
Logo pink
Are you a
new drug developer?
Contact us to learn more about our customized products and solutions.
Accession Number
DB01016  (APRD00233)
Small Molecule

Glyburide is an oral antihyperglycemic agent used for the treatment of non-insulin-dependent diabetes mellitus (NIDDM). It belongs to the sulfonylurea class of insulin secretagogues, which act by stimulating β cells of the pancreas to release insulin. Sulfonylureas increase both basal insulin secretion and meal-stimulated insulin release. Medications in this class differ in their dose, rate of absorption, duration of action, route of elimination and binding site on their target pancreatic β cell receptor. Sulfonylureas also increase peripheral glucose utilization, decrease hepatic gluconeogenesis and may increase the number and sensitivity of insulin receptors. Sulfonylureas are associated with weight gain, though less so than insulin. Due to their mechanism of action, sulfonylureas may cause hypoglycemia and require consistent food intake to decrease this risk. The risk of hypoglycemia is increased in elderly, debilitated and malnourished individuals. Glyburide has been shown to decrease fasting plasma glucose, postprandial blood glucose and glycosolated hemoglobin (HbA1c) levels (reflective of the last 8-10 weeks of glucose control). Glyburide appears to be completely metabolized, likely in the liver. Although its metabolites exert a small hypoglycemic effect, their contribution to glyburide's hypoglycemic effect is thought to be clinically unimportant. Glyburide metabolites are excreted in urine and feces in approximately equal proportions.

  • 1-((p-(2-(5-chloro-o-anisamido)ethyl)phenyl)sulfonyl)-3-cyclohexylurea
  • 1-(p-(2-(5-chloro-2-methoxybenzamido)ethyl)benzenesulfonyl)-3-cyclohexylurea
  • 5-chloro-N-(2-(4-((((cyclohexylamino)carbonyl)amino)sulfonyl)phenyl)ethyl)-2-methoxybenzamide
  • Glibenclamida
  • Glibenclamide
  • Glibenclamidum
  • Glyburide
External IDs
HB 419 / HB-419 / U-26,45 / U-26,452 / U-26452
Product Images
Prescription Products
NameDosageStrengthRouteLabellerMarketing StartMarketing End
Apo Glyburide Tab 2.5mgTablet2.5 mgOralApotex Corporation1991-12-31Not applicableCanada
Apo Glyburide Tab 5mgTablet5 mgOralApotex Corporation1991-12-31Not applicableCanada
DiaBetaTablet2.5 mgOralSanofi Aventis1997-05-28Not applicableCanada
DiaBetaTablet5 mgOralSanofi Aventis1997-02-21Not applicableCanada
DiaBetaTablet2.5 mg/1OralPhysicians Total Care, Inc.2009-06-012011-09-30Us
DiaBetaTablet5 mg/1OralPhysicians Total Care, Inc.2009-06-012011-09-30Us
DiaBetaTablet1.25 mg/1OralSanofi Aventis2009-06-012018-05-04Us
DiaBetaTablet2.5 mg/1OralSanofi Aventis2009-06-012018-05-04Us
DiaBetaTablet5 mg/1OralSanofi Aventis2009-06-012018-05-04Us
Diabeta 5mgTablet5 mgOralHoechst Canada Inc.1971-12-311996-09-09Canada
Generic Prescription Products
NameDosageStrengthRouteLabellerMarketing StartMarketing End
Ava-glyburideTablet2.5 mgOralAvanstra Inc2011-08-112014-08-21Canada
Ava-glyburideTablet5 mgOralAvanstra Inc2011-08-112014-08-21Canada
Dom-glyburideTablet2.5 mgOralDominion Pharmacal1998-03-202010-02-16Canada
Dom-glyburideTablet5 mgOralDominion Pharmacal1998-03-20Not applicableCanada
GlyburideTablet2.5 mg/1OralNucare Pharmaceuticals, Inc.2010-10-05Not applicableUs
GlyburideTablet1.5 mg/1OralTeva Pharmaceuticals USA, Inc.1999-05-11Not applicableUs0093 803420180907 15195 1jbl4m7
GlyburideTablet3 mg/1OralTeva Pharmaceuticals USA, Inc.1999-05-11Not applicableUs0093 803520180907 15195 112007o
GlyburideTablet6 mg/1OralTeva Pharmaceuticals USA, Inc.1999-05-12Not applicableUs0093 803620180907 15195 1khpaei
GlyburideTablet1.25 mg/1OralPhysicians Total Care, Inc.1994-11-18Not applicableUs
GlyburideTablet2.5 mg/1OralPhysicians Total Care, Inc.1994-08-26Not applicableUs64720 0124 10 nlmimage10 6007b00d
Mixture Products
NameIngredientsDosageRouteLabellerMarketing StartMarketing End
GlucovanceGlyburide (2.5 mg/1) + Metformin Hydrochloride (500 mg/1)Tablet, film coatedOralPhysicians Total Care, Inc.2002-05-31Not applicableUs
GlucovanceGlyburide (1.25 mg/1) + Metformin Hydrochloride (250 mg/1)Tablet, film coatedOralPhysicians Total Care, Inc.2003-08-292011-06-30Us
GlucovanceGlyburide (5 mg/1) + Metformin Hydrochloride (500 mg/1)Tablet, film coatedOralPhysicians Total Care, Inc.2003-08-292011-06-30Us
GlucovanceGlyburide (2.5 mg/1) + Metformin Hydrochloride (500 mg/1)Tablet, film coatedOralBristol-Myers Squibb Company2008-12-152018-10-31Us
GlucovanceGlyburide (5 mg/1) + Metformin Hydrochloride (500 mg/1)Tablet, film coatedOralBristol-Myers Squibb Company2008-12-152019-02-28Us
GlucovanceGlyburide (1.25 mg/1) + Metformin Hydrochloride (250 mg/1)Tablet, film coatedOralBristol-Myers Squibb Company2006-11-032006-11-03Us
Glyburide (micronized) and Metformin HydrochlorideGlyburide (1.25 mg/1) + Metformin Hydrochloride (250 mg/1)TabletOralActavis Pharma Inc.2011-06-212011-06-21Us
Glyburide (micronized) and Metformin HydrochlorideGlyburide (2.5 mg/1) + Metformin Hydrochloride (500 mg/1)TabletOralActavis Pharma Inc.2011-06-212011-06-21Us
Glyburide (micronized) and Metformin HydrochlorideGlyburide (5 mg/1) + Metformin Hydrochloride (500 mg/1)TabletOralActavis Pharma Inc.2011-07-122013-10-31Us
Glyburide and MetforminGlyburide (5 mg/1) + Metformin Hydrochloride (500 mg/1)Tablet, film coatedOralUnit Dose Services2011-01-032015-07-31Us50436 087320180907 15195 12n2gti
International/Other Brands
Daonil / Delmide / Novo-Glyburide (Novopharm) / Semi-Daonil
CAS number
Average: 494.004
Monoisotopic: 493.143819418
Chemical Formula
InChI Key



Indicated as an adjunct to diet to lower the blood glucose in patients with NIDDM whose hyperglycemia cannot be satisfactorily controlled by diet alone.

Associated Conditions

Glyburide, a second-generation sulfonylurea antidiabetic agent, lowers blood glucose acutely by stimulating the release of insulin from the pancreas, an effect dependent upon functioning beta cells in the pancreatic islets. With chronic administration in Type II diabetic patients, the blood glucose lowering effect persists despite a gradual decline in the insulin secretory response to the drug. Extrapancreatic effects may be involved in the mechanism of action of oral sulfonyl-urea hypoglycemic drugs. The combination of glibenclamide and metformin may have a synergistic effect, since both agents act to improve glucose tolerance by different but complementary mechanisms. In addition to its blood glucose lowering actions, glyburide produces a mild diuresis by enhancement of renal free water clearance. Glyburide is twice as potent as the related second-generation agent glipizide.

Mechanism of action

Sulfonylureas such as glyburide bind to ATP-sensitive potassium channels on the pancreatic cell surface, reducing potassium conductance and causing depolarization of the membrane. Depolarization stimulates calcium ion influx through voltage-sensitive calcium channels, raising intracellular concentrations of calcium ions, which induces the secretion, or exocytosis, of insulin.

