Accession NumberDB01016  (APRD00233)
TypeSmall Molecule

Glyburide is an oral antihyperglycemic agent used for the treatment of non-insulin-dependent diabetes mellitus (NIDDM). It belongs to the sulfonylurea class of insulin secretagogues, which act by stimulating β cells of the pancreas to release insulin. Sulfonylureas increase both basal insulin secretion and meal-stimulated insulin release. Medications in this class differ in their dose, rate of absorption, duration of action, route of elimination and binding site on their target pancreatic β cell receptor. Sulfonylureas also increase peripheral glucose utilization, decrease hepatic gluconeogenesis and may increase the number and sensitivity of insulin receptors. Sulfonylureas are associated with weight gain, though less so than insulin. Due to their mechanism of action, sulfonylureas may cause hypoglycemia and require consistent food intake to decrease this risk. The risk of hypoglycemia is increased in elderly, debilitated and malnourished individuals. Glyburide has been shown to decrease fasting plasma glucose, postprandial blood glucose and glycosolated hemoglobin (HbA1c) levels (reflective of the last 8-10 weeks of glucose control). Glyburide appears to be completely metabolized, likely in the liver. Although its metabolites exert a small hypoglycemic effect, their contribution to glyburide's hypoglycemic effect is thought to be clinically unimportant. Glyburide metabolites are excreted in urine and feces in approximately equal proportions.

External IDs HB 419 / HB-419 / U-26,45 / U-26,452 / U-26452
Product Ingredients Not Available
Approved Prescription Products
NameDosageStrengthRouteLabellerMarketing StartMarketing End
Ava-glyburideTablet2.5 mgOralAvanstra Inc2011-08-112014-08-21Canada
Ava-glyburideTablet5 mgOralAvanstra Inc2011-08-112014-08-21Canada
DiabetaTablet5 mgOralSanofi Aventis1997-02-21Not applicableCanada
DiabetaTablet1.25 mg/1OralSanofi Aventis2009-06-01Not applicableUs
DiabetaTablet2.5 mgOralSanofi Aventis1997-05-28Not applicableCanada
DiabetaTablet2.5 mg/1OralSanofi Aventis2009-06-01Not applicableUs
DiabetaTablet5 mg/1OralSanofi Aventis2009-06-01Not applicableUs
Diabeta 5mgTablet5 mgOralHoechst Canada Inc.1971-12-311996-09-09Canada
Diabeta Tab 2.5mgTablet2.5 mgOralHoechst Canada Inc.1978-12-311997-08-05Canada
Diabeta Tab 5mgTablet5 mgOralHoechst Roussel Canada Inc.1993-12-311999-08-11Canada
Diabeta Tablets 2.5mgTablet2.5 mgOralHoechst Roussel Canada Inc.1995-12-311999-08-11Canada
Dom-glyburideTablet5 mgOralDominion Pharmacal1998-03-20Not applicableCanada
Dom-glyburideTablet2.5 mgOralDominion Pharmacal1998-03-202010-02-16Canada
EugluconTablet2.5 mgOralPharmascience Inc1986-12-312009-10-14Canada
EugluconTablet5 mgOralPharmascience Inc1986-12-31Not applicableCanada
GlyburideTablet2.5 mg/1OralLegacy Pharmaceutical Packaging2010-05-18Not applicableUs
GlyburideTablet2.5 mg/1OralNucare Pharmaceuticals, Inc.1984-05-01Not applicableUs
GlyburideTablet2.5 mgOralSanis Health Inc2010-05-12Not applicableCanada
GlyburideTablet5 mg/1OralPd Rx Pharmaceuticals, Inc.1994-04-01Not applicableUs
GlyburideTablet5 mg/1OralTeva1984-05-01Not applicableUs
GlyburideTablet5 mg/1OralAvera Mc Kennan Hospital2015-03-01Not applicableUs
GlyburideTablet5 mgOralSanis Health Inc2010-05-12Not applicableCanada
GlyburideTablet5 mg/1OralAphena Pharma Solutions Tennessee, Inc.1984-05-01Not applicableUs
GlyburideTablet2.5 mg/1OralTeva1984-05-01Not applicableUs
GlyburideTablet2.5 mg/1OralAphena Pharma Solutions Tennessee, Inc.1984-05-01Not applicableUs
GlyburideTablet1.25 mg/1OralTeva1984-05-01Not applicableUs
GlyburideTablet1.25 mg/1OralAphena Pharma Solutions Tennessee, Inc.1984-05-01Not applicableUs
GlyburideTablet2.5 mg/1OralPd Rx Pharmaceuticals, Inc.1984-05-01Not applicableUs
Glyburide Tablets 2.5mgTablet2.5 mgOralPrempharm Inc1996-12-302005-08-05Canada
Glyburide Tablets 5mgTablet5 mgOralPrempharm Inc1996-12-302005-08-05Canada
Glyburide-2.5 Tab 2.5mgTablet2.5 mgOralPro Doc Limitee1992-12-31Not applicableCanada
Glyburide-5 Tab 5mgTablet5 mgOralPro Doc Limitee1992-12-312010-07-13Canada
GlynaseTablet1.5 mg/1OralPharmacia & Upjohn Inc1992-03-04Not applicableUs
GlynaseTablet3 mg/1OralPharmacia & Upjohn Inc1992-03-04Not applicableUs
GlynaseTablet6 mg/1OralPharmacia & Upjohn Inc1992-03-04Not applicableUs
Med Glybe Tab 2.5mgTablet2.5 mgOralMedican Pharma Incorporated1995-12-312011-03-29Canada
Med Glybe Tab 5mgTablet5 mgOralMedican Pharma Incorporated1994-12-312011-03-29Canada
Mylan-glybeTablet5 mgOralMylan Pharmaceuticals1991-12-312017-01-11Canada
Mylan-glybeTablet2.5 mgOralMylan Pharmaceuticals1991-12-312017-01-11Canada
Ntp-glyburideTablet2.5 mgOralTevaNot applicableNot applicableCanada
Ntp-glyburideTablet5 mgOralTevaNot applicableNot applicableCanada
Nu-glyburide Tab 2.5mgTablet2.5 mgOralNu Pharm Inc1993-12-312012-09-04Canada
Nu-glyburide Tab 5mgTablet5 mgOralNu Pharm Inc1993-12-312012-09-04Canada
Penta-glyburide - 2.5mgTablet2.5 mgOralPentapharm Ltd.1997-06-252004-07-30Canada
Penta-glyburide - 5mgTablet5 mgOralPentapharm Ltd.1997-06-252004-07-30Canada
PMS-glyburideTablet2.5 mgOralPharmascience Inc1998-01-292009-11-19Canada
PMS-glyburideTablet5 mgOralPharmascience Inc1998-01-29Not applicableCanada
Pro-glyburideTablet5 mgOralPro Doc Limitee2009-02-10Not applicableCanada
Ratio-glyburideTablet5 mgOralRatiopharm Inc Division Of Teva Canada Limited1990-12-312014-09-19Canada
Ratio-glyburideTablet2.5 mgOralRatiopharm Inc Division Of Teva Canada Limited1990-12-312014-09-19Canada
Riva-glyburideTablet2.5 mgOralLaboratoire Riva Inc2000-05-232013-07-31Canada
Riva-glyburideTablet5 mgOralPharmel Inc1998-06-04Not applicableCanada
Riva-glyburideTablet5 mgOralLaboratoire Riva Inc2000-05-23Not applicableCanada
Riva-glyburideTablet2.5 mgOralPharmel Inc1998-06-042010-02-16Canada
Sandoz GlyburideTablet5 mgOralSandoz Canada Incorporated2003-08-13Not applicableCanada
Sandoz GlyburideTablet2.5 mgOralSandoz Canada Incorporated2003-08-13Not applicableCanada
Teva-glyburideTablet2.5 mgOralTeva1991-12-31Not applicableCanada
Teva-glyburideTablet5 mgOralTeva1991-12-31Not applicableCanada
Approved Generic Prescription Products
NameDosageStrengthRouteLabellerMarketing StartMarketing End
Apo Glyburide Tab 2.5mgTablet2.5 mgOralApotex Corporation1991-12-31Not applicableCanada
Apo Glyburide Tab 5mgTablet5 mgOralApotex Corporation1991-12-31Not applicableCanada
GlyburideTablet2.5 mg/1OralNucare Pharmaceuticals, Inc.1995-08-30Not applicableUs
GlyburideTablet3 mg/1OralWest Ward Pharmaceutical2003-08-01Not applicableUs
GlyburideTablet2.5 mg/1OralA S Medication Solutions1995-08-30Not applicableUs
GlyburideTablet5 mg/1Oralbryant ranch prepack1995-08-30Not applicableUs
GlyburideTablet5 mg/1OralAurobindo Pharma2007-10-18Not applicableUs
GlyburideTablet2.5 mg/1OralMajor2002-08-06Not applicableUs
GlyburideTablet3 mg/1OralPhysicians Total Care, Inc.1999-02-24Not applicableUs
GlyburideTablet1.25 mg/1OralHeritage2010-10-05Not applicableUs
GlyburideTablet1.25 mg/1OralCore Pharma, Llc2016-06-01Not applicableUs
GlyburideTablet5 mg/1OralTeva1995-08-30Not applicableUs
GlyburideTablet2.5 mg/1OralCitron Pharma LLC2007-10-18Not applicableUs
GlyburideTablet2.5 mg/1OralNucare Pharmaceuticals, Inc.2010-10-05Not applicableUs
GlyburideTablet1.25 mg/1OralMajor2002-08-06Not applicableUs
GlyburideTablet2.5 mg/1OralClinical Solutions Wholsesale1995-08-30Not applicableUs
GlyburideTablet2.5 mg/1OralMylan Institutional1996-07-30Not applicableUs
GlyburideTablet3 mg/1OralDAVA Pharmaceuticals, Inc.1997-12-22Not applicableUs
GlyburideTablet6 mg/1OralRebel Distributors1999-05-12Not applicableUs
GlyburideTablet5 mg/1OralLake Erie Medical Dba Quality Care Produts Llc2011-02-23Not applicableUs
GlyburideTablet3 mg/1OralPd Rx Pharmaceuticals, Inc.1999-09-17Not applicableUs
GlyburideTablet6 mg/1OralWest Ward Pharmaceutical2003-08-01Not applicableUs
GlyburideTablet5 mg/1OralA S Medication Solutions2010-10-05Not applicableUs
GlyburideTablet2.5 mg/1Oralbryant ranch prepack1995-08-30Not applicableUs
GlyburideTablet5 mg/1OralMed Vantx, Inc.2011-07-18Not applicableUs
GlyburideTablet5 mg/1OralMajor2002-08-06Not applicableUs
GlyburideTablet1.5 mg/1OralTeva1999-05-11Not applicableUs
GlyburideTablet6 mg/1OralPhysicians Total Care, Inc.2003-07-02Not applicableUs
GlyburideTablet2.5 mg/1OralHeritage2010-10-05Not applicableUs
GlyburideTablet2.5 mg/1OralCore Pharma, Llc2016-06-01Not applicableUs
GlyburideTablet1.5 mg/1OralMylan Pharmaceuticals1999-09-17Not applicableUs
GlyburideTablet5 mg/1OralCitron Pharma LLC2007-10-18Not applicableUs
GlyburideTablet5 mg/1OralNucare Pharmaceuticals, Inc.2010-10-05Not applicableUs
GlyburideTablet2.5 mg/1OralRemedy Repack2016-11-28Not applicableUs
GlyburideTablet5 mg/1OralMylan Institutional1996-07-30Not applicableUs
GlyburideTablet6 mg/1OralDAVA Pharmaceuticals, Inc.1997-12-22Not applicableUs
GlyburideTablet2.5 mg/1OralProficient Rx LP2010-10-05Not applicableUs
GlyburideTablet2.5 mg/1OralAv Kare, Inc.2014-09-25Not applicableUs
GlyburideTablet2.5 mg/1OralUnit Dose Services2010-10-05Not applicableUs
GlyburideTablet6 mg/1OralPd Rx Pharmaceuticals, Inc.1999-09-17Not applicableUs
GlyburideTablet2.5 mg/1OralRemedy Repack2009-12-30Not applicableUs
GlyburideTablet5 mg/1OralA S Medication Solutions2007-10-18Not applicableUs
GlyburideTablet1.25 mg/1Oralbryant ranch prepack2010-10-05Not applicableUs
GlyburideTablet2.5 mg/1OralDispensing Solutions, Inc.2010-10-05Not applicableUs
GlyburideTablet2.5 mg/1OralBlenheim Pharmacal, Inc.2013-11-15Not applicableUs
GlyburideTablet3 mg/1OralTeva1999-05-11Not applicableUs
GlyburideTablet1.5 mg/1OralPhysicians Total Care, Inc.2006-12-07Not applicableUs
GlyburideTablet5 mg/1OralHeritage2010-10-05Not applicableUs
GlyburideTablet5 mg/1OralCore Pharma, Llc2016-06-01Not applicableUs
GlyburideTablet3 mg/1OralMylan Pharmaceuticals1999-09-17Not applicableUs
GlyburideTablet6 mg/1OralHikma Pharmaceutical2003-08-01Not applicableUs
GlyburideTablet1.25 mg/1OralZydus Pharmaceuticals Usa, Inc.2016-06-02Not applicableUs
GlyburideTablet5 mg/1OralZydus Pharmaceuticals Usa, Inc.2016-06-02Not applicableUs
GlyburideTablet5 mg/1OralMc Kesson Packaging Services A Buisness Unit Of Mc Kesson Corporation1995-08-30Not applicableUs
GlyburideTablet5 mg/1OralMc Kesson Contract Packaging2012-01-09Not applicableUs
GlyburideTablet5 mg/1OralProficient Rx LP2010-10-05Not applicableUs
GlyburideTablet5 mg/1OralAv Kare, Inc.2014-09-25Not applicableUs
GlyburideTablet2.5 mg/1OralRemedy Repack2013-07-012017-01-04Us
GlyburideTablet5 mg/1OralCardinal Health2011-05-13Not applicableUs
GlyburideTablet5 mg/1Oralbryant ranch prepack2010-10-05Not applicableUs
GlyburideTablet5 mg/1OralClinical Solutions Wholsesale1995-08-30Not applicableUs
GlyburideTablet1.25 mg/1OralTrupharma, Llc2016-06-01Not applicableUs
GlyburideTablet1.5 mg/1OralHikma Pharmaceutical2003-08-01Not applicableUs
GlyburideTablet5 mg/1OralTYA Pharmaceuticals2010-10-05Not applicableUs
GlyburideTablet5 mg/1OralBlenheim Pharmacal, Inc.2013-10-01Not applicableUs
GlyburideTablet6 mg/1OralTeva1999-05-12Not applicableUs
GlyburideTablet5 mg/1OralCardinal Health2010-08-04Not applicableUs
GlyburideTablet5 mg/1OralAidarex Pharmaceuticals LLC2010-10-05Not applicableUs
GlyburideTablet1.25 mg/1OralCadila Pharnmaceuticals2016-06-02Not applicableUs
GlyburideTablet6 mg/1OralMylan Pharmaceuticals1999-09-17Not applicableUs
GlyburideTablet3 mg/1OralHikma Pharmaceutical2003-08-01Not applicableUs
GlyburideTablet2.5 mg/1OralZydus Pharmaceuticals Usa, Inc.2016-06-02Not applicableUs
GlyburideTablet2.5 mg/1OralA S Medication Solutions2007-10-18Not applicableUs
GlyburideTablet2.5 mg/1OralPreferreed Pharmaceuticals Inc.2017-01-30Not applicableUs
GlyburideTablet6 mg/1OralDispensing Solutions, Inc.1999-05-12Not applicableUs
GlyburideTablet2.5 mg/1OralCore Pharma, Llc2002-08-062015-12-29Us
GlyburideTablet5 mg/1OralMesource Pharmaceuticals2010-10-05Not applicableUs
GlyburideTablet5 mg/1OralPhysicians Total Care, Inc.1994-04-26Not applicableUs
GlyburideTablet2.5 mg/1Oralbryant ranch prepack2010-10-05Not applicableUs
GlyburideTablet5 mg/1OralA S Medication Solutions2016-06-02Not applicableUs
GlyburideTablet5 mg/1OralA S Medication Solutions2007-10-18Not applicableUs
GlyburideTablet2.5 mg/1OralRemedy Repack2015-03-27Not applicableUs
GlyburideTablet2.5 mg/1OralDirectrx2015-12-03Not applicableUs
GlyburideTablet1.25 mg/1OralAurobindo Pharma2007-10-18Not applicableUs
GlyburideTablet2.5 mg/1OralPhysicians Total Care, Inc.1994-08-26Not applicableUs
GlyburideTablet2.5 mg/1OralRebel Distributors2002-08-06Not applicableUs
GlyburideTablet2.5 mg/1OralTrupharma, Llc2016-06-01Not applicableUs
GlyburideTablet1.25 mg/1OralTeva1995-08-30Not applicableUs
GlyburideTablet5 mg/1OralPd Rx Pharmaceuticals, Inc.2002-08-062017-02-24Us
GlyburideTablet2.5 mg/1OralAidarex Pharmaceuticals LLC2010-10-05Not applicableUs
GlyburideTablet2.5 mg/1OralCadila Pharnmaceuticals2016-06-02Not applicableUs
GlyburideTablet5 mg/1OralNcs Health Care Of Ky, Inc Dba Vangard Labs1995-08-30Not applicableUs
GlyburideTablet2.5 mg/1OralRemedy Repack2011-07-182017-11-09Us
GlyburideTablet5 mg/1OralRemedy Repack2013-03-28Not applicableUs
GlyburideTablet5 mg/1OralContract Pharmacy Services Pa2002-08-06Not applicableUs
GlyburideTablet5 mg/1OralCore Pharma, Llc2002-08-062015-12-29Us
GlyburideTablet1.25 mg/1OralLake Erie Medical Dba Quality Care Produts Llc1995-08-30Not applicableUs
GlyburideTablet5 mg/1OralRemedy Repack2010-10-112016-10-13Us
GlyburideTablet5 mg/1OralUnit Dose Services1995-08-30Not applicableUs
GlyburideTablet1.5 mg/1OralWest Ward Pharmaceutical2003-08-01Not applicableUs
GlyburideTablet5 mg/1OralPreferreed Pharmaceuticals Inc.2015-08-27Not applicableUs
GlyburideTablet5 mg/1OralDirectrx2015-12-03Not applicableUs
GlyburideTablet2.5 mg/1OralAurobindo Pharma2007-10-18Not applicableUs
GlyburideTablet1.25 mg/1OralPhysicians Total Care, Inc.1994-11-18Not applicableUs
GlyburideTablet5 mg/1OralRebel Distributors2002-08-06Not applicableUs
GlyburideTablet5 mg/1OralTrupharma, Llc2016-06-01Not applicableUs
GlyburideTablet2.5 mg/1OralTeva1995-08-30Not applicableUs
GlyburideTablet1.25 mg/1OralCitron Pharma LLC2007-10-18Not applicableUs
GlyburideTablet2.5 mg/1OralLake Erie Medical Dba Quality Care Produts Llc1995-08-30Not applicableUs
GlyburideTablet5 mg/1OralCadila Pharnmaceuticals2016-06-02Not applicableUs
GlyburideTablet2.5 mg/1OralNcs Health Care Of Ky, Inc Dba Vangard Labs1995-08-30Not applicableUs
GlyburideTablet5 mg/1OralAmerincan Health Packaging2014-08-222017-06-30Us
GlyburideTablet5 mg/1OralPreferreed Pharmaceuticals Inc.2012-01-30Not applicableUs
GlyburideTablet1.5 mg/1OralDAVA Pharmaceuticals, Inc.1997-12-22Not applicableUs
GlyburideTablet5 mg/1OralRebel Distributors2010-10-05Not applicableUs
GlyburideTablet2.5 mg/1OralRemedy Repack2011-07-082016-10-26Us
Approved Over the Counter ProductsNot Available
Unapproved/Other Products Not Available
International Brands
DaonilNot Available
DelmideNot Available
MicronaseNot Available
Semi-DaonilNot Available
Brand mixtures
GlucovanceBristol Myers Squibb
Glyburide (micronized) and Metformin HydrochlorideActavis Pharma Manufacturing Pvt. Ltd.
Glyburide and MetforminRebel Distributors
Glyburide and Metformin HydrochlorideTeva
Glyburide-metformin HydrochlorideBlenheim Pharmacal, Inc.
CAS number10238-21-8
WeightAverage: 494.004
Monoisotopic: 493.143819418
Chemical FormulaC23H28ClN3O5S

