
Accession Number
DB00672  (APRD00029)
Small Molecule
Approved, Investigational

Chlorpropamide is an oral antihyperglycemic agent used for the treatment of non-insulin-dependent diabetes mellitus (NIDDM). It belongs to the sulfonylurea class of insulin secretagogues, which act by stimulating β cells of the pancreas to release insulin. Sulfonylureas increase both basal insulin secretion and meal-stimulated insulin release. Medications in this class differ in their dose, rate of absorption, duration of action, route of elimination and binding site on their target pancreatic β cell receptor. Sulfonylureas also increase peripheral glucose utilization, decrease hepatic gluconeogenesis and may increase the number and sensitivity of insulin receptors. Sulfonylureas are associated with weight gain, though less so than insulin. Due to their mechanism of action, sulfonylureas may cause hypoglycemia and require consistent food intake to decrease this risk. The risk of hypoglycemia is increased in elderly, debilitated and malnourished individuals. Chlorpropamide is not recommended for the treatment of NIDDM as it increases blood pressure and the risk of retinopathy (UKPDS-33). Up to 80% of the single oral dose of chlorpropramide is metabolized, likely in the liver; 80-90% of the dose is excreted in urine as unchanged drug and metabolites. Renal and hepatic dysfunction may increase the risk of hypoglycemia.

  • 1-(p-chlorobenzenesulfonyl)-3-propylurea
  • 1-(p-chlorophenylsulfonyl)-3-propylurea
  • 1-propyl-3-(p-chlorobenzenesulfonyl)urea
  • 4-chloro-N-((propylamino)carbonyl)benzenesulfonamide
  • 4-chloro-N-[(propylamino)carbonyl]benzenesulfonamide
  • Chlorpropamid
  • Chlorpropamide
  • Chlorpropamidum
  • Clorpropamida
  • N-(4-chlorophenylsulfonyl)-N'-propylurea
  • N-(p-chlorobenzenesulfonyl)-N'-propylurea
  • n-propyl-N'-(p-chlorobenzenesulfonyl)urea
  • n-propyl-N'-p-chlorophenylsulfonylcarbamide
External IDs
Hoechst 18810 / P 607 / U 9818
Prescription Products
NameDosageStrengthRouteLabellerMarketing StartMarketing End
Apo Chlorpropamide Tab 100mgTablet100 mgOralApotex Corporation1977-12-31Not applicableCanada
Apo Chlorpropamide Tab 250mgTablet250 mgOralApotex Corporation1974-12-31Not applicableCanada
Chlorpropamide 100 Tab USPTablet100 mgOralPro Doc Limitee1983-12-312009-07-23Canada
Chlorpropamide Tab 250mgTablet250 mgOralDuchesnay Inc.1978-12-312003-07-18Canada
Chlorpropamide Tab 250mgTablet250 mgOralPro Doc Limitee1969-12-312009-07-23Canada
DiabineseTablet100 mg/1OralPfizer Laboratories Div Pfizer Inc.1958-10-282008-01-01Us
DiabineseTablet250 mg/1OralPfizer Laboratories Div Pfizer Inc.1958-10-282008-01-01Us
Diabinese Tab 100mgTablet100 mgOralPfizer1958-12-312000-10-18Canada
Diabinese Tab 250mgTablet250 mgOralPfizer1958-12-312000-07-26Canada
Generic Prescription Products
NameDosageStrengthRouteLabellerMarketing StartMarketing End
ChlorpropamideTablet100 mg/1OralMylan Pharmaceuticals Inc.1984-06-01Not applicableUs
ChlorpropamideTablet100 mg/1OralPliva, Inc.1990-09-302009-01-31Us
ChlorpropamideTablet100 mg/1OralPhysicians Total Care, Inc.1994-11-042012-06-30Us
ChlorpropamideTablet250 mg/1OralPD-Rx Pharmaceuticals, Inc.1984-06-01Not applicableUs
ChlorpropamideTablet250 mg/1OralPhysicians Total Care, Inc.1993-04-262012-06-30Us
ChlorpropamideTablet250 mg/1OralMylan Pharmaceuticals Inc.1984-06-01Not applicableUs
ChlorpropamideTablet250 mg/1OralPliva, Inc.1990-09-302010-03-31Us
Novo-propamide 250mgTablet250 mgOralNovopharm Limited1969-12-312010-09-10Canada
International/Other Brands
Abemide (Kobayashi Kako) / Chloronase (Hoechst) / Dabinese (Pfizer) / Diabeedol (Sriprasit Dispensary) / Diabemide (Guidotti) / Diabezin (Prince) / Diabinese (Pfizer) / Diabitex (Plantex-Ikapharm) / Dibecon (Pharmasant) / Glycemin (Siam Bheasach) / Hypomide (Aspen Pharmacare) / Litangen (Ming Ta) / Propamide (Atlantic) / Trane (Omega)
CAS number
Average: 276.74
Monoisotopic: 276.033540689
Chemical Formula
InChI Key



