1. Const...
Gene Name
Uniprot ID
Uniprot Name
Cytochrome P450 2A6
Molecular Weight
56501.005 Da
  1. Yamamiya I, Yoshisue K, Ishii Y, Yamada H, Yoshida K: Enantioselectivity in the cytochrome P450-dependent conversion of tegafur to 5-fluorouracil in human liver microsomes. Pharmacol Res Perspect. 2013 Oct;1(1):e00009. doi: 10.1002/prp2.9. Epub 2013 Oct 23. [PubMed:25505563]
Pharmacological action
General Function
Steroid hydroxylase activity
Specific Function
Cytochromes P450 are a group of heme-thiolate monooxygenases. In liver microsomes, this enzyme is involved in an NADPH-dependent electron transport pathway. It oxidizes a variety of structurally un...
Gene Name
Uniprot ID
Uniprot Name
Cytochrome P450 2C8
Molecular Weight
55824.275 Da
  1. Komatsu T, Yamazaki H, Shimada N, Nakajima M, Yokoi T: Roles of cytochromes P450 1A2, 2A6, and 2C8 in 5-fluorouracil formation from tegafur, an anticancer prodrug, in human liver microsomes. Drug Metab Dispos. 2000 Dec;28(12):1457-63. [PubMed:11095583]
Pharmacological action
General Function
Protein complex binding
Specific Function
Catalyzes the conversion of 5,10-methylenetetrahydrofolate to 5-methyltetrahydrofolate, a co-substrate for homocysteine remethylation to methionine.
Gene Name
Uniprot ID
Uniprot Name
Methylenetetrahydrofolate reductase
Molecular Weight
74595.895 Da
  1. Scartozzi M, Maccaroni E, Giampieri R, Pistelli M, Bittoni A, Del Prete M, Berardi R, Cascinu S: 5-Fluorouracil pharmacogenomics: still rocking after all these years? Pharmacogenomics. 2011 Feb;12(2):251-65. doi: 10.2217/pgs.10.167. [PubMed:21332317]
Pharmacological action
General Function
Thymidylate synthase activity
Specific Function
Contributes to the de novo mitochondrial thymidylate biosynthesis pathway.
Gene Name
Uniprot ID
Uniprot Name
Thymidylate synthase
Molecular Weight
35715.65 Da
  1. Scartozzi M, Maccaroni E, Giampieri R, Pistelli M, Bittoni A, Del Prete M, Berardi R, Cascinu S: 5-Fluorouracil pharmacogenomics: still rocking after all these years? Pharmacogenomics. 2011 Feb;12(2):251-65. doi: 10.2217/pgs.10.167. [PubMed:21332317]
Pharmacological action
General Function
Orotidine-5'-phosphate decarboxylase activity
Specific Function
Not Available
Gene Name
Uniprot ID
Uniprot Name
Uridine 5'-monophosphate synthase
Molecular Weight
52221.075 Da
  1. Link [Link]
Pharmacological action
General Function
Metal ion binding
Specific Function
Not Available
Gene Name
Uniprot ID
Uniprot Name
Molecular Weight
57398.52 Da
  1. Link [Link]


Pharmacological action
General Function
Toxic substance binding
Specific Function
Serum albumin, the main protein of plasma, has a good binding capacity for water, Ca(2+), Na(+), K(+), fatty acids, hormones, bilirubin and drugs. Its main function is the regulation of the colloid...
Gene Name
Uniprot ID
Uniprot Name
Serum albumin
Molecular Weight
69365.94 Da
  1. Sulkowska A, Bojko B, Rownicka J, Sulkowski W: Competition of drugs to serum albumin in combination therapy. Biopolymers. 2004 Jun 15;74(3):256-62. [PubMed:15150801]
  2. Bertucci C, Ascoli G, Uccello-Barretta G, Di Bari L, Salvadori P: The binding of 5-fluorouracil to native and modified human serum albumin: UV, CD, and 1H and 19F NMR investigation. J Pharm Biomed Anal. 1995 Aug;13(9):1087-93. [PubMed:8573632]
Pharmacological action
General Function
Serine-type endopeptidase inhibitor activity
Specific Function
Major thyroid hormone transport protein in serum.
Gene Name
Uniprot ID
Uniprot Name
Thyroxine-binding globulin
Molecular Weight
46324.12 Da
  1. CYTOMEL (liothyronine) FDA label [File]