ASulfonylurea receptor 1, Kir6.2
UG protein-activated inward rectifier potassium channel 4
UATP-binding cassette sub-family C member 9
UBile salt export pump
UATP-binding cassette sub-family A member 1
UCystic fibrosis transmembrane conductance regulator
UMitochondrial ATP-sensitive potassium channel
UCarnitine O-palmitoyltransferase 1, liver isoform

Significant absorption within 1 hour and peak plasma levels are reached in 2 to 4 hours. Onset of action occurs within one hour.

Volume of distribution

Steady state Vd=0.125 L/kg; Vd during elimination phase=0.155 L/kg.

Protein binding

Unchanged drug is ~99% bound to serum proteins; 4-trans-hydroxyglyburide is greater than 97% bound to serum proteins. Protein binding is primarily nonionic making glyburide and is less likely to displace or be displaced by drugs that bind via an ionic mechanism.


Primarily hepatic (mainly cytochrome P450 3A4). The major metabolite is the 4-trans-hydroxy derivative. A second metabolite, the 3-cis-hydroxy derivative, also occurs. These metabolites do not contribute clinically significant hypoglycemic action in humans as they are only weakly active; however, retention of 4-trans-hydroxyglyburide may prolong the hypoglycemic effect of the agent in those with severe renal impairment.

Route of elimination

Glyburide is excreted as metabolites in the bile and urine, approximately 50% by each route. This dual excretory pathway is qualitatively different from that of other sulfonylureas, which are excreted primarily in the urine.

Half life

1.4-1.8 hours (unchanged drug only); 10 hours (metabolites included). Duration of effect is 12-24 hours. The half-life of glyburide appears to be unaffected in those with a creatinine clearance of greater than 29 ml/min/1.73m2.


78 ml/hr/kg in healthy adults. Clearance may be substantially decreased in those with severe renal impairment.


Oral rat LD50: > 20,000 mg/kg. Oral mouse LD50: 3250 mg/kg.

Affected organisms
  • Humans and other mammals
Glibenclamide Action PathwayDrug action
Pharmacogenomic Effects/ADRs
Interacting Gene/EnzymeAllele nameGenotype(s)Defining Change(s)Type(s)DescriptionDetails
Glucose-6-phosphate 1-dehydrogenaseVilleurbanneNot Available1000_1002delACCADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseTorunNot Available1006A->GADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseSunderlandNot Available105_107delCATADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseIwatsukiNot Available1081G->AADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseSerresNot Available1082C->TADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseTondelaNot Available1084_1101delCTGAACGAGCGCAAGGCCADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseLoma LindaNot Available1089C->AADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseAachenNot Available1089C->GADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseTenriNot Available1096A->GADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseMontpellierNot Available1132G>AADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseCalvo MackennaNot Available1138A->GADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseRileyNot Available1139T->CADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseOlomoucNot Available1141T->CADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseTomahNot Available1153T->CADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseLynwoodNot Available1154G->TADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseMadridNot Available1155C->GADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseIowa, Walter Reed, SpringfieldNot Available1156A->GADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseBeverly Hills, Genova, Iwate, Niigata, YamaguchiNot Available1160G->AADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseHartfordNot Available1162A->GADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenasePrahaNot Available1166A->GADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseKrakowNot Available1175T>CADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseWisconsinNot Available1177C->GADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseNashville, Anaheim, PorticiNot Available1178G->AADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseAlhambraNot Available1180G->CADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseBariNot Available1187C->TADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenasePuerto LimonNot Available1192G->AADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseCovao do LoboNot Available1205C>AADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseClinicNot Available1215G->AADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseUtrechtNot Available1225C->TADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseSuwalkiNot Available1226C->GADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseRiversideNot Available1228G->TADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseJapan, ShinagawaNot Available1229G->AADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseKawasakiNot Available1229G->CADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseMunichNot Available1231A->GADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseGeorgiaNot Available1284C->AADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseSumareNot Available1292T->GADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseTelti/KobeNot Available1318C->TADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseSantiago de Cuba, MoriokaNot Available1339G->AADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseHarimaNot Available1358T->AADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseFiguera da FozNot Available1366G->CADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseAmiensNot Available1367A>TADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseBangkok NoiNot Available1376G->T, 1502T->GADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseFukayaNot Available1462G->AADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseCampinasNot Available1463G->TADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseBuenos AiresNot Available1465C>TADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseArakawaNot Available1466C->TADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseBrightonNot Available1488_1490delGAAADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseKozukataNot Available159G->CADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseAmsterdamNot Available180_182delTCTADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseNo nameNot Available202G->A, 376A->G, 1264C>GADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseSwanseaNot Available224T->CADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseUrayasuNot Available281_283delAGAADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseVancouverNot Available317C->G544C->T592C->TADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseMt SinaiNot Available376A->G, 1159C->TADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenasePlymouthNot Available488G->AADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseVolendamNot Available514C->TADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseShinshuNot Available527A->GADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseChikugoNot Available535A->TADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseTsukuiNot Available561_563delCTCADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenasePedoplis-CkaroNot Available573C>GADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseSantiagoNot Available593G->CADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseMinnesota, Marion, Gastonia, LeJeuneNot Available637G->TADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseCincinnatiNot Available637G->T, 1037A->TADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseHarilaouNot Available648T->GADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseNorth DallasNot Available683_685delACAADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseAsahikawaNot Available695G->AADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseDurhamNot Available713A->GADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseStonybrookNot Available724_729delGGCACTADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseWayneNot Available769C->GADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseAveiroNot Available806G->AADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseCleveland CorumNot Available820G->AADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseLilleNot Available821A>TADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseBangkokNot Available825G>CADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseSugaoNot Available826C->TADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseLa JollaNot Available832T->CADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseWexhamNot Available833C->TADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenasePiotrkowNot Available851T>CADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseWest VirginiaNot Available910G->TADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseOmiyaNot Available921G->CADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseNaraNot Available953_976delCCACCAAAGGGTACCTGGAC GACCADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseManhattanNot Available962G->AADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseRehevotNot Available964T->CADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseHoniaraNot Available99A->G / 1360C->TADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseTokyo, FukushimaNot Available1246G->AADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseChathamNot Available1003G->AADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseFushanNot Available1004C->AADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenasePartenopeNot Available1052G->TADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseIerapetraNot Available1057C->TADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseAnadiaNot Available1193A->GADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseAbenoNot Available1220A->CADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseSurabayaNot Available1291G->AADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenasePawneeNot Available1316G->CADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseS. AntiocoNot Available1342A->GADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseCassanoNot Available1347G->CADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseHermoupolisNot Available1347G->C / 1360C->TADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseUnion,Maewo, Chinese-2, KaloNot Available1360C->TADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseAndalusNot Available1361G->AADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseCosenzaNot Available1376G->CADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseCanton, Taiwan- Hakka, Gifu-like, Agrigento-likeNot Available1376G->TADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseFloresNot Available1387C->AADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseKaiping, Anant, Dhon, Sapporo-like, WoseraNot Available1388G->AADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseKamogawaNot Available169C->TADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseCostanzoNot Available179T>CADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseAmazoniaNot Available185C->AADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseSongklanagarindNot Available196T->AADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseHechiNot Available202G->A / 871G->AADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseNamouruNot Available208T->CADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseBao LocNot Available352T>CADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseCrispimNot Available375G->T, 379G->T383T->C384C>TADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseAcrokorinthosNot Available376A->G / 463C->GADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseSanta MariaNot Available376A->G / 542A->TADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseAnanindeuaNot Available376A->G / 871G->AADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseVanua LavaNot Available383T->CADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseValladolidNot Available406C->TADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseBelemNot Available409C->TADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseLiuzhouNot Available442G->AADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseShenzenNot Available473G>AADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseTaipei “Chinese- 3”Not Available493A->GADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseToledoNot Available496C>TADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseNaoneNot Available497G->AADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseNankangNot Available517T->CADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseMiaoliNot Available519C->GADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseMediterranean, Dallas, Panama‚ Sassari, Cagliari, BirminghamNot Available563C->TADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseCoimbra ShundeNot Available592C->TADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseNilgiriNot Available593G>AADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseRadlowoNot Available679C->TADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseRoubaixNot Available811G>CADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseHaikouNot Available835A->GADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseChinese-1Not Available835A->TADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseMizushimaNot Available848A>GADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseOsakaNot Available853C->TADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseViangchan, JammuNot Available871G->AADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseSeoulNot Available916G->AADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseLudhianaNot Available929G->AADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseFarroupilhaNot Available977C->AADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseChinese-5Not Available1024C->TADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseRignanoNot Available130G>AADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseOrissaNot Available131C->GADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseG6PDNiceNot Available1380G>CADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseKamiube, KeelungNot Available1387C->TADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseNeapolisNot Available1400C->GADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseAuresNot Available143T->CADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseSplitNot Available1442C->GADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseKambosNot Available148C->TADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenasePalestrinaNot Available170G>AADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseMetapontoNot Available172G->AADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseMusashinoNot Available185C->TADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseAsahiNot Available202G->AADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseA- (202), Ferrara INot Available202G->A / 376A->GADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseMurcia OristanoNot Available209A->GADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseUbe KonanNot Available241C->TADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseLagosantoNot Available242G->AADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseGuangzhouNot Available274C->TADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseHammersmithNot Available323T->AADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseSinnaiNot Available34G->TADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseA- (680)Not Available376A->G / 680G->TADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseA- (968), Betica,Selma, GuantanamoNot Available376A->G / 968T->CADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseSalerno PyrgosNot Available383T>GADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseQuing YanNot Available392G->TADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseLagesNot Available40G->AADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseIleshaNot Available466G->AADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseMahidolNot Available487G->AADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseMalagaNot Available542A->TADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseSibariNot Available634A->GADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseMexico CityNot Available680G->AADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseNanningNot Available703C->TADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseSeattle, Lodi, Modena, Ferrara II, Athens-likeNot Available844G->CADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseBajo MaumereNot Available844G->TADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseMontalbanoNot Available854G->AADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseKalyan-Kerala, Jamnaga, RohiniNot Available949G->AADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseGaoheNot Available95A->GADR InferredIncreased risk of hemolytic anemia.Details


