
Accession Number
DB01032  (APRD00167)
Small Molecule
Approved, Investigational

The prototypical uricosuric agent. It inhibits the renal excretion of organic anions and reduces tubular reabsorption of urate. Probenecid has also been used to treat patients with renal impairment, and, because it reduces the renal tubular excretion of other drugs, has been used as an adjunct to antibacterial therapy.

  • 4-((Dipropylamino)sulfonyl)benzoic acid
  • 4-(Di-n-propylsulfamoyl)benzoesäure
  • 4-(N,N-Dipropylsulfamoyl)benzoesäure
  • p-(Dipropylsulfamoyl)benzoic acid
  • Probenecid
  • Probenecid acid
  • Probenecida
  • Probenecide
  • Probenecidum
External IDs
HC 5006 / NSC-18786
Product Images
Prescription Products
NameDosageStrengthRouteLabellerMarketing StartMarketing End
Benemid Tab 500mgTablet500 mgOralMerck Frosst Canada & Cie, Merck Frosst Canada & Co.1952-12-312000-08-03Canada
BenurylTablet500 mgOralValeant Canada Lp Valeant Canada S.E.C.1974-12-312016-07-08Canada
Generic Prescription Products
NameDosageStrengthRouteLabellerMarketing StartMarketing End
ProbenecidTablet, film coated500 mg/1OralPhysicians Total Care, Inc.1995-03-28Not applicableUs00591 5347 01 nlmimage10 260e1360
ProbenecidTablet, film coated500 mg/1OralAphena Pharma Solutions Tennessee, Inc.1976-01-13Not applicableUs
ProbenecidTablet, film coated500 mg/1OralMarlex Pharmaceuticals Inc1976-07-29Not applicableUs
ProbenecidTablet, film coated500 mg/1OralAmerincan Health Packaging2015-10-162019-09-30Us
ProbenecidTablet, film coated500 mg/1OralActavis Pharma, Inc.1983-07-01Not applicableUs0591 534720180907 15195 jn97lw
ProbenecidTablet, film coated500 mg/1OralAphena Pharma Solutions Tennessee, Inc.1976-07-29Not applicableUs
ProbenecidTablet500 mg/1OralWestminster2016-07-28Not applicableUs
ProbenecidTablet, film coated500 mg/1OralHHS/Program Support Center/Supply Service Center1983-07-01Not applicableUs
ProbenecidTablet, film coated500 mg/1OralCarilion Materials Management1976-01-13Not applicableUs
ProbenecidTablet, film coated500 mg/1OralMylan Pharmaceuticals Inc.1976-01-13Not applicableUs
Mixture Products
NameIngredientsDosageRouteLabellerMarketing StartMarketing End
Pro Biosan KitProbenecid (500 mg) + Ampicillin (500 mg)Capsule; TabletOralIcn Pharmaceuticals1979-12-311998-08-13Canada
Probenecid and ColchicineProbenecid (500 mg/1) + Colchicine (0.5 mg/1)TabletOralAv Kare, Inc.2012-05-082016-02-01Us
Probenecid and ColchicineProbenecid (500 mg/1) + Colchicine (0.5 mg/1)TabletOralRising Pharmaceuticals, Inc.2008-05-13Not applicableUs
Probenecid and ColchicineProbenecid (500 mg/1) + Colchicine (0.5 mg/1)TabletOralPhysicians Total Care, Inc.1995-04-242013-05-30Us
Probenecid and ColchicineProbenecid (500 mg/1) + Colchicine (0.5 mg/1)TabletOralIngenus Pharmaceuticals Nj, Llc2008-05-132008-05-13Us
Probenecid and ColchicineProbenecid (500 mg/1) + Colchicine (0.5 mg/1)TabletOralActavis Pharma, Inc.1982-10-01Not applicableUs00591 5325 01 nlmimage10 240e1210
International/Other Brands
Benecid / Benemid / Probalan / Probecid / Proben
CAS number
Average: 285.359
Monoisotopic: 285.103478791
Chemical Formula
InChI Key
4-(dipropylsulfamoyl)benzoic acid



For the reduction of serum uric acid concentrations in chronic gouty arthritis and tophaceous gout in patients with frequent disabling gout attacks. Has also been effectively used to promote uric acid excretion in hyperuricemia secondary to the administration of thiazide and related diuretics.