Pharmacological action
General Function
Sodium-independent organic anion transmembrane transporter activity
Specific Function
Mediates sodium-independent multispecific organic anion transport. Transport of prostaglandin E2, prostaglandin F2, tetracycline, bumetanide, estrone sulfate, glutarate, dehydroepiandrosterone sulf...
Gene Name
Uniprot ID
Uniprot Name
Solute carrier family 22 member 7
Molecular Weight
60025.025 Da
  1. Kobayashi Y, Ohshiro N, Sakai R, Ohbayashi M, Kohyama N, Yamamoto T: Transport mechanism and substrate specificity of human organic anion transporter 2 (hOat2 [SLC22A7]). J Pharm Pharmacol. 2005 May;57(5):573-8. [PubMed:15901346]
Pharmacological action
General Function
Nucleoside transmembrane transporter activity
Specific Function
Mediates both influx and efflux of nucleosides across the membrane (equilibrative transporter). It is sensitive (ES) to low concentrations of the inhibitor nitrobenzylmercaptopurine riboside (NBMPR...
Gene Name
Uniprot ID
Uniprot Name
Equilibrative nucleoside transporter 1
Molecular Weight
50218.805 Da
  1. Tsujie M, Nakamori S, Nakahira S, Takahashi Y, Hayashi N, Okami J, Nagano H, Dono K, Umeshita K, Sakon M, Monden M: Human equilibrative nucleoside transporter 1, as a predictor of 5-fluorouracil resistance in human pancreatic cancer. Anticancer Res. 2007 Jul-Aug;27(4B):2241-9. [PubMed:17695509]
Pharmacological action
General Function
Xenobiotic-transporting atpase activity
Specific Function
High-capacity urate exporter functioning in both renal and extrarenal urate excretion. Plays a role in porphyrin homeostasis as it is able to mediates the export of protoporhyrin IX (PPIX) both fro...
Gene Name
Uniprot ID
Uniprot Name
ATP-binding cassette sub-family G member 2
Molecular Weight
72313.47 Da
  1. Yuan J, Lv H, Peng B, Wang C, Yu Y, He Z: Role of BCRP as a biomarker for predicting resistance to 5-fluorouracil in breast cancer. Cancer Chemother Pharmacol. 2009 May;63(6):1103-10. doi: 10.1007/s00280-008-0838-z. Epub 2008 Sep 27. [PubMed:18820913]
Pharmacological action
General Function
Organic anion transmembrane transporter activity
Specific Function
May act as an inducible transporter in the biliary and intestinal excretion of organic anions. Acts as an alternative route for the export of bile acids and glucuronides from cholestatic hepatocyte...
Gene Name
Uniprot ID
Uniprot Name
Canalicular multispecific organic anion transporter 2
Molecular Weight
169341.14 Da
  1. Hagmann W, Jesnowski R, Faissner R, Guo C, Lohr JM: ATP-binding cassette C transporters in human pancreatic carcinoma cell lines. Upregulation in 5-fluorouracil-resistant cells. Pancreatology. 2009;9(1-2):136-44. doi: 10.1159/000178884. Epub 2008 Dec 13. [PubMed:19077464]
Pharmacological action
General Function
Atpase activity, coupled to transmembrane movement of substances
Specific Function
May be an organic anion pump relevant to cellular detoxification.
Gene Name
Uniprot ID
Uniprot Name
Multidrug resistance-associated protein 4
Molecular Weight
149525.33 Da
  1. Hagmann W, Jesnowski R, Faissner R, Guo C, Lohr JM: ATP-binding cassette C transporters in human pancreatic carcinoma cell lines. Upregulation in 5-fluorouracil-resistant cells. Pancreatology. 2009;9(1-2):136-44. doi: 10.1159/000178884. Epub 2008 Dec 13. [PubMed:19077464]
Pharmacological action
General Function
Organic anion transmembrane transporter activity
Specific Function
Acts as a multispecific organic anion pump which can transport nucleotide analogs.
Gene Name
Uniprot ID
Uniprot Name
Multidrug resistance-associated protein 5
Molecular Weight
160658.8 Da
  1. Hagmann W, Jesnowski R, Faissner R, Guo C, Lohr JM: ATP-binding cassette C transporters in human pancreatic carcinoma cell lines. Upregulation in 5-fluorouracil-resistant cells. Pancreatology. 2009;9(1-2):136-44. doi: 10.1159/000178884. Epub 2008 Dec 13. [PubMed:19077464]

Drug created on June 13, 2005 07:24 / Updated on March 30, 2020 00:49

Logo pink
Are you a
new drug developer?
Contact us to learn more about our customized products and solutions.
Logo pink
Stay in the know!
As part of our commitment to providing the most up-to-date drug information, we will be releasing #DrugBankUpdates with our newly added curated drug pages.