For treatment of NIDDM in conjunction with diet and exercise.

Associated Conditions

Chlorpropamide, a second-generation sulfonylurea antidiabetic agent, is used with diet to lower blood glucose levels in patients with diabetes mellitus type II. Chlorpropamide is twice as potent as the related second-generation agent glipizide.

Mechanism of action

Sulfonylureas such as chlorpropamide bind to ATP-sensitive potassium channels on the pancreatic cell surface, reducing potassium conductance and causing depolarization of the membrane. Depolarization stimulates calcium ion influx through voltage-sensitive calcium channels, raising intracellular concentrations of calcium ions, which induces the secretion, or exocytosis, of insulin.

AATP-binding cassette sub-family C member 8

Readily absorbed from the GI tract. Peak plasma concentrations occur within 2-4 hours and the onset of action occurs within one hour. The maximal effect of chlorpropamide is seen 3-6 hours following oral administration.

Volume of distribution
Not Available
Protein binding

Highly bound to plasma proteins.


Up to 80% of dose is metabolized likely through the liver to to 2-hydroxylchlorpropamide (2-OH CPA), p-chlorobenzenesulfonylurea (CBSU), 3-hydroxylchlorpropamide (3-OH CPA), and p-chlorobenzenesulfonamide (CBSA); CBSA may be produced by decomposition in urine. It is unknown whether chlorpropamide metabolites exert hypoglycemic effects.

Route of elimination

80-90% of a single oral dose is excreted in the urine as unchaged drug and metabolites within 96 hours.

Half life

Approximately 36 hours with interindividual variation ranging from 25-60 hours. Duration of effect persists for at least 24 hours.