Associated Conditions

Probenecid is a uricosuric and renal tubular blocking agent and is used in combination with colchicine to treat chronic gouty arthritis when complicated by frequent, recurrent acute attacks of gout. It inhibits the reabsorption of urate at the proximal convoluted tubule, thus increasing the urinary excretion of uric acid and decreasing serum urate levels. Effective uricosuria reduces the miscible urate pool, retards urate deposition, and promotes resorption of urate deposits. At the proximal and distal tubles, probenecid competitively inhibits the secretion of many weak organic acids including penicillins, most cephalosporins, and some other β-lactam antibiotics. This results in an increase in the plasma concentrations of acidic drugs eliminated principally by renal secretion, but only a slight increase if the drug is eliminated mainly by filtration. Thus, the drug can be used for therapeutic advantages to increase concentrations of certain β-lactam antibiotics in the treatment of gonorrhea, neurosyphilis, or pelvic inflammatory disease (PID).

Mechanism of action

Probenecid inhibits the tubular reabsorption of urate, thus increasing the urinary excretion of uric acid and decreasing serum urate levels. Probenecid may also reduce plasma binding of urate and inhibit renal secretion of uric acid at subtherapeutic concentrations. The mechanism by which probenecid inhibits renal tubular transport is not known, but the drug may inhibit transport enzymes that require a source of high energy phosphate bonds and/or nonspecifically interfere with substrate access to protein receptor sites on the kidney tubules.

ASolute carrier family 22 member 6
ASolute carrier family 22 member 11
ASolute carrier family 22 member 8
UTaste receptor type 2 member 16Not AvailableHuman
Not Available
Volume of distribution
Not Available
Protein binding


Not Available
Route of elimination

Excreted principally in the urine as monoacyl glucuronide and unchanged drug. Alkalinization of urine increases renal probenecid excretion.

