
Accession Number
DB01016  (APRD00233)
Small Molecule

Glyburide is an oral antihyperglycemic agent used for the treatment of non-insulin-dependent diabetes mellitus (NIDDM). It belongs to the sulfonylurea class of insulin secretagogues, which act by stimulating β cells of the pancreas to release insulin. Sulfonylureas increase both basal insulin secretion and meal-stimulated insulin release. Medications in this class differ in their dose, rate of absorption, duration of action, route of elimination and binding site on their target pancreatic β cell receptor. Sulfonylureas also increase peripheral glucose utilization, decrease hepatic gluconeogenesis and may increase the number and sensitivity of insulin receptors. Sulfonylureas are associated with weight gain, though less so than insulin. Due to their mechanism of action, sulfonylureas may cause hypoglycemia and require consistent food intake to decrease this risk. The risk of hypoglycemia is increased in elderly, debilitated and malnourished individuals. Glyburide has been shown to decrease fasting plasma glucose, postprandial blood glucose and glycosolated hemoglobin (HbA1c) levels (reflective of the last 8-10 weeks of glucose control). Glyburide appears to be completely metabolized, likely in the liver. Although its metabolites exert a small hypoglycemic effect, their contribution to glyburide's hypoglycemic effect is thought to be clinically unimportant. Glyburide metabolites are excreted in urine and feces in approximately equal proportions.

  • 1-((p-(2-(5-chloro-o-anisamido)ethyl)phenyl)sulfonyl)-3-cyclohexylurea
  • 1-(p-(2-(5-chloro-2-methoxybenzamido)ethyl)benzenesulfonyl)-3-cyclohexylurea
  • 5-chloro-N-(2-(4-((((cyclohexylamino)carbonyl)amino)sulfonyl)phenyl)ethyl)-2-methoxybenzamide
  • Glibenclamida
  • Glibenclamide
  • Glibenclamidum
External IDs
HB 419 / HB-419 / U-26,45 / U-26,452 / U-26452
Product Images
Prescription Products
NameDosageStrengthRouteLabellerMarketing StartMarketing End
Apo Glyburide Tab 2.5mgTablet2.5 mgOralApotex Corporation1991-12-31Not applicableCanada
Apo Glyburide Tab 5mgTablet5 mgOralApotex Corporation1991-12-31Not applicableCanada
DiaBetaTablet2.5 mg/1OralSanofi Aventis2009-06-012018-05-11Us
DiaBetaTablet5 mgOralSanofi Aventis1997-02-21Not applicableCanada
DiaBetaTablet1.25 mg/1OralSanofi Aventis2009-06-012018-05-11Us
DiaBetaTablet2.5 mgOralSanofi Aventis1997-05-28Not applicableCanada
DiaBetaTablet5 mg/1OralSanofi Aventis2009-06-012018-05-11Us
Diabeta 5mgTablet5 mgOralHoechst Canada Inc.1971-12-311996-09-09Canada
Diabeta Tab 2.5mgTablet2.5 mgOralHoechst Canada Inc.1978-12-311997-08-05Canada
Diabeta Tab 5mgTablet5 mgOralHoechst Roussel Canada Inc.1993-12-311999-08-11Canada
Generic Prescription Products
NameDosageStrengthRouteLabellerMarketing StartMarketing End
Ava-glyburideTablet5 mgOralAvanstra Inc2011-08-112014-08-21Canada
Ava-glyburideTablet2.5 mgOralAvanstra Inc2011-08-112014-08-21Canada
Dom-glyburideTablet5 mgOralDominion Pharmacal1998-03-20Not applicableCanada
Dom-glyburideTablet2.5 mgOralDominion Pharmacal1998-03-202010-02-16Canada
GlyburideTablet2.5 mg/1Oralbryant ranch prepack2010-10-05Not applicableUs
GlyburideTablet2.5 mg/1OralRemedy Repack2011-07-182017-11-09Us
GlyburideTablet5 mg/1OralPreferreed Pharmaceuticals Inc.2015-08-27Not applicableUs
GlyburideTablet2.5 mg/1OralPd Rx Pharmaceuticals, Inc.1984-05-01Not applicableUs
GlyburideTablet5 mg/1OralNucare Pharmaceuticals, Inc.2010-10-05Not applicableUs
GlyburideTablet1.25 mg/1OralTeva1984-05-01Not applicableUs
Mixture Products
NameIngredientsDosageRouteLabellerMarketing StartMarketing End
GlucovanceGlyburide (2.5 mg/1) + Metformin Hydrochloride (500 mg/1)Tablet, film coatedOralBristol Myers Squibb2008-12-15Not applicableUs
GlucovanceGlyburide (2.5 mg/1) + Metformin Hydrochloride (500 mg/1)Tablet, film coatedOralPhysicians Total Care, Inc.2002-05-31Not applicableUs
GlucovanceGlyburide (5 mg/1) + Metformin Hydrochloride (500 mg/1)Tablet, film coatedOralBristol Myers Squibb2008-12-15Not applicableUs
Glyburide (micronized) and Metformin HydrochlorideGlyburide (1.25 mg/1) + Metformin Hydrochloride (250 mg/1)TabletOralActavis Pharma Manufacturing Pvt. Ltd.2010-05-032016-03-22Us
Glyburide (micronized) and Metformin HydrochlorideGlyburide (5 mg/1) + Metformin Hydrochloride (500 mg/1)TabletOralActavis Pharma Manufacturing Pvt. Ltd.2010-05-032016-03-22Us
Glyburide (micronized) and Metformin HydrochlorideGlyburide (5 mg/1) + Metformin Hydrochloride (500 mg/1)TabletOralActavis, Inc.2011-06-222017-07-22Us
Glyburide (micronized) and Metformin HydrochlorideGlyburide (2.5 mg/1) + Metformin Hydrochloride (500 mg/1)TabletOralActavis Pharma Manufacturing Pvt. Ltd.2010-05-032016-03-22Us
Glyburide and MetforminGlyburide (5 mg/1) + Metformin Hydrochloride (500 mg/1)Tablet, film coatedOralbryant ranch prepack2007-06-142018-05-11Us
Glyburide and MetforminGlyburide (2.5 mg/1) + Metformin Hydrochloride (500 mg/1)Tablet, film coatedOralRemedy Repack2013-05-142017-01-18Us
Glyburide and MetforminGlyburide (5 mg/1) + Metformin Hydrochloride (500 mg/1)Tablet, film coatedOralPhysicians Total Care, Inc.2005-03-07Not applicableUs00093 5712 05 nlmimage10 6807b45d
International/Other Brands
Daonil / Delmide / Micronase / Novo-Glyburide (Novopharm) / Semi-Daonil
CAS number
Average: 494.004
Monoisotopic: 493.143819418
Chemical Formula
InChI Key



Indicated as an adjunct to diet to lower the blood glucose in patients with NIDDM whose hyperglycemia cannot be satisfactorily controlled by diet alone.

Structured Indications

Glyburide, a second-generation sulfonylurea antidiabetic agent, lowers blood glucose acutely by stimulating the release of insulin from the pancreas, an effect dependent upon functioning beta cells in the pancreatic islets. With chronic administration in Type II diabetic patients, the blood glucose lowering effect persists despite a gradual decline in the insulin secretory response to the drug. Extrapancreatic effects may be involved in the mechanism of action of oral sulfonyl-urea hypoglycemic drugs. The combination of glibenclamide and metformin may have a synergistic effect, since both agents act to improve glucose tolerance by different but complementary mechanisms. In addition to its blood glucose lowering actions, glyburide produces a mild diuresis by enhancement of renal free water clearance. Glyburide is twice as potent as the related second-generation agent glipizide.

Mechanism of action

Sulfonylureas such as glyburide bind to ATP-sensitive potassium channels on the pancreatic cell surface, reducing potassium conductance and causing depolarization of the membrane. Depolarization stimulates calcium ion influx through voltage-sensitive calcium channels, raising intracellular concentrations of calcium ions, which induces the secretion, or exocytosis, of insulin.

ASulfonylurea receptor 1, Kir6.2
UG protein-activated inward rectifier potassium channel 4
UATP-binding cassette sub-family C member 9
UBile salt export pump
UATP-binding cassette sub-family A member 1
UCystic fibrosis transmembrane conductance regulator
UMitochondrial ATP-sensitive potassium channel
UCarnitine O-palmitoyltransferase 1, liver isoform

Significant absorption within 1 hour and peak plasma levels are reached in 2 to 4 hours. Onset of action occurs within one hour.

Volume of distribution

Steady state Vd=0.125 L/kg; Vd during elimination phase=0.155 L/kg.

Protein binding

Unchanged drug is ~99% bound to serum proteins; 4-trans-hydroxyglyburide is greater than 97% bound to serum proteins. Protein binding is primarily nonionic making glyburide and is less likely to displace or be displaced by drugs that bind via an ionic mechanism.


Primarily hepatic (mainly cytochrome P450 3A4). The major metabolite is the 4-trans-hydroxy derivative. A second metabolite, the 3-cis-hydroxy derivative, also occurs. These metabolites do not contribute clinically significant hypoglycemic action in humans as they are only weakly active; however, retention of 4-trans-hydroxyglyburide may prolong the hypoglycemic effect of the agent in those with severe renal impairment.

Route of elimination

Glyburide is excreted as metabolites in the bile and urine, approximately 50% by each route. This dual excretory pathway is qualitatively different from that of other sulfonylureas, which are excreted primarily in the urine.

Half life

1.4-1.8 hours (unchanged drug only); 10 hours (metabolites included). Duration of effect is 12-24 hours. The half-life of glyburide appears to be unaffected in those with a creatinine clearance of greater than 29 ml/min/1.73m2.


78 ml/hr/kg in healthy adults. Clearance may be substantially decreased in those with severe renal impairment.


Oral rat LD50: > 20,000 mg/kg. Oral mouse LD50: 3250 mg/kg.