Not Available

IPN-RAT LD50 580 mg/kg

Affected organisms
  • Humans and other mammals
Not Available
Pharmacogenomic Effects/ADRs
Interacting Gene/EnzymeAllele nameGenotype(s)Defining Change(s)Type(s)DescriptionDetails
Glucose-6-phosphate 1-dehydrogenaseVilleurbanneNot Available1000_1002delACCADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseTorunNot Available1006A->GADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseSunderlandNot Available105_107delCATADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseIwatsukiNot Available1081G->AADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseSerresNot Available1082C->TADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseTondelaNot Available1084_1101delCTGAACGAGCGCAAGGCCADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseLoma LindaNot Available1089C->AADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseAachenNot Available1089C->GADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseTenriNot Available1096A->GADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseMontpellierNot Available1132G>AADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseCalvo MackennaNot Available1138A->GADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseRileyNot Available1139T->CADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseOlomoucNot Available1141T->CADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseTomahNot Available1153T->CADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseLynwoodNot Available1154G->TADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseMadridNot Available1155C->GADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseIowa, Walter Reed, SpringfieldNot Available1156A->GADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseBeverly Hills, Genova, Iwate, Niigata, YamaguchiNot Available1160G->AADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseHartfordNot Available1162A->GADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenasePrahaNot Available1166A->GADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseKrakowNot Available1175T>CADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseWisconsinNot Available1177C->GADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseNashville, Anaheim, PorticiNot Available1178G->AADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseAlhambraNot Available1180G->CADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseBariNot Available1187C->TADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenasePuerto LimonNot Available1192G->AADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseCovao do LoboNot Available1205C>AADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseClinicNot Available1215G->AADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseUtrechtNot Available1225C->TADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseSuwalkiNot Available1226C->GADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseRiversideNot Available1228G->TADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseJapan, ShinagawaNot Available1229G->AADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseKawasakiNot Available1229G->CADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseMunichNot Available1231A->GADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseGeorgiaNot Available1284C->AADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseSumareNot Available1292T->GADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseTelti/KobeNot Available1318C->TADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseSantiago de Cuba, MoriokaNot Available1339G->AADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseHarimaNot Available1358T->AADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseFiguera da FozNot Available1366G->CADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseAmiensNot Available1367A>TADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseBangkok NoiNot Available1376G->T, 1502T->GADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseFukayaNot Available1462G->AADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseCampinasNot Available1463G->TADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseBuenos AiresNot Available1465C>TADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseArakawaNot Available1466C->TADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseBrightonNot Available1488_1490delGAAADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseKozukataNot Available159G->CADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseAmsterdamNot Available180_182delTCTADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseNo nameNot Available202G->A, 376A->G, 1264C>GADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseSwanseaNot Available224T->CADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseUrayasuNot Available281_283delAGAADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseVancouverNot Available317C->G544C->T592C->TADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseMt SinaiNot Available376A->G, 1159C->TADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenasePlymouthNot Available488G->AADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseVolendamNot Available514C->TADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseShinshuNot Available527A->GADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseChikugoNot Available535A->TADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseTsukuiNot Available561_563delCTCADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenasePedoplis-CkaroNot Available573C>GADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseSantiagoNot Available593G->CADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseMinnesota, Marion, Gastonia, LeJeuneNot Available637G->TADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseCincinnatiNot Available637G->T, 1037A->TADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseHarilaouNot Available648T->GADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseNorth DallasNot Available683_685delACAADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseAsahikawaNot Available695G->AADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseDurhamNot Available713A->GADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseStonybrookNot Available724_729delGGCACTADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseWayneNot Available769C->GADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseAveiroNot Available806G->AADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseCleveland CorumNot Available820G->AADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseLilleNot Available821A>TADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseBangkokNot Available825G>CADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseSugaoNot Available826C->TADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseLa JollaNot Available832T->CADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseWexhamNot Available833C->TADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenasePiotrkowNot Available851T>CADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseWest VirginiaNot Available910G->TADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseOmiyaNot Available921G->CADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseNaraNot Available953_976delCCACCAAAGGGTACCTGGAC GACCADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseManhattanNot Available962G->AADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseRehevotNot Available964T->CADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseHoniaraNot Available99A->G / 1360C->TADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseTokyo, FukushimaNot Available1246G->AADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseChathamNot Available1003G->AADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseFushanNot Available1004C->AADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenasePartenopeNot Available1052G->TADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseIerapetraNot Available1057C->TADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseAnadiaNot Available1193A->GADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseAbenoNot Available1220A->CADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseSurabayaNot Available1291G->AADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenasePawneeNot Available1316G->CADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseS. AntiocoNot Available1342A->GADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseCassanoNot Available1347G->CADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseHermoupolisNot Available1347G->C / 1360C->TADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseUnion,Maewo, Chinese-2, KaloNot Available1360C->TADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseAndalusNot Available1361G->AADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseCosenzaNot Available1376G->CADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseCanton, Taiwan- Hakka, Gifu-like, Agrigento-likeNot Available1376G->TADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseFloresNot Available1387C->AADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseKaiping, Anant, Dhon, Sapporo-like, WoseraNot Available1388G->AADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseKamogawaNot Available169C->TADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseCostanzoNot Available179T>CADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseAmazoniaNot Available185C->AADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseSongklanagarindNot Available196T->AADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseHechiNot Available202G->A / 871G->AADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseNamouruNot Available208T->CADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseBao LocNot Available352T>CADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseCrispimNot Available375G->T, 379G->T383T->C384C>TADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseAcrokorinthosNot Available376A->G / 463C->GADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseSanta MariaNot Available376A->G / 542A->TADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseAnanindeuaNot Available376A->G / 871G->AADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseVanua LavaNot Available383T->CADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseValladolidNot Available406C->TADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseBelemNot Available409C->TADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseLiuzhouNot Available442G->AADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseShenzenNot Available473G>AADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseTaipei “Chinese- 3”Not Available493A->GADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseToledoNot Available496C>TADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseNaoneNot Available497G->AADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseNankangNot Available517T->CADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseMiaoliNot Available519C->GADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseMediterranean, Dallas, Panama‚ Sassari, Cagliari, BirminghamNot Available563C->TADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseCoimbra ShundeNot Available592C->TADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseNilgiriNot Available593G>AADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseRadlowoNot Available679C->TADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseRoubaixNot Available811G>CADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseHaikouNot Available835A->GADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseChinese-1Not Available835A->TADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseMizushimaNot Available848A>GADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseOsakaNot Available853C->TADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseViangchan, JammuNot Available871G->AADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseSeoulNot Available916G->AADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseLudhianaNot Available929G->AADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseFarroupilhaNot Available977C->AADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseChinese-5Not Available1024C->TADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseRignanoNot Available130G>AADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseOrissaNot Available131C->GADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseG6PDNiceNot Available1380G>CADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseKamiube, KeelungNot Available1387C->TADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseNeapolisNot Available1400C->GADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseAuresNot Available143T->CADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseSplitNot Available1442C->GADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseKambosNot Available148C->TADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenasePalestrinaNot Available170G>AADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseMetapontoNot Available172G->AADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseMusashinoNot Available185C->TADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseAsahiNot Available202G->AADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseA- (202), Ferrara INot Available202G->A / 376A->GADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseMurcia OristanoNot Available209A->GADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseUbe KonanNot Available241C->TADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseLagosantoNot Available242G->AADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseGuangzhouNot Available274C->TADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseHammersmithNot Available323T->AADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseSinnaiNot Available34G->TADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseA- (680)Not Available376A->G / 680G->TADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseA- (968), Betica,Selma, GuantanamoNot Available376A->G / 968T->CADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseSalerno PyrgosNot Available383T>GADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseQuing YanNot Available392G->TADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseLagesNot Available40G->AADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseIleshaNot Available466G->AADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseMahidolNot Available487G->AADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseMalagaNot Available542A->TADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseSibariNot Available634A->GADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseMexico CityNot Available680G->AADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseNanningNot Available703C->TADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseSeattle, Lodi, Modena, Ferrara II, Athens-likeNot Available844G->CADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseBajo MaumereNot Available844G->TADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseMontalbanoNot Available854G->AADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseKalyan-Kerala, Jamnaga, RohiniNot Available949G->AADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseGaoheNot Available95A->GADR InferredIncreased risk of hemolytic anemia.Details