Half life

6-12 hours

Not Available
Not Available
Affected organisms
  • Humans and other mammals
Not Available
Pharmacogenomic Effects/ADRs
Interacting Gene/EnzymeAllele nameGenotype(s)Defining Change(s)Type(s)DescriptionDetails
Glucose-6-phosphate 1-dehydrogenaseVilleurbanneNot Available1000_1002delACCADR InferredIncreased risk of aplastic anemia, leukopenia and hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseTorunNot Available1006A->GADR InferredIncreased risk of aplastic anemia, leukopenia and hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseSunderlandNot Available105_107delCATADR InferredIncreased risk of aplastic anemia, leukopenia and hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseIwatsukiNot Available1081G->AADR InferredIncreased risk of aplastic anemia, leukopenia and hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseSerresNot Available1082C->TADR InferredIncreased risk of aplastic anemia, leukopenia and hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseTondelaNot Available1084_1101delCTGAACGAGCGCAAGGCCADR InferredIncreased risk of aplastic anemia, leukopenia and hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseLoma LindaNot Available1089C->AADR InferredIncreased risk of aplastic anemia, leukopenia and hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseAachenNot Available1089C->GADR InferredIncreased risk of aplastic anemia, leukopenia and hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseTenriNot Available1096A->GADR InferredIncreased risk of aplastic anemia, leukopenia and hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseMontpellierNot Available1132G>AADR InferredIncreased risk of aplastic anemia, leukopenia and hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseCalvo MackennaNot Available1138A->GADR InferredIncreased risk of aplastic anemia, leukopenia and hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseRileyNot Available1139T->CADR InferredIncreased risk of aplastic anemia, leukopenia and hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseOlomoucNot Available1141T->CADR InferredIncreased risk of aplastic anemia, leukopenia and hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseTomahNot Available1153T->CADR InferredIncreased risk of aplastic anemia, leukopenia and hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseLynwoodNot Available1154G->TADR InferredIncreased risk of aplastic anemia, leukopenia and hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseMadridNot Available1155C->GADR InferredIncreased risk of aplastic anemia, leukopenia and hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseIowa, Walter Reed, SpringfieldNot Available1156A->GADR InferredIncreased risk of aplastic anemia, leukopenia and hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseBeverly Hills, Genova, Iwate, Niigata, YamaguchiNot Available1160G->AADR InferredIncreased risk of aplastic anemia, leukopenia and hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseHartfordNot Available1162A->GADR InferredIncreased risk of aplastic anemia, leukopenia and hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenasePrahaNot Available1166A->GADR InferredIncreased risk of aplastic anemia, leukopenia and hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseKrakowNot Available1175T>CADR InferredIncreased risk of aplastic anemia, leukopenia and hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseWisconsinNot Available1177C->GADR InferredIncreased risk of aplastic anemia, leukopenia and hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseNashville, Anaheim, PorticiNot Available1178G->AADR InferredIncreased risk of aplastic anemia, leukopenia and hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseAlhambraNot Available1180G->CADR InferredIncreased risk of aplastic anemia, leukopenia and hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseBariNot Available1187C->TADR InferredIncreased risk of aplastic anemia, leukopenia and hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenasePuerto LimonNot Available1192G->AADR InferredIncreased risk of aplastic anemia, leukopenia and hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseCovao do LoboNot Available1205C>AADR InferredIncreased risk of aplastic anemia, leukopenia and hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseClinicNot Available1215G->AADR InferredIncreased risk of aplastic anemia, leukopenia and hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseUtrechtNot Available1225C->TADR InferredIncreased risk of aplastic anemia, leukopenia and hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseSuwalkiNot Available1226C->GADR InferredIncreased risk of aplastic anemia, leukopenia and hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseRiversideNot Available1228G->TADR InferredIncreased risk of aplastic anemia, leukopenia and hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseJapan, ShinagawaNot Available1229G->AADR InferredIncreased risk of aplastic anemia, leukopenia and hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseKawasakiNot Available1229G->CADR InferredIncreased risk of aplastic anemia, leukopenia and hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseMunichNot Available1231A->GADR InferredIncreased risk of aplastic anemia, leukopenia and hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseGeorgiaNot Available1284C->AADR InferredIncreased risk of aplastic anemia, leukopenia and hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseSumareNot Available1292T->GADR InferredIncreased risk of aplastic anemia, leukopenia and hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseTelti/KobeNot Available1318C->TADR InferredIncreased risk of aplastic anemia, leukopenia and hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseSantiago de Cuba, MoriokaNot Available1339G->AADR InferredIncreased risk of aplastic anemia, leukopenia and hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseHarimaNot Available1358T->AADR InferredIncreased risk of aplastic anemia, leukopenia and hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseFiguera da FozNot Available1366G->CADR InferredIncreased risk of aplastic anemia, leukopenia and hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseAmiensNot Available1367A>TADR InferredIncreased risk of aplastic anemia, leukopenia and hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseBangkok NoiNot Available1376G->T, 1502T->GADR InferredIncreased