Affected organisms
  • Humans and other mammals
Glibenclamide Action PathwayDrug action
Pharmacogenomic Effects/ADRs
Interacting Gene/EnzymeAllele nameGenotype(s)Defining Change(s)Type(s)DescriptionDetails
Glucose-6-phosphate 1-dehydrogenaseVilleurbanneNot Available1000_1002delACCADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseTorunNot Available1006A->GADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseSunderlandNot Available105_107delCATADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseIwatsukiNot Available1081G->AADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseSerresNot Available1082C->TADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseTondelaNot Available1084_1101delCTGAACGAGCGCAAGGCCADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseLoma LindaNot Available1089C->AADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseAachenNot Available1089C->GADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseTenriNot Available1096A->GADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseMontpellierNot Available1132G>AADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseCalvo MackennaNot Available1138A->GADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseRileyNot Available1139T->CADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseOlomoucNot Available1141T->CADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseTomahNot Available1153T->CADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseLynwoodNot Available1154G->TADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseMadridNot Available1155C->GADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseIowa, Walter Reed, SpringfieldNot Available1156A->GADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseBeverly Hills, Genova, Iwate, Niigata, YamaguchiNot Available1160G->AADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseHartfordNot Available1162A->GADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenasePrahaNot Available1166A->GADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseKrakowNot Available1175T>CADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseWisconsinNot Available1177C->GADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseNashville, Anaheim, PorticiNot Available1178G->AADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseAlhambraNot Available1180G->CADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseBariNot Available1187C->TADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenasePuerto LimonNot Available1192G->AADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseCovao do LoboNot Available1205C>AADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseClinicNot Available1215G->AADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseUtrechtNot Available1225C->TADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseSuwalkiNot Available1226C->GADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseRiversideNot Available1228G->TADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseJapan, ShinagawaNot Available1229G->AADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseKawasakiNot Available1229G->CADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseMunichNot Available1231A->GADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseGeorgiaNot Available1284C->AADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseSumareNot Available1292T->GADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseTelti/KobeNot Available1318C->TADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseSantiago de Cuba, MoriokaNot Available1339G->AADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseHarimaNot Available1358T->AADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseFiguera da FozNot Available1366G->CADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseAmiensNot Available1367A>TADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseBangkok NoiNot Available1376G->T, 1502T->GADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseFukayaNot Available1462G->AADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseCampinasNot Available1463G->TADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseBuenos AiresNot Available1465C>TADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseArakawaNot Available1466C->TADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseBrightonNot Available1488_1490delGAAADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseKozukataNot Available159G->CADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseAmsterdamNot Available180_182delTCTADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseNo nameNot Available202G->A, 376A->G, 1264C>GADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseSwanseaNot Available224T->CADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseUrayasuNot Available281_283delAGAADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseVancouverNot Available317C->G544C->T592C->TADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseMt SinaiNot Available376A->G, 1159C->TADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenasePlymouthNot Available488G->AADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseVolendamNot Available514C->TADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseShinshuNot Available527A->GADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseChikugoNot Available535A->TADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseTsukuiNot Available561_563delCTCADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenasePedoplis-CkaroNot Available573C>GADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseSantiagoNot Available593G->CADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseMinnesota, Marion, Gastonia, LeJeuneNot Available637G->TADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseCincinnatiNot Available637G->T, 1037A->TADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseHarilaouNot Available648T->GADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseNorth DallasNot Available683_685delACAADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseAsahikawaNot Available695G->AADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseDurhamNot Available713A->GADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseStonybrookNot Available724_729delGGCACTADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseWayneNot Available769C->GADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseAveiroNot Available806G->AADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseCleveland CorumNot Available820G->AADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseLilleNot Available821A>TADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseBangkokNot Available825G>CADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseSugaoNot Available826C->TADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseLa JollaNot Available832T->CADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseWexhamNot Available833C->TADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenasePiotrkowNot Available851T>CADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseWest VirginiaNot Available910G->TADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseOmiyaNot Available921G->CADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseNaraNot Available953_976delCCACCAAAGGGTACCTGGAC GACCADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseManhattanNot Available962G->AADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseRehevotNot Available964T->CADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseHoniaraNot Available99A->G / 1360C->TADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseTokyo, FukushimaNot Available1246G->AADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseChathamNot Available1003G->AADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseFushanNot Available1004C->AADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenasePartenopeNot Available1052G->TADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseIerapetraNot Available1057C->TADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseAnadiaNot Available1193A->GADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseAbenoNot Available1220A->CADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseSurabayaNot Available1291G->AADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenasePawneeNot Available1316G->CADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseS. AntiocoNot Available1342A->GADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseCassanoNot Available1347G->CADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseHermoupolisNot Available1347G->C / 1360C->TADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseUnion,Maewo, Chinese-2, KaloNot Available1360C->TADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseAndalusNot Available1361G->AADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseCosenzaNot Available1376G->CADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseCanton, Taiwan- Hakka, Gifu-like, Agrigento-likeNot Available1376G->TADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseFloresNot Available1387C->AADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseKaiping, Anant, Dhon, Sapporo-like, WoseraNot Available1388G->AADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseKamogawaNot Available169C->TADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseCostanzoNot Available179T>CADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseAmazoniaNot Available185C->AADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseSongklanagarindNot Available196T->AADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseHechiNot Available202G->A / 871G->AADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseNamouruNot Available208T->CADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseBao LocNot Available352T>CADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseCrispimNot Available375G->T, 379G->T383T->C384C>TADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseAcrokorinthosNot Available376A->G / 463C->GADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseSanta MariaNot Available376A->G / 542A->TADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseAnanindeuaNot Available376A->G / 871G->AADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseVanua LavaNot Available383T->CADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseValladolidNot Available406C->TADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseBelemNot Available409C->TADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseLiuzhouNot Available442G->AADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseShenzenNot Available473G>AADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseTaipei “Chinese- 3”Not Available493A->GADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseToledoNot Available496C>TADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseNaoneNot Available497G->AADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseNankangNot Available517T->CADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseMiaoliNot Available519C->GADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseMediterranean, Dallas, Panama‚ Sassari, Cagliari, BirminghamNot Available563C->TADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseCoimbra ShundeNot Available592C->TADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseNilgiriNot Available593G>AADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseRadlowoNot Available679C->TADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseRoubaixNot Available811G>CADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseHaikouNot Available835A->GADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseChinese-1Not Available835A->TADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseMizushimaNot Available848A>GADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseOsakaNot Available853C->TADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseViangchan, JammuNot Available871G->AADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseSeoulNot Available916G->AADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseLudhianaNot Available929G->AADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseFarroupilhaNot Available977C->AADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseChinese-5Not Available1024C->TADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseRignanoNot Available130G>AADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseOrissaNot Available131C->GADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseG6PDNiceNot Available1380G>CADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseKamiube, KeelungNot Available1387C->TADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseNeapolisNot Available1400C->GADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseAuresNot Available143T->CADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseSplitNot Available1442C->GADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseKambosNot Available148C->TADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenasePalestrinaNot Available170G>AADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseMetapontoNot Available172G->AADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseMusashinoNot Available185C->TADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseAsahiNot Available202G->AADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseA- (202), Ferrara INot Available202G->A / 376A->GADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseMurcia OristanoNot Available209A->GADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseUbe KonanNot Available241C->TADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseLagosantoNot Available242G->AADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseGuangzhouNot Available274C->TADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseHammersmithNot Available323T->AADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseSinnaiNot Available34G->TADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseA- (680)Not Available376A->G / 680G->TADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseA- (968), Betica,Selma, GuantanamoNot Available376A->G / 968T->CADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseSalerno PyrgosNot Available383T>GADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseQuing YanNot Available392G->TADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseLagesNot Available40G->AADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseIleshaNot Available466G->AADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseMahidolNot Available487G->AADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseMalagaNot Available542A->TADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseSibariNot Available634A->GADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseMexico CityNot Available680G->AADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseNanningNot Available703C->TADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseSeattle, Lodi, Modena, Ferrara II, Athens-likeNot Available844G->CADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseBajo MaumereNot Available844G->TADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseMontalbanoNot Available854G->AADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseKalyan-Kerala, Jamnaga, RohiniNot Available949G->AADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseGaoheNot Available95A->GADR InferredIncreased risk of hemolytic anemia.Details