Drug Interactions
(R)-warfarinChlorpropamide may increase the anticoagulant activities of (R)-warfarin.
(S)-WarfarinChlorpropamide may increase the anticoagulant activities of (S)-Warfarin.
2,4-thiazolidinedioneThe risk or severity of hypoglycemia can be increased when Chlorpropamide is combined with 2,4-thiazolidinedione.
4-hydroxycoumarinChlorpropamide may increase the anticoagulant activities of 4-hydroxycoumarin.
5-(2-methylpiperazine-1-sulfonyl)isoquinolineThe therapeutic efficacy of Chlorpropamide can be increased when used in combination with 5-(2-methylpiperazine-1-sulfonyl)isoquinoline.
AbacavirChlorpropamide may decrease the excretion rate of Abacavir which could result in a higher serum level.
AbataceptThe metabolism of Chlorpropamide can be increased when combined with Abatacept.
AbirateroneThe metabolism of Chlorpropamide can be decreased when combined with Abiraterone.
AcarboseThe risk or severity of hypoglycemia can be increased when Acarbose is combined with Chlorpropamide.
AcebutololAcebutolol may increase the hypoglycemic activities of Chlorpropamide.
Food Interactions
  • Avoid alcohol.
  • Food reduces the rate of absorption.
  • Take 30 minutes before meal.


Synthesis Reference

McLamore, W.M.; U S . Patent 3,349,124; October 24,1967; assigned to Chas. Pfizer Co., Inc.