risk of aplastic anemia, leukopenia and hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseFukayaNot Available1462G->AADR InferredIncreased risk of aplastic anemia, leukopenia and hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseCampinasNot Available1463G->TADR InferredIncreased risk of aplastic anemia, leukopenia and hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseBuenos AiresNot Available1465C>TADR InferredIncreased risk of aplastic anemia, leukopenia and hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseArakawaNot Available1466C->TADR InferredIncreased risk of aplastic anemia, leukopenia and hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseBrightonNot Available1488_1490delGAAADR InferredIncreased risk of aplastic anemia, leukopenia and hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseKozukataNot Available159G->CADR InferredIncreased risk of aplastic anemia, leukopenia and hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseAmsterdamNot Available180_182delTCTADR InferredIncreased risk of aplastic anemia, leukopenia and hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseNo nameNot Available202G->A, 376A->G, 1264C>GADR InferredIncreased risk of aplastic anemia, leukopenia and hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseSwanseaNot Available224T->CADR InferredIncreased risk of aplastic anemia, leukopenia and hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseUrayasuNot Available281_283delAGAADR InferredIncreased risk of aplastic anemia, leukopenia and hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseVancouverNot Available317C->G544C->T592C->TADR InferredIncreased risk of aplastic anemia, leukopenia and hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseMt SinaiNot Available376A->G, 1159C->TADR InferredIncreased risk of aplastic anemia, leukopenia and hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenasePlymouthNot Available488G->AADR InferredIncreased risk of aplastic anemia, leukopenia and hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseVolendamNot Available514C->TADR InferredIncreased risk of aplastic anemia, leukopenia and hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseShinshuNot Available527A->GADR InferredIncreased risk of aplastic anemia, leukopenia and hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseChikugoNot Available535A->TADR InferredIncreased risk of aplastic anemia, leukopenia and hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseTsukuiNot Available561_563delCTCADR InferredIncreased risk of aplastic anemia, leukopenia and hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenasePedoplis-CkaroNot Available573C>GADR InferredIncreased risk of aplastic anemia, leukopenia and hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseSantiagoNot Available593G->CADR InferredIncreased risk of aplastic anemia, leukopenia and hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseMinnesota, Marion, Gastonia, LeJeuneNot Available637G->TADR InferredIncreased risk of aplastic anemia, leukopenia and hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseCincinnatiNot Available637G->T, 1037A->TADR InferredIncreased risk of aplastic anemia, leukopenia and hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseHarilaouNot Available648T->GADR InferredIncreased risk of aplastic anemia, leukopenia and hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseNorth DallasNot Available683_685delACAADR InferredIncreased risk of aplastic anemia, leukopenia and hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseAsahikawaNot Available695G->AADR InferredIncreased risk of aplastic anemia, leukopenia and hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseDurhamNot Available713A->GADR InferredIncreased risk of aplastic anemia, leukopenia and hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseStonybrookNot Available724_729delGGCACTADR InferredIncreased risk of aplastic anemia, leukopenia and hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseWayneNot Available769C->GADR InferredIncreased risk of aplastic anemia, leukopenia and hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseAveiroNot Available806G->AADR InferredIncreased risk of aplastic anemia, leukopenia and hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseCleveland CorumNot Available820G->AADR InferredIncreased risk of aplastic anemia, leukopenia and hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseLilleNot Available821A>TADR InferredIncreased risk of aplastic anemia, leukopenia and hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseBangkokNot Available825G>CADR InferredIncreased risk of aplastic anemia, leukopenia and hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseSugaoNot Available826C->TADR InferredIncreased risk of aplastic anemia, leukopenia and hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseLa JollaNot Available832T->CADR InferredIncreased risk of aplastic anemia, leukopenia and hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseWexhamNot Available833C->TADR InferredIncreased risk of aplastic anemia, leukopenia and hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenasePiotrkowNot Available851T>CADR InferredIncreased risk of aplastic anemia, leukopenia and hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseWest VirginiaNot Available910G->TADR InferredIncreased risk of aplastic anemia, leukopenia and hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseOmiyaNot Available921G->CADR InferredIncreased risk of aplastic anemia, leukopenia and hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseNaraNot Available953_976delCCACCAAAGGGTACCTGGAC GACCADR InferredIncreased risk of aplastic anemia, leukopenia and hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseManhattanNot Available962G->AADR InferredIncreased risk of aplastic anemia, leukopenia and hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseRehevotNot Available964T->CADR InferredIncreased risk of aplastic anemia, leukopenia and hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseHoniaraNot Available99A->G / 1360C->TADR InferredIncreased risk of aplastic anemia, leukopenia and hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseTokyo, FukushimaNot Available1246G->AADR InferredIncreased risk of aplastic anemia, leukopenia and hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseChathamNot Available1003G->AADR InferredIncreased risk of aplastic anemia, leukopenia and hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseFushanNot Available1004C->AADR InferredIncreased risk of aplastic anemia, leukopenia and hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenasePartenopeNot Available1052G->TADR InferredIncreased risk of aplastic anemia, leukopenia and hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseIerapetraNot Available1057C->TADR InferredIncreased risk of aplastic anemia, leukopenia and hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseAnadiaNot Available1193A->GADR InferredIncreased risk of aplastic anemia, leukopenia and hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseAbenoNot Available1220A->CADR InferredIncreased risk of aplastic anemia, leukopenia and hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseSurabayaNot Available1291G->AADR InferredIncreased risk of aplastic anemia, leukopenia and hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenasePawneeNot Available1316G->CADR InferredIncreased risk of aplastic anemia, leukopenia and hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseS. AntiocoNot Available1342A->GADR InferredIncreased risk of aplastic anemia, leukopenia and hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseCassanoNot Available1347G->CADR InferredIncreased risk of aplastic anemia, leukopenia and hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseHermoupolisNot Available1347G->C / 1360C->TADR InferredIncreased risk of aplastic anemia, leukopenia and hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseUnion,Maewo, Chinese-2, KaloNot Available1360C->TADR InferredIncreased risk of aplastic anemia, leukopenia and hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseAndalusNot Available1361G->AADR InferredIncreased risk of aplastic anemia, leukopenia and hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseCosenzaNot Available1376G->CADR InferredIncreased risk of aplastic anemia, leukopenia and hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseCanton, Taiwan- Hakka, Gifu-like, Agrigento-likeNot Available1376G->TADR InferredIncreased risk of aplastic anemia, leukopenia and hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseFloresNot Available1387C->AADR InferredIncreased risk of aplastic anemia, leukopenia and hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseKaiping, Anant, Dhon, Sapporo-like, WoseraNot Available1388G->AADR InferredIncreased risk of aplastic anemia, leukopenia and hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseKamogawaNot Available169C->TADR InferredIncreased risk of aplastic anemia, leukopenia and hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseCostanzoNot Available179T>CADR InferredIncreased risk of aplastic anemia, leukopenia and hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseAmazoniaNot Available185C->AADR InferredIncreased risk of aplastic anemia, leukopenia and hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseSongklanagarindNot Available196T->AADR InferredIncreased risk of aplastic anemia, leukopenia and hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseHechiNot Available202G->A / 871G->AADR InferredIncreased risk of aplastic anemia, leukopenia and hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseNamouruNot Available208T->CADR InferredIncreased risk of aplastic anemia, leukopenia and hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseBao LocNot Available352T>CADR InferredIncreased risk of aplastic anemia, leukopenia and hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseCrispimNot Available375G->T, 379G->T383T->C384C>TADR InferredIncreased risk of aplastic anemia, leukopenia and hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseAcrokorinthosNot Available376A->G / 463C->GADR InferredIncreased risk of aplastic anemia, leukopenia and hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseSanta MariaNot Available376A->G / 542A->TADR InferredIncreased risk of aplastic anemia, leukopenia and hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseAnanindeuaNot Available376A->G / 871G->AADR InferredIncreased risk of aplastic anemia, leukopenia and hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseVanua LavaNot Available383T->CADR InferredIncreased risk of aplastic anemia, leukopenia and hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseValladolidNot Available406C->TADR InferredIncreased risk of aplastic anemia, leukopenia and hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseBelemNot Available409C->TADR InferredIncreased risk of aplastic anemia, leukopenia and hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseLiuzhouNot Available442G->AADR InferredIncreased risk of aplastic anemia, leukopenia and hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseShenzenNot Available473G>AADR InferredIncreased risk of aplastic anemia, leukopenia and hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseTaipei “Chinese- 3”Not Available493A->GADR InferredIncreased risk of aplastic anemia, leukopenia and hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseToledoNot Available496C>TADR InferredIncreased risk of aplastic anemia, leukopenia and hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseNaoneNot Available497G->AADR InferredIncreased risk of aplastic anemia, leukopenia and hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseNankangNot Available517T->CADR InferredIncreased risk of aplastic anemia, leukopenia and hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseMiaoliNot Available519C->GADR InferredIncreased risk of aplastic anemia, leukopenia and hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseMediterranean, Dallas, Panama‚ Sassari, Cagliari, BirminghamNot Available563C->TADR InferredIncreased risk of aplastic anemia, leukopenia and hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseCoimbra ShundeNot Available592C->TADR InferredIncreased risk of aplastic anemia, leukopenia and hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseNilgiriNot Available593G>AADR InferredIncreased risk of aplastic anemia, leukopenia and hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseRadlowoNot Available679C->TADR InferredIncreased risk of aplastic anemia, leukopenia and hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseRoubaixNot Available811G>CADR InferredIncreased risk of aplastic anemia, leukopenia and hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseHaikouNot Available835A->GADR InferredIncreased