Indicated as an adjunct to diet to lower the blood glucose in patients with NIDDM whose hyperglycemia cannot be satisfactorily controlled by diet alone.

Structured Indications

Glyburide, a second-generation sulfonylurea antidiabetic agent, lowers blood glucose acutely by stimulating the release of insulin from the pancreas, an effect dependent upon functioning beta cells in the pancreatic islets. With chronic administration in Type II diabetic patients, the blood glucose lowering effect persists despite a gradual decline in the insulin secretory response to the drug. Extrapancreatic effects may be involved in the mechanism of action of oral sulfonyl-urea hypoglycemic drugs. The combination of glibenclamide and metformin may have a synergistic effect, since both agents act to improve glucose tolerance by different but complementary mechanisms. In addition to its blood glucose lowering actions, glyburide produces a mild diuresis by enhancement of renal free water clearance. Glyburide is twice as potent as the related second-generation agent glipizide.

Mechanism of action

Sulfonylureas such as glyburide bind to ATP-sensitive potassium channels on the pancreatic cell surface, reducing potassium conductance and causing depolarization of the membrane. Depolarization stimulates calcium ion influx through voltage-sensitive calcium channels, raising intracellular concentrations of calcium ions, which induces the secretion, or exocytosis, of insulin.

TargetKindPharmacological actionActionsOrganismUniProt ID
Sulfonylurea receptor 1, Kir6.2Protein groupyes
Humannot applicabledetails
G protein-activated inward rectifier potassium channel 4Proteinunknown
HumanP48544 details
ATP-binding cassette sub-family C member 9Proteinunknown
HumanO60706 details
Bile salt export pumpProteinunknown
HumanO95342 details
ATP-binding cassette sub-family A member 1Proteinunknown
HumanO95477 details
Cystic fibrosis transmembrane conductance regulatorProteinunknown
HumanP13569 details
Mitochondrial ATP-sensitive potassium channelProtein groupunknownNot AvailableHumannot applicabledetails
Carnitine O-palmitoyltransferase 1, liver isoformProteinunknownNot AvailableHumanP50416 details
Related Articles

Significant absorption within 1 hour and peak plasma levels are reached in 2 to 4 hours. Onset of action occurs within one hour.

Volume of distribution

Steady state Vd=0.125 L/kg; Vd during elimination phase=0.155 L/kg.

Protein binding

Unchanged drug is ~99% bound to serum proteins; 4-trans-hydroxyglyburide is greater than 97% bound to serum proteins. Protein binding is primarily nonionic making glyburide and is less likely to displace or be displaced by drugs that bind via an ionic mechanism.


Primarily hepatic (mainly cytochrome P450 3A4). The major metabolite is the 4-trans-hydroxy derivative. A second metabolite, the 3-cis-hydroxy derivative, also occurs. These metabolites do not contribute clinically significant hypoglycemic action in humans as they are only weakly active; however, retention of 4-trans-hydroxyglyburide may prolong the hypoglycemic effect of the agent in those with severe renal impairment.

2-trans-Hydroxycyclohexyl glyburideDetails
4-cis-Hydroxycyclohexyl glyburideDetails
4-trans-Hydroxycyclohexyl glyburideDetails
3-trans-Hydroxycyclohexyl glyburideDetails
3-cis-Hydroxycyclohexyl glyburideDetails
Route of elimination

Glyburide is excreted as metabolites in the bile and urine, approximately 50% by each route. This dual excretory pathway is qualitatively different from that of other sulfonylureas, which are excreted primarily in the urine.

Half life

1.4-1.8 hours (unchanged drug only); 10 hours (metabolites included). Duration of effect is 12-24 hours. The half-life of glyburide appears to be unaffected in those with a creatinine clearance of greater than 29 ml/min/1.73m2.


78 ml/hr/kg in healthy adults. Clearance may be substantially decreased in those with severe renal impairment.


Oral rat LD50: > 20,000 mg/kg. Oral mouse LD50: 3250 mg/kg.