Drug Interactions
(R)-warfarinThe serum concentration of (R)-warfarin can be increased when it is combined with Glyburide.
(S)-WarfarinThe metabolism of (S)-Warfarin can be decreased when combined with Glyburide.
2,4-thiazolidinedioneThe risk or severity of hypoglycemia can be increased when Glyburide is combined with 2,4-thiazolidinedione.
3,5-diiodothyropropionic acidThe metabolism of 3,5-diiodothyropropionic acid can be decreased when combined with Glyburide.
4-hydroxycoumarinThe metabolism of 4-hydroxycoumarin can be decreased when combined with Glyburide.
5-(2-methylpiperazine-1-sulfonyl)isoquinolineThe therapeutic efficacy of Glyburide can be increased when used in combination with 5-(2-methylpiperazine-1-sulfonyl)isoquinoline.
5-androstenedioneThe metabolism of 5-androstenedione can be decreased when combined with Glyburide.
6-Deoxyerythronolide BThe metabolism of Glyburide can be decreased when combined with 6-Deoxyerythronolide B.
6-O-benzylguanineThe metabolism of 6-O-benzylguanine can be decreased when combined with Glyburide.
7-ethyl-10-hydroxycamptothecinThe metabolism of Glyburide can be decreased when combined with 7-ethyl-10-hydroxycamptothecin.
Food Interactions
  • Avoid alcohol.
  • Take 30-60 minutes before breakfast.


Synthesis Reference

Suresh Gidwani, "Solid oral dosage form of metformin and glyburide and the method of preparation thereof." U.S. Patent US20040175421, issued September 09, 2004.

General References
  1. Monami M, Luzzi C, Lamanna C, Chiasserini V, Addante F, Desideri CM, Masotti G, Marchionni N, Mannucci E: Three-year mortality in diabetic patients treated with different combinations of insulin secretagogues and metformin. Diabetes Metab Res Rev. 2006 Nov-Dec;22(6):477-82. [PubMed:16634115]
External Links
Human Metabolome Database
KEGG Compound
PubChem Compound
PubChem Substance
Therapeutic Targets Database
Guide to Pharmacology
GtP Drug Page
RxList Drug Page
ATC Codes
A10BB01 — Glibenclamide
AHFS Codes
  • 68:20.20 — Sulfonylureas
PDB Entries
4yvp / 4yvv / 5ifu / 5yke / 5ykf / 5ykg / 5yw7 / 6baa
Download (36.9 KB)

Clinical Trials

Clinical Trials
1CompletedNot AvailableHealthy Volunteers5
1CompletedBasic ScienceAngina Pectoris1
1CompletedOtherHealthy Volunteers1
1CompletedTreatmentHealthy Volunteers3
1CompletedTreatmentStrokes / Traumatic Brain Injury (TBI)1
1CompletedTreatmentType 2 Diabetes Mellitus2
1Not Yet RecruitingTreatmentHealthy Volunteers1
1Unknown StatusSupportive CareType 2 Diabetes Mellitus1
1WithdrawnBasic ScienceHealthy Volunteers1
1, 2CompletedTreatmentDiabetes Mellitus (DM)1
1, 2CompletedTreatmentStroke, Ischemic1
1, 2RecruitingTreatmentEdema of the cerebrum / Metastatic Brain Tumors1
1, 2RecruitingTreatmentSpinal Cord Injuries (SCI) / Spinal Cord Injury, Acute1
1, 2Unknown StatusTreatmentGestational Diabetes Mellitus (GDM)1
2Active Not RecruitingPreventionMalignant Edema / Stroke, Ischemic1
2Active Not RecruitingTreatmentTraumatic Brain Injury (TBI)1
2CompletedTreatmentDiabetes Mellitus (DM)1
2CompletedTreatmentImpaired Glucose Tolerance (IGT) / Type 2 Diabetes Mellitus1
2CompletedTreatmentType 2 Diabetes Mellitus2
2RecruitingTreatmentType 2 Diabetes Mellitus1
2TerminatedTreatmentType 2 Diabetes Mellitus1
2, 3CompletedPreventionDiabetes, Diabetes Mellitus Type 11
3CompletedTreatmentDiabetes Mellitus (DM)4
3CompletedTreatmentDiabetes Mellitus (DM) / Gestational1
3CompletedTreatmentDiabetes Mellitus (DM) / Type 2 Diabetes Mellitus1
3CompletedTreatmentDiabetes Mellitus, Non-Insulin-Dependent1
3CompletedTreatmentGestational Diabetes Mellitus (GDM)1
3CompletedTreatmentGestational Diabetes Mellitus (GDM) / Pregnancy1
3CompletedTreatmentNeonatal Diabetes Secondary to Mutation in the Potassium Channel1
3CompletedTreatmentType 2 Diabetes Mellitus3
3RecruitingTreatmentBrain Swelling / Stroke, Acute1
3TerminatedTreatmentDiabetes Mellitus (DM)2
3TerminatedTreatmentDiabetes Mellitus (DM) / Type 2 Diabetes Mellitus1
3TerminatedTreatmentType 2 Diabetes Mellitus1
4CompletedBasic ScienceType 2 Diabetes Mellitus1
4CompletedPreventionType 2 Diabetes Mellitus1
4CompletedTreatmentBlood Pressures / BMI >30 kg/m2 / Cardiac Hypertrophy / High Blood Pressure (Hypertension) / Microalbuminuria / Type 2 Diabetes Mellitus / Vascular Stiffness1
4CompletedTreatmentCarotid Artery Diseases / Coronary Artery Disease / Type 2 Diabetes Mellitus1
4CompletedTreatmentDiabetes Mellitus (DM)3
4CompletedTreatmentDiabetes Mellitus (DM) / Livers1
4CompletedTreatmentDiabetes Mellitus (DM) / Type 2 Diabetes Mellitus2
4CompletedTreatmentDiabetes Mellitus, Non-Insulin-Dependent1
4CompletedTreatmentEndothelial Dysfunction / High Blood Pressure (Hypertension) / Type 2 Diabetes Mellitus1
4CompletedTreatmentMild Gestational Diabetes1
4CompletedTreatmentPermanent Neonatal Diabetes Mellitus1
4CompletedTreatmentType 2 Diabetes Mellitus3
4Enrolling by InvitationTreatmentPermanent Neonatal Diabetes Mellitus1
4Not Yet RecruitingTreatmentGestational Diabetes Mellitus (GDM)1
4RecruitingTreatmentDiabetes Mellitus in Pregnancy / Gestational Diabetes Mellitus (GDM)1
4RecruitingTreatmentStroke, Acute1
4RecruitingTreatmentSubarachnoid Hemorrhage, Aneurysmal1
4Unknown StatusTreatmentDiabetes, Diabetes Mellitus Type 11
4Unknown StatusTreatmentDiabetic Blood Glucose Monitoring / Exercise / Hypoglycemic Agents / Type 2 Diabetes Mellitus1
4Unknown StatusTreatmentGestational Diabetes Mellitus (GDM)1
4WithdrawnTreatmentGestational Diabetes Mellitus (GDM)2
4WithdrawnTreatmentGestational Diabetes Mellitus, Class A21
Not AvailableCompletedNot AvailableType 2 Diabetes Mellitus5
Not AvailableCompletedScreeningDiabetes Mellitus, Insulin-Dependent / Ischemia-Reperfusion Injury1
Not AvailableCompletedTreatmentGestational Diabetes Mellitus (GDM)1
Not AvailableCompletedTreatmentType 2 Diabetes Mellitus3
Not AvailableRecruitingTreatmentDiabetes Mellitus (DM)1
Not AvailableRecruitingTreatmentGestational Diabetes Mellitus (GDM)1
Not AvailableRecruitingTreatmentIntracerebral Hemorrhage1
Not AvailableUnknown StatusNot AvailableArterial Stiffness / Diabetes Mellitus (DM)1
Not AvailableUnknown StatusTreatmentGestational Diabetes Mellitus (GDM) / Pregnancy / Type 2 Diabetes Mellitus1
Not AvailableUnknown StatusTreatmentHealthy Volunteers1