risk of aplastic anemia, leukopenia and hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseChinese-1Not Available835A->TADR InferredIncreased risk of aplastic anemia, leukopenia and hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseMizushimaNot Available848A>GADR InferredIncreased risk of aplastic anemia, leukopenia and hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseOsakaNot Available853C->TADR InferredIncreased risk of aplastic anemia, leukopenia and hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseViangchan, JammuNot Available871G->AADR InferredIncreased risk of aplastic anemia, leukopenia and hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseSeoulNot Available916G->AADR InferredIncreased risk of aplastic anemia, leukopenia and hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseLudhianaNot Available929G->AADR InferredIncreased risk of aplastic anemia, leukopenia and hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseFarroupilhaNot Available977C->AADR InferredIncreased risk of aplastic anemia, leukopenia and hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseChinese-5Not Available1024C->TADR InferredIncreased risk of aplastic anemia, leukopenia and hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseRignanoNot Available130G>AADR InferredIncreased risk of aplastic anemia, leukopenia and hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseOrissaNot Available131C->GADR InferredIncreased risk of aplastic anemia, leukopenia and hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseG6PDNiceNot Available1380G>CADR InferredIncreased risk of aplastic anemia, leukopenia and hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseKamiube, KeelungNot Available1387C->TADR InferredIncreased risk of aplastic anemia, leukopenia and hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseNeapolisNot Available1400C->GADR InferredIncreased risk of aplastic anemia, leukopenia and hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseAuresNot Available143T->CADR InferredIncreased risk of aplastic anemia, leukopenia and hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseSplitNot Available1442C->GADR InferredIncreased risk of aplastic anemia, leukopenia and hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseKambosNot Available148C->TADR InferredIncreased risk of aplastic anemia, leukopenia and hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenasePalestrinaNot Available170G>AADR InferredIncreased risk of aplastic anemia, leukopenia and hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseMetapontoNot Available172G->AADR InferredIncreased risk of aplastic anemia, leukopenia and hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseMusashinoNot Available185C->TADR InferredIncreased risk of aplastic anemia, leukopenia and hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseAsahiNot Available202G->AADR InferredIncreased risk of aplastic anemia, leukopenia and hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseA- (202), Ferrara INot Available202G->A / 376A->GADR InferredIncreased risk of aplastic anemia, leukopenia and hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseMurcia OristanoNot Available209A->GADR InferredIncreased risk of aplastic anemia, leukopenia and hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseUbe KonanNot Available241C->TADR InferredIncreased risk of aplastic anemia, leukopenia and hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseLagosantoNot Available242G->AADR InferredIncreased risk of aplastic anemia, leukopenia and hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseGuangzhouNot Available274C->TADR InferredIncreased risk of aplastic anemia, leukopenia and hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseHammersmithNot Available323T->AADR InferredIncreased risk of aplastic anemia, leukopenia and hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseSinnaiNot Available34G->TADR InferredIncreased risk of aplastic anemia, leukopenia and hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseA- (680)Not Available376A->G / 680G->TADR InferredIncreased risk of aplastic anemia, leukopenia and hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseA- (968), Betica,Selma, GuantanamoNot Available376A->G / 968T->CADR InferredIncreased risk of aplastic anemia, leukopenia and hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseSalerno PyrgosNot Available383T>GADR InferredIncreased risk of aplastic anemia, leukopenia and hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseQuing YanNot Available392G->TADR InferredIncreased risk of aplastic anemia, leukopenia and hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseLagesNot Available40G->AADR InferredIncreased risk of aplastic anemia, leukopenia and hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseIleshaNot Available466G->AADR InferredIncreased risk of aplastic anemia, leukopenia and hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseMahidolNot Available487G->AADR InferredIncreased risk of aplastic anemia, leukopenia and hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseMalagaNot Available542A->TADR InferredIncreased risk of aplastic anemia, leukopenia and hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseSibariNot Available634A->GADR InferredIncreased risk of aplastic anemia, leukopenia and hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseMexico CityNot Available680G->AADR InferredIncreased risk of aplastic anemia, leukopenia and hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseNanningNot Available703C->TADR InferredIncreased risk of aplastic anemia, leukopenia and hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseSeattle, Lodi, Modena, Ferrara II, Athens-likeNot Available844G->CADR InferredIncreased risk of aplastic anemia, leukopenia and hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseBajo MaumereNot Available844G->TADR InferredIncreased risk of aplastic anemia, leukopenia and hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseMontalbanoNot Available854G->AADR InferredIncreased risk of aplastic anemia, leukopenia and hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseKalyan-Kerala, Jamnaga, RohiniNot Available949G->AADR InferredIncreased risk of aplastic anemia, leukopenia and hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseGaoheNot Available95A->GADR InferredIncreased risk of aplastic anemia, leukopenia and hemolytic anemia.Details