Affected organisms
  • Humans and other mammals
PathwayCategorySMPDB ID
Glibenclamide Action PathwayDrug actionSMP00460
Pharmacogenomic Effects/ADRs
Interacting Gene/EnzymeAllele nameGenotype(s)Defining Change(s)Type(s)DescriptionDetails
Glucose-6-phosphate 1-dehydrogenaseVilleurbanne---1000_1002delACCADR InferredIncreased risk of hemolytic anemia. Details
Glucose-6-phosphate 1-dehydrogenaseTorun---1006A->GADR InferredIncreased risk of hemolytic anemia. Details
Glucose-6-phosphate 1-dehydrogenaseSunderland---105_107delCATADR InferredIncreased risk of hemolytic anemia. Details
Glucose-6-phosphate 1-dehydrogenaseIwatsuki---1081G->AADR InferredIncreased risk of hemolytic anemia. Details
Glucose-6-phosphate 1-dehydrogenaseSerres---1082C->TADR InferredIncreased risk of hemolytic anemia. Details
Glucose-6-phosphate 1-dehydrogenaseTondela---1084_1101delCTGAACGAGCGCAAGGCCADR InferredIncreased risk of hemolytic anemia. Details
Glucose-6-phosphate 1-dehydrogenaseLoma Linda---1089C->AADR InferredIncreased risk of hemolytic anemia. Details
Glucose-6-phosphate 1-dehydrogenaseAachen---1089C->GADR InferredIncreased risk of hemolytic anemia. Details
Glucose-6-phosphate 1-dehydrogenaseTenri---1096A->GADR InferredIncreased risk of hemolytic anemia. Details
Glucose-6-phosphate 1-dehydrogenaseMontpellier---1132G>AADR InferredIncreased risk of hemolytic anemia. Details
Glucose-6-phosphate 1-dehydrogenaseCalvo Mackenna---1138A->GADR InferredIncreased risk of hemolytic anemia. Details
Glucose-6-phosphate 1-dehydrogenaseRiley---1139T->CADR InferredIncreased risk of hemolytic anemia. Details
Glucose-6-phosphate 1-dehydrogenaseOlomouc---1141T->CADR InferredIncreased risk of hemolytic anemia. Details
Glucose-6-phosphate 1-dehydrogenaseTomah---1153T->CADR InferredIncreased risk of hemolytic anemia. Details
Glucose-6-phosphate 1-dehydrogenaseLynwood---1154G->TADR InferredIncreased risk of hemolytic anemia. Details
Glucose-6-phosphate 1-dehydrogenaseMadrid---1155C->GADR InferredIncreased risk of hemolytic anemia. Details
Glucose-6-phosphate 1-dehydrogenaseIowa, Walter Reed, Springfield---1156A->GADR InferredIncreased risk of hemolytic anemia. Details
Glucose-6-phosphate 1-dehydrogenaseBeverly Hills, Genova, Iwate, Niigata, Yamaguchi---1160G->AADR InferredIncreased risk of hemolytic anemia. Details
Glucose-6-phosphate 1-dehydrogenaseHartford---1162A->GADR InferredIncreased risk of hemolytic anemia. Details
Glucose-6-phosphate 1-dehydrogenasePraha---1166A->GADR InferredIncreased risk of hemolytic anemia. Details
Glucose-6-phosphate 1-dehydrogenaseKrakow---1175T>CADR InferredIncreased risk of hemolytic anemia. Details
Glucose-6-phosphate 1-dehydrogenaseWisconsin---1177C->GADR InferredIncreased risk of hemolytic anemia. Details
Glucose-6-phosphate 1-dehydrogenaseNashville, Anaheim, Portici---1178G->AADR InferredIncreased risk of hemolytic anemia. Details
Glucose-6-phosphate 1-dehydrogenaseAlhambra---1180G->CADR InferredIncreased risk of hemolytic anemia. Details
Glucose-6-phosphate 1-dehydrogenaseBari---1187C->TADR InferredIncreased risk of hemolytic anemia. Details
Glucose-6-phosphate 1-dehydrogenasePuerto Limon---1192G->AADR InferredIncreased risk of hemolytic anemia. Details
Glucose-6-phosphate 1-dehydrogenaseCovao do Lobo---1205C>AADR InferredIncreased risk of hemolytic anemia. Details
Glucose-6-phosphate 1-dehydrogenaseClinic---1215G->AADR InferredIncreased risk of hemolytic anemia. Details
Glucose-6-phosphate 1-dehydrogenaseUtrecht---1225C->TADR InferredIncreased risk of hemolytic anemia. Details
Glucose-6-phosphate 1-dehydrogenaseSuwalki---1226C->GADR InferredIncreased risk of hemolytic anemia. Details
Glucose-6-phosphate 1-dehydrogenaseRiverside---1228G->TADR InferredIncreased risk of hemolytic anemia. Details
Glucose-6-phosphate 1-dehydrogenaseJapan, Shinagawa---1229G->AADR InferredIncreased risk of hemolytic anemia. Details
Glucose-6-phosphate 1-dehydrogenaseKawasaki---1229G->CADR InferredIncreased risk of hemolytic anemia. Details
Glucose-6-phosphate 1-dehydrogenaseMunich---1231A->GADR InferredIncreased risk of hemolytic anemia. Details
Glucose-6-phosphate 1-dehydrogenaseGeorgia---1284C->AADR InferredIncreased risk of hemolytic anemia. Details
Glucose-6-phosphate 1-dehydrogenaseSumare---1292T->GADR InferredIncreased risk of hemolytic anemia. Details
Glucose-6-phosphate 1-dehydrogenaseTelti/Kobe---1318C->TADR InferredIncreased risk of hemolytic anemia. Details
Glucose-6-phosphate 1-dehydrogenaseSantiago de Cuba, Morioka---1339G->AADR InferredIncreased risk of hemolytic anemia. Details
Glucose-6-phosphate 1-dehydrogenaseHarima---1358T->AADR InferredIncreased risk of hemolytic anemia. Details
Glucose-6-phosphate 1-dehydrogenaseFiguera da Foz---1366G->CADR InferredIncreased risk of hemolytic anemia. Details
Glucose-6-phosphate 1-dehydrogenaseAmiens---1367A>TADR InferredIncreased risk of hemolytic anemia. Details
Glucose-6-phosphate 1-dehydrogenaseBangkok Noi---1376G->T, 1502T->GADR InferredIncreased risk of hemolytic anemia. Details
Glucose-6-phosphate 1-dehydrogenaseFukaya---1462G->AADR InferredIncreased risk of hemolytic anemia. Details
Glucose-6-phosphate 1-dehydrogenaseCampinas---1463G->TADR InferredIncreased risk of hemolytic anemia. Details
Glucose-6-phosphate 1-dehydrogenaseBuenos Aires---1465C>TADR InferredIncreased risk of hemolytic anemia. Details
Glucose-6-phosphate 1-dehydrogenaseArakawa---1466C->TADR InferredIncreased risk of hemolytic anemia. Details
Glucose-6-phosphate 1-dehydrogenaseBrighton---1488_1490delGAAADR InferredIncreased risk of hemolytic anemia. Details
Glucose-6-phosphate 1-dehydrogenaseKozukata---159G->CADR InferredIncreased risk of hemolytic anemia. Details
Glucose-6-phosphate 1-dehydrogenaseAmsterdam---180_182delTCTADR InferredIncreased risk of hemolytic anemia. Details
Glucose-6-phosphate 1-dehydrogenaseNo name---202G->A, 376A->G, 1264C>GADR InferredIncreased risk of hemolytic anemia. Details
Glucose-6-phosphate 1-dehydrogenaseSwansea---224T->CADR InferredIncreased risk of hemolytic anemia. Details
Glucose-6-phosphate 1-dehydrogenaseUrayasu---281_283delAGAADR InferredIncreased risk of hemolytic anemia. Details
Glucose-6-phosphate 1-dehydrogenaseVancouver---317C->G544C->T592C->TADR InferredIncreased risk of hemolytic anemia. Details
Glucose-6-phosphate 1-dehydrogenaseMt Sinai---376A->G, 1159C->TADR InferredIncreased risk of hemolytic anemia. Details
Glucose-6-phosphate 1-dehydrogenasePlymouth---488G->AADR InferredIncreased risk of hemolytic anemia. Details
Glucose-6-phosphate 1-dehydrogenaseVolendam---514C->TADR InferredIncreased risk of hemolytic anemia. Details
Glucose-6-phosphate 1-dehydrogenaseShinshu---527A->GADR InferredIncreased risk of hemolytic anemia. Details
Glucose-6-phosphate 1-dehydrogenaseChikugo---535A->TADR InferredIncreased risk of hemolytic anemia. Details
Glucose-6-phosphate 1-dehydrogenaseTsukui---561_563delCTCADR InferredIncreased risk of hemolytic anemia. Details
Glucose-6-phosphate 1-dehydrogenasePedoplis-Ckaro---573C>GADR InferredIncreased risk of hemolytic anemia. Details
Glucose-6-phosphate 1-dehydrogenaseSantiago---593G->CADR InferredIncreased risk of hemolytic anemia. Details
Glucose-6-phosphate 1-dehydrogenaseMinnesota, Marion, Gastonia, LeJeune---637G->TADR InferredIncreased risk of hemolytic anemia. Details
Glucose-6-phosphate 1-dehydrogenaseCincinnati---637G->T, 1037A->TADR InferredIncreased risk of hemolytic anemia. Details
Glucose-6-phosphate 1-dehydrogenaseHarilaou---648T->GADR InferredIncreased risk of hemolytic anemia. Details
Glucose-6-phosphate 1-dehydrogenaseNorth Dallas---683_685delACAADR InferredIncreased risk of hemolytic anemia. Details
Glucose-6-phosphate 1-dehydrogenaseAsahikawa---695G->AADR InferredIncreased risk of hemolytic anemia. Details
Glucose-6-phosphate 1-dehydrogenaseDurham---713A->GADR InferredIncreased risk of hemolytic anemia. Details
Glucose-6-phosphate 1-dehydrogenaseStonybrook---724_729delGGCACTADR InferredIncreased risk of hemolytic anemia. Details
Glucose-6-phosphate 1-dehydrogenaseWayne---769C->GADR InferredIncreased risk of hemolytic anemia. Details
Glucose-6-phosphate 1-dehydrogenaseAveiro---806G->AADR InferredIncreased risk of hemolytic anemia. Details
Glucose-6-phosphate 1-dehydrogenaseCleveland Corum---820G->AADR InferredIncreased risk of hemolytic anemia. Details
Glucose-6-phosphate 1-dehydrogenaseLille---821A>TADR InferredIncreased risk of hemolytic anemia. Details
Glucose-6-phosphate 1-dehydrogenaseBangkok---825G>CADR InferredIncreased risk of hemolytic anemia. Details
Glucose-6-phosphate 1-dehydrogenaseSugao---826C->TADR InferredIncreased risk of hemolytic anemia. Details
Glucose-6-phosphate 1-dehydrogenaseLa Jolla---832T->CADR InferredIncreased risk of hemolytic anemia. Details
Glucose-6-phosphate 1-dehydrogenaseWexham---833C->TADR InferredIncreased risk of hemolytic anemia. Details
Glucose-6-phosphate 1-dehydrogenasePiotrkow---851T>CADR InferredIncreased risk of hemolytic anemia. Details
Glucose-6-phosphate 1-dehydrogenaseWest Virginia---910G->TADR InferredIncreased risk of hemolytic anemia. Details
Glucose-6-phosphate 1-dehydrogenaseOmiya---921G->CADR InferredIncreased risk of hemolytic anemia. Details
Glucose-6-phosphate 1-dehydrogenaseNara---953_976delCCACCAAAGGGTACCTGGAC GACCADR InferredIncreased risk of hemolytic anemia. Details
Glucose-6-phosphate 1-dehydrogenaseManhattan---962G->AADR InferredIncreased risk of hemolytic anemia. Details
Glucose-6-phosphate 1-dehydrogenaseRehevot---964T->CADR InferredIncreased risk of hemolytic anemia. Details
Glucose-6-phosphate 1-dehydrogenaseHoniara---99A->G / 1360C->TADR InferredIncreased risk of hemolytic anemia. Details
Glucose-6-phosphate 1-dehydrogenaseTokyo, Fukushima---1246G->AADR InferredIncreased risk of hemolytic anemia. Details
Glucose-6-phosphate 1-dehydrogenaseChatham---1003G->AADR InferredIncreased risk of hemolytic anemia. Details
Glucose-6-phosphate 1-dehydrogenaseFushan---1004C->AADR InferredIncreased risk of hemolytic anemia. Details
Glucose-6-phosphate 1-dehydrogenasePartenope---1052G->TADR InferredIncreased risk of hemolytic anemia. Details
Glucose-6-phosphate 1-dehydrogenaseIerapetra---1057C->TADR InferredIncreased risk of hemolytic anemia. Details
Glucose-6-phosphate 1-dehydrogenaseAnadia---1193A->GADR InferredIncreased risk of hemolytic anemia. Details
Glucose-6-phosphate 1-dehydrogenaseAbeno---1220A->CADR InferredIncreased risk of hemolytic anemia. Details
Glucose-6-phosphate 1-dehydrogenaseSurabaya---1291G->AADR InferredIncreased risk of hemolytic anemia. Details
Glucose-6-phosphate 1-dehydrogenasePawnee---1316G->CADR InferredIncreased risk of hemolytic anemia. Details
Glucose-6-phosphate 1-dehydrogenaseS. Antioco---1342A->GADR InferredIncreased risk of hemolytic anemia. Details
Glucose-6-phosphate 1-dehydrogenaseCassano---1347G->CADR InferredIncreased risk of hemolytic anemia. Details
Glucose-6-phosphate 1-dehydrogenaseHermoupolis---1347G->C / 1360C->TADR InferredIncreased risk of hemolytic anemia. Details
Glucose-6-phosphate 1-dehydrogenaseUnion,Maewo, Chinese-2, Kalo---1360C->TADR InferredIncreased risk of hemolytic anemia. Details
Glucose-6-phosphate 1-dehydrogenaseAndalus---1361G->AADR InferredIncreased risk of hemolytic anemia. Details
Glucose-6-phosphate 1-dehydrogenaseCosenza---1376G->CADR InferredIncreased risk of hemolytic anemia. Details
Glucose-6-phosphate 1-dehydrogenaseCanton, Taiwan- Hakka, Gifu-like, Agrigento-like---1376G->TADR InferredIncreased risk of hemolytic anemia. Details
Glucose-6-phosphate 1-dehydrogenaseFlores---1387C->AADR InferredIncreased risk of hemolytic anemia. Details
Glucose-6-phosphate 1-dehydrogenaseKaiping, Anant, Dhon, Sapporo-like, Wosera---1388G->AADR InferredIncreased risk of hemolytic anemia. Details
Glucose-6-phosphate 1-dehydrogenaseKamogawa---169C->TADR InferredIncreased risk of hemolytic anemia. Details
Glucose-6-phosphate 1-dehydrogenaseCostanzo---179T>CADR InferredIncreased risk of hemolytic anemia. Details
Glucose-6-phosphate 1-dehydrogenaseAmazonia---185C->AADR InferredIncreased risk of hemolytic anemia. Details
Glucose-6-phosphate 1-dehydrogenaseSongklanagarind---196T->AADR InferredIncreased risk of hemolytic anemia. Details
Glucose-6-phosphate 1-dehydrogenaseHechi---202G->A / 871G->AADR InferredIncreased risk of hemolytic anemia. Details
Glucose-6-phosphate 1-dehydrogenaseNamouru---208T->CADR InferredIncreased risk of hemolytic anemia. Details
Glucose-6-phosphate 1-dehydrogenaseBao Loc---352T>CADR InferredIncreased risk of hemolytic anemia. Details
Glucose-6-phosphate 1-dehydrogenaseCrispim---375G->T, 379G->T383T->C384C>TADR InferredIncreased risk of hemolytic anemia. Details
Glucose-6-phosphate 1-dehydrogenaseAcrokorinthos---376A->G / 463C->GADR InferredIncreased risk of hemolytic anemia. Details
Glucose-6-phosphate 1-dehydrogenaseSanta Maria---376A->G / 542A->TADR InferredIncreased risk of hemolytic anemia. Details
Glucose-6-phosphate 1-dehydrogenaseAnanindeua---376A->G / 871G->AADR InferredIncreased risk of hemolytic anemia. Details
Glucose-6-phosphate 1-dehydrogenaseVanua Lava---383T->CADR InferredIncreased risk of hemolytic anemia. Details
Glucose-6-phosphate 1-dehydrogenaseValladolid---406C->TADR InferredIncreased risk of hemolytic anemia. Details
Glucose-6-phosphate 1-dehydrogenaseBelem---409C->TADR InferredIncreased risk of hemolytic anemia. Details
Glucose-6-phosphate 1-dehydrogenaseLiuzhou---442G->AADR InferredIncreased risk of hemolytic anemia. Details
Glucose-6-phosphate 1-dehydrogenaseShenzen---473G>AADR InferredIncreased risk of hemolytic anemia. Details
Glucose-6-phosphate 1-dehydrogenaseTaipei “Chinese- 3”---493A->GADR InferredIncreased risk of hemolytic anemia. Details
Glucose-6-phosphate 1-dehydrogenaseToledo---496C>TADR InferredIncreased risk of hemolytic anemia. Details
Glucose-6-phosphate 1-dehydrogenaseNaone---497G->AADR InferredIncreased risk of hemolytic anemia. Details
Glucose-6-phosphate 1-dehydrogenaseNankang---517T->CADR InferredIncreased risk of hemolytic anemia. Details
Glucose-6-phosphate 1-dehydrogenaseMiaoli---519C->GADR InferredIncreased risk of hemolytic anemia. Details
Glucose-6-phosphate 1-dehydrogenaseMediterranean, Dallas, Panama‚ Sassari, Cagliari, Birmingham---563C->TADR InferredIncreased risk of hemolytic anemia. Details
Glucose-6-phosphate 1-dehydrogenaseCoimbra Shunde---592C->TADR InferredIncreased risk of hemolytic anemia. Details
Glucose-6-phosphate 1-dehydrogenaseNilgiri---593G>AADR InferredIncreased risk of hemolytic anemia. Details
Glucose-6-phosphate 1-dehydrogenaseRadlowo---679C->TADR InferredIncreased risk of hemolytic anemia. Details
Glucose-6-phosphate 1-dehydrogenaseRoubaix---811G>CADR InferredIncreased risk of hemolytic anemia. Details
Glucose-6-phosphate 1-dehydrogenaseHaikou---835A->GADR InferredIncreased risk of hemolytic anemia. Details
Glucose-6-phosphate 1-dehydrogenaseChinese-1---835A->TADR InferredIncreased risk of hemolytic anemia. Details
Glucose-6-phosphate 1-dehydrogenaseMizushima---848A>GADR InferredIncreased risk of hemolytic anemia. Details
Glucose-6-phosphate 1-dehydrogenaseOsaka---853C->TADR InferredIncreased risk of hemolytic anemia. Details
Glucose-6-phosphate 1-dehydrogenaseViangchan, Jammu---871G->AADR InferredIncreased risk of hemolytic anemia. Details
Glucose-6-phosphate 1-dehydrogenaseSeoul---916G->AADR InferredIncreased risk of hemolytic anemia. Details
Glucose-6-phosphate 1-dehydrogenaseLudhiana---929G->AADR InferredIncreased risk of hemolytic anemia. Details
Glucose-6-phosphate 1-dehydrogenaseFarroupilha---977C->AADR InferredIncreased risk of hemolytic anemia. Details
Glucose-6-phosphate 1-dehydrogenaseChinese-5---1024C->TADR InferredIncreased risk of hemolytic anemia. Details
Glucose-6-phosphate 1-dehydrogenaseRignano---130G>AADR InferredIncreased risk of hemolytic anemia. Details
Glucose-6-phosphate 1-dehydrogenaseOrissa---131C->GADR InferredIncreased risk of hemolytic anemia. Details
Glucose-6-phosphate 1-dehydrogenaseG6PDNice---1380G>CADR InferredIncreased risk of hemolytic anemia. Details
Glucose-6-phosphate 1-dehydrogenaseKamiube, Keelung---1387C->TADR InferredIncreased risk of hemolytic anemia. Details
Glucose-6-phosphate 1-dehydrogenaseNeapolis---1400C->GADR InferredIncreased risk of hemolytic anemia. Details
Glucose-6-phosphate 1-dehydrogenaseAures---143T->CADR InferredIncreased risk of hemolytic anemia. Details
Glucose-6-phosphate 1-dehydrogenaseSplit---1442C->GADR InferredIncreased risk of hemolytic anemia. Details
Glucose-6-phosphate 1-dehydrogenaseKambos---148C->TADR InferredIncreased risk of hemolytic anemia. Details
Glucose-6-phosphate 1-dehydrogenasePalestrina---170G>AADR InferredIncreased risk of hemolytic anemia. Details
Glucose-6-phosphate 1-dehydrogenaseMetaponto---172G->AADR InferredIncreased risk of hemolytic anemia. Details
Glucose-6-phosphate 1-dehydrogenaseMusashino---185C->TADR InferredIncreased risk of hemolytic anemia. Details
Glucose-6-phosphate 1-dehydrogenaseAsahi---202G->AADR InferredIncreased risk of hemolytic anemia. Details
Glucose-6-phosphate 1-dehydrogenaseA- (202), Ferrara I---202G->A / 376A->GADR InferredIncreased risk of hemolytic anemia. Details
Glucose-6-phosphate 1-dehydrogenaseMurcia Oristano---209A->GADR InferredIncreased risk of hemolytic anemia. Details
Glucose-6-phosphate 1-dehydrogenaseUbe Konan---241C->TADR InferredIncreased risk of hemolytic anemia. Details
Glucose-6-phosphate 1-dehydrogenaseLagosanto---242G->AADR InferredIncreased risk of hemolytic anemia. Details
Glucose-6-phosphate 1-dehydrogenaseGuangzhou---274C->TADR InferredIncreased risk of hemolytic anemia. Details
Glucose-6-phosphate 1-dehydrogenaseHammersmith---323T->AADR InferredIncreased risk of hemolytic anemia. Details
Glucose-6-phosphate 1-dehydrogenaseSinnai---34G->TADR InferredIncreased risk of hemolytic anemia. Details
Glucose-6-phosphate 1-dehydrogenaseA- (680)---376A->G / 680G->TADR InferredIncreased risk of hemolytic anemia. Details
Glucose-6-phosphate 1-dehydrogenaseA- (968), Betica,Selma, Guantanamo---376A->G / 968T->CADR InferredIncreased risk of hemolytic anemia. Details
Glucose-6-phosphate 1-dehydrogenaseSalerno Pyrgos---383T>GADR InferredIncreased risk of hemolytic anemia. Details
Glucose-6-phosphate 1-dehydrogenaseQuing Yan---392G->TADR InferredIncreased risk of hemolytic anemia. Details
Glucose-6-phosphate 1-dehydrogenaseLages---40G->AADR InferredIncreased risk of hemolytic anemia. Details
Glucose-6-phosphate 1-dehydrogenaseIlesha---466G->AADR InferredIncreased risk of hemolytic anemia. Details
Glucose-6-phosphate 1-dehydrogenaseMahidol---487G->AADR InferredIncreased risk of hemolytic anemia. Details
Glucose-6-phosphate 1-dehydrogenaseMalaga---542A->TADR InferredIncreased risk of hemolytic anemia. Details
Glucose-6-phosphate 1-dehydrogenaseSibari---634A->GADR InferredIncreased risk of hemolytic anemia. Details
Glucose-6-phosphate 1-dehydrogenaseMexico City---680G->AADR InferredIncreased risk of hemolytic anemia. Details
Glucose-6-phosphate 1-dehydrogenaseNanning---703C->TADR InferredIncreased risk of hemolytic anemia. Details
Glucose-6-phosphate 1-dehydrogenaseSeattle, Lodi, Modena, Ferrara II, Athens-like---844G->CADR InferredIncreased risk of hemolytic anemia. Details
Glucose-6-phosphate 1-dehydrogenaseBajo Maumere---844G->TADR InferredIncreased risk of hemolytic anemia. Details
Glucose-6-phosphate 1-dehydrogenaseMontalbano---854G->AADR InferredIncreased risk of hemolytic anemia. Details
Glucose-6-phosphate 1-dehydrogenaseKalyan-Kerala, Jamnaga, Rohini---949G->AADR InferredIncreased risk of hemolytic anemia. Details
Glucose-6-phosphate 1-dehydrogenaseGaohe---95A->GADR InferredIncreased risk of hemolytic anemia. Details
Drug Interactions
DrugInteractionDrug group
7,8-DICHLORO-1,2,3,4-TETRAHYDROISOQUINOLINE7,8-DICHLORO-1,2,3,4-TETRAHYDROISOQUINOLINE may increase the hypoglycemic activities of Glyburide.Experimental
AbirateroneThe metabolism of Glyburide can be decreased when combined with Abiraterone.Approved
AcarboseAcarbose may increase the hypoglycemic activities of Glyburide.Approved, Investigational
AcebutololThe serum concentration of Acebutolol can be increased when it is combined with Glyburide.Approved
AcenocoumarolGlyburide may increase the anticoagulant activities of Acenocoumarol.Approved
AcetaminophenThe serum concentration of Acetaminophen can be increased when it is combined with Glyburide.Approved
AcetohexamideAcetohexamide may increase the hypoglycemic activities of Glyburide.Withdrawn
Acetylsalicylic acidThe serum concentration of Acetylsalicylic acid can be increased when it is combined with Glyburide.Approved, Vet Approved
AfatinibThe serum concentration of Afatinib can be increased when it is combined with Glyburide.Approved
AicarAicar may increase the hypoglycemic activities of Glyburide.Experimental
AlbiglutideAlbiglutide may increase the hypoglycemic activities of Glyburide.Approved
AldosteroneThe serum concentration of Aldosterone can be increased when it is combined with Glyburide.Experimental
AlitretinoinThe serum concentration of Alitretinoin can be increased when it is combined with Glyburide.Approved, Investigational
AlogliptinAlogliptin may increase the hypoglycemic activities of Glyburide.Approved
AlprenololAlprenolol may increase the hypoglycemic activities of Glyburide.Approved, Withdrawn
AmbrisentanThe serum concentration of Ambrisentan can be increased when it is combined with Glyburide.Approved, Investigational
Aminosalicylic AcidAminosalicylic Acid may increase the hypoglycemic activities of Glyburide.Approved
AmiodaroneThe metabolism of Glyburide can be decreased when combined with Amiodarone.Approved, Investigational
AmitriptylineThe serum concentration of Amitriptyline can be increased when it is combined with Glyburide.Approved
ApixabanThe serum concentration of Apixaban can be increased when it is combined with Glyburide.Approved
AprepitantThe serum concentration of Glyburide can be increased when it is combined with Aprepitant.Approved, Investigational
AripiprazoleThe therapeutic efficacy of Glyburide can be decreased when used in combination with Aripiprazole.Approved, Investigational
ArmodafinilThe metabolism of Glyburide can be decreased when combined with Armodafinil.Approved, Investigational
ArotinololArotinolol may increase the hypoglycemic activities of Glyburide.Approved
Arsenic trioxideThe serum concentration of Arsenic trioxide can be increased when it is combined with Glyburide.Approved, Investigational
ArticaineThe therapeutic efficacy of Glyburide can be decreased when used in combination with Articaine.Approved
AsenapineThe therapeutic efficacy of Glyburide can be decreased when used in combination with Asenapine.Approved
AtazanavirThe metabolism of Glyburide can be decreased when combined with Atazanavir.Approved, Investigational
AtenololThe serum concentration of Atenolol can be increased when it is combined with Glyburide.Approved
AtomoxetineThe metabolism of Glyburide can be decreased when combined with Atomoxetine.Approved
AtorvastatinAtorvastatin may increase the hypoglycemic activities of Glyburide.Approved
AxitinibThe serum concentration of Axitinib can be increased when it is combined with Glyburide.Approved, Investigational
BalsalazideBalsalazide may increase the hypoglycemic activities of Glyburide.Approved, Investigational
BefunololBefunolol may increase the hypoglycemic activities of Glyburide.Experimental
BendroflumethiazideThe therapeutic efficacy of Glyburide can be decreased when used in combination with Bendroflumethiazide.Approved
BenmoxinBenmoxin may increase the hypoglycemic activities of Glyburide.Withdrawn
BetamethasoneThe serum concentration of Betamethasone can be increased when it is combined with Glyburide.Approved, Vet Approved
BetaxololBetaxolol may increase the hypoglycemic activities of Glyburide.Approved
BevantololBevantolol may increase the hypoglycemic activities of Glyburide.Approved
BexaroteneThe serum concentration of Glyburide can be decreased when it is combined with Bexarotene.Approved, Investigational
BezafibrateBezafibrate may increase the hypoglycemic activities of Glyburide.Approved
BisoprololBisoprolol may increase the hypoglycemic activities of Glyburide.Approved
BoceprevirThe metabolism of Glyburide can be decreased when combined with Boceprevir.Approved, Investigational
BopindololBopindolol may increase the hypoglycemic activities of Glyburide.Approved
BortezomibThe metabolism of Glyburide can be decreased when combined with Bortezomib.Approved, Investigational
BosentanGlyburide may increase the hepatotoxic activities of Bosentan.Approved, Investigational
BosutinibThe serum concentration of Bosutinib can be increased when it is combined with Glyburide.Approved
Brentuximab vedotinThe serum concentration of Brentuximab vedotin can be increased when it is combined with Glyburide.Approved
BrexpiprazoleThe therapeutic efficacy of Glyburide can be decreased when used in combination with Brexpiprazole.Approved
BromocriptineThe serum concentration of Bromocriptine can be increased when it is combined with Glyburide.Approved, Investigational
BuforminBuformin may increase the hypoglycemic activities of Glyburide.Withdrawn
BufuralolBufuralol may increase the hypoglycemic activities of Glyburide.Experimental, Investigational
BumetanideThe therapeutic efficacy of Glyburide can be decreased when used in combination with Bumetanide.Approved
BupranololBupranolol may increase the hypoglycemic activities of Glyburide.Approved
BuserelinThe therapeutic efficacy of Glyburide can be decreased when used in combination with Buserelin.Approved
CabazitaxelThe serum concentration of Cabazitaxel can be increased when it is combined with Glyburide.Approved
CaffeineThe serum concentration of Caffeine can be increased when it is combined with Glyburide.Approved
CamptothecinThe serum concentration of Camptothecin can be increased when it is combined with Glyburide.Experimental
CanagliflozinCanagliflozin may increase the hypoglycemic activities of Glyburide.Approved
CapecitabineThe metabolism of Glyburide can be decreased when combined with Capecitabine.Approved, Investigational
CarbamazepineThe metabolism of Glyburide can be increased when combined with Carbamazepine.Approved, Investigational
CarbocisteineThe risk or severity of adverse effects can be increased when Glyburide is combined with Carbocisteine.Approved
CarfilzomibThe serum concentration of Carfilzomib can be increased when it is combined with Glyburide.Approved
CaroxazoneCaroxazone may increase the hypoglycemic activities of Glyburide.Withdrawn
CarteololCarteolol may increase the hypoglycemic activities of Glyburide.Approved
CarvedilolCarvedilol may increase the hypoglycemic activities of Glyburide.Approved, Investigational
CastanospermineCastanospermine may increase the hypoglycemic activities of Glyburide.Experimental
CeliprololCeliprolol may increase the hypoglycemic activities of Glyburide.Approved, Investigational
CeritinibThe serum concentration of Glyburide can be increased when it is combined with Ceritinib.Approved
CerivastatinThe serum concentration of Cerivastatin can be increased when it is combined with Glyburide.Withdrawn
ChloramphenicolThe metabolism of Glyburide can be decreased when combined with Chloramphenicol.Approved, Vet Approved
ChlorothiazideThe therapeutic efficacy of Glyburide can be decreased when used in combination with Chlorothiazide.Approved, Vet Approved
ChlorpromazineThe serum concentration of Chlorpromazine can be increased when it is combined with Glyburide.Approved, Vet Approved
ChlorpropamideChlorpropamide may increase the hypoglycemic activities of Glyburide.Approved
ChlorthalidoneThe therapeutic efficacy of Glyburide can be decreased when used in combination with Chlorthalidone.Approved
CholecalciferolThe metabolism of Glyburide can be decreased when combined with Cholecalciferol.Approved, Nutraceutical
Cholic AcidGlyburide may decrease the excretion rate of Cholic Acid which could result in a higher serum level.Approved
CiglitazoneCiglitazone may increase the hypoglycemic activities of Glyburide.Experimental
CimetidineThe serum concentration of Glyburide can be increased when it is combined with Cimetidine.Approved
CinoxacinCinoxacin may increase the hypoglycemic activities of Glyburide.Approved, Withdrawn
CiprofloxacinThe serum concentration of Ciprofloxacin can be increased when it is combined with Glyburide.Approved, Investigational
CisplatinThe serum concentration of Cisplatin can be increased when it is combined with Glyburide.Approved
CitalopramThe serum concentration of Citalopram can be increased when it is combined with Glyburide.Approved
ClarithromycinThe serum concentration of Glyburide can be increased when it is combined with Clarithromycin.Approved
ClemastineThe metabolism of Glyburide can be decreased when combined with Clemastine.Approved
ClobazamThe serum concentration of Clobazam can be increased when it is combined with Glyburide.Approved, Illicit
ClofibrateClofibrate may increase the hypoglycemic activities of Glyburide.Approved
ClomifeneThe serum concentration of Clomifene can be increased when it is combined with Glyburide.Approved, Investigational
ClonidineThe serum concentration of Clonidine can be increased when it is combined with Glyburide.Approved
ClopidogrelThe serum concentration of Clopidogrel can be increased when it is combined with Glyburide.Approved, Nutraceutical
ClotrimazoleThe metabolism of Glyburide can be decreased when combined with Clotrimazole.Approved, Vet Approved
ClozapineThe serum concentration of Clozapine can be increased when it is combined with Glyburide.Approved
CobicistatThe metabolism of Glyburide can be decreased when combined with Cobicistat.Approved
CobimetinibThe serum concentration of Cobimetinib can be increased when it is combined with Glyburide.Approved
ColchicineThe serum concentration of Colchicine can be increased when it is combined with Glyburide.Approved
ColesevelamThe serum concentration of Glyburide can be decreased when it is combined with Colesevelam.Approved
ConivaptanThe serum concentration of Glyburide can be increased when it is combined with Conivaptan.Approved, Investigational
Conjugated Equine EstrogensThe serum concentration of Conjugated Equine Estrogens can be increased when it is combined with Glyburide.Approved
CorticotropinThe therapeutic efficacy of Glyburide can be decreased when used in combination with Corticotropin.Approved, Vet Approved
Cortisone acetateThe therapeutic efficacy of Glyburide can be decreased when used in combination with Cortisone acetate.Approved
CrizotinibThe metabolism of Glyburide can be decreased when combined with Crizotinib.Approved
CyclosporineThe therapeutic efficacy of Glyburide can be decreased when used in combination with Cyclosporine.Approved, Investigational, Vet Approved
CyclosporineThe metabolism of Glyburide can be decreased when combined with Cyclosporine.Approved, Investigational, Vet Approved
Cyproterone acetateThe therapeutic efficacy of Glyburide can be decreased when used in combination with Cyproterone acetate.Approved, Investigational
Dabigatran etexilateThe serum concentration of the active metabolites of Dabigatran etexilate can be increased when Dabigatran etexilate is used in combination with Glyburide.Approved
DabrafenibThe serum concentration of Glyburide can be decreased when it is combined with Dabrafenib.Approved
DactinomycinThe serum concentration of Dactinomycin can be increased when it is combined with Glyburide.Approved
DanazolThe therapeutic efficacy of Glyburide can be decreased when used in combination with Danazol.Approved
DapagliflozinThe serum concentration of Dapagliflozin can be increased when it is combined with Glyburide.Approved
DapoxetineDapoxetine may increase the hypoglycemic activities of Glyburide.Investigational
DarunavirThe metabolism of Glyburide can be decreased when combined with Darunavir.Approved
DasatinibThe serum concentration of Glyburide can be increased when it is combined with Dasatinib.Approved, Investigational
DaunorubicinThe serum concentration of Daunorubicin can be increased when it is combined with Glyburide.Approved
DebrisoquinThe serum concentration of Debrisoquin can be increased when it is combined with Glyburide.Approved
DeferasiroxThe serum concentration of Glyburide can be decreased when it is combined with Deferasirox.Approved, Investigational
DelavirdineThe metabolism of Glyburide can be decreased when combined with Delavirdine.Approved
DesogestrelThe therapeutic efficacy of Glyburide can be decreased when used in combination with Desogestrel.Approved
DesvenlafaxineDesvenlafaxine may increase the hypoglycemic activities of Glyburide.Approved
DexamethasoneThe serum concentration of Glyburide can be decreased when it is combined with Dexamethasone.Approved, Investigational, Vet Approved
DiazepamThe serum concentration of Diazepam can be increased when it is combined with Glyburide.Approved, Illicit, Vet Approved
DiazoxideThe therapeutic efficacy of Glyburide can be decreased when used in combination with Diazoxide.Approved
DicoumarolGlyburide may increase the anticoagulant activities of Dicoumarol.Approved
DienogestThe therapeutic efficacy of Glyburide can be decreased when used in combination with Dienogest.Approved
DiethylstilbestrolThe serum concentration of Diethylstilbestrol can be increased when it is combined with Glyburide.Approved
DiflunisalDiflunisal may increase the hypoglycemic activities of Glyburide.Approved
DigitoxinThe serum concentration of Digitoxin can be increased when it is combined with Glyburide.Approved
DigoxinThe serum concentration of Digoxin can be increased when it is combined with Glyburide.Approved
DihydroergotamineThe metabolism of Glyburide can be decreased when combined with Dihydroergotamine.Approved
DihydrotestosteroneThe serum concentration of Dihydrotestosterone can be increased when it is combined with Glyburide.Illicit
DiltiazemThe metabolism of Glyburide can be decreased when combined with Diltiazem.Approved
DipyridamoleThe serum concentration of Dipyridamole can be increased when it is combined with Glyburide.Approved
DisopyramideDisopyramide may increase the hypoglycemic activities of Glyburide.Approved
DocetaxelThe serum concentration of Docetaxel can be increased when it is combined with Glyburide.Approved, Investigational
DomperidoneThe serum concentration of Domperidone can be increased when it is combined with Glyburide.Approved, Investigational, Vet Approved
DoxorubicinThe serum concentration of Doxorubicin can be increased when it is combined with Glyburide.Approved, Investigational
DoxycyclineThe metabolism of Glyburide can be decreased when combined with Doxycycline.Approved, Investigational, Vet Approved
DronedaroneThe metabolism of Glyburide can be decreased when combined with Dronedarone.Approved
DrospirenoneThe therapeutic efficacy of Glyburide can be decreased when used in combination with Drospirenone.Approved
DulaglutideDulaglutide may increase the hypoglycemic activities of Glyburide.Approved
DuloxetineDuloxetine may increase the hypoglycemic activities of Glyburide.Approved
EdoxabanThe serum concentration of Edoxaban can be increased when it is combined with Glyburide.Approved
EfavirenzThe serum concentration of Glyburide can be decreased when it is combined with Efavirenz.Approved, Investigational
EletriptanThe serum concentration of Eletriptan can be increased when it is combined with Glyburide.Approved, Investigational
EltrombopagThe serum concentration of Glyburide can be increased when it is combined with Eltrombopag.Approved
EmpagliflozinEmpagliflozin may increase the hypoglycemic activities of Glyburide.Approved
EnoxacinEnoxacin may increase the hypoglycemic activities of Glyburide.Approved
EnzalutamideThe serum concentration of Glyburide can be decreased when it is combined with Enzalutamide.Approved
EpinastineThe serum concentration of Epinastine can be increased when it is combined with Glyburide.Approved, Investigational