  • Sanofi aventis us llc
  • Actavis totowa llc
  • Aurobindo pharma ltd
  • Corepharma llc
  • Teva pharmaceuticals usa inc
  • Dava pharmaceuticals inc
  • Hikma pharmaceuticals
  • Mylan pharmaceuticals inc
  • Sandoz inc
  • Pharmacia and upjohn co
  • Advanced Pharmaceutical Services Inc.
  • Amerisource Health Services Corp.
  • Apotheca Inc.
  • AQ Pharmaceuticals Inc.
  • A-S Medication Solutions LLC
  • Aurobindo Pharma Ltd.
  • Bryant Ranch Prepack
  • Cardinal Health
  • Caremark LLC
  • Corepharma LLC
  • Coupler Enterprises Inc.
  • DAVA Pharmaceuticals
  • DHHS Program Support Center Supply Service Center
  • Direct Dispensing Inc.
  • Dispensing Solutions
  • Diversified Healthcare Services Inc.
  • Golden State Medical Supply Inc.
  • Greenstone LLC
  • H.J. Harkins Co. Inc.
  • Heartland Repack Services LLC
  • Hikma Pharmaceuticals
  • Kaiser Foundation Hospital
  • Lake Erie Medical and Surgical Supply
  • Legacy Pharmaceuticals Packaging LLC
  • Liberty Pharmaceuticals
  • Major Pharmaceuticals
  • Mckesson Corp.
  • Medvantx Inc.
  • Merrell Pharmaceuticals Inc.
  • Murfreesboro Pharmaceutical Nursing Supply
  • Mylan
  • Novopharm Ltd.
  • Nucare Pharmaceuticals Inc.
  • Palmetto Pharmaceuticals Inc.
  • Patheon Inc.
  • PD-Rx Pharmaceuticals Inc.
  • Pfizer Inc.
  • Pharmaceutical Utilization Management Program VA Inc.
  • Pharmacia Inc.
  • Pharmedix
  • Physicians Total Care Inc.
  • Preferred Pharmaceuticals Inc.
  • Prepackage Specialists
  • Prepak Systems Inc.
  • Rebel Distributors Corp.
  • Remedy Repack
  • Resource Optimization and Innovation LLC
  • Rite Aid Corp.
  • Sandhills Packaging Inc.
  • Sandoz
  • Sanofi-Aventis Inc.
  • Southwood Pharmaceuticals
  • Talbert Medical Management Corp.
  • Teva Pharmaceutical Industries Ltd.
  • UDL Laboratories
  • Va Cmop Dallas
  • Vangard Labs Inc.
  • Warrick Pharmaceuticals Corp.
  • West-Ward Pharmaceuticals
  • Zoetica Pharmaceutical Corp.
Dosage forms
TabletOral2.5 mg
TabletOral5 mg
TabletOral2.5 mg/1
TabletOral5 mg/1
Tablet, film coatedOral
TabletOral1.25 mg/1
TabletOral1.5 mg/1
TabletOral3 mg/1
TabletOral6 mg/1
Unit descriptionCostUnit
Glynase 6 mg tablet2.28USD tablet
Glynase 6 mg prestab2.19USD tablet
Glynase 3 mg tablet1.45USD tablet
Glynase 3 mg prestab1.39USD tablet
Diabeta 5 mg tablet1.36USD tablet
Micronase 5 mg tablet1.36USD tablet
Diabeta 2.5 mg tablet0.91USD tablet
Glynase 1.5 mg tablet0.83USD tablet
Glynase 1.5 mg prestab0.82USD tablet
Micronase 2.5 mg tablet0.8USD tablet
Diabeta 1.25 mg tablet0.5USD tablet
Micronase 1.25 mg tablet0.48USD tablet
Diabeta 5 mg Tablet0.26USD tablet
Diabeta 2.5 mg Tablet0.14USD tablet
Apo-Glyburide 5 mg Tablet0.07USD tablet
Euglucon 5 mg Tablet0.07USD tablet
Mylan-Glybe 5 mg Tablet0.07USD tablet
Novo-Glyburide 5 mg Tablet0.07USD tablet
Nu-Glyburide 5 mg Tablet0.07USD tablet
Pms-Glyburide 5 mg Tablet0.07USD tablet
Ratio-Glyburide 5 mg Tablet0.07USD tablet
Sandoz Glyburide 5 mg Tablet0.07USD tablet
Apo-Glyburide 2.5 mg Tablet0.04USD tablet
Euglucon 2.5 mg Tablet0.04USD tablet
Mylan-Glybe 2.5 mg Tablet0.04USD tablet
Novo-Glyburide 2.5 mg Tablet0.04USD tablet
Nu-Glyburide 2.5 mg Tablet0.04USD tablet
Pms-Glyburide 2.5 mg Tablet0.04USD tablet
Ratio-Glyburide 2.5 mg Tablet0.04USD tablet
Sandoz Glyburide 2.5 mg Tablet0.04USD tablet
DrugBank does not sell nor buy drugs. Pricing information is supplied for informational purposes only.
Patent NumberPediatric ExtensionApprovedExpires (estimated)