General References
Not Available
External Links
Human Metabolome Database
PubChem Compound
PubChem Substance
Therapeutic Targets Database
RxList Drug Page Drug Page
ATC Codes
A10BB02 — Chlorpropamide
AHFS Codes
  • 68:20.20 — Sulfonylureas
Download (35.8 KB)

Clinical Trials

Clinical Trials
2CompletedTreatmentImpaired Glucose Tolerance (IGT) / Type 2 Diabetes Mellitus1
Not AvailableCompletedNot AvailableType 2 Diabetes Mellitus3
Not AvailableCompletedScreeningDiabetes Insipidus / Diabetes Insipidus, Neurohypophyseal1


  • Barr laboratories inc
  • Clonmel healthcare ltd
  • Duramed pharmaceuticals inc sub barr laboratories inc
  • Halsey drug co inc
  • Ivax pharmaceuticals inc
  • Mylan pharmaceuticals inc
  • Par pharmaceutical inc
  • Pliva inc
  • Sandoz inc
  • Superpharm corp
  • Teva pharmaceuticals usa inc
  • Usl pharma inc
  • Watson laboratories inc
  • Pfizer laboratories div pfizer inc
  • Central Texas Community Health Centers
  • Direct Dispensing Inc.
  • Dispensing Solutions
  • H and H Laboratories
  • Major Pharmaceuticals
  • Murfreesboro Pharmaceutical Nursing Supply
  • Mylan
  • Nucare Pharmaceuticals Inc.
  • PD-Rx Pharmaceuticals Inc.
  • Pfizer Inc.
  • Pharmedix
  • Physicians Total Care Inc.
  • Pliva Inc.
  • Prepackage Specialists
  • Prescript Pharmaceuticals
  • Qualitest
  • UDL Laboratories
  • Wyeth Pharmaceuticals
Dosage forms
TabletOral100 mg
TabletOral250 mg
TabletOral100 mg/1
TabletOral250 mg/1
Unit descriptionCostUnit
Diabinese 250 mg tablet1.34USD tablet
Diabinese 100 mg tablet0.61USD tablet
Chlorpropamide 250 mg tablet0.46USD tablet
Chlorpropamide 100 mg tablet0.33USD tablet
DrugBank does not sell nor buy drugs. Pricing information is supplied for informational purposes only.
Not Available


Experimental Properties
melting point (°C)129.2-129.8McLamore, W.M.; U S . Patent 3,349,124; October 24,1967; assigned to Chas. Pfizer Co., Inc.
water solubility258 mg/L (at 37 °C)YALKOWSKY,SH & DANNENFELSER,RM (1992)
logP2.27HANSCH,C ET AL. (1995)
logS-3.03ADME Research, USCD
pKa5.13LIPINSKI,CA ET AL. (1991)
Predicted Properties
Water Solubility0.157 mg/mLALOGPS
pKa (Strongest Acidic)4.33ChemAxon
Physiological Charge-1ChemAxon
Hydrogen Acceptor Count3ChemAxon
Hydrogen Donor Count2ChemAxon
Polar Surface Area75.27 Å2ChemAxon
Rotatable Bond Count3ChemAxon
Refractivity65.43 m3·mol-1ChemAxon
Polarizability27.06 Å3ChemAxon
Number of Rings1ChemAxon
Rule of FiveYesChemAxon
Ghose FilterYesChemAxon
Veber's RuleNoChemAxon
MDDR-like RuleNoChemAxon
Predicted ADMET features
Human Intestinal Absorption+0.9969
Blood Brain Barrier+0.8087
Caco-2 permeable-0.6198
P-glycoprotein substrateNon-substrate0.6087
P-glycoprotein inhibitor INon-inhibitor0.9009
P-glycoprotein inhibitor IINon-inhibitor0.9533
Renal organic cation transporterNon-inhibitor0.8747
CYP450 2C9 substrateSubstrate0.5553
CYP450 2D6 substrateNon-substrate0.8806
CYP450 3A4 substrateNon-substrate0.7042
CYP450 1A2 substrateNon-inhibitor0.9044
CYP450 2C9 inhibitorNon-inhibitor0.9071
CYP450 2D6 inhibitorNon-inhibitor0.9231
CYP450 2C19 inhibitorNon-inhibitor0.9026
CYP450 3A4 inhibitorNon-inhibitor0.9592
CYP450 inhibitory promiscuityLow CYP Inhibitory Promiscuity0.6454
Ames testNon AMES toxic0.9133
BiodegradationNot ready biodegradable0.9206
Rat acute toxicity2.1413 LD50, mol/kg Not applicable
hERG inhibition (predictor I)Weak inhibitor0.9072
hERG inhibition (predictor II)Non-inhibitor0.9306
ADMET data is predicted using admetSAR, a free tool for evaluating chemical ADMET properties. (23092397)