EpinephrineThe therapeutic efficacy of Glyburide can be decreased when used in combination with Epinephrine.Approved, Vet Approved
ErlotinibThe serum concentration of Erlotinib can be increased when it is combined with Glyburide.Approved, Investigational
ErythromycinThe metabolism of Glyburide can be decreased when combined with Erythromycin.Approved, Vet Approved
EscitalopramEscitalopram may increase the hypoglycemic activities of Glyburide.Approved, Investigational
Eslicarbazepine acetateThe serum concentration of Glyburide can be decreased when it is combined with Eslicarbazepine acetate.Approved
EsmololEsmolol may increase the hypoglycemic activities of Glyburide.Approved
EsomeprazoleThe metabolism of Glyburide can be decreased when combined with Esomeprazole.Approved, Investigational
EstradiolThe serum concentration of Estradiol can be increased when it is combined with Glyburide.Approved, Investigational, Vet Approved
EstriolThe serum concentration of Estriol can be increased when it is combined with Glyburide.Approved, Vet Approved
EstroneThe serum concentration of Estrone can be increased when it is combined with Glyburide.Approved
Estrone sulfateThe therapeutic efficacy of Glyburide can be decreased when used in combination with Estrone sulfate.Approved
Etacrynic acidThe therapeutic efficacy of Glyburide can be decreased when used in combination with Etacrynic acid.Approved
EthanolThe risk or severity of adverse effects can be increased when Glyburide is combined with Ethanol.Approved
Ethinyl EstradiolThe serum concentration of Ethinyl Estradiol can be increased when it is combined with Glyburide.Approved
Ethyl biscoumacetateGlyburide may increase the anticoagulant activities of Ethyl biscoumacetate.Withdrawn
Ethynodiol diacetateThe therapeutic efficacy of Glyburide can be decreased when used in combination with Ethynodiol diacetate.Approved
EtofibrateEtofibrate may increase the hypoglycemic activities of Glyburide.Approved
EtonogestrelThe therapeutic efficacy of Glyburide can be decreased when used in combination with Etonogestrel.Approved, Investigational
EtoperidoneEtoperidone may increase the hypoglycemic activities of Glyburide.Approved
EtoposideThe serum concentration of Etoposide can be increased when it is combined with Glyburide.Approved
EtravirineThe serum concentration of Glyburide can be decreased when it is combined with Etravirine.Approved
EverolimusThe serum concentration of Everolimus can be increased when it is combined with Glyburide.Approved
ExenatideExenatide may increase the hypoglycemic activities of Glyburide.Approved, Investigational
EzetimibeThe serum concentration of Ezetimibe can be increased when it is combined with Glyburide.Approved
FenofibrateFenofibrate may increase the hypoglycemic activities of Glyburide.Approved
FesoterodineThe serum concentration of Fesoterodine can be increased when it is combined with Glyburide.Approved
FexofenadineThe serum concentration of Fexofenadine can be increased when it is combined with Glyburide.Approved
FidaxomicinThe serum concentration of Fidaxomicin can be increased when it is combined with Glyburide.Approved
FleroxacinFleroxacin may increase the hypoglycemic activities of Glyburide.Approved
FloxuridineThe metabolism of Glyburide can be decreased when combined with Floxuridine.Approved
FluconazoleThe serum concentration of Glyburide can be increased when it is combined with Fluconazole.Approved
FludrocortisoneThe therapeutic efficacy of Glyburide can be decreased when used in combination with Fludrocortisone.Approved
FlumequineFlumequine may increase the hypoglycemic activities of Glyburide.Withdrawn
FluorouracilThe metabolism of Glyburide can be decreased when combined with Fluorouracil.Approved
FluoxetineThe metabolism of Glyburide can be decreased when combined with Fluoxetine.Approved, Vet Approved
FluoxymesteroneFluoxymesterone may increase the hypoglycemic activities of Glyburide.Approved, Illicit
Fluticasone furoateThe serum concentration of Fluticasone furoate can be increased when it is combined with Glyburide.Approved
FluvastatinThe metabolism of Glyburide can be decreased when combined with Fluvastatin.Approved
FluvoxamineThe metabolism of Glyburide can be decreased when combined with Fluvoxamine.Approved, Investigational
FosamprenavirThe metabolism of Glyburide can be decreased when combined with Fosamprenavir.Approved
FosaprepitantThe serum concentration of Glyburide can be increased when it is combined with Fosaprepitant.Approved
FosphenytoinThe metabolism of Glyburide can be increased when combined with Fosphenytoin.Approved
FurazolidoneFurazolidone may increase the hypoglycemic activities of Glyburide.Approved, Vet Approved
FurosemideThe therapeutic efficacy of Glyburide can be decreased when used in combination with Furosemide.Approved, Vet Approved
Fusidic AcidThe serum concentration of Glyburide can be increased when it is combined with Fusidic Acid.Approved
GatifloxacinGatifloxacin may increase the hypoglycemic activities of Glyburide.Approved, Investigational
GefitinibThe serum concentration of Gefitinib can be increased when it is combined with Glyburide.Approved, Investigational
GemcitabineThe serum concentration of Gemcitabine can be increased when it is combined with Glyburide.Approved
GemfibrozilThe metabolism of Glyburide can be decreased when combined with Gemfibrozil.Approved
GemifloxacinGemifloxacin may increase the hypoglycemic activities of Glyburide.Approved, Investigational
GlibornurideGlibornuride may increase the hypoglycemic activities of Glyburide.Withdrawn
GliclazideGlyburide may increase the hypoglycemic activities of Gliclazide.Approved
GlimepirideGlimepiride may increase the hypoglycemic activities of Glyburide.Approved
GlipizideGlyburide may increase the hypoglycemic activities of Glipizide.Approved
GliquidoneGliquidone may increase the hypoglycemic activities of Glyburide.Approved
GoserelinThe therapeutic efficacy of Glyburide can be decreased when used in combination with Goserelin.Approved
GrazoprevirThe serum concentration of Grazoprevir can be increased when it is combined with Glyburide.Approved
GrepafloxacinThe serum concentration of Grepafloxacin can be increased when it is combined with Glyburide.Withdrawn
HaloperidolThe serum concentration of Haloperidol can be increased when it is combined with Glyburide.Approved
HistrelinThe therapeutic efficacy of Glyburide can be decreased when used in combination with Histrelin.Approved
HydracarbazineHydracarbazine may increase the hypoglycemic activities of Glyburide.Approved
HydrochlorothiazideThe therapeutic efficacy of Glyburide can be decreased when used in combination with Hydrochlorothiazide.Approved, Vet Approved
HydrocortisoneThe serum concentration of Hydrocortisone can be increased when it is combined with Glyburide.Approved, Vet Approved
HydroflumethiazideThe therapeutic efficacy of Glyburide can be decreased when used in combination with Hydroflumethiazide.Approved
Hydroxyprogesterone caproateThe therapeutic efficacy of Glyburide can be decreased when used in combination with Hydroxyprogesterone caproate.Approved
IbuprofenThe serum concentration of Ibuprofen can be increased when it is combined with Glyburide.Approved
IdelalisibThe serum concentration of Glyburide can be increased when it is combined with Idelalisib.Approved
IloperidoneThe therapeutic efficacy of Glyburide can be decreased when used in combination with Iloperidone.Approved
ImatinibThe metabolism of Glyburide can be decreased when combined with Imatinib.Approved
ImipramineThe serum concentration of Imipramine can be increased when it is combined with Glyburide.Approved
IndacaterolThe serum concentration of Indacaterol can be increased when it is combined with Glyburide.Approved
IndalpineIndalpine may increase the hypoglycemic activities of Glyburide.Investigational, Withdrawn
IndapamideThe therapeutic efficacy of Glyburide can be decreased when used in combination with Indapamide.Approved
IndenololIndenolol may increase the hypoglycemic activities of Glyburide.Withdrawn
IndinavirThe metabolism of Glyburide can be decreased when combined with Indinavir.Approved
IndomethacinThe serum concentration of Indomethacin can be increased when it is combined with Glyburide.Approved, Investigational
Insulin AspartGlyburide may increase the hypoglycemic activities of Insulin Aspart.Approved
Insulin DetemirGlyburide may increase the hypoglycemic activities of Insulin Detemir.Approved
Insulin GlargineInsulin Glargine may increase the hypoglycemic activities of Glyburide.Approved
Insulin GlulisineGlyburide may increase the hypoglycemic activities of Insulin Glulisine.Approved
Insulin HumanInsulin Human may increase the hypoglycemic activities of Glyburide.Approved, Investigational
Insulin LisproInsulin Lispro may increase the hypoglycemic activities of Glyburide.Approved
Insulin PorkInsulin Pork may increase the hypoglycemic activities of Glyburide.Approved
IproclozideIproclozide may increase the hypoglycemic activities of Glyburide.Withdrawn
IproniazidIproniazid may increase the hypoglycemic activities of Glyburide.Withdrawn
IrbesartanThe metabolism of Glyburide can be decreased when combined with Irbesartan.Approved, Investigational
IrinotecanThe serum concentration of Irinotecan can be increased when it is combined with Glyburide.Approved, Investigational
IsavuconazoniumThe metabolism of Glyburide can be decreased when combined with Isavuconazonium.Approved, Investigational
IsocarboxazidIsocarboxazid may increase the hypoglycemic activities of Glyburide.Approved
IsoniazidThe metabolism of Glyburide can be decreased when combined with Isoniazid.Approved
IsradipineThe metabolism of Glyburide can be decreased when combined with Isradipine.Approved
ItraconazoleThe metabolism of Glyburide can be decreased when combined with Itraconazole.Approved, Investigational
IvacaftorThe serum concentration of Glyburide can be increased when it is combined with Ivacaftor.Approved
IvermectinThe serum concentration of Ivermectin can be increased when it is combined with Glyburide.Approved, Vet Approved
KetazolamThe serum concentration of Ketazolam can be increased when it is combined with Glyburide.Approved
KetoconazoleThe metabolism of Glyburide can be decreased when combined with Ketoconazole.Approved, Investigational
LabetalolLabetalol may increase the hypoglycemic activities of Glyburide.Approved
LamivudineThe serum concentration of Lamivudine can be increased when it is combined with Glyburide.Approved, Investigational
LamotrigineThe serum concentration of Lamotrigine can be increased when it is combined with Glyburide.Approved, Investigational
LanreotideGlyburide may increase the hypoglycemic activities of Lanreotide.Approved
LansoprazoleThe serum concentration of Lansoprazole can be increased when it is combined with Glyburide.Approved, Investigational
LedipasvirThe serum concentration of Ledipasvir can be increased when it is combined with Glyburide.Approved
LeflunomideThe metabolism of Glyburide can be decreased when combined with Leflunomide.Approved, Investigational
LenalidomideThe serum concentration of Lenalidomide can be increased when it is combined with Glyburide.Approved
LenvatinibThe serum concentration of Lenvatinib can be increased when it is combined with Glyburide.Approved
LeuprolideThe therapeutic efficacy of Glyburide can be decreased when used in combination with Leuprolide.Approved, Investigational
LevetiracetamThe serum concentration of Levetiracetam can be increased when it is combined with Glyburide.Approved, Investigational
LevobunololLevobunolol may increase the hypoglycemic activities of Glyburide.Approved
LevofloxacinThe serum concentration of Levofloxacin can be increased when it is combined with Glyburide.Approved, Investigational
LevomilnacipranThe serum concentration of Levomilnacipran can be increased when it is combined with Glyburide.Approved
LevonorgestrelThe therapeutic efficacy of Glyburide can be decreased when used in combination with Levonorgestrel.Approved, Investigational
LinagliptinLinagliptin may increase the hypoglycemic activities of Glyburide.Approved
Lipoic AcidLipoic Acid may increase the hypoglycemic activities of Glyburide.Approved, Nutraceutical
LiraglutideLiraglutide may increase the hypoglycemic activities of Glyburide.Approved
LomefloxacinLomefloxacin may increase the hypoglycemic activities of Glyburide.Approved
LoperamideThe serum concentration of Loperamide can be increased when it is combined with Glyburide.Approved
LopinavirThe metabolism of Glyburide can be decreased when combined with Lopinavir.Approved
LosartanThe serum concentration of Losartan can be increased when it is combined with Glyburide.Approved
LovastatinThe metabolism of Glyburide can be decreased when combined with Lovastatin.Approved, Investigational
LuliconazoleThe serum concentration of Glyburide can be increased when it is combined with Luliconazole.Approved
LumacaftorThe serum concentration of Glyburide can be decreased when it is combined with Lumacaftor.Approved
LurasidoneThe therapeutic efficacy of Glyburide can be decreased when used in combination with Lurasidone.Approved
MannitolThe serum concentration of Mannitol can be increased when it is combined with Glyburide.Approved, Investigational
MebanazineMebanazine may increase the hypoglycemic activities of Glyburide.Withdrawn
MecaserminGlyburide may increase the hypoglycemic activities of Mecasermin.Approved, Investigational
Medroxyprogesterone acetateThe therapeutic efficacy of Glyburide can be decreased when used in combination with Medroxyprogesterone acetate.Approved, Investigational
Megestrol acetateThe therapeutic efficacy of Glyburide can be decreased when used in combination with Megestrol acetate.Approved, Vet Approved
MesalazineMesalazine may increase the hypoglycemic activities of Glyburide.Approved
MestranolThe therapeutic efficacy of Glyburide can be decreased when used in combination with Mestranol.Approved
MetforminMetformin may increase the hypoglycemic activities of Glyburide.Approved
MethotrexateThe serum concentration of Methotrexate can be increased when it is combined with Glyburide.Approved
MethotrimeprazineThe therapeutic efficacy of Glyburide can be decreased when used in combination with Methotrimeprazine.Approved
MethyclothiazideThe therapeutic efficacy of Glyburide can be decreased when used in combination with Methyclothiazide.Approved
Methylene blueMethylene blue may increase the hypoglycemic activities of Glyburide.Investigational
MethylprednisoloneThe serum concentration of Methylprednisolone can be increased when it is combined with Glyburide.Approved, Vet Approved
MethyltestosteroneMethyltestosterone may increase the hypoglycemic activities of Glyburide.Approved
MetipranololMetipranolol may increase the hypoglycemic activities of Glyburide.Approved
MetolazoneThe therapeutic efficacy of Glyburide can be decreased when used in combination with Metolazone.Approved
MetoprololThe serum concentration of Metoprolol can be increased when it is combined with Glyburide.Approved, Investigational
MetreleptinMetreleptin may increase the hypoglycemic activities of Glyburide.Approved
MiconazoleMiconazole may increase the hypoglycemic activities of Glyburide.Approved, Investigational, Vet Approved
MidazolamThe serum concentration of Midazolam can be increased when it is combined with Glyburide.Approved, Illicit
MifepristoneThe serum concentration of Glyburide can be increased when it is combined with Mifepristone.Approved, Investigational
MiglitolMiglitol may increase the hypoglycemic activities of Glyburide.Approved
MiglustatMiglustat may increase the hypoglycemic activities of Glyburide.Approved
MilnacipranMilnacipran may increase the hypoglycemic activities of Glyburide.Approved
MinaprineMinaprine may increase the hypoglycemic activities of Glyburide.Approved
MirabegronThe serum concentration of Mirabegron can be increased when it is combined with Glyburide.Approved
MitiglinideMitiglinide may increase the hypoglycemic activities of Glyburide.Approved, Investigational
MitotaneThe serum concentration of Glyburide can be decreased when it is combined with Mitotane.Approved
MitoxantroneThe serum concentration of Mitoxantrone can be increased when it is combined with Glyburide.Approved, Investigational
MoclobemideMoclobemide may increase the hypoglycemic activities of Glyburide.Approved
ModafinilThe serum concentration of Glyburide can be decreased when it is combined with Modafinil.Approved, Investigational
MorphineThe serum concentration of Morphine can be increased when it is combined with Glyburide.Approved, Investigational
MoxifloxacinMoxifloxacin may increase the hypoglycemic activities of Glyburide.Approved, Investigational
Mycophenolate mofetilThe serum concentration of Mycophenolate mofetil can be increased when it is combined with Glyburide.Approved, Investigational
NadololThe serum concentration of Nadolol can be increased when it is combined with Glyburide.Approved
NafcillinThe serum concentration of Glyburide can be decreased when it is combined with Nafcillin.Approved
Nalidixic AcidNalidixic Acid may increase the hypoglycemic activities of Glyburide.Approved
NaloxegolThe serum concentration of Naloxegol can be increased when it is combined with Glyburide.Approved
NaloxoneThe serum concentration of Naloxone can be increased when it is combined with Glyburide.Approved, Vet Approved
NateglinideNateglinide may increase the hypoglycemic activities of Glyburide.Approved, Investigational
NCX 4016NCX 4016 may increase the hypoglycemic activities of Glyburide.Investigational
NefazodoneThe metabolism of Glyburide can be decreased when combined with Nefazodone.Approved, Withdrawn
NelfinavirThe metabolism of Glyburide can be decreased when combined with Nelfinavir.Approved
NetupitantThe serum concentration of Glyburide can be increased when it is combined with Netupitant.Approved
NevirapineThe metabolism of Glyburide can be increased when combined with Nevirapine.Approved
NiacinThe therapeutic efficacy of Glyburide can be decreased when used in combination with Niacin.Approved, Investigational, Nutraceutical
NialamideNialamide may increase the hypoglycemic activities of Glyburide.Withdrawn
NicardipineThe metabolism of Glyburide can be decreased when combined with Nicardipine.Approved
NifedipineThe serum concentration of Nifedipine can be increased when it is combined with Glyburide.Approved
NilotinibThe metabolism of Glyburide can be decreased when combined with Nilotinib.Approved, Investigational
NintedanibThe serum concentration of Nintedanib can be increased when it is combined with Glyburide.Approved
NizatidineThe serum concentration of Nizatidine can be increased when it is combined with Glyburide.Approved
NorethisteroneThe therapeutic efficacy of Glyburide can be decreased when used in combination with Norethisterone.Approved
NorfloxacinNorfloxacin may increase the hypoglycemic activities of Glyburide.Approved
NorgestimateThe therapeutic efficacy of Glyburide can be decreased when used in combination with Norgestimate.Approved
OctamoxinOctamoxin may increase the hypoglycemic activities of Glyburide.Withdrawn
OctreotideOctreotide may increase the hypoglycemic activities of Glyburide.Approved, Investigational
OfloxacinOfloxacin may increase the hypoglycemic activities of Glyburide.Approved
OlanzapineThe serum concentration of Olanzapine can be increased when it is combined with Glyburide.Approved, Investigational
OlaparibThe metabolism of Glyburide can be decreased when combined with Olaparib.Approved
OlsalazineOlsalazine may increase the hypoglycemic activities of Glyburide.Approved
OmbitasvirThe serum concentration of Ombitasvir can be increased when it is combined with Glyburide.Approved
OmeprazoleThe metabolism of Glyburide can be decreased when combined with Omeprazole.Approved, Investigational, Vet Approved
OsimertinibThe serum concentration of Glyburide can be increased when it is combined with Osimertinib.Approved
OxandroloneOxandrolone may increase the hypoglycemic activities of Glyburide.Approved, Investigational
OxprenololOxprenolol may increase the hypoglycemic activities of Glyburide.Approved
OxymetholoneOxymetholone may increase the hypoglycemic activities of Glyburide.Approved, Illicit
PaclitaxelThe serum concentration of Paclitaxel can be increased when it is combined with Glyburide.Approved, Vet Approved
PalbociclibThe serum concentration of Glyburide can be increased when it is combined with Palbociclib.Approved
PaliperidoneThe therapeutic efficacy of Glyburide can be decreased when used in combination with Paliperidone.Approved
PanobinostatThe serum concentration of Panobinostat can be increased when it is combined with Glyburide.Approved, Investigational
PantoprazoleThe metabolism of Glyburide can be decreased when combined with Pantoprazole.Approved
PargylinePargyline may increase the hypoglycemic activities of Glyburide.Approved
ParoxetineParoxetine may increase the hypoglycemic activities of Glyburide.Approved, Investigational
PasireotideGlyburide may increase the hypoglycemic activities of Pasireotide.Approved
PazopanibThe serum concentration of Pazopanib can be increased when it is combined with Glyburide.Approved
PefloxacinPefloxacin may increase the hypoglycemic activities of Glyburide.Approved
PegvisomantPegvisomant may increase the hypoglycemic activities of Glyburide.Approved
PenbutololPenbutolol may increase the hypoglycemic activities of Glyburide.Approved, Investigational
PentamidinePentamidine may increase the hypoglycemic activities of Glyburide.Approved
PentobarbitalThe metabolism of Glyburide can be increased when combined with Pentobarbital.Approved, Vet Approved
PhenelzinePhenelzine may increase the hypoglycemic activities of Glyburide.Approved
PhenforminPhenformin may increase the hypoglycemic activities of Glyburide.Approved, Withdrawn
PhenindioneGlyburide may increase the anticoagulant activities of Phenindione.Approved
PheniprazinePheniprazine may increase the hypoglycemic activities of Glyburide.Withdrawn
PhenobarbitalThe metabolism of Glyburide can be increased when combined with Phenobarbital.Approved
PhenoxypropazinePhenoxypropazine may increase the hypoglycemic activities of Glyburide.Withdrawn
PhenprocoumonGlyburide may increase the anticoagulant activities of Phenprocoumon.Approved
PhenytoinThe metabolism of Glyburide can be increased when combined with Phenytoin.Approved, Vet Approved
PindololPindolol may increase the hypoglycemic activities of Glyburide.Approved
PioglitazonePioglitazone may increase the hypoglycemic activities of Glyburide.Approved, Investigational
PiperazineThe therapeutic efficacy of Glyburide can be decreased when used in combination with Piperazine.Approved, Vet Approved
PipotiazineThe therapeutic efficacy of Glyburide can be decreased when used in combination with Pipotiazine.Approved
PirlindolePirlindole may increase the hypoglycemic activities of Glyburide.Approved
PitavastatinThe serum concentration of Pitavastatin can be increased when it is combined with Glyburide.Approved
PivhydrazinePivhydrazine may increase the hypoglycemic activities of Glyburide.Withdrawn
PolythiazideThe therapeutic efficacy of Glyburide can be decreased when used in combination with Polythiazide.Approved
PomalidomideThe serum concentration of Pomalidomide can be increased when it is combined with Glyburide.Approved
PonatinibThe serum concentration of Ponatinib can be increased when it is combined with Glyburide.Approved
PosaconazoleThe metabolism of Glyburide can be decreased when combined with Posaconazole.Approved, Investigational, Vet Approved
PractololPractolol may increase the hypoglycemic activities of Glyburide.Approved
PramlintidePramlintide may increase the hypoglycemic activities of Glyburide.Approved, Investigational
PravastatinThe serum concentration of Pravastatin can be increased when it is combined with Glyburide.Approved
PrazosinThe serum concentration of Prazosin can be increased when it is combined with Glyburide.Approved
PrednisoloneThe serum concentration of Prednisolone can be increased when it is combined with Glyburide.Approved, Vet Approved
PrednisoneThe serum concentration of Prednisone can be increased when it is combined with Glyburide.Approved, Vet Approved
PrimidoneThe metabolism of Glyburide can be increased when combined with Primidone.Approved, Vet Approved
ProbenecidThe protein binding of Glyburide can be decreased when combined with Probenecid.Approved
ProgesteroneThe serum concentration of Progesterone can be increased when it is combined with Glyburide.Approved, Vet Approved
PropranololThe serum concentration of Propranolol can be increased when it is combined with Glyburide.Approved, Investigational
PrucaloprideThe serum concentration of Prucalopride can be increased when it is combined with Glyburide.Approved
PyrimethamineThe metabolism of Glyburide can be decreased when combined with Pyrimethamine.Approved, Vet Approved
QuetiapineThe serum concentration of Quetiapine can be increased when it is combined with Glyburide.Approved
QuinethazoneThe therapeutic efficacy of Glyburide can be decreased when used in combination with Quinethazone.Approved
QuinidineThe serum concentration of Quinidine can be increased when it is combined with Glyburide.Approved
QuinineQuinine may increase the hypoglycemic activities of Glyburide.Approved
RanitidineThe serum concentration of Glyburide can be increased when it is combined with Ranitidine.Approved
RanolazineThe serum concentration of Ranolazine can be increased when it is combined with Glyburide.Approved, Investigational
RasagilineRasagiline may increase the hypoglycemic activities of Glyburide.Approved
RepaglinideRepaglinide may increase the hypoglycemic activities of Glyburide.Approved, Investigational
ReserpineThe serum concentration of Reserpine can be increased when it is combined with Glyburide.Approved
RifabutinThe metabolism of Glyburide can be increased when combined with Rifabutin.Approved
RifampicinThe serum concentration of Glyburide can be decreased when it is combined with Rifampicin.Approved
RifapentineThe metabolism of Glyburide can be increased when combined with Rifapentine.Approved
RifaximinThe serum concentration of Rifaximin can be increased when it is combined with Glyburide.Approved, Investigational
RisperidoneThe serum concentration of Risperidone can be increased when it is combined with Glyburide.Approved, Investigational
RitonavirThe metabolism of Glyburide can be decreased when combined with Ritonavir.Approved, Investigational
RivaroxabanThe serum concentration of Rivaroxaban can be increased when it is combined with Glyburide.Approved
RolapitantThe serum concentration of Glyburide can be increased when it is combined with Rolapitant.Approved
RomidepsinThe serum concentration of Romidepsin can be increased when it is combined with Glyburide.Approved, Investigational
RosiglitazoneRosiglitazone may increase the hypoglycemic activities of Glyburide.Approved, Investigational
RosoxacinRosoxacin may increase the hypoglycemic activities of Glyburide.Approved
SafrazineSafrazine may increase the hypoglycemic activities of Glyburide.Withdrawn
Salicylic acidThe serum concentration of Salicylic acid can be increased when it is combined with Glyburide.Approved, Vet Approved
SaquinavirThe metabolism of Glyburide can be decreased when combined with Saquinavir.Approved, Investigational
SaxagliptinSaxagliptin may increase the hypoglycemic activities of Glyburide.Approved
SecobarbitalThe metabolism of Glyburide can be increased when combined with Secobarbital.Approved, Vet Approved
SelegilineSelegiline may increase the hypoglycemic activities of Glyburide.Approved, Investigational, Vet Approved
SelexipagThe serum concentration of Selexipag can be increased when it is combined with Glyburide.Approved
SertralineThe metabolism of Glyburide can be decreased when combined with Sertraline.Approved
SildenafilThe metabolism of Glyburide can be decreased when combined with Sildenafil.Approved, Investigational
SilodosinThe serum concentration of Silodosin can be increased when it is combined with Glyburide.Approved
SiltuximabThe serum concentration of Glyburide can be decreased when it is combined with Siltuximab.Approved
SimeprevirThe serum concentration of Glyburide can be increased when it is combined with Simeprevir.Approved
SirolimusThe therapeutic efficacy of Glyburide can be decreased when used in combination with Sirolimus.Approved, Investigational
SitagliptinSitagliptin may increase the hypoglycemic activities of Glyburide.Approved, Investigational
SofosbuvirThe serum concentration of Sofosbuvir can be increased when it is combined with Glyburide.Approved
SorafenibThe serum concentration of Sorafenib can be increased when it is combined with Glyburide.Approved, Investigational
SotalolSotalol may increase the hypoglycemic activities of Glyburide.Approved
SparfloxacinThe serum concentration of Sparfloxacin can be increased when it is combined with Glyburide.Approved
SphingosineThe serum concentration of Sphingosine can be increased when it is combined with Glyburide.Experimental
St. John's WortThe serum concentration of Glyburide can be decreased when it is combined with St. John's Wort.Nutraceutical
StanozololStanozolol may increase the hypoglycemic activities of Glyburide.Approved, Vet Approved
StiripentolThe serum concentration of Glyburide can be increased when it is combined with Stiripentol.Approved
SulfadiazineThe metabolism of Glyburide can be decreased when combined with Sulfadiazine.Approved, Vet Approved
SulfamethoxazoleSulfamethoxazole may increase the hypoglycemic activities of Glyburide.Approved
SulfisoxazoleThe metabolism of Glyburide can be decreased when combined with Sulfisoxazole.Approved, Vet Approved
SulodexideSulodexide may increase the hypoglycemic activities of Glyburide.Approved, Investigational
SunitinibGlyburide may increase the hypoglycemic activities of Sunitinib.Approved, Investigational
TacrolimusThe serum concentration of Tacrolimus can be increased when it is combined with Glyburide.Approved, Investigational
TamoxifenThe serum concentration of Tamoxifen can be increased when it is combined with Glyburide.Approved
Taurocholic AcidThe serum concentration of Taurocholic Acid can be increased when it is combined with Glyburide.Experimental
Technetium Tc-99m sestamibiThe serum concentration of Technetium Tc-99m sestamibi can be increased when it is combined with Glyburide.Approved
TelaprevirThe metabolism of Glyburide can be decreased when combined with Telaprevir.Approved
TelithromycinThe metabolism of Glyburide can be decreased when combined with Telithromycin.Approved
TemafloxacinTemafloxacin may increase the hypoglycemic activities of Glyburide.Withdrawn
TemsirolimusThe serum concentration of Temsirolimus can be increased when it is combined with Glyburide.Approved
TeriflunomideThe serum concentration of Glyburide can be increased when it is combined with Teriflunomide.Approved
TestosteroneTestosterone may increase the hypoglycemic activities of Glyburide.Approved, Investigational
TicagrelorThe serum concentration of Ticagrelor can be increased when it is combined with Glyburide.Approved
TiclopidineThe metabolism of Glyburide can be decreased when combined with Ticlopidine.Approved
TimololThe serum concentration of Timolol can be increased when it is combined with Glyburide.Approved
TipranavirThe therapeutic efficacy of Glyburide can be decreased when used in combination with Tipranavir.Approved, Investigational
TocilizumabThe serum concentration of Glyburide can be decreased when it is combined with Tocilizumab.Approved
TolazamideTolazamide may increase the hypoglycemic activities of Glyburide.Approved
TolbutamideThe metabolism of Glyburide can be decreased when combined with Tolbutamide.Approved
ToloxatoneToloxatone may increase the hypoglycemic activities of Glyburide.Approved
TolvaptanThe serum concentration of Tolvaptan can be increased when it is combined with Glyburide.Approved
TopiramateThe metabolism of Glyburide can be decreased when combined with Topiramate.Approved
TopotecanThe serum concentration of Topotecan can be increased when it is combined with Glyburide.Approved, Investigational
TorasemideThe therapeutic efficacy of Glyburide can be decreased when used in combination with Torasemide.Approved
ToremifeneThe serum concentration of Toremifene can be increased when it is combined with Glyburide.Approved, Investigational
Trans-2-PhenylcyclopropylamineTrans-2-Phenylcyclopropylamine may increase the hypoglycemic activities of Glyburide.Experimental
TranylcypromineTranylcypromine may increase the hypoglycemic activities of Glyburide.Approved
Trastuzumab emtansineThe serum concentration of Trastuzumab emtansine can be increased when it is combined with Glyburide.Approved
TriamcinoloneThe therapeutic efficacy of Glyburide can be decreased when used in combination with Triamcinolone.Approved, Vet Approved
TrichlormethiazideThe therapeutic efficacy of Glyburide can be decreased when used in combination with Trichlormethiazide.Approved, Vet Approved
TrimethoprimThe metabolism of Glyburide can be decreased when combined with Trimethoprim.Approved, Vet Approved
TriptorelinThe therapeutic efficacy of Glyburide can be decreased when used in combination with Triptorelin.Approved, Vet Approved
TroglitazoneTroglitazone may increase the hypoglycemic activities of Glyburide.Withdrawn
TrovafloxacinTrovafloxacin may increase the hypoglycemic activities of Glyburide.Approved, Withdrawn
UlipristalThe serum concentration of Ulipristal can be increased when it is combined with Glyburide.Approved
UmeclidiniumThe serum concentration of Umeclidinium can be increased when it is combined with Glyburide.Approved
Valproic AcidThe metabolism of Glyburide can be decreased when combined with Valproic Acid.Approved, Investigational
ValsartanThe metabolism of Glyburide can be decreased when combined with Valsartan.Approved, Investigational
VecuroniumThe serum concentration of Vecuronium can be increased when it is combined with Glyburide.Approved
VenetoclaxThe serum concentration of Venetoclax can be increased when it is combined with Glyburide.Approved
VenlafaxineThe metabolism of Glyburide can be decreased when combined with Venlafaxine.Approved
VerapamilThe metabolism of Glyburide can be decreased when combined with Verapamil.Approved
VildagliptinVildagliptin may increase the hypoglycemic activities of Glyburide.Approved, Investigational
VinblastineThe serum concentration of Vinblastine can be increased when it is combined with Glyburide.Approved
VincristineThe serum concentration of Vincristine can be increased when it is combined with Glyburide.Approved, Investigational
VismodegibThe serum concentration of Vismodegib can be increased when it is combined with Glyburide.Approved
VogliboseVoglibose may increase the hypoglycemic activities of Glyburide.Approved, Investigational
VoriconazoleThe serum concentration of Glyburide can be increased when it is combined with Voriconazole.Approved, Investigational
VorinostatThe therapeutic efficacy of Glyburide can be decreased when used in combination with Vorinostat.Approved, Investigational
WarfarinGlyburide may increase the anticoagulant activities of Warfarin.Approved
ZafirlukastThe metabolism of Glyburide can be decreased when combined with Zafirlukast.Approved, Investigational
ZidovudineThe serum concentration of Zidovudine can be increased when it is combined with Glyburide.Approved
ZimelidineZimelidine may increase the hypoglycemic activities of Glyburide.Withdrawn
ZiprasidoneThe metabolism of Glyburide can be decreased when combined with Ziprasidone.Approved
Food Interactions
  • Avoid alcohol.
  • Take 30-60 minutes before breakfast.
Synthesis Reference