Experimental Properties
melting point (°C)169 °CPhysProp
water solubility4 mg/L (at 27 °C)YALKOWSKY,SH & DANNENFELSER,RM (1992)
logP4.7Not Available
logS-5.09ADME Research, USCD
Predicted Properties
Water Solubility0.00206 mg/mLALOGPS
pKa (Strongest Acidic)4.32ChemAxon
pKa (Strongest Basic)-1.2ChemAxon
Physiological Charge-1ChemAxon
Hydrogen Acceptor Count5ChemAxon
Hydrogen Donor Count3ChemAxon
Polar Surface Area113.6 Å2ChemAxon
Rotatable Bond Count7ChemAxon
Refractivity126.98 m3·mol-1ChemAxon
Polarizability51.75 Å3ChemAxon
Number of Rings3ChemAxon
Rule of FiveYesChemAxon
Ghose FilterNoChemAxon
Veber's RuleNoChemAxon
MDDR-like RuleYesChemAxon
Predicted ADMET features
Human Intestinal Absorption+0.9701
Blood Brain Barrier-0.6707
Caco-2 permeable-0.6479
P-glycoprotein substrateNon-substrate0.5109
P-glycoprotein inhibitor INon-inhibitor0.7119
P-glycoprotein inhibitor IINon-inhibitor0.8185
Renal organic cation transporterNon-inhibitor0.7982
CYP450 2C9 substrateSubstrate0.6488
CYP450 2D6 substrateNon-substrate0.9116
CYP450 3A4 substrateSubstrate0.5329
CYP450 1A2 substrateNon-inhibitor0.9045
CYP450 2C9 inhibitorInhibitor0.8948
CYP450 2D6 inhibitorInhibitor0.8932
CYP450 2C19 inhibitorNon-inhibitor0.9026
CYP450 3A4 inhibitorInhibitor0.7959
CYP450 inhibitory promiscuityHigh CYP Inhibitory Promiscuity0.8627
Ames testNon AMES toxic0.6996
BiodegradationNot ready biodegradable0.8245
Rat acute toxicity1.4243 LD50, mol/kg Not applicable
hERG inhibition (predictor I)Weak inhibitor0.7551
hERG inhibition (predictor II)Non-inhibitor0.8024
ADMET data is predicted using admetSAR, a free tool for evaluating chemical ADMET properties. (23092397)


Mass Spec (NIST)
Not Available
SpectrumSpectrum TypeSplash Key
Predicted GC-MS Spectrum - GC-MSPredicted GC-MSNot Available
Predicted MS/MS Spectrum - 10V, Positive (Annotated)Predicted LC-MS/MSNot Available
Predicted MS/MS Spectrum - 20V, Positive (Annotated)Predicted LC-MS/MSNot Available
Predicted MS/MS Spectrum - 40V, Positive (Annotated)Predicted LC-MS/MSNot Available
Predicted MS/MS Spectrum - 10V, Negative (Annotated)Predicted LC-MS/MSNot Available
Predicted MS/MS Spectrum - 20V, Negative (Annotated)Predicted LC-MS/MSNot Available
Predicted MS/MS Spectrum - 40V, Negative (Annotated)Predicted LC-MS/MSNot Available
LC-MS/MS Spectrum - LC-ESI-qTof , PositiveLC-MS/MSNot Available
LC-MS/MS Spectrum - LC-ESI-qTof , PositiveLC-MS/MSNot Available
LC-MS/MS Spectrum - LC-ESI-qTof , PositiveLC-MS/MSNot Available
LC-MS/MS Spectrum - LC-ESI-qTof , PositiveLC-MS/MSNot Available
LC-MS/MS Spectrum - LC-ESI-QFT , negativeLC-MS/MSsplash10-00dl-0901300000-a19ba3565aec1b9acb36
MS/MS Spectrum - , positiveLC-MS/MSsplash10-014i-0002290000-4a0641596c33a997d77e
MS/MS Spectrum - , positiveLC-MS/MSsplash10-014i-0319000000-b4fc8ec2ce4cb2f7b9fe
MS/MS Spectrum - , positiveLC-MS/MSsplash10-014i-0002190000-7f61119495ccea67ff2f
MS/MS Spectrum - , positiveLC-MS/MSsplash10-014i-1629000000-bcf31c97391018018369
MS/MS Spectrum - , positiveLC-MS/MSsplash10-014i-2911000000-7c5e8a23fd392fd3eb4d
LC-MS/MS Spectrum - LC-ESI-QFT , positiveLC-MS/MSsplash10-014i-0906000000-4ed189ce2c190cc04470


This compound belongs to the class of organic compounds known as benzenesulfonamides. These are organic compounds containing a sulfonamide group that is S-linked to a benzene ring.
Organic compounds
Super Class
Benzene and substituted derivatives
Sub Class
Direct Parent
Alternative Parents
Benzenesulfonyl compounds / Anisoles / Methoxybenzenes / Phenoxy compounds / Chlorobenzenes / Sulfonylureas / Alkyl aryl ethers / Aryl chlorides / Aminosulfonyl compounds / Organosulfonic acids and derivatives
show 6 more
Benzenesulfonamide / Benzenesulfonyl group / Anisole / Phenol ether / Methoxybenzene / Phenoxy compound / Chlorobenzene / Halobenzene / Sulfonylurea / Alkyl aryl ether
show 22 more
Molecular Framework
Aromatic homomonocyclic compounds
External Descriptors
monochlorobenzenes, N-sulfonylurea (CHEBI:5441)


Protein group
Pharmacological action
General Function
Sulfonylurea receptor activity
Specific Function
Subunit of the beta-cell ATP-sensitive potassium channel (KATP). Regulator of ATP-sensitive K(+) channels and insulin release.