Mass Spec (NIST)
Not Available
SpectrumSpectrum TypeSplash Key
Predicted GC-MS Spectrum - GC-MSPredicted GC-MSNot Available
Predicted MS/MS Spectrum - 10V, Positive (Annotated)Predicted LC-MS/MSNot Available
Predicted MS/MS Spectrum - 20V, Positive (Annotated)Predicted LC-MS/MSNot Available
Predicted MS/MS Spectrum - 40V, Positive (Annotated)Predicted LC-MS/MSNot Available
Predicted MS/MS Spectrum - 10V, Negative (Annotated)Predicted LC-MS/MSNot Available
Predicted MS/MS Spectrum - 20V, Negative (Annotated)Predicted LC-MS/MSNot Available
Predicted MS/MS Spectrum - 40V, Negative (Annotated)Predicted LC-MS/MSNot Available
LC-MS/MS Spectrum - LC-ESI-qTof , PositiveLC-MS/MSNot Available
LC-MS/MS Spectrum - LC-ESI-qTof , PositiveLC-MS/MSNot Available
LC-MS/MS Spectrum - LC-ESI-qTof , PositiveLC-MS/MSNot Available
MS/MS Spectrum - , positiveLC-MS/MSsplash10-0002-0093000000-fa4d8bff1a5b0d68d8ea
MS/MS Spectrum - , positiveLC-MS/MSsplash10-006x-0910000000-a09d8795a568a12a0da3
MS/MS Spectrum - , positiveLC-MS/MSsplash10-03dr-2910000000-7ee6a1f4754e3058ddb6


This compound belongs to the class of organic compounds known as benzenesulfonamides. These are organic compounds containing a sulfonamide group that is S-linked to a benzene ring.
Organic compounds
Super Class
Benzene and substituted derivatives
Sub Class
Direct Parent
Alternative Parents
Benzenesulfonyl compounds / Sulfonylureas / Chlorobenzenes / Aryl chlorides / Organosulfonic acids and derivatives / Aminosulfonyl compounds / Propargyl-type 1,3-dipolar organic compounds / Carboximidic acids and derivatives / Organopnictogen compounds / Organooxygen compounds
show 3 more
Benzenesulfonamide / Benzenesulfonyl group / Chlorobenzene / Halobenzene / Sulfonylurea / Aryl chloride / Aryl halide / Organic sulfonic acid or derivatives / Organosulfonic acid or derivatives / Sulfonyl
show 15 more
Molecular Framework
Aromatic homomonocyclic compounds
External Descriptors
monochlorobenzenes, N-sulfonylurea (CHEBI:3650)


Pharmacological action
General Function
Sulfonylurea receptor activity
Specific Function
Subunit of the beta-cell ATP-sensitive potassium channel (KATP). Regulator of ATP-sensitive K(+) channels and insulin release.
Gene Name
Uniprot ID
Uniprot Name
ATP-binding cassette sub-family C member 8
Molecular Weight
176990.36 Da
  1. Mizuno CS, Chittiboyina AG, Kurtz TW, Pershadsingh HA, Avery MA: Type 2 diabetes and oral antihyperglycemic drugs. Curr Med Chem. 2008;15(1):61-74. [PubMed:18220763]