Drug Interactions
DrugInteractionDrug group
2,4-thiazolidinedione2,4-thiazolidinedione may increase the hypoglycemic activities of Glyburide.Investigational
7,8-Dichloro-1,2,3,4-tetrahydroisoquinoline7,8-Dichloro-1,2,3,4-tetrahydroisoquinoline may increase the hypoglycemic activities of Glyburide.Experimental
AbirateroneThe metabolism of Glyburide can be decreased when combined with Abiraterone.Approved
AcarboseAcarbose may increase the hypoglycemic activities of Glyburide.Approved, Investigational
AcebutololAcebutolol may increase the hypoglycemic activities of Glyburide.Approved, Investigational
AcenocoumarolGlyburide may increase the anticoagulant activities of Acenocoumarol.Approved, Investigational
AcetohexamideAcetohexamide may increase the hypoglycemic activities of Glyburide.Approved, Investigational, Withdrawn
Acetyl sulfisoxazoleThe metabolism of Glyburide can be decreased when combined with Acetyl sulfisoxazole.Approved, Vet Approved
Acetylsalicylic acidAcetylsalicylic acid may increase the hypoglycemic activities of Glyburide.Approved, Vet Approved
AfatinibThe serum concentration of Afatinib can be increased when it is combined with Glyburide.Approved
AICA ribonucleotideAICA ribonucleotide may increase the hypoglycemic activities of Glyburide.Experimental, Investigational
AlaproclateAlaproclate may increase the hypoglycemic activities of Glyburide.Experimental
AlbiglutideAlbiglutide may increase the hypoglycemic activities of Glyburide.Approved
AllicinAllicin may increase the hypoglycemic activities of Glyburide.Investigational
AlogliptinAlogliptin may increase the hypoglycemic activities of Glyburide.Approved
AloxiprinAloxiprin may increase the hypoglycemic activities of Glyburide.Experimental
AlprenololAlprenolol may increase the hypoglycemic activities of Glyburide.Approved, Withdrawn
Aluminium clofibrateAluminium clofibrate may increase the hypoglycemic activities of Glyburide.Experimental
Aminosalicylic AcidAminosalicylic Acid may increase the hypoglycemic activities of Glyburide.Approved
AmiodaroneThe metabolism of Glyburide can be decreased when combined with Amiodarone.Approved, Investigational
AmphetamineAmphetamine may increase the hypoglycemic activities of Glyburide.Approved, Illicit, Investigational
ApalutamideThe serum concentration of Glyburide can be decreased when it is combined with Apalutamide.Approved, Investigational
AprepitantThe serum concentration of Glyburide can be increased when it is combined with Aprepitant.Approved, Investigational
AripiprazoleThe therapeutic efficacy of Glyburide can be decreased when used in combination with Aripiprazole.Approved, Investigational
ArmodafinilThe metabolism of Glyburide can be decreased when combined with Armodafinil.Approved, Investigational
ArotinololArotinolol may increase the hypoglycemic activities of Glyburide.Investigational
Arsenic trioxideThe therapeutic efficacy of Glyburide can be decreased when used in combination with Arsenic trioxide.Approved, Investigational
ArticaineThe therapeutic efficacy of Glyburide can be decreased when used in combination with Articaine.Approved
AsenapineThe therapeutic efficacy of Glyburide can be decreased when used in combination with Asenapine.Approved
AsunaprevirThe serum concentration of Asunaprevir can be increased when it is combined with Glyburide.Approved, Investigational, Withdrawn
AtazanavirThe metabolism of Glyburide can be decreased when combined with Atazanavir.Approved, Investigational
AtenololAtenolol may increase the hypoglycemic activities of Glyburide.Approved
AtomoxetineThe metabolism of Glyburide can be decreased when combined with Atomoxetine.Approved
AtorvastatinThe risk or severity of adverse effects can be increased when Glyburide is combined with Atorvastatin.Approved
BalaglitazoneBalaglitazone may increase the hypoglycemic activities of Glyburide.Investigational
BalsalazideBalsalazide may increase the hypoglycemic activities of Glyburide.Approved, Investigational
BefunololBefunolol may increase the hypoglycemic activities of Glyburide.Experimental
Bempedoic acidBempedoic acid may increase the hypoglycemic activities of Glyburide.Investigational
BendroflumethiazideThe therapeutic efficacy of Glyburide can be decreased when used in combination with Bendroflumethiazide.Approved
BenmoxinBenmoxin may increase the hypoglycemic activities of Glyburide.Withdrawn
BetamethasoneThe therapeutic efficacy of Glyburide can be decreased when used in combination with Betamethasone.Approved, Vet Approved
BetaxololBetaxolol may increase the hypoglycemic activities of Glyburide.Approved, Investigational
BevantololBevantolol may increase the hypoglycemic activities of Glyburide.Approved
BezafibrateBezafibrate may increase the hypoglycemic activities of Glyburide.Approved, Investigational
BisoprololBisoprolol may increase the hypoglycemic activities of Glyburide.Approved
BoceprevirThe metabolism of Glyburide can be decreased when combined with Boceprevir.Approved, Withdrawn
BopindololBopindolol may increase the hypoglycemic activities of Glyburide.Approved
BortezomibThe metabolism of Glyburide can be decreased when combined with Bortezomib.Approved, Investigational
BosentanGlyburide may increase the hepatotoxic activities of Bosentan.Approved, Investigational
BosutinibThe serum concentration of Bosutinib can be increased when it is combined with Glyburide.Approved
Brentuximab vedotinThe serum concentration of Brentuximab vedotin can be increased when it is combined with Glyburide.Approved, Investigational
BrexpiprazoleThe therapeutic efficacy of Glyburide can be decreased when used in combination with Brexpiprazole.Approved, Investigational
BrofaromineBrofaromine may increase the hypoglycemic activities of Glyburide.Experimental
BromocriptineThe risk or severity of adverse effects can be increased when Bromocriptine is combined with Glyburide.Approved, Investigational
BucindololBucindolol may increase the hypoglycemic activities of Glyburide.Investigational
BuforminBuformin may increase the hypoglycemic activities of Glyburide.Investigational, Withdrawn
BufuralolBufuralol may increase the hypoglycemic activities of Glyburide.Experimental, Investigational
BumetanideThe therapeutic efficacy of Glyburide can be decreased when used in combination with Bumetanide.Approved
BupranololBupranolol may increase the hypoglycemic activities of Glyburide.Approved
BuserelinThe therapeutic efficacy of Glyburide can be decreased when used in combination with Buserelin.Approved, Investigational
CabergolineThe risk or severity of adverse effects can be increased when Cabergoline is combined with Glyburide.Approved
CanagliflozinCanagliflozin may increase the hypoglycemic activities of Glyburide.Approved
CapecitabineThe metabolism of Glyburide can be decreased when combined with Capecitabine.Approved, Investigational
CarbamazepineThe metabolism of Glyburide can be increased when combined with Carbamazepine.Approved, Investigational
Carbaspirin calciumCarbaspirin calcium may increase the hypoglycemic activities of Glyburide.Experimental, Investigational
CarbocisteineThe risk or severity of adverse effects can be increased when Glyburide is combined with Carbocisteine.Approved, Investigational
CarbutamideCarbutamide may increase the hypoglycemic activities of Glyburide.Experimental
CaroxazoneCaroxazone may increase the hypoglycemic activities of Glyburide.Withdrawn
CarteololCarteolol may increase the hypoglycemic activities of Glyburide.Approved
CarvedilolCarvedilol may increase the hypoglycemic activities of Glyburide.Approved, Investigational
CastanospermineCastanospermine may increase the hypoglycemic activities of Glyburide.Experimental
CeliprololCeliprolol may increase the hypoglycemic activities of Glyburide.Approved, Investigational
CeritinibThe serum concentration of Glyburide can be increased when it is combined with Ceritinib.Approved
CerivastatinThe serum concentration of Cerivastatin can be increased when it is combined with Glyburide.Approved, Withdrawn
ChloramphenicolThe metabolism of Glyburide can be decreased when combined with Chloramphenicol.Approved, Vet Approved
ChlorothiazideThe therapeutic efficacy of Glyburide can be decreased when used in combination with Chlorothiazide.Approved, Vet Approved
ChlorpropamideChlorpropamide may increase the hypoglycemic activities of Glyburide.Approved, Investigational
ChlorthalidoneThe therapeutic efficacy of Glyburide can be decreased when used in combination with Chlorthalidone.Approved
CholecalciferolThe metabolism of Glyburide can be decreased when combined with Cholecalciferol.Approved, Nutraceutical
Cholic AcidGlyburide may decrease the excretion rate of Cholic Acid which could result in a higher serum level.Approved
CiglitazoneCiglitazone may increase the hypoglycemic activities of Glyburide.Experimental
CimetidineThe serum concentration of Glyburide can be increased when it is combined with Cimetidine.Approved, Investigational
CinoxacinCinoxacin may increase the hypoglycemic activities of Glyburide.Approved, Investigational, Withdrawn
CiprofibrateCiprofibrate may increase the hypoglycemic activities of Glyburide.Approved, Investigational
CitalopramThe metabolism of Glyburide can be decreased when combined with Citalopram.Approved
ClarithromycinThe serum concentration of Glyburide can be increased when it is combined with Clarithromycin.Approved
ClemastineThe metabolism of Glyburide can be decreased when combined with Clemastine.Approved, Investigational
ClofibrateClofibrate may increase the hypoglycemic activities of Glyburide.Approved, Investigational
ClofibrideClofibride may increase the hypoglycemic activities of Glyburide.Experimental
CloranololCloranolol may increase the hypoglycemic activities of Glyburide.Experimental
ClorindioneGlyburide may increase the anticoagulant activities of Clorindione.Experimental
ClotrimazoleThe metabolism of Glyburide can be decreased when combined with Clotrimazole.Approved, Vet Approved
ClozapineThe therapeutic efficacy of Glyburide can be decreased when used in combination with Clozapine.Approved
CobicistatThe metabolism of Glyburide can be decreased when combined with Cobicistat.Approved
ColchicineThe serum concentration of Colchicine can be increased when it is combined with Glyburide.Approved
ColesevelamThe serum concentration of Glyburide can be decreased when it is combined with Colesevelam.Approved
ConivaptanThe serum concentration of Conivaptan can be increased when it is combined with Glyburide.Approved, Investigational
CorticotropinThe therapeutic efficacy of Glyburide can be decreased when used in combination with Corticotropin.Approved, Investigational, Vet Approved
Cortisone acetateThe therapeutic efficacy of Glyburide can be decreased when used in combination with Cortisone acetate.Approved, Investigational
CrisaboroleThe metabolism of Glyburide can be decreased when combined with Crisaborole.Approved, Investigational
CrizotinibThe metabolism of Glyburide can be decreased when combined with Crizotinib.Approved
CyclopenthiazideThe therapeutic efficacy of Glyburide can be decreased when used in combination with Cyclopenthiazide.Experimental
CyclosporineThe therapeutic efficacy of Glyburide can be decreased when used in combination with Cyclosporine.Approved, Investigational, Vet Approved
Cyproterone acetateThe therapeutic efficacy of Glyburide can be decreased when used in combination with Cyproterone acetate.Approved, Investigational
Dabigatran etexilateThe serum concentration of the active metabolites of Dabigatran etexilate can be increased when Dabigatran etexilate is used in combination with Glyburide.Approved
DabrafenibThe serum concentration of Glyburide can be decreased when it is combined with Dabrafenib.Approved, Investigational
DanazolThe therapeutic efficacy of Glyburide can be decreased when used in combination with Danazol.Approved
DapoxetineDapoxetine may increase the hypoglycemic activities of Glyburide.Investigational
DarunavirThe metabolism of Glyburide can be decreased when combined with Darunavir.Approved
DasatinibThe serum concentration of Glyburide can be increased when it is combined with Dasatinib.Approved, Investigational
DeferasiroxThe serum concentration of Glyburide can be decreased when it is combined with Deferasirox.Approved, Investigational
DelavirdineThe metabolism of Glyburide can be decreased when combined with Delavirdine.Approved
DeoxyspergualinDeoxyspergualin may increase the hypoglycemic activities of Glyburide.Investigational
DersalazineDersalazine may increase the hypoglycemic activities of Glyburide.Investigational
DesogestrelThe therapeutic efficacy of Glyburide can be decreased when used in combination with Desogestrel.Approved
DesvenlafaxineDesvenlafaxine may increase the hypoglycemic activities of Glyburide.Approved, Investigational
DexamethasoneThe therapeutic efficacy of Glyburide can be decreased when used in combination with Dexamethasone.Approved, Investigational, Vet Approved
DiazoxideThe therapeutic efficacy of Glyburide can be decreased when used in combination with Diazoxide.Approved
DicoumarolGlyburide may increase the anticoagulant activities of Dicoumarol.Approved
DienogestThe therapeutic efficacy of Glyburide can be decreased when used in combination with Dienogest.Approved
DiflunisalDiflunisal may increase the hypoglycemic activities of Glyburide.Approved, Investigational
DihydroergocornineThe risk or severity of adverse effects can be increased when Dihydroergocornine is combined with Glyburide.Approved
DihydroergocristineThe risk or severity of adverse effects can be increased when Dihydroergocristine is combined with Glyburide.Approved, Experimental
DihydroergocryptineThe risk or severity of adverse effects can be increased when Dihydroergocryptine is combined with Glyburide.Experimental
DihydroergotamineThe risk or severity of adverse effects can be increased when Dihydroergotamine is combined with Glyburide.Approved, Investigational
DiltiazemThe metabolism of Glyburide can be decreased when combined with Diltiazem.Approved, Investigational
DiphenadioneGlyburide may increase the anticoagulant activities of Diphenadione.Experimental
DisopyramideDisopyramide may increase the hypoglycemic activities of Glyburide.Approved
DosulepinThe metabolism of Glyburide can be decreased when combined with Dosulepin.Approved
DoxorubicinThe serum concentration of Doxorubicin can be increased when it is combined with Glyburide.Approved, Investigational
DoxycyclineThe metabolism of Glyburide can be decreased when combined with Doxycycline.Approved, Investigational, Vet Approved
DronedaroneThe metabolism of Glyburide can be decreased when combined with Dronedarone.Approved
DrospirenoneThe therapeutic efficacy of Glyburide can be decreased when used in combination with Drospirenone.Approved
DulaglutideDulaglutide may increase the hypoglycemic activities of Glyburide.Approved, Investigational
DuloxetineDuloxetine may increase the hypoglycemic activities of Glyburide.Approved
EdoxabanThe serum concentration of Edoxaban can be increased when it is combined with Glyburide.Approved
EfavirenzThe metabolism of Glyburide can be decreased when combined with Efavirenz.Approved, Investigational
EltrombopagThe serum concentration of Glyburide can be increased when it is combined with Eltrombopag.Approved
EmpagliflozinEmpagliflozin may increase the hypoglycemic activities of Glyburide.Approved
EnoxacinEnoxacin may increase the hypoglycemic activities of Glyburide.Approved, Investigational
EnzalutamideThe serum concentration of Glyburide can be decreased when it is combined with Enzalutamide.Approved
EpanololEpanolol may increase the hypoglycemic activities of Glyburide.Experimental
EpinephrineThe therapeutic efficacy of Glyburide can be decreased when used in combination with Epinephrine.Approved, Vet Approved
EpitizideThe therapeutic efficacy of Glyburide can be decreased when used in combination with Epitizide.Experimental
ErgonovineThe risk or severity of adverse effects can be increased when Ergonovine is combined with Glyburide.Approved
ErgotamineThe risk or severity of adverse effects can be increased when Ergotamine is combined with Glyburide.Approved
ErtugliflozinErtugliflozin may increase the hypoglycemic activities of Glyburide.Approved, Investigational
ErythromycinThe metabolism of Glyburide can be decreased when combined with Erythromycin.Approved, Investigational, Vet Approved
EscitalopramEscitalopram may increase the hypoglycemic activities of Glyburide.Approved, Investigational
Eslicarbazepine acetateThe metabolism of Glyburide can be decreased when combined with Eslicarbazepine acetate.Approved
EsmololEsmolol may increase the hypoglycemic activities of Glyburide.Approved
EsomeprazoleThe metabolism of Glyburide can be decreased when combined with Esomeprazole.Approved, Investigational
EstradiolThe therapeutic efficacy of Glyburide can be decreased when used in combination with Estradiol.Approved, Investigational, Vet Approved
Estrone sulfateThe therapeutic efficacy of Glyburide can be decreased when used in combination with Estrone sulfate.Approved
Etacrynic acidThe therapeutic efficacy of Glyburide can be decreased when used in combination with Etacrynic acid.Approved, Investigational
EthanolThe risk or severity of adverse effects can be increased when Glyburide is combined with Ethanol.Approved
Ethinyl EstradiolThe therapeutic efficacy of Glyburide can be decreased when used in combination with Ethinyl Estradiol.Approved
Ethyl biscoumacetateGlyburide may increase the anticoagulant activities of Ethyl biscoumacetate.Withdrawn