  1. Dabrowski M, Ashcroft FM, Ashfield R, Lebrun P, Pirotte B, Egebjerg J, Bondo Hansen J, Wahl P: The novel diazoxide analog 3-isopropylamino-7-methoxy-4H-1,2,4-benzothiadiazine 1,1-dioxide is a selective Kir6.2/SUR1 channel opener. Diabetes. 2002 Jun;51(6):1896-906. [PubMed:12031979]
  2. Hambrock A, Preisig-Muller R, Russ U, Piehl A, Hanley PJ, Ray J, Daut J, Quast U, Derst C: Four novel splice variants of sulfonylurea receptor 1. Am J Physiol Cell Physiol. 2002 Aug;283(2):C587-98. [PubMed:12107069]
  3. Hambrock A, Loffler-Walz C, Quast U: Glibenclamide binding to sulphonylurea receptor subtypes: dependence on adenine nucleotides. Br J Pharmacol. 2002 Aug;136(7):995-1004. [PubMed:12145099]
  4. Nielsen FE, Bodvarsdottir TB, Worsaae A, MacKay P, Stidsen CE, Boonen HC, Pridal L, Arkhammar PO, Wahl P, Ynddal L, Junager F, Dragsted N, Tagmose TM, Mogensen JP, Koch A, Treppendahl SP, Hansen JB: 6-Chloro-3-alkylamino-4H-thieno[3,2-e]-1,2,4-thiadiazine 1,1-dioxide derivatives potently and selectively activate ATP sensitive potassium channels of pancreatic beta-cells. J Med Chem. 2002 Sep 12;45(19):4171-87. [PubMed:12213059]
  5. Babenko AP, Bryan J: SUR-dependent modulation of KATP channels by an N-terminal KIR6.2 peptide. Defining intersubunit gating interactions. J Biol Chem. 2002 Nov 15;277(46):43997-4004. Epub 2002 Sep 3. [PubMed:12213829]
  6. Ueda K, Komine J, Matsuo M, Seino S, Amachi T: Cooperative binding of ATP and MgADP in the sulfonylurea receptor is modulated by glibenclamide. Proc Natl Acad Sci U S A. 1999 Feb 16;96(4):1268-72. [PubMed:9990013]
  7. Serrano-Martin X, Payares G, Mendoza-Leon A: Glibenclamide, a blocker of K+(ATP) channels, shows antileishmanial activity in experimental murine cutaneous leishmaniasis. Antimicrob Agents Chemother. 2006 Dec;50(12):4214-6. Epub 2006 Oct 2. [PubMed:17015627]
Pharmacological action
General Function
G-protein activated inward rectifier potassium channel activity
Specific Function
This potassium channel is controlled by G proteins. Inward rectifier potassium channels are characterized by a greater tendency to allow potassium to flow into the cell rather than out of it. Their...
Gene Name
Uniprot ID
Uniprot Name
G protein-activated inward rectifier potassium channel 4
Molecular Weight
47667.3 Da
  1. Chen X, Ji ZL, Chen YZ: TTD: Therapeutic Target Database. Nucleic Acids Res. 2002 Jan 1;30(1):412-5. [PubMed:11752352]
Pharmacological action
General Function
Transporter activity
Specific Function
Subunit of ATP-sensitive potassium channels (KATP). Can form cardiac and smooth muscle-type KATP channels with KCNJ11. KCNJ11 forms the channel pore while ABCC9 is required for activation and regul...
Gene Name
Uniprot ID
Uniprot Name
ATP-binding cassette sub-family C member 9
Molecular Weight
174221.7 Da
  1. Hambrock A, Loffler-Walz C, Quast U: Glibenclamide binding to sulphonylurea receptor subtypes: dependence on adenine nucleotides. Br J Pharmacol. 2002 Aug;136(7):995-1004. [PubMed:12145099]
  2. Rainbow RD, James M, Hudman D, Al Johi M, Singh H, Watson PJ, Ashmole I, Davies NW, Lodwick D, Norman RI: Proximal C-terminal domain of sulphonylurea receptor 2A interacts with pore-forming Kir6 subunits in KATP channels. Biochem J. 2004 Apr 1;379(Pt 1):173-81. [PubMed:14672537]
  3. Felsch H, Lange U, Hambrock A, Loffler-Walz C, Russ U, Carroll WA, Gopalakrishnan M, Quast U: Interaction of a novel dihydropyridine K+ channel opener, A-312110, with recombinant sulphonylurea receptors and KATP channels: comparison with the cyanoguanidine P1075. Br J Pharmacol. 2004 Apr;141(7):1098-105. Epub 2004 Mar 15. [PubMed:15023854]
  4. Zhao JL, Yang YJ, You SJ, Jing ZC, Wu YJ, Cheng JL, Gao RL: Pretreatment with fosinopril or valsartan reduces myocardial no-reflow after acute myocardial infarction and reperfusion. Coron Artery Dis. 2006 Aug;17(5):463-9. [PubMed:16845255]
  5. Wang YH, Zheng HY, Qin NL, Yu SB, Liu SY: Involvement of ATP-sensitive potassium channels in proliferation and differentiation of rat preadipocytes. Sheng Li Xue Bao. 2007 Feb 25;59(1):8-12. [PubMed:17294036]
4. Bile salt export pump
Pharmacological action
General Function
Transporter activity
Specific Function
Involved in the ATP-dependent secretion of bile salts into the canaliculus of hepatocytes.
Gene Name
Uniprot ID
Uniprot Name
Bile salt export pump
Molecular Weight
146405.83 Da
  1. Byrne JA, Strautnieks SS, Mieli-Vergani G, Higgins CF, Linton KJ, Thompson RJ: The human bile salt export pump: characterization of substrate specificity and identification of inhibitors. Gastroenterology. 2002 Nov;123(5):1649-58. [PubMed:12404239]
  2. Kemp DC, Brouwer KL: Viability assessment in sandwich-cultured rat hepatocytes after xenobiotic exposure. Toxicol In Vitro. 2004 Dec;18(6):869-77. [PubMed:15465654]
  3. Horikawa M, Kato Y, Tyson CA, Sugiyama Y: Potential cholestatic activity of various therapeutic agents assessed by bile canalicular membrane vesicles isolated from rats and humans. Drug Metab Pharmacokinet. 2003;18(1):16-22. [PubMed:15618715]
Pharmacological action
General Function
Syntaxin binding
Specific Function
cAMP-dependent and sulfonylurea-sensitive anion transporter. Key gatekeeper influencing intracellular cholesterol transport.
Gene Name
Uniprot ID
Uniprot Name
ATP-binding cassette sub-family A member 1
Molecular Weight
254299.89 Da
  1. Reddy ST, Hama S, Ng C, Grijalva V, Navab M, Fogelman AM: ATP-binding cassette transporter 1 participates in LDL oxidation by artery wall cells. Arterioscler Thromb Vasc Biol. 2002 Nov 1;22(11):1877-83. [PubMed:12426219]
  2. Muhl H, Hofler S, Pfeilschifter J: Inhibition of lipopolysaccharide/ATP-induced release of interleukin-18 by KN-62 and glyburide. Eur J Pharmacol. 2003 Dec 15;482(1-3):325-8. [PubMed:14660039]
  3. Agassandian M, Mathur SN, Zhou J, Field FJ, Mallampalli RK: Oxysterols trigger ABCA1-mediated basolateral surfactant efflux. Am J Respir Cell Mol Biol. 2004 Aug;31(2):227-33. Epub 2004 Mar 23. [PubMed:15039140]
  4. Nieland TJ, Chroni A, Fitzgerald ML, Maliga Z, Zannis VI, Kirchhausen T, Krieger M: Cross-inhibition of SR-BI- and ABCA1-mediated cholesterol transport by the small molecules BLT-4 and glyburide. J Lipid Res. 2004 Jul;45(7):1256-65. Epub 2004 Apr 21. [PubMed:15102890]
  5. Alder-Baerens N, Muller P, Pohl A, Korte T, Hamon Y, Chimini G, Pomorski T, Herrmann A: Headgroup-specific exposure of phospholipids in ABCA1-expressing cells. J Biol Chem. 2005 Jul 15;280(28):26321-9. Epub 2005 May 19. [PubMed:15905177]
  6. Lamkanfi M, Mueller JL, Vitari AC, Misaghi S, Fedorova A, Deshayes K, Lee WP, Hoffman HM, Dixit VM: Glyburide inhibits the Cryopyrin/Nalp3 inflammasome. J Cell Biol. 2009 Oct 5;187(1):61-70. doi: 10.1083/jcb.200903124. [PubMed:19805629]
Pharmacological action
General Function
Pdz domain binding
Specific Function
Involved in the transport of chloride ions. May regulate bicarbonate secretion and salvage in epithelial cells by regulating the SLC4A7 transporter. Can inhibit the chloride channel activity of ANO...
Gene Name
Uniprot ID
Uniprot Name
Cystic fibrosis transmembrane conductance regulator
Molecular Weight
168139.895 Da
  1. Reddy MM, Quinton PM: Effect of anion transport blockers on CFTR in the human sweat duct. J Membr Biol. 2002 Sep 1;189(1):15-25. [PubMed:12202948]
  2. Jiang J, Song Y, Bai C, Koller BH, Matthay MA, Verkman AS: Pleural surface fluorescence measurement of Na+ and Cl- transport across the air space-capillary barrier. J Appl Physiol (1985). 2003 Jan;94(1):343-52. Epub 2002 Aug 30. [PubMed:12391048]
  3. Zhou Z, Hu S, Hwang TC: Probing an open CFTR pore with organic anion blockers. J Gen Physiol. 2002 Nov;120(5):647-62. [PubMed:12407077]
  4. Larsen EH, Amstrup J, Willumsen NJ: Beta-adrenergic receptors couple to CFTR chloride channels of intercalated mitochondria-rich cells in the heterocellular toad skin epithelium. Biochim Biophys Acta. 2003 Dec 30;1618(2):140-52. [PubMed:14729151]
  5. Lee SY, Lee CO: Inhibition of Na+-K+ pump and L-type Ca2+ channel by glibenclamide in Guinea pig ventricular myocytes. J Pharmacol Exp Ther. 2005 Jan;312(1):61-8. Epub 2004 Sep 13. [PubMed:15365090]
Protein group
Pharmacological action
General Function
Voltage-gated potassium channel activity
Specific Function
This receptor is controlled by G proteins. Inward rectifier potassium channels are characterized by a greater tendency to allow potassium to flow into the cell rather than out of it. Their voltage ...