Pharmacological action
General Function
Steroid hydroxylase activity
Specific Function
Cytochromes P450 are a group of heme-thiolate monooxygenases. In liver microsomes, this enzyme is involved in an NADPH-dependent electron transport pathway. It oxidizes a variety of structurally un...
Gene Name
Uniprot ID
Uniprot Name
Cytochrome P450 2C9
Molecular Weight
55627.365 Da
  1. Zhou SF, Zhou ZW, Yang LP, Cai JP: Substrates, inducers, inhibitors and structure-activity relationships of human Cytochrome P450 2C9 and implications in drug development. Curr Med Chem. 2009;16(27):3480-675. Epub 2009 Sep 1. [PubMed:19515014]
  2. Preissner S, Kroll K, Dunkel M, Senger C, Goldsobel G, Kuzman D, Guenther S, Winnenburg R, Schroeder M, Preissner R: SuperCYP: a comprehensive database on Cytochrome P450 enzymes including a tool for analysis of CYP-drug interactions. Nucleic Acids Res. 2010 Jan;38(Database issue):D237-43. doi: 10.1093/nar/gkp970. Epub 2009 Nov 24. [PubMed:19934256]
Pharmacological action
General Function
Steroid hydroxylase activity
Specific Function
Responsible for the metabolism of a number of therapeutic agents such as the anticonvulsant drug S-mephenytoin, omeprazole, proguanil, certain barbiturates, diazepam, propranolol, citalopram and im...
Gene Name
Uniprot ID
Uniprot Name
Cytochrome P450 2C19
Molecular Weight
55930.545 Da
  1. Zhou SF, Zhou ZW, Yang LP, Cai JP: Substrates, inducers, inhibitors and structure-activity relationships of human Cytochrome P450 2C9 and implications in drug development. Curr Med Chem. 2009;16(27):3480-675. Epub 2009 Sep 1. [PubMed:19515014]
  2. Preissner S, Kroll K, Dunkel M, Senger C, Goldsobel G, Kuzman D, Guenther S, Winnenburg R, Schroeder M, Preissner R: SuperCYP: a comprehensive database on Cytochrome P450 enzymes including a tool for analysis of CYP-drug interactions. Nucleic Acids Res. 2010 Jan;38(Database issue):D237-43. doi: 10.1093/nar/gkp970. Epub 2009 Nov 24. [PubMed:19934256]
Pharmacological action
General Function
Prostaglandin-endoperoxide synthase activity
Specific Function
Converts arachidonate to prostaglandin H2 (PGH2), a committed step in prostanoid synthesis. Involved in the constitutive production of prostanoids in particular in the stomach and platelets. In gas...
Gene Name
Uniprot ID
Uniprot Name
Prostaglandin G/H synthase 1
Molecular Weight
68685.82 Da
  1. Zhou SF, Zhou ZW, Yang LP, Cai JP: Substrates, inducers, inhibitors and structure-activity relationships of human Cytochrome P450 2C9 and implications in drug development. Curr Med Chem. 2009;16(27):3480-675. Epub 2009 Sep 1. [PubMed:19515014]


Pharmacological action
General Function
Proton-dependent oligopeptide secondary active transmembrane transporter activity
Specific Function
Proton-coupled intake of oligopeptides of 2 to 4 amino acids with a preference for dipeptides. May constitute a major route for the absorption of protein digestion end-products.
Gene Name
Uniprot ID
Uniprot Name
Solute carrier family 15 member 1
Molecular Weight
78805.265 Da
  1. Terada T, Sawada K, Saito H, Hashimoto Y, Inui K: Inhibitory effect of novel oral hypoglycemic agent nateglinide (AY4166) on peptide transporters PEPT1 and PEPT2. Eur J Pharmacol. 2000 Mar 24;392(1-2):11-7. [PubMed:10748266]
Pharmacological action
General Function
Peptide:proton symporter activity
Specific Function
Proton-coupled intake of oligopeptides of 2 to 4 amino acids with a preference for dipeptides.
Gene Name
Uniprot ID
Uniprot Name
Solute carrier family 15 member 2
Molecular Weight
81782.77 Da
  1. Terada T, Sawada K, Saito H, Hashimoto Y, Inui K: Inhibitory effect of novel oral hypoglycemic agent nateglinide (AY4166) on peptide transporters PEPT1 and PEPT2. Eur J Pharmacol. 2000 Mar 24;392(1-2):11-7. [PubMed:10748266]
Pharmacological action
General Function
Sodium-independent organic anion transmembrane transporter activity
Specific Function
Involved in the renal elimination of endogenous and exogenous organic anions. Functions as organic anion exchanger when the uptake of one molecule of organic anion is coupled with an efflux of one ...
Gene Name
Uniprot ID
Uniprot Name
Solute carrier family 22 member 6
Molecular Weight
61815.78 Da
  1. Uwai Y, Saito H, Hashimoto Y, Inui K: Inhibitory effect of anti-diabetic agents on rat organic anion transporter rOAT1. Eur J Pharmacol. 2000 Jun 16;398(2):193-7. [PubMed:10854830]

Drug created on June 13, 2005 07:24 / Updated on January 22, 2019 17:57