Ethynodiol diacetateThe therapeutic efficacy of Glyburide can be decreased when used in combination with Ethynodiol diacetate.Approved
EtofibrateEtofibrate may increase the hypoglycemic activities of Glyburide.Approved
EtonogestrelThe therapeutic efficacy of Glyburide can be decreased when used in combination with Etonogestrel.Approved, Investigational
EtoperidoneEtoperidone may increase the hypoglycemic activities of Glyburide.Withdrawn
EtravirineThe metabolism of Glyburide can be decreased when combined with Etravirine.Approved
EverolimusThe serum concentration of Everolimus can be increased when it is combined with Glyburide.Approved
ExenatideExenatide may increase the hypoglycemic activities of Glyburide.Approved, Investigational
FenofibrateFenofibrate may increase the hypoglycemic activities of Glyburide.Approved
Fenofibric acidFenofibric acid may increase the hypoglycemic activities of Glyburide.Approved
FleroxacinFleroxacin may increase the hypoglycemic activities of Glyburide.Approved
FloxuridineThe metabolism of Glyburide can be decreased when combined with Floxuridine.Approved
FluconazoleThe serum concentration of Glyburide can be increased when it is combined with Fluconazole.Approved, Investigational
FludrocortisoneThe therapeutic efficacy of Glyburide can be decreased when used in combination with Fludrocortisone.Approved, Investigational
FluindioneGlyburide may increase the anticoagulant activities of Fluindione.Approved, Investigational
FlumequineFlumequine may increase the hypoglycemic activities of Glyburide.Withdrawn
FluorouracilThe metabolism of Glyburide can be decreased when combined with Fluorouracil.Approved
FluoxetineThe metabolism of Glyburide can be decreased when combined with Fluoxetine.Approved, Vet Approved
FluoxymesteroneFluoxymesterone may increase the hypoglycemic activities of Glyburide.Approved, Illicit
FluvastatinThe serum concentration of Fluvastatin can be increased when it is combined with Glyburide.Approved
FluvoxamineThe metabolism of Glyburide can be decreased when combined with Fluvoxamine.Approved, Investigational
FosamprenavirThe metabolism of Glyburide can be decreased when combined with Fosamprenavir.Approved
FosaprepitantThe serum concentration of Glyburide can be increased when it is combined with Fosaprepitant.Approved
FosphenytoinThe metabolism of Glyburide can be increased when combined with Fosphenytoin.Approved, Investigational
FurazolidoneFurazolidone may increase the hypoglycemic activities of Glyburide.Approved, Investigational, Vet Approved
FurosemideThe therapeutic efficacy of Glyburide can be decreased when used in combination with Furosemide.Approved, Vet Approved
Fusidic AcidThe serum concentration of Glyburide can be increased when it is combined with Fusidic Acid.Approved, Investigational
GarenoxacinGarenoxacin may increase the hypoglycemic activities of Glyburide.Investigational
GatifloxacinGatifloxacin may increase the hypoglycemic activities of Glyburide.Approved, Investigational
GemfibrozilThe metabolism of Glyburide can be decreased when combined with Gemfibrozil.Approved
GemifloxacinGemifloxacin may increase the hypoglycemic activities of Glyburide.Approved, Investigational
GlibornurideGlibornuride may increase the hypoglycemic activities of Glyburide.Investigational, Withdrawn
GliclazideGlyburide may increase the hypoglycemic activities of Gliclazide.Approved
GlimepirideGlimepiride may increase the hypoglycemic activities of Glyburide.Approved
GlipizideGlyburide may increase the hypoglycemic activities of Glipizide.Approved, Investigational
GliquidoneGliquidone may increase the hypoglycemic activities of Glyburide.Approved, Investigational
GLPG-0492GLPG-0492 may increase the hypoglycemic activities of Glyburide.Investigational
GoserelinThe therapeutic efficacy of Glyburide can be decreased when used in combination with Goserelin.Approved
GrepafloxacinGrepafloxacin may increase the hypoglycemic activities of Glyburide.Approved, Investigational, Withdrawn
GuacetisalGuacetisal may increase the hypoglycemic activities of Glyburide.Experimental
GusperimusGusperimus may increase the hypoglycemic activities of Glyburide.Investigational
HarmalineHarmaline may increase the hypoglycemic activities of Glyburide.Experimental
Hemoglobin crosfumarilHemoglobin crosfumaril may increase the hypoglycemic activities of Glyburide.Experimental
HistrelinThe therapeutic efficacy of Glyburide can be decreased when used in combination with Histrelin.Approved
HydracarbazineHydracarbazine may increase the hypoglycemic activities of Glyburide.Experimental
HydrochlorothiazideThe therapeutic efficacy of Glyburide can be decreased when used in combination with Hydrochlorothiazide.Approved, Vet Approved
HydrocortisoneThe therapeutic efficacy of Glyburide can be decreased when used in combination with Hydrocortisone.Approved, Vet Approved
HydroflumethiazideThe therapeutic efficacy of Glyburide can be decreased when used in combination with Hydroflumethiazide.Approved, Investigational
Hydroxyprogesterone caproateThe therapeutic efficacy of Glyburide can be decreased when used in combination with Hydroxyprogesterone caproate.Approved, Investigational
IbrutinibThe serum concentration of Ibrutinib can be increased when it is combined with Glyburide.Approved
IdelalisibThe metabolism of Glyburide can be decreased when combined with Idelalisib.Approved
IloperidoneThe therapeutic efficacy of Glyburide can be decreased when used in combination with Iloperidone.Approved
ImatinibThe metabolism of Glyburide can be decreased when combined with Imatinib.Approved
IndalpineIndalpine may increase the hypoglycemic activities of Glyburide.Investigational, Withdrawn
IndapamideThe therapeutic efficacy of Glyburide can be decreased when used in combination with Indapamide.Approved
IndenololIndenolol may increase the hypoglycemic activities of Glyburide.Withdrawn
IndinavirThe metabolism of Glyburide can be decreased when combined with Indinavir.Approved
Insulin AspartGlyburide may increase the hypoglycemic activities of Insulin Aspart.Approved
Insulin DetemirGlyburide may increase the hypoglycemic activities of Insulin Detemir.Approved
Insulin GlargineInsulin Glargine may increase the hypoglycemic activities of Glyburide.Approved
Insulin GlulisineGlyburide may increase the hypoglycemic activities of Insulin Glulisine.Approved
Insulin HumanInsulin Human may increase the hypoglycemic activities of Glyburide.Approved, Investigational
Insulin LisproInsulin Lispro may increase the hypoglycemic activities of Glyburide.Approved
Insulin PorkInsulin Pork may increase the hypoglycemic activities of Glyburide.Approved
IproclozideIproclozide may increase the hypoglycemic activities of Glyburide.Withdrawn
IproniazidIproniazid may increase the hypoglycemic activities of Glyburide.Withdrawn
IrbesartanThe metabolism of Glyburide can be decreased when combined with Irbesartan.Approved, Investigational
IsavuconazoleThe serum concentration of Glyburide can be increased when it is combined with Isavuconazole.Approved, Investigational
IsavuconazoniumThe metabolism of Glyburide can be decreased when combined with Isavuconazonium.Approved, Investigational
IsocarboxazidIsocarboxazid may increase the hypoglycemic activities of Glyburide.Approved
IsoniazidThe metabolism of Glyburide can be decreased when combined with Isoniazid.Approved, Investigational
IsradipineThe metabolism of Glyburide can be decreased when combined with Isradipine.Approved, Investigational
ItraconazoleThe metabolism of Glyburide can be decreased when combined with Itraconazole.Approved, Investigational
IvacaftorThe serum concentration of Glyburide can be increased when it is combined with Ivacaftor.Approved
KetoconazoleThe metabolism of Glyburide can be decreased when combined with Ketoconazole.Approved, Investigational
LabetalolLabetalol may increase the hypoglycemic activities of Glyburide.Approved
LandiololLandiolol may increase the hypoglycemic activities of Glyburide.Investigational
LanreotideGlyburide may increase the hypoglycemic activities of Lanreotide.Approved
LedipasvirThe serum concentration of Ledipasvir can be increased when it is combined with Glyburide.Approved
LeflunomideThe metabolism of Glyburide can be decreased when combined with Leflunomide.Approved, Investigational
LeuprolideThe therapeutic efficacy of Glyburide can be decreased when used in combination with Leuprolide.Approved, Investigational
LevobunololLevobunolol may increase the hypoglycemic activities of Glyburide.Approved
LevofloxacinLevofloxacin may increase the hypoglycemic activities of Glyburide.Approved, Investigational
LevomilnacipranLevomilnacipran may increase the hypoglycemic activities of Glyburide.Approved, Investigational
LevonorgestrelThe therapeutic efficacy of Glyburide can be decreased when used in combination with Levonorgestrel.Approved, Investigational
LinagliptinLinagliptin may increase the hypoglycemic activities of Glyburide.Approved
Lipoic AcidLipoic Acid may increase the hypoglycemic activities of Glyburide.Approved, Investigational, Nutraceutical
LiraglutideLiraglutide may increase the hypoglycemic activities of Glyburide.Approved
LisurideThe risk or severity of adverse effects can be increased when Lisuride is combined with Glyburide.Approved, Investigational
LixisenatideLixisenatide may increase the hypoglycemic activities of Glyburide.Approved
LobeglitazoneLobeglitazone may increase the hypoglycemic activities of Glyburide.Approved, Investigational
LopinavirThe metabolism of Glyburide can be decreased when combined with Lopinavir.Approved
LorpiprazoleThe serum concentration of Glyburide can be increased when it is combined with Lorpiprazole.Approved
LosartanThe metabolism of Glyburide can be decreased when combined with Losartan.Approved
LovastatinThe serum concentration of Lovastatin can be increased when it is combined with Glyburide.Approved, Investigational
LuliconazoleThe serum concentration of Glyburide can be increased when it is combined with Luliconazole.Approved
LumacaftorThe serum concentration of Glyburide can be decreased when it is combined with Lumacaftor.Approved
LurasidoneThe therapeutic efficacy of Glyburide can be decreased when used in combination with Lurasidone.Approved, Investigational
Lysergic Acid DiethylamideThe risk or severity of adverse effects can be increased when Lysergic Acid Diethylamide is combined with Glyburide.Illicit, Investigational, Withdrawn
ManidipineThe metabolism of Glyburide can be decreased when combined with Manidipine.Approved, Investigational
MebanazineMebanazine may increase the hypoglycemic activities of Glyburide.Withdrawn
MecaserminGlyburide may increase the hypoglycemic activities of Mecasermin.Approved, Investigational
MedrogestoneThe serum concentration of Glyburide can be decreased when it is combined with Medrogestone.Approved
Medroxyprogesterone acetateThe therapeutic efficacy of Glyburide can be decreased when used in combination with Medroxyprogesterone acetate.Approved, Investigational
Megestrol acetateThe therapeutic efficacy of Glyburide can be decreased when used in combination with Megestrol acetate.Approved, Investigational, Vet Approved
MepindololMepindolol may increase the hypoglycemic activities of Glyburide.Experimental
MesalazineMesalazine may increase the hypoglycemic activities of Glyburide.Approved
MesteroloneMesterolone may increase the hypoglycemic activities of Glyburide.Experimental
MestranolThe therapeutic efficacy of Glyburide can be decreased when used in combination with Mestranol.Approved
MetergolineThe risk or severity of adverse effects can be increased when Metergoline is combined with Glyburide.Experimental
MetforminMetformin may increase the hypoglycemic activities of Glyburide.Approved
MethotrimeprazineThe therapeutic efficacy of Glyburide can be decreased when used in combination with Methotrimeprazine.Approved, Investigational
MethyclothiazideThe therapeutic efficacy of Glyburide can be decreased when used in combination with Methyclothiazide.Approved
Methyl salicylateMethyl salicylate may increase the hypoglycemic activities of Glyburide.Approved, Vet Approved
Methylene blueMethylene blue may increase the hypoglycemic activities of Glyburide.Approved, Investigational
MethylergometrineThe risk or severity of adverse effects can be increased when Methylergometrine is combined with Glyburide.Approved
MethylprednisoloneThe therapeutic efficacy of Glyburide can be decreased when used in combination with Methylprednisolone.Approved, Vet Approved
MethyltestosteroneMethyltestosterone may increase the hypoglycemic activities of Glyburide.Approved
MethysergideThe risk or severity of adverse effects can be increased when Methysergide is combined with Glyburide.Approved
MetipranololMetipranolol may increase the hypoglycemic activities of Glyburide.Approved
MetolazoneThe therapeutic efficacy of Glyburide can be decreased when used in combination with Metolazone.Approved
MetoprololMetoprolol may increase the hypoglycemic activities of Glyburide.Approved, Investigational
MetreleptinMetreleptin may increase the hypoglycemic activities of Glyburide.Approved
MevastatinThe serum concentration of Mevastatin can be increased when it is combined with Glyburide.Experimental
MiconazoleMiconazole may increase the hypoglycemic activities of Glyburide.Approved, Investigational, Vet Approved
MidostaurinThe metabolism of Glyburide can be decreased when combined with Midostaurin.Approved, Investigational
MifepristoneThe serum concentration of Glyburide can be increased when it is combined with Mifepristone.Approved, Investigational
MiglitolMiglitol may increase the hypoglycemic activities of Glyburide.Approved
MiglustatMiglustat may increase the hypoglycemic activities of Glyburide.Approved
MilnacipranMilnacipran may increase the hypoglycemic activities of Glyburide.Approved, Investigational
MinaprineMinaprine may increase the hypoglycemic activities of Glyburide.Approved
MitiglinideMitiglinide may increase the hypoglycemic activities of Glyburide.Approved, Investigational
MitotaneThe serum concentration of Glyburide can be decreased when it is combined with Mitotane.Approved
MoclobemideThe metabolism of Glyburide can be decreased when combined with Moclobemide.Approved, Investigational
ModafinilThe metabolism of Glyburide can be decreased when combined with Modafinil.Approved, Investigational
NabiloneThe metabolism of Glyburide can be decreased when combined with Nabilone.Approved, Investigational
NadololNadolol may increase the hypoglycemic activities of Glyburide.Approved
Nalidixic AcidNalidixic Acid may increase the hypoglycemic activities of Glyburide.Approved, Investigational
NaloxegolThe serum concentration of Naloxegol can be increased when it is combined with Glyburide.Approved
NandroloneNandrolone may increase the hypoglycemic activities of Glyburide.Experimental, Investigational
Nandrolone decanoateNandrolone decanoate may increase the hypoglycemic activities of Glyburide.Approved, Illicit
NateglinideNateglinide may increase the hypoglycemic activities of Glyburide.Approved, Investigational
NebivololNebivolol may increase the hypoglycemic activities of Glyburide.Approved, Investigational
NefazodoneThe metabolism of Glyburide can be decreased when combined with Nefazodone.Approved, Withdrawn
NelfinavirThe metabolism of Glyburide can be decreased when combined with Nelfinavir.Approved
NemonoxacinNemonoxacin may increase the hypoglycemic activities of Glyburide.Investigational
NetoglitazoneNetoglitazone may increase the hypoglycemic activities of Glyburide.Experimental
NetupitantThe serum concentration of Glyburide can be increased when it is combined with Netupitant.Approved, Investigational
NevirapineThe metabolism of Glyburide can be increased when combined with Nevirapine.Approved
NiacinThe therapeutic efficacy of Glyburide can be decreased when used in combination with Niacin.Approved, Investigational, Nutraceutical
NialamideNialamide may increase the hypoglycemic activities of Glyburide.Withdrawn
NicardipineThe metabolism of Glyburide can be decreased when combined with Nicardipine.Approved, Investigational
NicergolineThe risk or severity of adverse effects can be increased when Nicergoline is combined with Glyburide.Approved, Investigational
NilotinibThe metabolism of Glyburide can be decreased when combined with Nilotinib.Approved, Investigational
NintedanibThe serum concentration of Nintedanib can be increased when it is combined with Glyburide.Approved
NitroaspirinNitroaspirin may increase the hypoglycemic activities of Glyburide.Investigational
NorethisteroneThe therapeutic efficacy of Glyburide can be decreased when used in combination with Norethisterone.Approved
NorfloxacinNorfloxacin may increase the hypoglycemic activities of Glyburide.Approved
NorgestimateThe therapeutic efficacy of Glyburide can be decreased when used in combination with Norgestimate.Approved, Investigational
OctamoxinOctamoxin may increase the hypoglycemic activities of Glyburide.Withdrawn
OctreotideOctreotide may increase the hypoglycemic activities of Glyburide.Approved, Investigational
OlanzapineThe therapeutic efficacy of Glyburide can be decreased when used in combination with Olanzapine.Approved, Investigational
OlaparibThe metabolism of Glyburide can be decreased when combined with Olaparib.Approved
OlsalazineOlsalazine may increase the hypoglycemic activities of Glyburide.Approved
OmeprazoleThe metabolism of Glyburide can be decreased when combined with Omeprazole.Approved, Investigational, Vet Approved