Suresh Gidwani, “Solid oral dosage form of metformin and glyburide and the method of preparation thereof.” U.S. Patent US20040175421, issued September 09, 2004.

General References
  1. Monami M, Luzzi C, Lamanna C, Chiasserini V, Addante F, Desideri CM, Masotti G, Marchionni N, Mannucci E: Three-year mortality in diabetic patients treated with different combinations of insulin secretagogues and metformin. Diabetes Metab Res Rev. 2006 Nov-Dec;22(6):477-82. [PubMed:16634115 ]
External Links
ATC CodesA10BB01
AHFS Codes
  • 68:20.20
PDB EntriesNot Available
FDA labelNot Available
MSDSDownload (36.9 KB)
Clinical Trials
Clinical Trials
1CompletedNot AvailableHealthy Volunteers5
1CompletedBasic ScienceAngina Pectoris1
1CompletedTreatmentHealthy Volunteers3
1CompletedTreatmentStroke / Traumatic Brain Injury (TBI)1
1CompletedTreatmentType 2 Diabetes Mellitus (T2D)2
1Unknown StatusSupportive CareType 2 Diabetes Mellitus (T2D)1
1WithdrawnBasic ScienceHealthy Volunteers1
1, 2CompletedTreatmentDiabetes1
1, 2CompletedTreatmentStroke, Ischemic1
1, 2Not Yet RecruitingTreatmentEdema of the cerebrum / Metastases, Brain1
1, 2RecruitingTreatmentAcute Spinal Cord Injury / Spinal Cord Injuries (SCI)1
1, 2Unknown StatusTreatmentGestational Diabetes Mellitus (GDM)1
2Active Not RecruitingPreventionMalignant Edema / Stroke, Ischemic1
2Active Not RecruitingTreatmentTraumatic Brain Injury (TBI)1
2Active Not RecruitingTreatmentType 2 Diabetes Mellitus (T2D)1
2CompletedTreatmentDiabetes Mellitus (DM)1
2CompletedTreatmentImpaired Glucose Tolerance (IGT) / Type 2 Diabetes Mellitus (T2D)1
2CompletedTreatmentType 2 Diabetes Mellitus (T2D)1
2TerminatedTreatmentType 2 Diabetes Mellitus (T2D)1
2, 3CompletedPreventionDiabetes, Diabetes Mellitus Type 11
3Active Not RecruitingTreatmentDiabetes / Gestational1
3CompletedTreatmentDiabetes Mellitus (DM)3
3CompletedTreatmentDiabetes Mellitus, Non-Insulin-Dependent1
3CompletedTreatmentDiabetes, Gestational / Pregnancy1
3CompletedTreatmentDiabetes / Type 2 Diabetes Mellitus (T2D)1
3CompletedTreatmentGestational Diabetes Mellitus (GDM)1
3CompletedTreatmentNeonatal Diabetes Secondary to Mutation in the Potassium Channel1
3CompletedTreatmentType 2 Diabetes Mellitus (T2D)3
3Not Yet RecruitingTreatmentBrain oedema / Stroke, Acute1
3TerminatedTreatmentDiabetes Mellitus (DM)2
3TerminatedTreatmentDiabetes / Type 2 Diabetes Mellitus (T2D)1
3TerminatedTreatmentType 2 Diabetes Mellitus (T2D)1
4CompletedBasic ScienceType 2 Diabetes Mellitus (T2D)1
4CompletedPreventionType 2 Diabetes Mellitus (T2D)1
4CompletedTreatmentDiabetes Mellitus (DM)2
4CompletedTreatmentDiabetes Mellitus (DM) / Livers1
4CompletedTreatmentDiabetes Mellitus, Non-Insulin-Dependent1
4CompletedTreatmentDiabetes / Type 2 Diabetes Mellitus (T2D)2
4CompletedTreatmentEndothelial Dysfunction / Hypertensive / Type 2 Diabetes Mellitus (T2D)1
4CompletedTreatmentMild Gestational Diabetes1
4CompletedTreatmentType 2 Diabetes Mellitus (T2D)3
4Enrolling by InvitationTreatmentPermanent Neonatal Diabetes Mellitus2
4Not Yet RecruitingTreatmentCarotid Artery Diseases / Coronary Artery Disease / Type 2 Diabetes Mellitus (T2D)1
4Not Yet RecruitingTreatmentDiabetes, Gestational / Pregnancy in Diabetes1
4Not Yet RecruitingTreatmentGestational Diabetes Mellitus, Class A21
4RecruitingTreatmentBlood Pressures / BMI >30 kg/m2 / Cardiac Hypertrophy / Hypertensive / Microalbuminuria / Type 2 Diabetes Mellitus (T2D) / Vascular Stiffness1
4Unknown StatusTreatmentDiabetes, Diabetes Mellitus Type 11
4Unknown StatusTreatmentDiabetes, Gestational1
4Unknown StatusTreatmentDiabetic Blood Glucose Monitoring / Exercise / Hypoglycemic Agents / Type 2 Diabetes Mellitus (T2D)1
4WithdrawnTreatmentDiabetes, Gestational2
Not AvailableCompletedNot AvailableType 2 Diabetes Mellitus (T2D)5
Not AvailableCompletedScreeningDiabetes Mellitus, Insulin-Dependent / Ischemia-Reperfusion Injury1
Not AvailableCompletedTreatmentDiabetes, Gestational1
Not AvailableCompletedTreatmentType 2 Diabetes Mellitus (T2D)3
Not AvailableRecruitingTreatmentDiabetes1
Not AvailableRecruitingTreatmentDiabetes, Gestational1
Not AvailableUnknown StatusNot AvailableArterial Stiffness / Diabetes Mellitus (DM)1
Not AvailableUnknown StatusTreatmentDiabetes, Gestational / Pregnancy / Type 2 Diabetes Mellitus (T2D)1
Not AvailableUnknown StatusTreatmentHealthy Volunteers1
  • Sanofi aventis us llc
  • Actavis totowa llc
  • Aurobindo pharma ltd
  • Corepharma llc
  • Teva pharmaceuticals usa inc
  • Dava pharmaceuticals inc
  • Hikma pharmaceuticals
  • Mylan pharmaceuticals inc
  • Sandoz inc
  • Pharmacia and upjohn co
Dosage forms
TabletOral2.5 mg
TabletOral5 mg
Tablet, film coatedOral
TabletOral1.25 mg/1
TabletOral1.5 mg/1
TabletOral2.5 mg/1
TabletOral3 mg/1
TabletOral5 mg/1
TabletOral6 mg/1
Unit descriptionCostUnit
Glynase 6 mg tablet2.28USD tablet
Glynase 6 mg prestab2.19USD tablet
Glynase 3 mg tablet1.45USD tablet
Glynase 3 mg prestab1.39USD tablet
Diabeta 5 mg tablet1.36USD tablet
Micronase 5 mg tablet1.36USD tablet
Diabeta 2.5 mg tablet0.91USD tablet
Glynase 1.5 mg tablet0.83USD tablet
Glynase 1.5 mg prestab0.82USD tablet
Micronase 2.5 mg tablet0.8USD tablet
Diabeta 1.25 mg tablet0.5USD tablet
Micronase 1.25 mg tablet0.48USD tablet
Diabeta 5 mg Tablet0.26USD tablet
Diabeta 2.5 mg Tablet0.14USD tablet
Apo-Glyburide 5 mg Tablet0.07USD tablet
Euglucon 5 mg Tablet0.07USD tablet
Mylan-Glybe 5 mg Tablet0.07USD tablet
Novo-Glyburide 5 mg Tablet0.07USD tablet
Nu-Glyburide 5 mg Tablet0.07USD tablet
Pms-Glyburide 5 mg Tablet0.07USD tablet
Ratio-Glyburide 5 mg Tablet0.07USD tablet
Sandoz Glyburide 5 mg Tablet0.07USD tablet
Apo-Glyburide 2.5 mg Tablet0.04USD tablet
Euglucon 2.5 mg Tablet0.04USD tablet
Mylan-Glybe 2.5 mg Tablet0.04USD tablet
Novo-Glyburide 2.5 mg Tablet0.04USD tablet
Nu-Glyburide 2.5 mg Tablet0.04USD tablet
Pms-Glyburide 2.5 mg Tablet0.04USD tablet
Ratio-Glyburide 2.5 mg Tablet0.04USD tablet
Sandoz Glyburide 2.5 mg Tablet0.04USD tablet
DrugBank does not sell nor buy drugs. Pricing information is supplied for informational purposes only.
Patent NumberPediatric ExtensionApprovedExpires (estimated)
US6303146 Yes2000-01-142020-01-14Us
Experimental Properties
melting point (°C)169 °CPhysProp
water solubility4 mg/L (at 27 °C)YALKOWSKY,SH & DANNENFELSER,RM (1992)
logP4.7Not Available
logS-5.09ADME Research, USCD
Predicted Properties
Water Solubility0.00206 mg/mLALOGPS
pKa (Strongest Acidic)4.32ChemAxon
pKa (Strongest Basic)-1.2ChemAxon
Physiological Charge-1ChemAxon
Hydrogen Acceptor Count5ChemAxon
Hydrogen Donor Count3ChemAxon
Polar Surface Area113.6 Å2ChemAxon
Rotatable Bond Count7ChemAxon
Refractivity126.98 m3·mol-1ChemAxon
Polarizability51.75 Å3ChemAxon
Number of Rings3ChemAxon
Rule of FiveYesChemAxon
Ghose FilterYesChemAxon
Veber's RuleYesChemAxon
MDDR-like RuleYesChemAxon
Predicted ADMET features
Human Intestinal Absorption+0.9701
Blood Brain Barrier-0.6707
Caco-2 permeable-0.6479
P-glycoprotein substrateNon-substrate0.5109
P-glycoprotein inhibitor INon-inhibitor0.7119
P-glycoprotein inhibitor IINon-inhibitor0.8185
Renal organic cation transporterNon-inhibitor0.7982
CYP450 2C9 substrateSubstrate0.6488
CYP450 2D6 substrateNon-substrate0.9116
CYP450 3A4 substrateSubstrate0.5329
CYP450 1A2 substrateNon-inhibitor0.9045
CYP450 2C9 inhibitorInhibitor0.8948
CYP450 2D6 inhibitorInhibitor0.8932
CYP450 2C19 inhibitorNon-inhibitor0.9026
CYP450 3A4 inhibitorInhibitor0.7959
CYP450 inhibitory promiscuityHigh CYP Inhibitory Promiscuity0.8627
Ames testNon AMES toxic0.6996
BiodegradationNot ready biodegradable0.8245
Rat acute toxicity1.4243 LD50, mol/kg Not applicable
hERG inhibition (predictor I)Weak inhibitor0.7551
hERG inhibition (predictor II)Non-inhibitor0.8024
ADMET data is predicted using admetSAR, a free tool for evaluating chemical ADMET properties. (23092397 )
Mass Spec (NIST)Not Available
Spectrum TypeDescriptionSplash Key
LC-MS/MSLC-MS/MS Spectrum - , positivesplash10-014i-0002290000-4a0641596c33a997d77eView in MoNA
LC-MS/MSLC-MS/MS Spectrum - , positivesplash10-014i-0319000000-b4fc8ec2ce4cb2f7b9feView in MoNA
LC-MS/MSLC-MS/MS Spectrum - , positivesplash10-014i-0002190000-7f61119495ccea67ff2fView in MoNA
LC-MS/MSLC-MS/MS Spectrum - , positivesplash10-014i-1629000000-bcf31c97391018018369View in MoNA
LC-MS/MSLC-MS/MS Spectrum - , positivesplash10-014i-2911000000-7c5e8a23fd392fd3eb4dView in MoNA
LC-MS/MSLC-MS/MS Spectrum - LC-ESI-QFT , positivesplash10-014i-0906000000-4ed189ce2c190cc04470View in MoNA
Predicted LC-MS/MSPredicted LC-MS/MS Spectrum - 10V, PositiveNot Available
Predicted LC-MS/MSPredicted LC-MS/MS Spectrum - 20V, PositiveNot Available
Predicted LC-MS/MSPredicted LC-MS/MS Spectrum - 40V, PositiveNot Available
Predicted LC-MS/MSPredicted LC-MS/MS Spectrum - 10V, NegativeNot Available
Predicted LC-MS/MSPredicted LC-MS/MS Spectrum - 20V, NegativeNot Available
Predicted LC-MS/MSPredicted LC-MS/MS Spectrum - 40V, NegativeNot Available
DescriptionThis compound belongs to the class of chemical entities known as benzenesulfonamides. These are organic compounds containing a sulfonamide group that is S-linked to a benzene ring.
KingdomChemical entities
Super ClassOrganic compounds
Sub ClassBenzene and substituted derivatives
Direct ParentBenzenesulfonamides
Alternative Parents
  • Benzenesulfonamide
  • Benzenesulfonyl group
  • Anisole
  • Phenol ether
  • Methoxybenzene
  • Phenoxy compound
  • Chlorobenzene
  • Halobenzene
  • Sulfonylurea
  • Alkyl aryl ether
  • Aryl chloride
  • Aryl halide
  • Aminosulfonyl compound
  • Sulfonyl
  • Organosulfonic acid or derivatives
  • Organic sulfonic acid or derivatives
  • Carboximidic acid
  • Carboximidic acid derivative
  • Organic 1,3-dipolar compound
  • Ether
  • Propargyl-type 1,3-dipolar organic compound
  • Hydrocarbon derivative
  • Organic oxide
  • Organopnictogen compound
  • Organic oxygen compound
  • Organic nitrogen compound
  • Organohalogen compound
  • Organochloride
  • Organonitrogen compound
  • Organooxygen compound
  • Organosulfur compound
  • Aromatic homomonocyclic compound
Molecular FrameworkAromatic homomonocyclic compounds
External Descriptors