  1. Jaburek M, Yarov-Yarovoy V, Paucek P, Garlid KD: State-dependent inhibition of the mitochondrial KATP channel by glyburide and 5-hydroxydecanoate. J Biol Chem. 1998 May 29;273(22):13578-82. [PubMed:9593694]
Pharmacological action
General Function
Carnitine o-palmitoyltransferase activity
Specific Function
Catalyzes the transfer of the acyl group of long-chain fatty acid-CoA conjugates onto carnitine, an essential step for the mitochondrial uptake of long-chain fatty acids and their subsequent beta-o...
Gene Name
Uniprot ID
Uniprot Name
Carnitine O-palmitoyltransferase 1, liver isoform
Molecular Weight
88366.92 Da
  1. Patel TB: Effect of sulfonylureas on hepatic fatty acid oxidation. Am J Physiol. 1986 Aug;251(2 Pt 1):E241-6. [PubMed:3090894]
  2. Cook GA: The hypoglycemic sulfonylureas glyburide and tolbutamide inhibit fatty acid oxidation by inhibiting carnitine palmitoyltransferase. J Biol Chem. 1987 Apr 15;262(11):4968-72. [PubMed:3104327]


Pharmacological action
General Function
Steroid hydroxylase activity
Specific Function
Responsible for the metabolism of a number of therapeutic agents such as the anticonvulsant drug S-mephenytoin, omeprazole, proguanil, certain barbiturates, diazepam, propranolol, citalopram and im...
Gene Name
Uniprot ID
Uniprot Name
Cytochrome P450 2C19
Molecular Weight
55930.545 Da
  1. Zhou SF, Zhou ZW, Yang LP, Cai JP: Substrates, inducers, inhibitors and structure-activity relationships of human Cytochrome P450 2C9 and implications in drug development. Curr Med Chem. 2009;16(27):3480-675. Epub 2009 Sep 1. [PubMed:19515014]
  2. Preissner S, Kroll K, Dunkel M, Senger C, Goldsobel G, Kuzman D, Guenther S, Winnenburg R, Schroeder M, Preissner R: SuperCYP: a comprehensive database on Cytochrome P450 enzymes including a tool for analysis of CYP-drug interactions. Nucleic Acids Res. 2010 Jan;38(Database issue):D237-43. doi: 10.1093/nar/gkp970. Epub 2009 Nov 24. [PubMed:19934256]
Pharmacological action
General Function
Vitamin d3 25-hydroxylase activity
Specific Function
Cytochromes P450 are a group of heme-thiolate monooxygenases. In liver microsomes, this enzyme is involved in an NADPH-dependent electron transport pathway. It performs a variety of oxidation react...
Gene Name
Uniprot ID
Uniprot Name
Cytochrome P450 3A4
Molecular Weight
57342.67 Da
  1. Zhou SF, Zhou ZW, Yang LP, Cai JP: Substrates, inducers, inhibitors and structure-activity relationships of human Cytochrome P450 2C9 and implications in drug development. Curr Med Chem. 2009;16(27):3480-675. Epub 2009 Sep 1. [PubMed:19515014]
  2. Preissner S, Kroll K, Dunkel M, Senger C, Goldsobel G, Kuzman D, Guenther S, Winnenburg R, Schroeder M, Preissner R: SuperCYP: a comprehensive database on Cytochrome P450 enzymes including a tool for analysis of CYP-drug interactions. Nucleic Acids Res. 2010 Jan;38(Database issue):D237-43. doi: 10.1093/nar/gkp970. Epub 2009 Nov 24. [PubMed:19934256]
  3. Kim KA, Park JY: Inhibitory effect of glyburide on human cytochrome p450 isoforms in human liver microsomes. Drug Metab Dispos. 2003 Sep;31(9):1090-2. [PubMed:12920163]
Pharmacological action
Curator comments
The inhibition of CYP2C9 by glyburide is currently supported by only 1 in vitro study.
General Function
Steroid hydroxylase activity
Specific Function
Cytochromes P450 are a group of heme-thiolate monooxygenases. In liver microsomes, this enzyme is involved in an NADPH-dependent electron transport pathway. It oxidizes a variety of structurally un...
Gene Name
Uniprot ID
Uniprot Name
Cytochrome P450 2C9
Molecular Weight
55627.365 Da
  1. Yin OQ, Tomlinson B, Chow MS: CYP2C9, but not CYP2C19, polymorphisms affect the pharmacokinetics and pharmacodynamics of glyburide in Chinese subjects. Clin Pharmacol Ther. 2005 Oct;78(4):370-7. doi: 10.1016/j.clpt.2005.06.006. [PubMed:16198656]
  2. Zhou L, Naraharisetti SB, Liu L, Wang H, Lin YS, Isoherranen N, Unadkat JD, Hebert MF, Mao Q: Contributions of human cytochrome P450 enzymes to glyburide metabolism. Biopharm Drug Dispos. 2010 May;31(4):228-42. doi: 10.1002/bdd.706. [PubMed:20437462]
  3. Kim KA, Park JY: Inhibitory effect of glyburide on human cytochrome p450 isoforms in human liver microsomes. Drug Metab Dispos. 2003 Sep;31(9):1090-2. [PubMed:12920163]
  4. Drug Interactions: Cytochrome P450 Drug Interaction Table [Link]


Pharmacological action
General Function
Toxic substance binding
Specific Function
Serum albumin, the main protein of plasma, has a good binding capacity for water, Ca(2+), Na(+), K(+), fatty acids, hormones, bilirubin and drugs. Its main function is the regulation of the colloid...
Gene Name
Uniprot ID
Uniprot Name
Serum albumin
Molecular Weight
69365.94 Da
  1. Crooks MJ, Brown KF: The binding of sulphonylureas to serum albumin. J Pharm Pharmacol. 1974 May;26(5):304-11. [PubMed:4153105]
  2. Hsu PL, Ma JK, Luzzi LA: Interactions of sulfonylureas with plasma proteins. J Pharm Sci. 1974 Apr;63(4):570-3. [PubMed:4208196]
  3. Brown KF, Crooks MJ: Displacement of tolbutamide, glibencalmide and chlorpropamide from serum albumin by anionic drugs. Biochem Pharmacol. 1976 May 15;25(10):1175-8. [PubMed:820348]