OsimertinibThe serum concentration of Glyburide can be increased when it is combined with Osimertinib.Approved
OxandroloneOxandrolone may increase the hypoglycemic activities of Glyburide.Approved, Investigational
Oxolinic acidOxolinic acid may increase the hypoglycemic activities of Glyburide.Experimental
OxprenololOxprenolol may increase the hypoglycemic activities of Glyburide.Approved
OxymetholoneOxymetholone may increase the hypoglycemic activities of Glyburide.Approved, Illicit
PalbociclibThe serum concentration of Glyburide can be increased when it is combined with Palbociclib.Approved, Investigational
PaliperidoneThe therapeutic efficacy of Glyburide can be decreased when used in combination with Paliperidone.Approved
PantoprazoleThe metabolism of Glyburide can be decreased when combined with Pantoprazole.Approved
PargylinePargyline may increase the hypoglycemic activities of Glyburide.Approved
ParoxetineParoxetine may increase the hypoglycemic activities of Glyburide.Approved, Investigational
PasireotideGlyburide may increase the hypoglycemic activities of Pasireotide.Approved
PazopanibThe serum concentration of Pazopanib can be increased when it is combined with Glyburide.Approved
PazufloxacinPazufloxacin may increase the hypoglycemic activities of Glyburide.Investigational
PefloxacinPefloxacin may increase the hypoglycemic activities of Glyburide.Approved
PegvisomantPegvisomant may increase the hypoglycemic activities of Glyburide.Approved
PenbutololPenbutolol may increase the hypoglycemic activities of Glyburide.Approved, Investigational
PentamidinePentamidine may increase the hypoglycemic activities of Glyburide.Approved, Investigational
PentobarbitalThe metabolism of Glyburide can be increased when combined with Pentobarbital.Approved, Investigational, Vet Approved
PergolideThe risk or severity of adverse effects can be increased when Pergolide is combined with Glyburide.Approved, Investigational, Vet Approved, Withdrawn
PhenelzinePhenelzine may increase the hypoglycemic activities of Glyburide.Approved
PhenforminPhenformin may increase the hypoglycemic activities of Glyburide.Approved, Investigational, Withdrawn
PhenindioneGlyburide may increase the anticoagulant activities of Phenindione.Approved, Investigational
PheniprazinePheniprazine may increase the hypoglycemic activities of Glyburide.Withdrawn
PhenobarbitalThe metabolism of Glyburide can be increased when combined with Phenobarbital.Approved, Investigational
PhenoxypropazinePhenoxypropazine may increase the hypoglycemic activities of Glyburide.Withdrawn
PhenprocoumonGlyburide may increase the anticoagulant activities of Phenprocoumon.Approved, Investigational
Phenyl aminosalicylatePhenyl aminosalicylate may increase the hypoglycemic activities of Glyburide.Approved
PhenytoinThe metabolism of Glyburide can be increased when combined with Phenytoin.Approved, Vet Approved
PindololPindolol may increase the hypoglycemic activities of Glyburide.Approved, Investigational
PioglitazonePioglitazone may increase the hypoglycemic activities of Glyburide.Approved, Investigational
Pipemidic acidPipemidic acid may increase the hypoglycemic activities of Glyburide.Experimental
PiperazineThe therapeutic efficacy of Glyburide can be decreased when used in combination with Piperazine.Approved, Vet Approved
PipotiazineThe therapeutic efficacy of Glyburide can be decreased when used in combination with Pipotiazine.Approved, Investigational
PirlindolePirlindole may increase the hypoglycemic activities of Glyburide.Approved
Piromidic acidPiromidic acid may increase the hypoglycemic activities of Glyburide.Experimental
PitavastatinThe serum concentration of Pitavastatin can be increased when it is combined with Glyburide.Approved
PitolisantThe serum concentration of Glyburide can be decreased when it is combined with Pitolisant.Approved, Investigational
PivhydrazinePivhydrazine may increase the hypoglycemic activities of Glyburide.Withdrawn
Platelet Activating FactorPlatelet Activating Factor may increase the hypoglycemic activities of Glyburide.Experimental
PolythiazideThe therapeutic efficacy of Glyburide can be decreased when used in combination with Polythiazide.Approved
PosaconazoleThe metabolism of Glyburide can be decreased when combined with Posaconazole.Approved, Investigational, Vet Approved
PractololPractolol may increase the hypoglycemic activities of Glyburide.Approved
PramlintidePramlintide may increase the hypoglycemic activities of Glyburide.Approved, Investigational
PravastatinThe serum concentration of Pravastatin can be increased when it is combined with Glyburide.Approved
PrednisoloneThe therapeutic efficacy of Glyburide can be decreased when used in combination with Prednisolone.Approved, Vet Approved
PrednisoneThe therapeutic efficacy of Glyburide can be decreased when used in combination with Prednisone.Approved, Vet Approved
PregabalinThe risk or severity of heart failure can be increased when Pregabalin is combined with Glyburide.Approved, Illicit, Investigational
PrimidoneThe metabolism of Glyburide can be increased when combined with Primidone.Approved, Vet Approved
ProbenecidThe protein binding of Glyburide can be decreased when combined with Probenecid.Approved, Investigational
ProcarbazineProcarbazine may increase the hypoglycemic activities of Glyburide.Approved, Investigational
ProgesteroneThe therapeutic efficacy of Glyburide can be decreased when used in combination with Progesterone.Approved, Vet Approved
PropranololPropranolol may increase the hypoglycemic activities of Glyburide.Approved, Investigational
PrucaloprideThe serum concentration of Prucalopride can be increased when it is combined with Glyburide.Approved
PrulifloxacinPrulifloxacin may increase the hypoglycemic activities of Glyburide.Investigational
PyrimethamineThe metabolism of Glyburide can be decreased when combined with Pyrimethamine.Approved, Investigational, Vet Approved
QuetiapineThe therapeutic efficacy of Glyburide can be decreased when used in combination with Quetiapine.Approved
QuinethazoneThe therapeutic efficacy of Glyburide can be decreased when used in combination with Quinethazone.Approved
QuinineThe metabolism of Glyburide can be decreased when combined with Quinine.Approved
RanitidineThe serum concentration of Glyburide can be increased when it is combined with Ranitidine.Approved
RanolazineThe serum concentration of Ranolazine can be increased when it is combined with Glyburide.Approved, Investigational
RasagilineRasagiline may increase the hypoglycemic activities of Glyburide.Approved
RepaglinideRepaglinide may increase the hypoglycemic activities of Glyburide.Approved, Investigational
RifabutinThe metabolism of Glyburide can be increased when combined with Rifabutin.Approved, Investigational
RifampicinThe serum concentration of Glyburide can be decreased when it is combined with Rifampicin.Approved
RifapentineThe metabolism of Glyburide can be increased when combined with Rifapentine.Approved, Investigational
RifaximinThe serum concentration of Rifaximin can be increased when it is combined with Glyburide.Approved, Investigational
RilpivirineThe serum concentration of Rilpivirine can be increased when it is combined with Glyburide.Approved
RisperidoneThe therapeutic efficacy of Glyburide can be decreased when used in combination with Risperidone.Approved, Investigational
RitonavirThe therapeutic efficacy of Glyburide can be decreased when used in combination with Ritonavir.Approved, Investigational
RivoglitazoneRivoglitazone may increase the hypoglycemic activities of Glyburide.Experimental, Investigational
RolapitantThe serum concentration of Glyburide can be increased when it is combined with Rolapitant.Approved, Investigational
RonifibrateRonifibrate may increase the hypoglycemic activities of Glyburide.Experimental
RosiglitazoneRosiglitazone may increase the hypoglycemic activities of Glyburide.Approved, Investigational
RosoxacinRosoxacin may increase the hypoglycemic activities of Glyburide.Approved, Investigational
RosuvastatinThe serum concentration of Rosuvastatin can be increased when it is combined with Glyburide.Approved
RucaparibThe metabolism of Glyburide can be decreased when combined with Rucaparib.Approved, Investigational
RufloxacinRufloxacin may increase the hypoglycemic activities of Glyburide.Experimental
SafrazineSafrazine may increase the hypoglycemic activities of Glyburide.Withdrawn
Salicylic acidSalicylic acid may increase the hypoglycemic activities of Glyburide.Approved, Investigational, Vet Approved
SaquinavirThe metabolism of Glyburide can be decreased when combined with Saquinavir.Approved, Investigational
SarilumabThe therapeutic efficacy of Glyburide can be decreased when used in combination with Sarilumab.Approved, Investigational
SaxagliptinSaxagliptin may increase the hypoglycemic activities of Glyburide.Approved
SecobarbitalThe metabolism of Glyburide can be increased when combined with Secobarbital.Approved, Vet Approved
SelegilineSelegiline may increase the hypoglycemic activities of Glyburide.Approved, Investigational, Vet Approved
SemaglutideSemaglutide may increase the hypoglycemic activities of Glyburide.Approved, Investigational
SertralineThe metabolism of Glyburide can be decreased when combined with Sertraline.Approved
SildenafilThe metabolism of Glyburide can be decreased when combined with Sildenafil.Approved, Investigational
SilodosinThe serum concentration of Silodosin can be increased when it is combined with Glyburide.Approved
SiltuximabThe serum concentration of Glyburide can be decreased when it is combined with Siltuximab.Approved, Investigational
SimeprevirThe serum concentration of Glyburide can be increased when it is combined with Simeprevir.Approved
SimfibrateSimfibrate may increase the hypoglycemic activities of Glyburide.Experimental
SimvastatinThe serum concentration of Simvastatin can be increased when it is combined with Glyburide.Approved
SirolimusThe therapeutic efficacy of Glyburide can be decreased when used in combination with Sirolimus.Approved, Investigational
SitafloxacinSitafloxacin may increase the hypoglycemic activities of Glyburide.Experimental, Investigational
SitagliptinSitagliptin may increase the hypoglycemic activities of Glyburide.Approved, Investigational
SorafenibThe metabolism of Glyburide can be decreased when combined with Sorafenib.Approved, Investigational
SotagliflozinSotagliflozin may increase the hypoglycemic activities of Glyburide.Investigational
SotalolSotalol may increase the hypoglycemic activities of Glyburide.Approved
SparfloxacinSparfloxacin may increase the hypoglycemic activities of Glyburide.Approved, Investigational
St. John's WortThe serum concentration of Glyburide can be decreased when it is combined with St. John's Wort.Approved, Investigational, Nutraceutical
StanoloneStanolone may increase the hypoglycemic activities of Glyburide.Illicit, Investigational
StanozololStanozolol may increase the hypoglycemic activities of Glyburide.Approved, Vet Approved
StiripentolThe serum concentration of Glyburide can be increased when it is combined with Stiripentol.Approved
SulfadiazineThe metabolism of Glyburide can be decreased when combined with Sulfadiazine.Approved, Investigational, Vet Approved
SulfamethoxazoleThe metabolism of Glyburide can be decreased when combined with Sulfamethoxazole.Approved
SulfisoxazoleThe metabolism of Glyburide can be decreased when combined with Sulfisoxazole.Approved, Vet Approved
SulodexideSulodexide may increase the hypoglycemic activities of Glyburide.Approved, Investigational
SunitinibGlyburide may increase the hypoglycemic activities of Sunitinib.Approved, Investigational
TacrolimusThe therapeutic efficacy of Glyburide can be decreased when used in combination with Tacrolimus.Approved, Investigational
TalinololTalinolol may increase the hypoglycemic activities of Glyburide.Investigational
TaspoglutideTaspoglutide may increase the hypoglycemic activities of Glyburide.Investigational
TelaprevirThe metabolism of Glyburide can be decreased when combined with Telaprevir.Approved, Withdrawn
TelithromycinThe metabolism of Glyburide can be decreased when combined with Telithromycin.Approved
TemafloxacinTemafloxacin may increase the hypoglycemic activities of Glyburide.Withdrawn
TemsirolimusThe therapeutic efficacy of Glyburide can be decreased when used in combination with Temsirolimus.Approved
TergurideThe risk or severity of adverse effects can be increased when Terguride is combined with Glyburide.Experimental
TeriflunomideThe serum concentration of Glyburide can be increased when it is combined with Teriflunomide.Approved
TertatololTertatolol may increase the hypoglycemic activities of Glyburide.Experimental
TestosteroneTestosterone may increase the hypoglycemic activities of Glyburide.Approved, Investigational
Testosterone cypionateTestosterone cypionate may increase the hypoglycemic activities of Glyburide.Approved
Testosterone enanthateTestosterone enanthate may increase the hypoglycemic activities of Glyburide.Approved
Testosterone propionateTestosterone propionate may increase the hypoglycemic activities of Glyburide.Approved, Investigational, Vet Approved, Withdrawn
Testosterone undecanoateTestosterone undecanoate may increase the hypoglycemic activities of Glyburide.Approved, Investigational
TicagrelorThe metabolism of Glyburide can be decreased when combined with Ticagrelor.Approved
TiclopidineThe metabolism of Glyburide can be decreased when combined with Ticlopidine.Approved
TimololTimolol may increase the hypoglycemic activities of Glyburide.Approved
TioclomarolGlyburide may increase the anticoagulant activities of Tioclomarol.Experimental
TipranavirThe therapeutic efficacy of Glyburide can be decreased when used in combination with Tipranavir.Approved, Investigational
TocilizumabThe serum concentration of Glyburide can be decreased when it is combined with Tocilizumab.Approved
TolazamideTolazamide may increase the hypoglycemic activities of Glyburide.Approved, Investigational
TolbutamideThe metabolism of Glyburide can be decreased when combined with Tolbutamide.Approved, Investigational
ToloxatoneToloxatone may increase the hypoglycemic activities of Glyburide.Approved
TolvaptanThe serum concentration of Tolvaptan can be increased when it is combined with Glyburide.Approved
TopiramateThe metabolism of Glyburide can be decreased when combined with Topiramate.Approved
TopiroxostatThe metabolism of Glyburide can be decreased when combined with Topiroxostat.Approved, Investigational
TopotecanThe serum concentration of Topotecan can be increased when it is combined with Glyburide.Approved, Investigational
TorasemideThe therapeutic efficacy of Glyburide can be decreased when used in combination with Torasemide.Approved
TranylcypromineThe metabolism of Glyburide can be decreased when combined with Tranylcypromine.Approved, Investigational
TriamcinoloneThe therapeutic efficacy of Glyburide can be decreased when used in combination with Triamcinolone.Approved, Vet Approved
TrichlormethiazideThe therapeutic efficacy of Glyburide can be decreased when used in combination with Trichlormethiazide.Approved, Vet Approved
TrimethoprimThe metabolism of Glyburide can be decreased when combined with Trimethoprim.Approved, Vet Approved
TriptorelinThe therapeutic efficacy of Glyburide can be decreased when used in combination with Triptorelin.Approved, Vet Approved
TroglitazoneTroglitazone may increase the hypoglycemic activities of Glyburide.Investigational, Withdrawn
Trolamine salicylateTrolamine salicylate may increase the hypoglycemic activities of Glyburide.Approved
TrovafloxacinTrovafloxacin may increase the hypoglycemic activities of Glyburide.Approved, Investigational, Withdrawn
UbidecarenoneThe therapeutic efficacy of Glyburide can be increased when used in combination with Ubidecarenone.Approved, Investigational, Nutraceutical
Valproic AcidThe metabolism of Glyburide can be decreased when combined with Valproic Acid.Approved, Investigational
ValsartanThe metabolism of Glyburide can be decreased when combined with Valsartan.Approved, Investigational
VemurafenibThe serum concentration of Glyburide can be decreased when it is combined with Vemurafenib.Approved
VenlafaxineThe metabolism of Glyburide can be decreased when combined with Venlafaxine.Approved
VerapamilThe metabolism of Glyburide can be decreased when combined with Verapamil.Approved
VildagliptinVildagliptin may increase the hypoglycemic activities of Glyburide.Approved, Investigational
VincristineThe excretion of Vincristine can be decreased when combined with Glyburide.Approved, Investigational
VogliboseVoglibose may increase the hypoglycemic activities of Glyburide.Approved, Investigational
VoriconazoleThe serum concentration of Glyburide can be increased when it is combined with Voriconazole.Approved, Investigational
VorinostatThe therapeutic efficacy of Glyburide can be decreased when used in combination with Vorinostat.Approved, Investigational
WarfarinGlyburide may increase the anticoagulant activities of Warfarin.Approved
ZafirlukastThe metabolism of Glyburide can be decreased when combined with Zafirlukast.Approved, Investigational
ZimelidineZimelidine may increase the hypoglycemic activities of Glyburide.Withdrawn
ZiprasidoneThe metabolism of Glyburide can be decreased when combined with Ziprasidone.Approved
ZucapsaicinThe metabolism of Glyburide can be decreased when combined with Zucapsaicin.Approved, Investigational
Food Interactions
  • Avoid alcohol.
  • Take 30-60 minutes before breakfast.