Protein group
Pharmacological action
General Function:
Sulfonylurea receptor activity
Specific Function:
Subunit of the beta-cell ATP-sensitive potassium channel (KATP). Regulator of ATP-sensitive K(+) channels and insulin release.
NameUniProt IDDetails
ATP-binding cassette sub-family C member 8Q09428 Details
ATP-sensitive inward rectifier potassium channel 11Q14654 Details
  1. Dabrowski M, Ashcroft FM, Ashfield R, Lebrun P, Pirotte B, Egebjerg J, Bondo Hansen J, Wahl P: The novel diazoxide analog 3-isopropylamino-7-methoxy-4H-1,2,4-benzothiadiazine 1,1-dioxide is a selective Kir6.2/SUR1 channel opener. Diabetes. 2002 Jun;51(6):1896-906. [PubMed:12031979 ]
  2. Hambrock A, Preisig-Muller R, Russ U, Piehl A, Hanley PJ, Ray J, Daut J, Quast U, Derst C: Four novel splice variants of sulfonylurea receptor 1. Am J Physiol Cell Physiol. 2002 Aug;283(2):C587-98. [PubMed:12107069 ]
  3. Hambrock A, Loffler-Walz C, Quast U: Glibenclamide binding to sulphonylurea receptor subtypes: dependence on adenine nucleotides. Br J Pharmacol. 2002 Aug;136(7):995-1004. [PubMed:12145099 ]
  4. Nielsen FE, Bodvarsdottir TB, Worsaae A, MacKay P, Stidsen CE, Boonen HC, Pridal L, Arkhammar PO, Wahl P, Ynddal L, Junager F, Dragsted N, Tagmose TM, Mogensen JP, Koch A, Treppendahl SP, Hansen JB: 6-Chloro-3-alkylamino-4H-thieno[3,2-e]-1,2,4-thiadiazine 1,1-dioxide derivatives potently and selectively activate ATP sensitive potassium channels of pancreatic beta-cells. J Med Chem. 2002 Sep 12;45(19):4171-87. [PubMed:12213059 ]
  5. Babenko AP, Bryan J: SUR-dependent modulation of KATP channels by an N-terminal KIR6.2 peptide. Defining intersubunit gating interactions. J Biol Chem. 2002 Nov 15;277(46):43997-4004. Epub 2002 Sep 3. [PubMed:12213829 ]
  6. Ueda K, Komine J, Matsuo M, Seino S, Amachi T: Cooperative binding of ATP and MgADP in the sulfonylurea receptor is modulated by glibenclamide. Proc Natl Acad Sci U S A. 1999 Feb 16;96(4):1268-72. [PubMed:9990013 ]
  7. Serrano-Martin X, Payares G, Mendoza-Leon A: Glibenclamide, a blocker of K+(ATP) channels, shows antileishmanial activity in experimental murine cutaneous leishmaniasis. Antimicrob Agents Chemother. 2006 Dec;50(12):4214-6. Epub 2006 Oct 2. [PubMed:17015627 ]
Pharmacological action
General Function:
G-protein activated inward rectifier potassium channel activity
Specific Function:
This potassium channel is controlled by G proteins. Inward rectifier potassium channels are characterized by a greater tendency to allow potassium to flow into the cell rather than out of it. Their voltage dependence is regulated by the concentration of extracellular potassium; as external potassium is raised, the voltage range of the channel opening shifts to more positive voltages. The inward...
Gene Name:
Uniprot ID:
Molecular Weight:
47667.3 Da
  1. Chen X, Ji ZL, Chen YZ: TTD: Therapeutic Target Database. Nucleic Acids Res. 2002 Jan 1;30(1):412-5. [PubMed:11752352 ]
Pharmacological action
General Function:
Transporter activity
Specific Function:
Subunit of ATP-sensitive potassium channels (KATP). Can form cardiac and smooth muscle-type KATP channels with KCNJ11. KCNJ11 forms the channel pore while ABCC9 is required for activation and regulation.
Gene Name:
Uniprot ID:
Molecular Weight:
174221.7 Da
  1. Hambrock A, Loffler-Walz C, Quast U: Glibenclamide binding to sulphonylurea receptor subtypes: dependence on adenine nucleotides. Br J Pharmacol. 2002 Aug;136(7):995-1004. [PubMed:12145099 ]
  2. Rainbow RD, James M, Hudman D, Al Johi M, Singh H, Watson PJ, Ashmole I, Davies NW, Lodwick D, Norman RI: Proximal C-terminal domain of sulphonylurea receptor 2A interacts with pore-forming Kir6 subunits in KATP channels. Biochem J. 2004 Apr 1;379(Pt 1):173-81. [PubMed:14672537 ]
  3. Felsch H, Lange U, Hambrock A, Loffler-Walz C, Russ U, Carroll WA, Gopalakrishnan M, Quast U: Interaction of a novel dihydropyridine K+ channel opener, A-312110, with recombinant sulphonylurea receptors and KATP channels: comparison with the cyanoguanidine P1075. Br J Pharmacol. 2004 Apr;141(7):1098-105. Epub 2004 Mar 15. [PubMed:15023854 ]
  4. Zhao JL, Yang YJ, You SJ, Jing ZC, Wu YJ, Cheng JL, Gao RL: Pretreatment with fosinopril or valsartan reduces myocardial no-reflow after acute myocardial infarction and reperfusion. Coron Artery Dis. 2006 Aug;17(5):463-9. [PubMed:16845255 ]
  5. Wang YH, Zheng HY, Qin NL, Yu SB, Liu SY: Involvement of ATP-sensitive potassium channels in proliferation and differentiation of rat preadipocytes. Sheng Li Xue Bao. 2007 Feb 25;59(1):8-12. [PubMed:17294036 ]
Pharmacological action
General Function:
Transporter activity
Specific Function:
Involved in the ATP-dependent secretion of bile salts into the canaliculus of hepatocytes.
Gene Name:
Uniprot ID:
Molecular Weight:
146405.83 Da
  1. Byrne JA, Strautnieks SS, Mieli-Vergani G, Higgins CF, Linton KJ, Thompson RJ: The human bile salt export pump: characterization of substrate specificity and identification of inhibitors. Gastroenterology. 2002 Nov;123(5):1649-58. [PubMed:12404239 ]
  2. Kemp DC, Brouwer KL: Viability assessment in sandwich-cultured rat hepatocytes after xenobiotic exposure. Toxicol In Vitro. 2004 Dec;18(6):869-77. [PubMed:15465654 ]
  3. Horikawa M, Kato Y, Tyson CA, Sugiyama Y: Potential cholestatic activity of various therapeutic agents assessed by bile canalicular membrane vesicles isolated from rats and humans. Drug Metab Pharmacokinet. 2003;18(1):16-22. [PubMed:15618715 ]
Pharmacological action
General Function:
Syntaxin binding
Specific Function:
cAMP-dependent and sulfonylurea-sensitive anion transporter. Key gatekeeper influencing intracellular cholesterol transport.
Gene Name:
Uniprot ID:
Molecular Weight:
254299.89 Da
  1. Reddy ST, Hama S, Ng C, Grijalva V, Navab M, Fogelman AM: ATP-binding cassette transporter 1 participates in LDL oxidation by artery wall cells. Arterioscler Thromb Vasc Biol. 2002 Nov 1;22(11):1877-83. [PubMed:12426219 ]
  2. Muhl H, Hofler S, Pfeilschifter J: Inhibition of lipopolysaccharide/ATP-induced release of interleukin-18 by KN-62 and glyburide. Eur J Pharmacol. 2003 Dec 15;482(1-3):325-8. [PubMed:14660039 ]
  3. Agassandian M, Mathur SN, Zhou J, Field FJ, Mallampalli RK: Oxysterols trigger ABCA1-mediated basolateral surfactant efflux. Am J Respir Cell Mol Biol. 2004 Aug;31(2):227-33. Epub 2004 Mar 23. [PubMed:15039140 ]
  4. Nieland TJ, Chroni A, Fitzgerald ML, Maliga Z, Zannis VI, Kirchhausen T, Krieger M: Cross-inhibition of SR-BI- and ABCA1-mediated cholesterol transport by the small molecules BLT-4 and glyburide. J Lipid Res. 2004 Jul;45(7):1256-65. Epub 2004 Apr 21. [PubMed:15102890 ]
  5. Alder-Baerens N, Muller P, Pohl A, Korte T, Hamon Y, Chimini G, Pomorski T, Herrmann A: Headgroup-specific exposure of phospholipids in ABCA1-expressing cells. J Biol Chem. 2005 Jul 15;280(28):26321-9. Epub 2005 May 19. [PubMed:15905177 ]
  6. Lamkanfi M, Mueller JL, Vitari AC, Misaghi S, Fedorova A, Deshayes K, Lee WP, Hoffman HM, Dixit VM: Glyburide inhibits the Cryopyrin/Nalp3 inflammasome. J Cell Biol. 2009 Oct 5;187(1):61-70. doi: 10.1083/jcb.200903124. [PubMed:19805629 ]
Pharmacological action
General Function:
Pdz domain binding
Specific Function:
Involved in the transport of chloride ions. May regulate bicarbonate secretion and salvage in epithelial cells by regulating the SLC4A7 transporter. Can inhibit the chloride channel activity of ANO1. Plays a role in the chloride and bicarbonate homeostasis during sperm epididymal maturation and capacitation.
Gene Name:
Uniprot ID:
Molecular Weight:
168139.895 Da
  1. Reddy MM, Quinton PM: Effect of anion transport blockers on CFTR in the human sweat duct. J Membr Biol. 2002 Sep 1;189(1):15-25. [PubMed:12202948 ]
  2. Jiang J, Song Y, Bai C, Koller BH, Matthay MA, Verkman AS: Pleural surface fluorescence measurement of Na+ and Cl- transport across the air space-capillary barrier. J Appl Physiol (1985). 2003 Jan;94(1):343-52. Epub 2002 Aug 30. [PubMed:12391048 ]
  3. Zhou Z, Hu S, Hwang TC: Probing an open CFTR pore with organic anion blockers. J Gen Physiol. 2002 Nov;120(5):647-62. [PubMed:12407077 ]
  4. Larsen EH, Amstrup J, Willumsen NJ: Beta-adrenergic receptors couple to CFTR chloride channels of intercalated mitochondria-rich cells in the heterocellular toad skin epithelium. Biochim Biophys Acta. 2003 Dec 30;1618(2):140-52. [PubMed:14729151 ]
  5. Lee SY, Lee CO: Inhibition of Na+-K+ pump and L-type Ca2+ channel by glibenclamide in Guinea pig ventricular myocytes. J Pharmacol Exp Ther. 2005 Jan;312(1):61-8. Epub 2004 Sep 13. [PubMed:15365090 ]
Protein group
Pharmacological action
General Function:
Voltage-gated potassium channel activity
Specific Function:
This receptor is controlled by G proteins. Inward rectifier potassium channels are characterized by a greater tendency to allow potassium to flow into the cell rather than out of it. Their voltage dependence is regulated by the concentration of extracellular potassium; as external potassium is raised, the voltage range of the channel opening shifts to more positive voltages. The inward rectification is mainly due to the blockage of outward current by internal magnesium. Can be blocked by extracellular barium (By similarity). Subunit of ATP-sensitive potassium channels (KATP). Can form cardiac and smooth muscle-type KATP channels with ABCC9. KCNJ11 forms the channel pore while ABCC9 is required for activation and regulation.
NameUniProt IDDetails
ATP-sensitive inward rectifier potassium channel 11Q14654 Details
ATP-sensitive inward rectifier potassium channel 8Q15842 Details
  1. Jaburek M, Yarov-Yarovoy V, Paucek P, Garlid KD: State-dependent inhibition of the mitochondrial KATP channel by glyburide and 5-hydroxydecanoate. J Biol Chem. 1998 May 29;273(22):13578-82. [PubMed:9593694 ]
Pharmacological action
General Function:
Carnitine o-palmitoyltransferase activity
Specific Function:
Catalyzes the transfer of the acyl group of long-chain fatty acid-CoA conjugates onto carnitine, an essential step for the mitochondrial uptake of long-chain fatty acids and their subsequent beta-oxidation in the mitochondrion. Plays an important role in triglyceride metabolism.
Gene Name:
Uniprot ID:
Molecular Weight:
88366.92 Da
  1. Patel TB: Effect of sulfonylureas on hepatic fatty acid oxidation. Am J Physiol. 1986 Aug;251(2 Pt 1):E241-6. [PubMed:3090894 ]
  2. Cook GA: The hypoglycemic sulfonylureas glyburide and tolbutamide inhibit fatty acid oxidation by inhibiting carnitine palmitoyltransferase. J Biol Chem. 1987 Apr 15;262(11):4968-72. [PubMed:3104327 ]