Pharmacological action
General Function
Organic anion transmembrane transporter activity
Specific Function
May act as an inducible transporter in the biliary and intestinal excretion of organic anions. Acts as an alternative route for the export of bile acids and glucuronides from cholestatic hepatocyte...
Gene Name
Uniprot ID
Uniprot Name
Canalicular multispecific organic anion transporter 2
Molecular Weight
169341.14 Da
  1. Gedeon C, Behravan J, Koren G, Piquette-Miller M: Transport of glyburide by placental ABC transporters: implications in fetal drug exposure. Placenta. 2006 Nov-Dec;27(11-12):1096-102. Epub 2006 Feb 3. [PubMed:16460798]
Pharmacological action
General Function
Transporter activity
Specific Function
Involved in the ATP-dependent secretion of bile salts into the canaliculus of hepatocytes.
Gene Name
Uniprot ID
Uniprot Name
Bile salt export pump
Molecular Weight
146405.83 Da
  1. Byrne JA, Strautnieks SS, Mieli-Vergani G, Higgins CF, Linton KJ, Thompson RJ: The human bile salt export pump: characterization of substrate specificity and identification of inhibitors. Gastroenterology. 2002 Nov;123(5):1649-58. [PubMed:12404239]
  2. Wang EJ, Casciano CN, Clement RP, Johnson WW: Fluorescent substrates of sister-P-glycoprotein (BSEP) evaluated as markers of active transport and inhibition: evidence for contingent unequal binding sites. Pharm Res. 2003 Apr;20(4):537-44. [PubMed:12739759]
  3. Noe J, Hagenbuch B, Meier PJ, St-Pierre MV: Characterization of the mouse bile salt export pump overexpressed in the baculovirus system. Hepatology. 2001 May;33(5):1223-31. [PubMed:11343252]
  4. Funk C, Pantze M, Jehle L, Ponelle C, Scheuermann G, Lazendic M, Gasser R: Troglitazone-induced intrahepatic cholestasis by an interference with the hepatobiliary export of bile acids in male and female rats. Correlation with the gender difference in troglitazone sulfate formation and the inhibition of the canalicular bile salt export pump (Bsep) by troglitazone and troglitazone sulfate. Toxicology. 2001 Oct 5;167(1):83-98. [PubMed:11557132]
  5. Stieger B, Fattinger K, Madon J, Kullak-Ublick GA, Meier PJ: Drug- and estrogen-induced cholestasis through inhibition of the hepatocellular bile salt export pump (Bsep) of rat liver. Gastroenterology. 2000 Feb;118(2):422-30. [PubMed:10648470]
  6. Pedersen JM, Matsson P, Bergstrom CA, Hoogstraate J, Noren A, LeCluyse EL, Artursson P: Early identification of clinically relevant drug interactions with the human bile salt export pump (BSEP/ABCB11). Toxicol Sci. 2013 Dec;136(2):328-43. doi: 10.1093/toxsci/kft197. Epub 2013 Sep 6. [PubMed:24014644]
Pharmacological action
General Function
Xenobiotic-transporting atpase activity
Specific Function
Energy-dependent efflux pump responsible for decreased drug accumulation in multidrug-resistant cells.
Gene Name
Uniprot ID
Uniprot Name
Multidrug resistance protein 1
Molecular Weight
141477.255 Da
  1. Golstein PE, Boom A, van Geffel J, Jacobs P, Masereel B, Beauwens R: P-glycoprotein inhibition by glibenclamide and related compounds. Pflugers Arch. 1999 Apr;437(5):652-60. [PubMed:10087141]
Pharmacological action
General Function
Transporter activity
Specific Function
Mediates export of organic anions and drugs from the cytoplasm. Mediates ATP-dependent transport of glutathione and glutathione conjugates, leukotriene C4, estradiol-17-beta-o-glucuronide, methotre...
Gene Name
Uniprot ID
Uniprot Name
Multidrug resistance-associated protein 1
Molecular Weight
171589.5 Da
  1. Payen L, Delugin L, Courtois A, Trinquart Y, Guillouzo A, Fardel O: The sulphonylurea glibenclamide inhibits multidrug resistance protein (MRP1) activity in human lung cancer cells. Br J Pharmacol. 2001 Feb;132(3):778-84. [PubMed:11159731]
  2. Gedeon C, Behravan J, Koren G, Piquette-Miller M: Transport of glyburide by placental ABC transporters: implications in fetal drug exposure. Placenta. 2006 Nov-Dec;27(11-12):1096-102. Epub 2006 Feb 3. [PubMed:16460798]
Pharmacological action
General Function
Proton-dependent oligopeptide secondary active transmembrane transporter activity
Specific Function
Proton-coupled intake of oligopeptides of 2 to 4 amino acids with a preference for dipeptides. May constitute a major route for the absorption of protein digestion end-products.
Gene Name
Uniprot ID
Uniprot Name
Solute carrier family 15 member 1
Molecular Weight
78805.265 Da
  1. Sawada K, Terada T, Saito H, Hashimoto Y, Inui K: Effects of glibenclamide on glycylsarcosine transport by the rat peptide transporters PEPT1 and PEPT2. Br J Pharmacol. 1999 Nov;128(6):1159-64. [PubMed:10578127]
Pharmacological action
General Function
Sodium-independent organic anion transmembrane transporter activity
Specific Function
Mediates the Na(+)-independent transport of organic anions such as sulfobromophthalein (BSP) and conjugated (taurocholate) and unconjugated (cholate) bile acids (By similarity). Selectively inhibit...
Gene Name
Uniprot ID
Uniprot Name
Solute carrier organic anion transporter family member 1A2
Molecular Weight
74144.105 Da
  1. Shitara Y, Sugiyama D, Kusuhara H, Kato Y, Abe T, Meier PJ, Itoh T, Sugiyama Y: Comparative inhibitory effects of different compounds on rat oatpl (slc21a1)- and Oatp2 (Slc21a5)-mediated transport. Pharm Res. 2002 Feb;19(2):147-53. [PubMed:11883641]
Pharmacological action
General Function
Peptide:proton symporter activity
Specific Function
Proton-coupled intake of oligopeptides of 2 to 4 amino acids with a preference for dipeptides.
Gene Name
Uniprot ID
Uniprot Name
Solute carrier family 15 member 2
Molecular Weight
81782.77 Da
  1. Sawada K, Terada T, Saito H, Hashimoto Y, Inui K: Effects of glibenclamide on glycylsarcosine transport by the rat peptide transporters PEPT1 and PEPT2. Br J Pharmacol. 1999 Nov;128(6):1159-64. [PubMed:10578127]
Pharmacological action
General Function
Sodium-independent organic anion transmembrane transporter activity
Specific Function
Involved in the renal elimination of endogenous and exogenous organic anions. Functions as organic anion exchanger when the uptake of one molecule of organic anion is coupled with an efflux of one ...
Gene Name
Uniprot ID
Uniprot Name
Solute carrier family 22 member 6
Molecular Weight
61815.78 Da
  1. Uwai Y, Saito H, Hashimoto Y, Inui K: Inhibitory effect of anti-diabetic agents on rat organic anion transporter rOAT1. Eur J Pharmacol. 2000 Jun 16;398(2):193-7. [PubMed:10854830]
Pharmacological action
General Function
Organic anion transmembrane transporter activity
Specific Function
Mediates hepatobiliary excretion of numerous organic anions. May function as a cellular cisplatin transporter.
Gene Name
Uniprot ID
Uniprot Name
Canalicular multispecific organic anion transporter 1
Molecular Weight
174205.64 Da
  1. Gedeon C, Behravan J, Koren G, Piquette-Miller M: Transport of glyburide by placental ABC transporters: implications in fetal drug exposure. Placenta. 2006 Nov-Dec;27(11-12):1096-102. Epub 2006 Feb 3. [PubMed:16460798]
  2. Payen L, Delugin L, Courtois A, Trinquart Y, Guillouzo A, Fardel O: The sulphonylurea glibenclamide inhibits multidrug resistance protein (MRP1) activity in human lung cancer cells. Br J Pharmacol. 2001 Feb;132(3):778-84. [PubMed:11159731]
Pharmacological action
General Function
Xenobiotic-transporting atpase activity
Specific Function
High-capacity urate exporter functioning in both renal and extrarenal urate excretion. Plays a role in porphyrin homeostasis as it is able to mediates the export of protoporhyrin IX (PPIX) both fro...
Gene Name
Uniprot ID
Uniprot Name
ATP-binding cassette sub-family G member 2
Molecular Weight
72313.47 Da
  1. Gedeon C, Behravan J, Koren G, Piquette-Miller M: Transport of glyburide by placental ABC transporters: implications in fetal drug exposure. Placenta. 2006 Nov-Dec;27(11-12):1096-102. Epub 2006 Feb 3. [PubMed:16460798]
  2. Pollex EK, Anger G, Hutson J, Koren G, Piquette-Miller M: Breast cancer resistance protein (BCRP)-mediated glyburide transport: effect of the C421A/Q141K BCRP single-nucleotide polymorphism. Drug Metab Dispos. 2010 May;38(5):740-4. doi: 10.1124/dmd.109.030791. Epub 2010 Feb 16. [PubMed:20159988]
Pharmacological action
General Function
Sodium-independent organic anion transmembrane transporter activity
Specific Function
Mediates sodium-independent multispecific organic anion transport. Transport of prostaglandin E2, prostaglandin F2, tetracycline, bumetanide, estrone sulfate, glutarate, dehydroepiandrosterone sulf...
Gene Name
Uniprot ID
Uniprot Name
Solute carrier family 22 member 7
Molecular Weight
60025.025 Da
  1. Morita N, Kusuhara H, Sekine T, Endou H, Sugiyama Y: Functional characterization of rat organic anion transporter 2 in LLC-PK1 cells. J Pharmacol Exp Ther. 2001 Sep;298(3):1179-84. [PubMed:11504818]
Pharmacological action
General Function
Sodium-independent organic anion transmembrane transporter activity
Specific Function
Mediates the Na(+)-independent transport of organic anions such as taurocholate, the prostaglandins PGD2, PGE1, PGE2, leukotriene C4, thromboxane B2 and iloprost.
Gene Name
Uniprot ID
Uniprot Name
Solute carrier organic anion transporter family member 2B1
Molecular Weight
76709.98 Da
  1. Satoh H, Yamashita F, Tsujimoto M, Murakami H, Koyabu N, Ohtani H, Sawada Y: Citrus juices inhibit the function of human organic anion-transporting polypeptide OATP-B. Drug Metab Dispos. 2005 Apr;33(4):518-23. Epub 2005 Jan 7. [PubMed:15640378]

Drug created on June 13, 2005 07:24 / Updated on April 18, 2019 06:15