Synthesis Reference

Suresh Gidwani, "Solid oral dosage form of metformin and glyburide and the method of preparation thereof." U.S. Patent US20040175421, issued September 09, 2004.

General References
  1. Monami M, Luzzi C, Lamanna C, Chiasserini V, Addante F, Desideri CM, Masotti G, Marchionni N, Mannucci E: Three-year mortality in diabetic patients treated with different combinations of insulin secretagogues and metformin. Diabetes Metab Res Rev. 2006 Nov-Dec;22(6):477-82. [PubMed:16634115]
External Links
Human Metabolome Database
KEGG Compound
PubChem Compound
PubChem Substance
Therapeutic Targets Database
Guide to Pharmacology
GtP Drug Page
RxList Drug Page
ATC Codes
A10BB01 — Glibenclamide
AHFS Codes
  • 68:20.20 — Sulfonylureas
PDB Entries
4yvp / 4yvv / 5ifu / 5yke / 5ykf / 5ykg / 5yw7 / 6baa
Download (36.9 KB)

Clinical Trials

Clinical Trials
1CompletedNot AvailableHealthy Volunteers5
1CompletedBasic ScienceAngina Pectoris1
1CompletedTreatmentHealthy Volunteers3
1CompletedTreatmentStrokes / Traumatic Brain Injury (TBI)1
1CompletedTreatmentType 2 Diabetes Mellitus2
1Unknown StatusSupportive CareType 2 Diabetes Mellitus1
1WithdrawnBasic ScienceHealthy Volunteers1
1, 2CompletedTreatmentDiabetes Mellitus (DM)1
1, 2CompletedTreatmentStroke, Ischemic1
1, 2RecruitingTreatmentAcute Spinal Cord Injury / Spinal Cord Injuries (SCI)1
1, 2RecruitingTreatmentEdema of the cerebrum / Metastatic Brain Tumors1
1, 2Unknown StatusTreatmentGestational Diabetes Mellitus (GDM)1
2Active Not RecruitingPreventionMalignant Edema / Stroke, Ischemic1
2Active Not RecruitingTreatmentTraumatic Brain Injury (TBI)1
2CompletedTreatmentDiabetes Mellitus (DM)1
2CompletedTreatmentImpaired Glucose Tolerance (IGT) / Type 2 Diabetes Mellitus1
2CompletedTreatmentType 2 Diabetes Mellitus2
2RecruitingTreatmentType 2 Diabetes Mellitus1
2TerminatedTreatmentType 2 Diabetes Mellitus1
2, 3CompletedPreventionDiabetes, Diabetes Mellitus Type 11
3CompletedTreatmentDiabetes Mellitus (DM)4
3CompletedTreatmentDiabetes Mellitus (DM) / Gestational1
3CompletedTreatmentDiabetes Mellitus (DM) / Type 2 Diabetes Mellitus1
3CompletedTreatmentDiabetes Mellitus, Non-Insulin-Dependent1
3CompletedTreatmentGestational Diabetes Mellitus (GDM)1
3CompletedTreatmentGestational Diabetes Mellitus (GDM) / Pregnancy1
3CompletedTreatmentNeonatal Diabetes Secondary to Mutation in the Potassium Channel1
3CompletedTreatmentType 2 Diabetes Mellitus3
3Not Yet RecruitingTreatmentBrain Swelling / Stroke, Acute1
3TerminatedTreatmentDiabetes Mellitus (DM)2
3TerminatedTreatmentDiabetes Mellitus (DM) / Type 2 Diabetes Mellitus1
3TerminatedTreatmentType 2 Diabetes Mellitus1
4CompletedBasic ScienceType 2 Diabetes Mellitus1
4CompletedPreventionType 2 Diabetes Mellitus1
4CompletedTreatmentBlood Pressures / BMI >30 kg/m2 / Cardiac Hypertrophy / High Blood Pressure (Hypertension) / Microalbuminuria / Type 2 Diabetes Mellitus / Vascular Stiffness1
4CompletedTreatmentDiabetes Mellitus (DM)3
4CompletedTreatmentDiabetes Mellitus (DM) / Livers1
4CompletedTreatmentDiabetes Mellitus (DM) / Type 2 Diabetes Mellitus2
4CompletedTreatmentDiabetes Mellitus, Non-Insulin-Dependent1
4CompletedTreatmentEndothelial Dysfunction / High Blood Pressure (Hypertension) / Type 2 Diabetes Mellitus1
4CompletedTreatmentMild Gestational Diabetes1
4CompletedTreatmentPermanent Neonatal Diabetes Mellitus1
4CompletedTreatmentType 2 Diabetes Mellitus3
4Enrolling by InvitationTreatmentPermanent Neonatal Diabetes Mellitus1
4Not Yet RecruitingTreatmentCarotid Artery Diseases / Coronary Artery Disease / Type 2 Diabetes Mellitus1
4Not Yet RecruitingTreatmentGestational Diabetes Mellitus (GDM)1
4RecruitingTreatmentGestational Diabetes Mellitus (GDM) / Pregnancy in Diabetes1
4RecruitingTreatmentStroke, Acute1
4Unknown StatusTreatmentDiabetes, Diabetes Mellitus Type 11
4Unknown StatusTreatmentDiabetic Blood Glucose Monitoring / Exercise / Hypoglycemic Agents / Type 2 Diabetes Mellitus1
4Unknown StatusTreatmentGestational Diabetes Mellitus (GDM)1
4WithdrawnTreatmentGestational Diabetes Mellitus (GDM)2
4WithdrawnTreatmentGestational Diabetes Mellitus, Class A21
Not AvailableCompletedNot AvailableType 2 Diabetes Mellitus5
Not AvailableCompletedScreeningDiabetes Mellitus, Insulin-Dependent / Ischemia-Reperfusion Injury1
Not AvailableCompletedTreatmentGestational Diabetes Mellitus (GDM)1
Not AvailableCompletedTreatmentType 2 Diabetes Mellitus3
Not AvailableRecruitingTreatmentDiabetes Mellitus (DM)1
Not AvailableRecruitingTreatmentGestational Diabetes Mellitus (GDM)1
Not AvailableUnknown StatusNot AvailableArterial Stiffness / Diabetes Mellitus (DM)1
Not AvailableUnknown StatusTreatmentGestational Diabetes Mellitus (GDM) / Pregnancy / Type 2 Diabetes Mellitus1
Not AvailableUnknown StatusTreatmentHealthy Volunteers1


  • Sanofi aventis us llc
  • Actavis totowa llc
  • Aurobindo pharma ltd
  • Corepharma llc
  • Teva pharmaceuticals usa inc
  • Dava pharmaceuticals inc
  • Hikma pharmaceuticals
  • Mylan pharmaceuticals inc
  • Sandoz inc
  • Pharmacia and upjohn co
  • Advanced Pharmaceutical Services Inc.
  • Amerisource Health Services Corp.
  • Apotheca Inc.
  • AQ Pharmaceuticals Inc.
  • A-S Medication Solutions LLC
  • Aurobindo Pharma Ltd.
  • Bryant Ranch Prepack
  • Cardinal Health
  • Caremark LLC
  • Corepharma LLC
  • Coupler Enterprises Inc.
  • DAVA Pharmaceuticals
  • DHHS Program Support Center Supply Service Center
  • Direct Dispensing Inc.
  • Dispensing Solutions
  • Diversified Healthcare Services Inc.
  • Golden State Medical Supply Inc.
  • Greenstone LLC
  • H.J. Harkins Co. Inc.
  • Heartland Repack Services LLC
  • Hikma Pharmaceuticals
  • Kaiser Foundation Hospital
  • Lake Erie Medical and Surgical Supply
  • Legacy Pharmaceuticals Packaging LLC
  • Liberty Pharmaceuticals
  • Major Pharmaceuticals
  • Mckesson Corp.
  • Medvantx Inc.
  • Merrell Pharmaceuticals Inc.
  • Murfreesboro Pharmaceutical Nursing Supply
  • Mylan
  • Novopharm Ltd.
  • Nucare Pharmaceuticals Inc.
  • Palmetto Pharmaceuticals Inc.
  • Patheon Inc.
  • PD-Rx Pharmaceuticals Inc.
  • Pfizer Inc.
  • Pharmaceutical Utilization Management Program VA Inc.
  • Pharmacia Inc.
  • Pharmedix
  • Physicians Total Care Inc.
  • Preferred Pharmaceuticals Inc.
  • Prepackage Specialists
  • Prepak Systems Inc.
  • Rebel Distributors Corp.
  • Remedy Repack
  • Resource Optimization and Innovation LLC
  • Rite Aid Corp.
  • Sandhills Packaging Inc.
  • Sandoz
  • Sanofi-Aventis Inc.
  • Southwood Pharmaceuticals
  • Talbert Medical Management Corp.
  • Teva Pharmaceutical Industries Ltd.
  • UDL Laboratories
  • Va Cmop Dallas
  • Vangard Labs Inc.
  • Warrick Pharmaceuticals Corp.
  • West-Ward Pharmaceuticals
  • Zoetica Pharmaceutical Corp.
Dosage forms
TabletOral2.5 mg
TabletOral5 mg
TabletOral1.25 mg/1
TabletOral1.5 mg/1
TabletOral2.5 mg/1
TabletOral3 mg/1
TabletOral5 mg/1
TabletOral6 mg/1
Tablet, film coatedOral
Unit descriptionCostUnit
Glynase 6 mg tablet2.28USD tablet
Glynase 6 mg prestab2.19USD tablet
Glynase 3 mg tablet1.45USD tablet
Glynase 3 mg prestab1.39USD tablet
Diabeta 5 mg tablet1.36USD tablet
Micronase 5 mg tablet1.36USD tablet
Diabeta 2.5 mg tablet0.91USD tablet
Glynase 1.5 mg tablet0.83USD tablet
Glynase 1.5 mg prestab0.82USD tablet
Micronase 2.5 mg tablet0.8USD tablet
Diabeta 1.25 mg tablet0.5USD tablet
Micronase 1.25 mg tablet0.48USD tablet
Diabeta 5 mg Tablet0.26USD tablet
Diabeta 2.5 mg Tablet0.14USD tablet
Apo-Glyburide 5 mg Tablet0.07USD tablet
Euglucon 5 mg Tablet0.07USD tablet
Mylan-Glybe 5 mg Tablet0.07USD tablet
Novo-Glyburide 5 mg Tablet0.07USD tablet
Nu-Glyburide 5 mg Tablet0.07USD tablet
Pms-Glyburide 5 mg Tablet0.07USD tablet
Ratio-Glyburide 5 mg Tablet0.07USD tablet
Sandoz Glyburide 5 mg Tablet0.07USD tablet
Apo-Glyburide 2.5 mg Tablet0.04USD tablet
Euglucon 2.5 mg Tablet0.04USD tablet
Mylan-Glybe 2.5 mg Tablet0.04USD tablet
Novo-Glyburide 2.5 mg Tablet0.04USD tablet
Nu-Glyburide 2.5 mg Tablet0.04USD tablet
Pms-Glyburide 2.5 mg Tablet0.04USD tablet
Ratio-Glyburide 2.5 mg Tablet0.04USD tablet
Sandoz Glyburide 2.5 mg Tablet0.04USD tablet
DrugBank does not sell nor buy drugs. Pricing information is supplied for informational purposes only.
Patent NumberPediatric ExtensionApprovedExpires (estimated)


Experimental Properties
melting point (°C)169 °CPhysProp
water solubility4 mg/L (at 27 °C)YALKOWSKY,SH & DANNENFELSER,RM (1992)
logP4.7Not Available
logS-5.09ADME Research, USCD
Predicted Properties
Water Solubility0.00206 mg/mLALOGPS
pKa (Strongest Acidic)4.32ChemAxon
pKa (Strongest Basic)-1.2ChemAxon
Physiological Charge-1ChemAxon
Hydrogen Acceptor Count5ChemAxon
Hydrogen Donor Count3ChemAxon
Polar Surface Area113.6 Å2ChemAxon
Rotatable Bond Count7ChemAxon
Refractivity126.98 m3·mol-1ChemAxon
Polarizability51.75 Å3ChemAxon
Number of Rings3ChemAxon
Rule of FiveYesChemAxon
Ghose FilterNoChemAxon
Veber's RuleNoChemAxon
MDDR-like RuleYesChemAxon
Predicted ADMET features
Human Intestinal Absorption+0.9701
Blood Brain Barrier-0.6707
Caco-2 permeable-0.6479
P-glycoprotein substrateNon-substrate0.5109
P-glycoprotein inhibitor INon-inhibitor0.7119
P-glycoprotein inhibitor IINon-inhibitor0.8185
Renal organic cation transporterNon-inhibitor0.7982
CYP450 2C9 substrateSubstrate0.6488
CYP450 2D6 substrateNon-substrate0.9116
CYP450 3A4 substrateSubstrate0.5329
CYP450 1A2 substrateNon-inhibitor0.9045
CYP450 2C9 inhibitorInhibitor0.8948
CYP450 2D6 inhibitorInhibitor0.8932
CYP450 2C19 inhibitorNon-inhibitor0.9026
CYP450 3A4 inhibitorInhibitor0.7959
CYP450 inhibitory promiscuityHigh CYP Inhibitory Promiscuity0.8627
Ames testNon AMES toxic0.6996
BiodegradationNot ready biodegradable0.8245
Rat acute toxicity1.4243 LD50, mol/kg Not applicable
hERG inhibition (predictor I)Weak inhibitor0.7551
hERG inhibition (predictor II)Non-inhibitor0.8024
ADMET data is predicted using admetSAR, a free tool for evaluating chemical ADMET properties. (23092397)


Mass Spec (NIST)
Not Available
SpectrumSpectrum TypeSplash Key
Predicted GC-MS Spectrum - GC-MSPredicted GC-MSNot Available
Predicted MS/MS Spectrum - 10V, Positive (Annotated)Predicted LC-MS/MSNot Available
Predicted MS/MS Spectrum - 20V, Positive (Annotated)Predicted LC-MS/MSNot Available
Predicted MS/MS Spectrum - 40V, Positive (Annotated)Predicted LC-MS/MSNot Available
Predicted MS/MS Spectrum - 10V, Negative (Annotated)Predicted LC-MS/MSNot Available
Predicted MS/MS Spectrum - 20V, Negative (Annotated)Predicted LC-MS/MSNot Available
Predicted MS/MS Spectrum - 40V, Negative (Annotated)Predicted LC-MS/MSNot Available
LC-MS/MS Spectrum - LC-ESI-qTof , PositiveLC-MS/MSNot Available
LC-MS/MS Spectrum - LC-ESI-qTof , PositiveLC-MS/MSNot Available
LC-MS/MS Spectrum - LC-ESI-qTof , PositiveLC-MS/MSNot Available
LC-MS/MS Spectrum - LC-ESI-qTof , PositiveLC-MS/MSNot Available
LC-MS/MS Spectrum - LC-ESI-QFT , negativeLC-MS/MSsplash10-00dl-0901300000-a19ba3565aec1b9acb36
MS/MS Spectrum - , positiveLC-MS/MSsplash10-014i-0002290000-4a0641596c33a997d77e
MS/MS Spectrum - , positiveLC-MS/MSsplash10-014i-0319000000-b4fc8ec2ce4cb2f7b9fe
MS/MS Spectrum - , positiveLC-MS/MSsplash10-014i-0002190000-7f61119495ccea67ff2f
MS/MS Spectrum - , positiveLC-MS/MSsplash10-014i-1629000000-bcf31c97391018018369
MS/MS Spectrum - , positiveLC-MS/MSsplash10-014i-2911000000-7c5e8a23fd392fd3eb4d
LC-MS/MS Spectrum - LC-ESI-QFT , positiveLC-MS/MSsplash10-014i-0906000000-4ed189ce2c190cc04470


This compound belongs to the class of organic compounds known as benzenesulfonamides. These are organic compounds containing a sulfonamide group that is S-linked to a benzene ring.
Organic compounds
Super Class
Benzene and substituted derivatives
Sub Class
Direct Parent
Alternative Parents
Benzenesulfonyl compounds / Anisoles / Methoxybenzenes / Phenoxy compounds / Chlorobenzenes / Sulfonylureas / Alkyl aryl ethers / Aryl chlorides / Aminosulfonyl compounds / Organosulfonic acids and derivatives
show 6 more
Benzenesulfonamide / Benzenesulfonyl group / Anisole / Phenol ether / Methoxybenzene / Phenoxy compound / Chlorobenzene / Halobenzene / Sulfonylurea / Alkyl aryl ether
show 22 more
Molecular Framework
Aromatic homomonocyclic compounds
External Descriptors
monochlorobenzenes, N-sulfonylurea (CHEBI:5441)


Protein group
Pharmacological action
General Function
Sulfonylurea receptor activity
Specific Function
Subunit of the beta-cell ATP-sensitive potassium channel (KATP). Regulator of ATP-sensitive K(+) channels and insulin release.