Pharmacological action
General Function:
Steroid hydroxylase activity
Specific Function:
Cytochromes P450 are a group of heme-thiolate monooxygenases. In liver microsomes, this enzyme is involved in an NADPH-dependent electron transport pathway. It oxidizes a variety of structurally unrelated compounds, including steroids, fatty acids, and xenobiotics. This enzyme contributes to the wide pharmacokinetics variability of the metabolism of drugs such as S-warfarin, diclofenac, phenyto...
Gene Name:
Uniprot ID:
Molecular Weight:
55627.365 Da
  1. Zhou SF, Zhou ZW, Yang LP, Cai JP: Substrates, inducers, inhibitors and structure-activity relationships of human Cytochrome P450 2C9 and implications in drug development. Curr Med Chem. 2009;16(27):3480-675. Epub 2009 Sep 1. [PubMed:19515014 ]
  2. Preissner S, Kroll K, Dunkel M, Senger C, Goldsobel G, Kuzman D, Guenther S, Winnenburg R, Schroeder M, Preissner R: SuperCYP: a comprehensive database on Cytochrome P450 enzymes including a tool for analysis of CYP-drug interactions. Nucleic Acids Res. 2010 Jan;38(Database issue):D237-43. doi: 10.1093/nar/gkp970. Epub 2009 Nov 24. [PubMed:19934256 ]
  3. Drug Interactions: Cytochrome P450 Drug Interaction Table [Link]
Pharmacological action
General Function:
Steroid hydroxylase activity
Specific Function:
Responsible for the metabolism of a number of therapeutic agents such as the anticonvulsant drug S-mephenytoin, omeprazole, proguanil, certain barbiturates, diazepam, propranolol, citalopram and imipramine.
Gene Name:
Uniprot ID:
Molecular Weight:
55930.545 Da
  1. Zhou SF, Zhou ZW, Yang LP, Cai JP: Substrates, inducers, inhibitors and structure-activity relationships of human Cytochrome P450 2C9 and implications in drug development. Curr Med Chem. 2009;16(27):3480-675. Epub 2009 Sep 1. [PubMed:19515014 ]
  2. Preissner S, Kroll K, Dunkel M, Senger C, Goldsobel G, Kuzman D, Guenther S, Winnenburg R, Schroeder M, Preissner R: SuperCYP: a comprehensive database on Cytochrome P450 enzymes including a tool for analysis of CYP-drug interactions. Nucleic Acids Res. 2010 Jan;38(Database issue):D237-43. doi: 10.1093/nar/gkp970. Epub 2009 Nov 24. [PubMed:19934256 ]
Pharmacological action
General Function:
Vitamin d3 25-hydroxylase activity
Specific Function:
Cytochromes P450 are a group of heme-thiolate monooxygenases. In liver microsomes, this enzyme is involved in an NADPH-dependent electron transport pathway. It performs a variety of oxidation reactions (e.g. caffeine 8-oxidation, omeprazole sulphoxidation, midazolam 1'-hydroxylation and midazolam 4-hydroxylation) of structurally unrelated compounds, including steroids, fatty acids, and xenobiot...
Gene Name:
Uniprot ID:
Molecular Weight:
57342.67 Da
  1. Zhou SF, Zhou ZW, Yang LP, Cai JP: Substrates, inducers, inhibitors and structure-activity relationships of human Cytochrome P450 2C9 and implications in drug development. Curr Med Chem. 2009;16(27):3480-675. Epub 2009 Sep 1. [PubMed:19515014 ]
  2. Preissner S, Kroll K, Dunkel M, Senger C, Goldsobel G, Kuzman D, Guenther S, Winnenburg R, Schroeder M, Preissner R: SuperCYP: a comprehensive database on Cytochrome P450 enzymes including a tool for analysis of CYP-drug interactions. Nucleic Acids Res. 2010 Jan;38(Database issue):D237-43. doi: 10.1093/nar/gkp970. Epub 2009 Nov 24. [PubMed:19934256 ]


Pharmacological action
General Function:
Toxic substance binding
Specific Function:
Serum albumin, the main protein of plasma, has a good binding capacity for water, Ca(2+), Na(+), K(+), fatty acids, hormones, bilirubin and drugs. Its main function is the regulation of the colloidal osmotic pressure of blood. Major zinc transporter in plasma, typically binds about 80% of all plasma zinc.
Gene Name:
Uniprot ID:
Molecular Weight:
69365.94 Da
  1. Crooks MJ, Brown KF: The binding of sulphonylureas to serum albumin. J Pharm Pharmacol. 1974 May;26(5):304-11. [PubMed:4153105 ]
  2. Hsu PL, Ma JK, Luzzi LA: Interactions of sulfonylureas with plasma proteins. J Pharm Sci. 1974 Apr;63(4):570-3. [PubMed:4208196 ]
  3. Brown KF, Crooks MJ: Displacement of tolbutamide, glibencalmide and chlorpropamide from serum albumin by anionic drugs. Biochem Pharmacol. 1976 May 15;25(10):1175-8. [PubMed:820348 ]


Pharmacological action
General Function:
Organic anion transmembrane transporter activity
Specific Function:
May act as an inducible transporter in the biliary and intestinal excretion of organic anions. Acts as an alternative route for the export of bile acids and glucuronides from cholestatic hepatocytes (By similarity).
Gene Name:
Uniprot ID:
Molecular Weight:
169341.14 Da
  1. Gedeon C, Behravan J, Koren G, Piquette-Miller M: Transport of glyburide by placental ABC transporters: implications in fetal drug exposure. Placenta. 2006 Nov-Dec;27(11-12):1096-102. Epub 2006 Feb 3. [PubMed:16460798 ]
Pharmacological action
General Function:
Transporter activity
Specific Function:
Involved in the ATP-dependent secretion of bile salts into the canaliculus of hepatocytes.
Gene Name:
Uniprot ID:
Molecular Weight:
146405.83 Da
  1. Byrne JA, Strautnieks SS, Mieli-Vergani G, Higgins CF, Linton KJ, Thompson RJ: The human bile salt export pump: characterization of substrate specificity and identification of inhibitors. Gastroenterology. 2002 Nov;123(5):1649-58. [PubMed:12404239 ]
  2. Wang EJ, Casciano CN, Clement RP, Johnson WW: Fluorescent substrates of sister-P-glycoprotein (BSEP) evaluated as markers of active transport and inhibition: evidence for contingent unequal binding sites. Pharm Res. 2003 Apr;20(4):537-44. [PubMed:12739759 ]
  3. Noe J, Hagenbuch B, Meier PJ, St-Pierre MV: Characterization of the mouse bile salt export pump overexpressed in the baculovirus system. Hepatology. 2001 May;33(5):1223-31. [PubMed:11343252 ]
  4. Funk C, Pantze M, Jehle L, Ponelle C, Scheuermann G, Lazendic M, Gasser R: Troglitazone-induced intrahepatic cholestasis by an interference with the hepatobiliary export of bile acids in male and female rats. Correlation with the gender difference in troglitazone sulfate formation and the inhibition of the canalicular bile salt export pump (Bsep) by troglitazone and troglitazone sulfate. Toxicology. 2001 Oct 5;167(1):83-98. [PubMed:11557132 ]
  5. Stieger B, Fattinger K, Madon J, Kullak-Ublick GA, Meier PJ: Drug- and estrogen-induced cholestasis through inhibition of the hepatocellular bile salt export pump (Bsep) of rat liver. Gastroenterology. 2000 Feb;118(2):422-30. [PubMed:10648470 ]
Pharmacological action
General Function:
Xenobiotic-transporting atpase activity
Specific Function:
Energy-dependent efflux pump responsible for decreased drug accumulation in multidrug-resistant cells.
Gene Name:
Uniprot ID:
Molecular Weight:
141477.255 Da
  1. Golstein PE, Boom A, van Geffel J, Jacobs P, Masereel B, Beauwens R: P-glycoprotein inhibition by glibenclamide and related compounds. Pflugers Arch. 1999 Apr;437(5):652-60. [PubMed:10087141 ]
Pharmacological action
General Function:
Transporter activity
Specific Function:
Mediates export of organic anions and drugs from the cytoplasm. Mediates ATP-dependent transport of glutathione and glutathione conjugates, leukotriene C4, estradiol-17-beta-o-glucuronide, methotrexate, antiviral drugs and other xenobiotics. Confers resistance to anticancer drugs. Hydrolyzes ATP with low efficiency.
Gene Name:
Uniprot ID:
Molecular Weight:
171589.5 Da
  1. Payen L, Delugin L, Courtois A, Trinquart Y, Guillouzo A, Fardel O: The sulphonylurea glibenclamide inhibits multidrug resistance protein (MRP1) activity in human lung cancer cells. Br J Pharmacol. 2001 Feb;132(3):778-84. [PubMed:11159731 ]
  2. Gedeon C, Behravan J, Koren G, Piquette-Miller M: Transport of glyburide by placental ABC transporters: implications in fetal drug exposure. Placenta. 2006 Nov-Dec;27(11-12):1096-102. Epub 2006 Feb 3. [PubMed:16460798 ]
Pharmacological action
General Function:
Proton-dependent oligopeptide secondary active transmembrane transporter activity
Specific Function:
Proton-coupled intake of oligopeptides of 2 to 4 amino acids with a preference for dipeptides. May constitute a major route for the absorption of protein digestion end-products.
Gene Name:
Uniprot ID:
Molecular Weight:
78805.265 Da
  1. Sawada K, Terada T, Saito H, Hashimoto Y, Inui K: Effects of glibenclamide on glycylsarcosine transport by the rat peptide transporters PEPT1 and PEPT2. Br J Pharmacol. 1999 Nov;128(6):1159-64. [PubMed:10578127 ]
Pharmacological action
General Function:
Sodium-independent organic anion transmembrane transporter activity
Specific Function:
Mediates the Na(+)-independent transport of organic anions such as sulfobromophthalein (BSP) and conjugated (taurocholate) and unconjugated (cholate) bile acids (By similarity). Selectively inhibited by the grapefruit juice component naringin.
Gene Name:
Uniprot ID:
Molecular Weight:
74144.105 Da
  1. Shitara Y, Sugiyama D, Kusuhara H, Kato Y, Abe T, Meier PJ, Itoh T, Sugiyama Y: Comparative inhibitory effects of different compounds on rat oatpl (slc21a1)- and Oatp2 (Slc21a5)-mediated transport. Pharm Res. 2002 Feb;19(2):147-53. [PubMed:11883641 ]
Pharmacological action
General Function:
Peptide:proton symporter activity
Specific Function:
Proton-coupled intake of oligopeptides of 2 to 4 amino acids with a preference for dipeptides.
Gene Name:
Uniprot ID:
Molecular Weight:
81782.77 Da
  1. Sawada K, Terada T, Saito H, Hashimoto Y, Inui K: Effects of glibenclamide on glycylsarcosine transport by the rat peptide transporters PEPT1 and PEPT2. Br J Pharmacol. 1999 Nov;128(6):1159-64. [PubMed:10578127 ]
Pharmacological action
General Function:
Sodium-independent organic anion transmembrane transporter activity
Specific Function:
Involved in the renal elimination of endogenous and exogenous organic anions. Functions as organic anion exchanger when the uptake of one molecule of organic anion is coupled with an efflux of one molecule of endogenous dicarboxylic acid (glutarate, ketoglutarate, etc). Mediates the sodium-independent uptake of 2,3-dimercapto-1-propanesulfonic acid (DMPS) (By similarity). Mediates the sodium-in...
Gene Name:
Uniprot ID:
Molecular Weight:
61815.78 Da
  1. Uwai Y, Saito H, Hashimoto Y, Inui K: Inhibitory effect of anti-diabetic agents on rat organic anion transporter rOAT1. Eur J Pharmacol. 2000 Jun 16;398(2):193-7. [PubMed:10854830 ]
Pharmacological action
General Function:
Organic anion transmembrane transporter activity
Specific Function:
Mediates hepatobiliary excretion of numerous organic anions. May function as a cellular cisplatin transporter.
Gene Name:
Uniprot ID:
Molecular Weight:
174205.64 Da
  1. Gedeon C, Behravan J, Koren G, Piquette-Miller M: Transport of glyburide by placental ABC transporters: implications in fetal drug exposure. Placenta. 2006 Nov-Dec;27(11-12):1096-102. Epub 2006 Feb 3. [PubMed:16460798 ]
  2. Payen L, Delugin L, Courtois A, Trinquart Y, Guillouzo A, Fardel O: The sulphonylurea glibenclamide inhibits multidrug resistance protein (MRP1) activity in human lung cancer cells. Br J Pharmacol. 2001 Feb;132(3):778-84. [PubMed:11159731 ]
Pharmacological action
General Function:
Xenobiotic-transporting atpase activity
Specific Function:
High-capacity urate exporter functioning in both renal and extrarenal urate excretion. Plays a role in porphyrin homeostasis as it is able to mediates the export of protoporhyrin IX (PPIX) both from mitochondria to cytosol and from cytosol to extracellular space, and cellular export of hemin, and heme. Xenobiotic transporter that may play an important role in the exclusion of xenobiotics from t...
Gene Name:
Uniprot ID:
Molecular Weight:
72313.47 Da
  1. Gedeon C, Behravan J, Koren G, Piquette-Miller M: Transport of glyburide by placental ABC transporters: implications in fetal drug exposure. Placenta. 2006 Nov-Dec;27(11-12):1096-102. Epub 2006 Feb 3. [PubMed:16460798 ]
  2. Pollex EK, Anger G, Hutson J, Koren G, Piquette-Miller M: Breast cancer resistance protein (BCRP)-mediated glyburide transport: effect of the C421A/Q141K BCRP single-nucleotide polymorphism. Drug Metab Dispos. 2010 May;38(5):740-4. doi: 10.1124/dmd.109.030791. Epub 2010 Feb 16. [PubMed:20159988 ]
Pharmacological action
General Function:
Sodium-independent organic anion transmembrane transporter activity
Specific Function:
Mediates sodium-independent multispecific organic anion transport. Transport of prostaglandin E2, prostaglandin F2, tetracycline, bumetanide, estrone sulfate, glutarate, dehydroepiandrosterone sulfate, allopurinol, 5-fluorouracil, paclitaxel, L-ascorbic acid, salicylate, ethotrexate, and alpha-ketoglutarate.
Gene Name:
Uniprot ID:
Molecular Weight:
60025.025 Da
  1. Morita N, Kusuhara H, Sekine T, Endou H, Sugiyama Y: Functional characterization of rat organic anion transporter 2 in LLC-PK1 cells. J Pharmacol Exp Ther. 2001 Sep;298(3):1179-84. [PubMed:11504818 ]
Pharmacological action
General Function:
Sodium-independent organic anion transmembrane transporter activity
Specific Function:
Mediates the Na(+)-independent transport of organic anions such as taurocholate, the prostaglandins PGD2, PGE1, PGE2, leukotriene C4, thromboxane B2 and iloprost.
Gene Name:
Uniprot ID:
Molecular Weight:
76709.98 Da
  1. Satoh H, Yamashita F, Tsujimoto M, Murakami H, Koyabu N, Ohtani H, Sawada Y: Citrus juices inhibit the function of human organic anion-transporting polypeptide OATP-B. Drug Metab Dispos. 2005 Apr;33(4):518-23. Epub 2005 Jan 7. [PubMed:15640378 ]
Drug created on June 13, 2005 07:24 / Updated on May 27, 2017 07:41