  1. Dabrowski M, Ashcroft FM, Ashfield R, Lebrun P, Pirotte B, Egebjerg J, Bondo Hansen J, Wahl P: The novel diazoxide analog 3-isopropylamino-7-methoxy-4H-1,2,4-benzothiadiazine 1,1-dioxide is a selective Kir6.2/SUR1 channel opener. Diabetes. 2002 Jun;51(6):1896-906. [PubMed:12031979]
  2. Hambrock A, Preisig-Muller R, Russ U, Piehl A, Hanley PJ, Ray J, Daut J, Quast U, Derst C: Four novel splice variants of sulfonylurea receptor 1. Am J Physiol Cell Physiol. 2002 Aug;283(2):C587-98. [PubMed:12107069]
  3. Hambrock A, Loffler-Walz C, Quast U: Glibenclamide binding to sulphonylurea receptor subtypes: dependence on adenine nucleotides. Br J Pharmacol. 2002 Aug;136(7):995-1004. [PubMed:12145099]
  4. Nielsen FE, Bodvarsdottir TB, Worsaae A, MacKay P, Stidsen CE, Boonen HC, Pridal L, Arkhammar PO, Wahl P, Ynddal L, Junager F, Dragsted N, Tagmose TM, Mogensen JP, Koch A, Treppendahl SP, Hansen JB: 6-Chloro-3-alkylamino-4H-thieno[3,2-e]-1,2,4-thiadiazine 1,1-dioxide derivatives potently and selectively activate ATP sensitive potassium channels of pancreatic beta-cells. J Med Chem. 2002 Sep 12;45(19):4171-87. [PubMed:12213059]
  5. Babenko AP, Bryan J: SUR-dependent modulation of KATP channels by an N-terminal KIR6.2 peptide. Defining intersubunit gating interactions. J Biol Chem. 2002 Nov 15;277(46):43997-4004. Epub 2002 Sep 3. [PubMed:12213829]
  6. Ueda K, Komine J, Matsuo M, Seino S, Amachi T: Cooperative binding of ATP and MgADP in the sulfonylurea receptor is modulated by glibenclamide. Proc Natl Acad Sci U S A. 1999 Feb 16;96(4):1268-72. [PubMed:9990013]
  7. Serrano-Martin X, Payares G, Mendoza-Leon A: Glibenclamide, a blocker of K+(ATP) channels, shows antileishmanial activity in experimental murine cutaneous leishmaniasis. Antimicrob Agents Chemother. 2006 Dec;50(12):4214-6. Epub 2006 Oct 2. [PubMed:17015627]
Pharmacological action
General Function
G-protein activated inward rectifier potassium channel activity
Specific Function
This potassium channel is controlled by G proteins. Inward rectifier potassium channels are characterized by a greater tendency to allow potassium to flow into the cell rather than out of it. Their...
Gene Name
Uniprot ID
Uniprot Name
G protein-activated inward rectifier potassium channel 4
Molecular Weight
47667.3 Da
  1. Chen X, Ji ZL, Chen YZ: TTD: Therapeutic Target Database. Nucleic Acids Res. 2002 Jan 1;30(1):412-5. [PubMed:11752352]
Pharmacological action
General Function
Transporter activity
Specific Function
Subunit of ATP-sensitive potassium channels (KATP). Can form cardiac and smooth muscle-type KATP channels with KCNJ11. KCNJ11 forms the channel pore while ABCC9 is required for activation and regul...
Gene Name
Uniprot ID
Uniprot Name
ATP-binding cassette sub-family C member 9
Molecular Weight
174221.7 Da
  1. Hambrock A, Loffler-Walz C, Quast U: Glibenclamide binding to sulphonylurea receptor subtypes: dependence on adenine nucleotides. Br J Pharmacol. 2002 Aug;136(7):995-1004. [PubMed:12145099]
  2. Rainbow RD, James M, Hudman D, Al Johi M, Singh H, Watson PJ, Ashmole I, Davies NW, Lodwick D, Norman RI: Proximal C-terminal domain of sulphonylurea receptor 2A interacts with pore-forming Kir6 subunits in KATP channels. Biochem J. 2004 Apr 1;379(Pt 1):173-81. [PubMed:14672537]
  3. Felsch H, Lange U, Hambrock A, Loffler-Walz C, Russ U, Carroll WA, Gopalakrishnan M, Quast U: Interaction of a novel dihydropyridine K+ channel opener, A-312110, with recombinant sulphonylurea receptors and KATP channels: comparison with the cyanoguanidine P1075. Br J Pharmacol. 2004 Apr;141(7):1098-105. Epub 2004 Mar 15. [PubMed:15023854]
  4. Zhao JL, Yang YJ, You SJ, Jing ZC, Wu YJ, Cheng JL, Gao RL: Pretreatment with fosinopril or valsartan reduces myocardial no-reflow after acute myocardial infarction and reperfusion. Coron Artery Dis. 2006 Aug;17(5):463-9. [PubMed:16845255]
  5. Wang YH, Zheng HY, Qin NL, Yu SB, Liu SY: Involvement of ATP-sensitive potassium channels in proliferation and differentiation of rat preadipocytes. Sheng Li Xue Bao. 2007 Feb 25;59(1):8-12. [PubMed:17294036]
4. Bile salt export pump
Pharmacological action
General Function
Transporter activity
Specific Function
Involved in the ATP-dependent secretion of bile salts into the canaliculus of hepatocytes.
Gene Name
Uniprot ID
Uniprot Name
Bile salt export pump
Molecular Weight
146405.83 Da
  1. Byrne JA, Strautnieks SS, Mieli-Vergani G, Higgins CF, Linton KJ, Thompson RJ: The human bile salt export pump: characterization of substrate specificity and identification of inhibitors. Gastroenterology. 2002 Nov;123(5):1649-58. [PubMed:12404239]
  2. Kemp DC, Brouwer KL: Viability assessment in sandwich-cultured rat hepatocytes after xenobiotic exposure. Toxicol In Vitro. 2004 Dec;18(6):869-77. [PubMed:15465654]
  3. Horikawa M, Kato Y, Tyson CA, Sugiyama Y: Potential cholestatic activity of various therapeutic agents assessed by bile canalicular membrane vesicles isolated from rats and humans. Drug Metab Pharmacokinet. 2003;18(1):16-22. [PubMed:15618715]
Pharmacological action
General Function
Syntaxin binding
Specific Function
cAMP-dependent and sulfonylurea-sensitive anion transporter. Key gatekeeper influencing intracellular cholesterol transport.
Gene Name
Uniprot ID
Uniprot Name
ATP-binding cassette sub-family A member 1
Molecular Weight
254299.89 Da
  1. Reddy ST, Hama S, Ng C, Grijalva V, Navab M, Fogelman AM: ATP-binding cassette transporter 1 participates in LDL oxidation by artery wall cells. Arterioscler Thromb Vasc Biol. 2002 Nov 1;22(11):1877-83. [PubMed:12426219]
  2. Muhl H, Hofler S, Pfeilschifter J: Inhibition of lipopolysaccharide/ATP-induced release of interleukin-18 by KN-62 and glyburide. Eur J Pharmacol. 2003 Dec 15;482(1-3):325-8. [PubMed:14660039]
  3. Agassandian M, Mathur SN, Zhou J, Field FJ, Mallampalli RK: Oxysterols trigger ABCA1-mediated basolateral surfactant efflux. Am J Respir Cell Mol Biol. 2004 Aug;31(2):227-33. Epub 2004 Mar 23. [PubMed:15039140]
  4. Nieland TJ, Chroni A, Fitzgerald ML, Maliga Z, Zannis VI, Kirchhausen T, Krieger M: Cross-inhibition of SR-BI- and ABCA1-mediated cholesterol transport by the small molecules BLT-4 and glyburide. J Lipid Res. 2004 Jul;45(7):1256-65. Epub 2004 Apr 21. [PubMed:15102890]
  5. Alder-Baerens N, Muller P, Pohl A, Korte T, Hamon Y, Chimini G, Pomorski T, Herrmann A: Headgroup-specific exposure of phospholipids in ABCA1-expressing cells. J Biol Chem. 2005 Jul 15;280(28):26321-9. Epub 2005 May 19. [PubMed:15905177]
  6. Lamkanfi M, Mueller JL, Vitari AC, Misaghi S, Fedorova A, Deshayes K, Lee WP, Hoffman HM, Dixit VM: Glyburide inhibits the Cryopyrin/Nalp3 inflammasome. J Cell Biol. 2009 Oct 5;187(1):61-70. doi: 10.1083/jcb.200903124. [PubMed:19805629]
Pharmacological action
General Function
Pdz domain binding
Specific Function
Involved in the transport of chloride ions. May regulate bicarbonate secretion and salvage in epithelial cells by regulating the SLC4A7 transporter. Can inhibit the chloride channel activity of ANO...
Gene Name
Uniprot ID
Uniprot Name
Cystic fibrosis transmembrane conductance regulator
Molecular Weight
168139.895 Da
  1. Reddy MM, Quinton PM: Effect of anion transport blockers on CFTR in the human sweat duct. J Membr Biol. 2002 Sep 1;189(1):15-25. [PubMed:12202948]
  2. Jiang J, Song Y, Bai C, Koller BH, Matthay MA, Verkman AS: Pleural surface fluorescence measurement of Na+ and Cl- transport across the air space-capillary barrier. J Appl Physiol (1985). 2003 Jan;94(1):343-52. Epub 2002 Aug 30. [PubMed:12391048]
  3. Zhou Z, Hu S, Hwang TC: Probing an open CFTR pore with organic anion blockers. J Gen Physiol. 2002 Nov;120(5):647-62. [PubMed:12407077]
  4. Larsen EH, Amstrup J, Willumsen NJ: Beta-adrenergic receptors couple to CFTR chloride channels of intercalated mitochondria-rich cells in the heterocellular toad skin epithelium. Biochim Biophys Acta. 2003 Dec 30;1618(2):140-52. [PubMed:14729151]
  5. Lee SY, Lee CO: Inhibition of Na+-K+ pump and L-type Ca2+ channel by glibenclamide in Guinea pig ventricular myocytes. J Pharmacol Exp Ther. 2005 Jan;312(1):61-8. Epub 2004 Sep 13. [PubMed:15365090]
Protein group
Pharmacological action
General Function
Voltage-gated potassium channel activity
Specific Function
This receptor is controlled by G proteins. Inward rectifier potassium channels are characterized by a greater tendency to allow potassium to flow into the cell rather than out of it. Their voltage ...

  1. Jaburek M, Yarov-Yarovoy V, Paucek P, Garlid KD: State-dependent inhibition of the mitochondrial KATP channel by glyburide and 5-hydroxydecanoate. J Biol Chem. 1998 May 29;273(22):13578-82. [PubMed:9593694]
Pharmacological action
General Function
Carnitine o-palmitoyltransferase activity
Specific Function
Catalyzes the transfer of the acyl group of long-chain fatty acid-CoA conjugates onto carnitine, an essential step for the mitochondrial uptake of long-chain fatty acids and their subsequent beta-o...
Gene Name
Uniprot ID
Uniprot Name
Carnitine O-palmitoyltransferase 1, liver isoform
Molecular Weight
88366.92 Da
  1. Patel TB: Effect of sulfonylureas on hepatic fatty acid oxidation. Am J Physiol. 1986 Aug;251(2 Pt 1):E241-6. [PubMed:3090894]
  2. Cook GA: The hypoglycemic sulfonylureas glyburide and tolbutamide inhibit fatty acid oxidation by inhibiting carnitine palmitoyltransferase. J Biol Chem. 1987 Apr 15;262(11):4968-72. [PubMed:3104327]


Pharmacological action
General Function
Steroid hydroxylase activity
Specific Function
Responsible for the metabolism of a number of therapeutic agents such as the anticonvulsant drug S-mephenytoin, omeprazole, proguanil, certain barbiturates, diazepam, propranolol, citalopram and im...
Gene Name
Uniprot ID
Uniprot Name
Cytochrome P450 2C19
Molecular Weight
55930.545 Da
  1. Zhou SF, Zhou ZW, Yang LP, Cai JP: Substrates, inducers, inhibitors and structure-activity relationships of human Cytochrome P450 2C9 and implications in drug development. Curr Med Chem. 2009;16(27):3480-675. Epub 2009 Sep 1. [PubMed:19515014]
  2. Preissner S, Kroll K, Dunkel M, Senger C, Goldsobel G, Kuzman D, Guenther S, Winnenburg R, Schroeder M, Preissner R: SuperCYP: a comprehensive database on Cytochrome P450 enzymes including a tool for analysis of CYP-drug interactions. Nucleic Acids Res. 2010 Jan;38(Database issue):D237-43. doi: 10.1093/nar/gkp970. Epub 2009 Nov 24. [PubMed:19934256]
Pharmacological action
General Function
Vitamin d3 25-hydroxylase activity
Specific Function
Cytochromes P450 are a group of heme-thiolate monooxygenases. In liver microsomes, this enzyme is involved in an NADPH-dependent electron transport pathway. It performs a variety of oxidation react...
Gene Name
Uniprot ID
Uniprot Name
Cytochrome P450 3A4
Molecular Weight
57342.67 Da
  1. Zhou SF, Zhou ZW, Yang LP, Cai JP: Substrates, inducers, inhibitors and structure-activity relationships of human Cytochrome P450 2C9 and implications in drug development. Curr Med Chem. 2009;16(27):3480-675. Epub 2009 Sep 1. [PubMed:19515014]
  2. Preissner S, Kroll K, Dunkel M, Senger C, Goldsobel G, Kuzman D, Guenther S, Winnenburg R, Schroeder M, Preissner R: SuperCYP: a comprehensive database on Cytochrome P450 enzymes including a tool for analysis of CYP-drug interactions. Nucleic Acids Res. 2010 Jan;38(Database issue):D237-43. doi: 10.1093/nar/gkp970. Epub 2009 Nov 24. [PubMed:19934256]
Pharmacological action
General Function
Steroid hydroxylase activity
Specific Function
Cytochromes P450 are a group of heme-thiolate monooxygenases. In liver microsomes, this enzyme is involved in an NADPH-dependent electron transport pathway. It oxidizes a variety of structurally un...
Gene Name
Uniprot ID
Uniprot Name
Cytochrome P450 2C9
Molecular Weight
55627.365 Da
  1. Zhou SF, Zhou ZW, Yang LP, Cai JP: Substrates, inducers, inhibitors and structure-activity relationships of human Cytochrome P450 2C9 and implications in drug development. Curr Med Chem. 2009;16(27):3480-675. Epub 2009 Sep 1. [PubMed:19515014]
  2. Preissner S, Kroll K, Dunkel M, Senger C, Goldsobel G, Kuzman D, Guenther S, Winnenburg R, Schroeder M, Preissner R: SuperCYP: a comprehensive database on Cytochrome P450 enzymes including a tool for analysis of CYP-drug interactions. Nucleic Acids Res. 2010 Jan;38(Database issue):D237-43. doi: 10.1093/nar/gkp970. Epub 2009 Nov 24. [PubMed:19934256]
  3. Drug Interactions: Cytochrome P450 Drug Interaction Table [Link]


Pharmacological action
General Function
Toxic substance binding
Specific Function
Serum albumin, the main protein of plasma, has a good binding capacity for water, Ca(2+), Na(+), K(+), fatty acids, hormones, bilirubin and drugs. Its main function is the regulation of the colloid...
Gene Name
Uniprot ID
Uniprot Name
Serum albumin
Molecular Weight
69365.94 Da
  1. Crooks MJ, Brown KF: The binding of sulphonylureas to serum albumin. J Pharm Pharmacol. 1974 May;26(5):304-11. [PubMed:4153105]
  2. Hsu PL, Ma JK, Luzzi LA: Interactions of sulfonylureas with plasma proteins. J Pharm Sci. 1974 Apr;63(4):570-3. [PubMed:4208196]
  3. Brown KF, Crooks MJ: Displacement of tolbutamide, glibencalmide and chlorpropamide from serum albumin by anionic drugs. Biochem Pharmacol. 1976 May 15;25(10):1175-8. [PubMed:820348]


Pharmacological action
General Function
Organic anion transmembrane transporter activity
Specific Function
May act as an inducible transporter in the biliary and intestinal excretion of organic anions. Acts as an alternative route for the export of bile acids and glucuronides from cholestatic hepatocyte...
Gene Name
Uniprot ID
Uniprot Name
Canalicular multispecific organic anion transporter 2
Molecular Weight
169341.14 Da
  1. Gedeon C, Behravan J, Koren G, Piquette-Miller M: Transport of glyburide by placental ABC transporters: implications in fetal drug exposure. Placenta. 2006 Nov-Dec;27(11-12):1096-102. Epub 2006 Feb 3. [PubMed:16460798]
Pharmacological action
General Function
Transporter activity
Specific Function
Involved in the ATP-dependent secretion of bile salts into the canaliculus of hepatocytes.
Gene Name
Uniprot ID
Uniprot Name
Bile salt export pump
Molecular Weight
146405.83 Da
  1. Byrne JA, Strautnieks SS, Mieli-Vergani G, Higgins CF, Linton KJ, Thompson RJ: The human bile salt export pump: characterization of substrate specificity and identification of inhibitors. Gastroenterology. 2002 Nov;123(5):1649-58. [PubMed:12404239]
  2. Wang EJ, Casciano CN, Clement RP, Johnson WW: Fluorescent substrates of sister-P-glycoprotein (BSEP) evaluated as markers of active transport and inhibition: evidence for contingent unequal binding sites. Pharm Res. 2003 Apr;20(4):537-44. [PubMed:12739759]
  3. Noe J, Hagenbuch B, Meier PJ, St-Pierre MV: Characterization of the mouse bile salt export pump overexpressed in the baculovirus system. Hepatology. 2001 May;33(5):1223-31. [PubMed:11343252]
  4. Funk C, Pantze M, Jehle L, Ponelle C, Scheuermann G, Lazendic M, Gasser R: Troglitazone-induced intrahepatic cholestasis by an interference with the hepatobiliary export of bile acids in male and female rats. Correlation with the gender difference in troglitazone sulfate formation and the inhibition of the canalicular bile salt export pump (Bsep) by troglitazone and troglitazone sulfate. Toxicology. 2001 Oct 5;167(1):83-98. [PubMed:11557132]
  5. Stieger B, Fattinger K, Madon J, Kullak-Ublick GA, Meier PJ: Drug- and estrogen-induced cholestasis through inhibition of the hepatocellular bile salt export pump (Bsep) of rat liver. Gastroenterology. 2000 Feb;118(2):422-30. [PubMed:10648470]
Pharmacological action
General Function
Xenobiotic-transporting atpase activity
Specific Function
Energy-dependent efflux pump responsible for decreased drug accumulation in multidrug-resistant cells.
Gene Name
Uniprot ID
Uniprot Name
Multidrug resistance protein 1
Molecular Weight
141477.255 Da
  1. Golstein PE, Boom A, van Geffel J, Jacobs P, Masereel B, Beauwens R: P-glycoprotein inhibition by glibenclamide and related compounds. Pflugers Arch. 1999 Apr;437(5):652-60. [PubMed:10087141]
Pharmacological action
General Function
Transporter activity
Specific Function
Mediates export of organic anions and drugs from the cytoplasm. Mediates ATP-dependent transport of glutathione and glutathione conjugates, leukotriene C4, estradiol-17-beta-o-glucuronide, methotre...
Gene Name
Uniprot ID
Uniprot Name
Multidrug resistance-associated protein 1
Molecular Weight
171589.5 Da
  1. Payen L, Delugin L, Courtois A, Trinquart Y, Guillouzo A, Fardel O: The sulphonylurea glibenclamide inhibits multidrug resistance protein (MRP1) activity in human lung cancer cells. Br J Pharmacol. 2001 Feb;132(3):778-84. [PubMed:11159731]
  2. Gedeon C, Behravan J, Koren G, Piquette-Miller M: Transport of glyburide by placental ABC transporters: implications in fetal drug exposure. Placenta. 2006 Nov-Dec;27(11-12):1096-102. Epub 2006 Feb 3. [PubMed:16460798]
Pharmacological action
General Function
Proton-dependent oligopeptide secondary active transmembrane transporter activity
Specific Function
Proton-coupled intake of oligopeptides of 2 to 4 amino acids with a preference for dipeptides. May constitute a major route for the absorption of protein digestion end-products.
Gene Name
Uniprot ID
Uniprot Name
Solute carrier family 15 member 1
Molecular Weight
78805.265 Da
  1. Sawada K, Terada T, Saito H, Hashimoto Y, Inui K: Effects of glibenclamide on glycylsarcosine transport by the rat peptide transporters PEPT1 and PEPT2. Br J Pharmacol. 1999 Nov;128(6):1159-64. [PubMed:10578127]
Pharmacological action
General Function
Sodium-independent organic anion transmembrane transporter activity
Specific Function
Mediates the Na(+)-independent transport of organic anions such as sulfobromophthalein (BSP) and conjugated (taurocholate) and unconjugated (cholate) bile acids (By similarity). Selectively inhibit...
Gene Name
Uniprot ID
Uniprot Name
Solute carrier organic anion transporter family member 1A2
Molecular Weight
74144.105 Da
  1. Shitara Y, Sugiyama D, Kusuhara H, Kato Y, Abe T, Meier PJ, Itoh T, Sugiyama Y: Comparative inhibitory effects of different compounds on rat oatpl (slc21a1)- and Oatp2 (Slc21a5)-mediated transport. Pharm Res. 2002 Feb;19(2):147-53. [PubMed:11883641]
Pharmacological action
General Function
Peptide:proton symporter activity
Specific Function
Proton-coupled intake of oligopeptides of 2 to 4 amino acids with a preference for dipeptides.
Gene Name
Uniprot ID
Uniprot Name
Solute carrier family 15 member 2
Molecular Weight
81782.77 Da
  1. Sawada K, Terada T, Saito H, Hashimoto Y, Inui K: Effects of glibenclamide on glycylsarcosine transport by the rat peptide transporters PEPT1 and PEPT2. Br J Pharmacol. 1999 Nov;128(6):1159-64. [PubMed:10578127]
Pharmacological action
General Function
Sodium-independent organic anion transmembrane transporter activity
Specific Function
Involved in the renal elimination of endogenous and exogenous organic anions. Functions as organic anion exchanger when the uptake of one molecule of organic anion is coupled with an efflux of one ...
Gene Name
Uniprot ID
Uniprot Name
Solute carrier family 22 member 6
Molecular Weight
61815.78 Da
  1. Uwai Y, Saito H, Hashimoto Y, Inui K: Inhibitory effect of anti-diabetic agents on rat organic anion transporter rOAT1. Eur J Pharmacol. 2000 Jun 16;398(2):193-7. [PubMed:10854830]
Pharmacological action
General Function
Organic anion transmembrane transporter activity
Specific Function
Mediates hepatobiliary excretion of numerous organic anions. May function as a cellular cisplatin transporter.
Gene Name
Uniprot ID
Uniprot Name
Canalicular multispecific organic anion transporter 1
Molecular Weight
174205.64 Da
  1. Gedeon C, Behravan J, Koren G, Piquette-Miller M: Transport of glyburide by placental ABC transporters: implications in fetal drug exposure. Placenta. 2006 Nov-Dec;27(11-12):1096-102. Epub 2006 Feb 3. [PubMed:16460798]
  2. Payen L, Delugin L, Courtois A, Trinquart Y, Guillouzo A, Fardel O: The sulphonylurea glibenclamide inhibits multidrug resistance protein (MRP1) activity in human lung cancer cells. Br J Pharmacol. 2001 Feb;132(3):778-84. [PubMed:11159731]
Pharmacological action
General Function
Xenobiotic-transporting atpase activity
Specific Function
High-capacity urate exporter functioning in both renal and extrarenal urate excretion. Plays a role in porphyrin homeostasis as it is able to mediates the export of protoporhyrin IX (PPIX) both fro...
Gene Name
Uniprot ID
Uniprot Name
ATP-binding cassette sub-family G member 2
Molecular Weight
72313.47 Da
  1. Gedeon C, Behravan J, Koren G, Piquette-Miller M: Transport of glyburide by placental ABC transporters: implications in fetal drug exposure. Placenta. 2006 Nov-Dec;27(11-12):1096-102. Epub 2006 Feb 3. [PubMed:16460798]
  2. Pollex EK, Anger G, Hutson J, Koren G, Piquette-Miller M: Breast cancer resistance protein (BCRP)-mediated glyburide transport: effect of the C421A/Q141K BCRP single-nucleotide polymorphism. Drug Metab Dispos. 2010 May;38(5):740-4. doi: 10.1124/dmd.109.030791. Epub 2010 Feb 16. [PubMed:20159988]
Pharmacological action
General Function
Sodium-independent organic anion transmembrane transporter activity
Specific Function
Mediates sodium-independent multispecific organic anion transport. Transport of prostaglandin E2, prostaglandin F2, tetracycline, bumetanide, estrone sulfate, glutarate, dehydroepiandrosterone sulf...
Gene Name
Uniprot ID
Uniprot Name
Solute carrier family 22 member 7
Molecular Weight
60025.025 Da
  1. Morita N, Kusuhara H, Sekine T, Endou H, Sugiyama Y: Functional characterization of rat organic anion transporter 2 in LLC-PK1 cells. J Pharmacol Exp Ther. 2001 Sep;298(3):1179-84. [PubMed:11504818]
Pharmacological action
General Function
Sodium-independent organic anion transmembrane transporter activity
Specific Function
Mediates the Na(+)-independent transport of organic anions such as taurocholate, the prostaglandins PGD2, PGE1, PGE2, leukotriene C4, thromboxane B2 and iloprost.
Gene Name
Uniprot ID
Uniprot Name
Solute carrier organic anion transporter family member 2B1
Molecular Weight
76709.98 Da
  1. Satoh H, Yamashita F, Tsujimoto M, Murakami H, Koyabu N, Ohtani H, Sawada Y: Citrus juices inhibit the function of human organic anion-transporting polypeptide OATP-B. Drug Metab Dispos. 2005 Apr;33(4):518-23. Epub 2005 Jan 7. [PubMed:15640378]

Drug created on June 13, 2005 07:24 / Updated on May 26, 2018 08:52