Drug Interactions
2,4-thiazolidinedioneThe therapeutic efficacy of 2,4-thiazolidinedione can be increased when used in combination with Probenecid.
3-isobutyl-1-methyl-7H-xanthineThe serum concentration of 3-isobutyl-1-methyl-7H-xanthine can be increased when it is combined with Probenecid.
4-hydroxycoumarinThe metabolism of 4-hydroxycoumarin can be increased when combined with Probenecid.
6-O-benzylguanineThe serum concentration of 6-O-benzylguanine can be increased when it is combined with Probenecid.
7-DeazaguanineThe serum concentration of 7-Deazaguanine can be increased when it is combined with Probenecid.
7,9-DimethylguanineThe serum concentration of 7,9-Dimethylguanine can be increased when it is combined with Probenecid.
8-azaguanineThe serum concentration of 8-azaguanine can be increased when it is combined with Probenecid.
8-chlorotheophyllineThe serum concentration of 8-chlorotheophylline can be increased when it is combined with Probenecid.
9-DeazaguanineThe serum concentration of 9-Deazaguanine can be increased when it is combined with Probenecid.
9-MethylguanineThe serum concentration of 9-Methylguanine can be increased when it is combined with Probenecid.
Food Interactions
  • Increase liquid intake, avoid alcohol.
  • Take with food to reduce irritation.


General References
  1. Butler D: Wartime tactic doubles power of scarce bird-flu drug. Nature. 2005 Nov 3;438(7064):6. [PubMed:16267514]
External Links
Human Metabolome Database
KEGG Compound
PubChem Compound
PubChem Substance
Therapeutic Targets Database
Guide to Pharmacology
GtP Drug Page
RxList Drug Page Drug Page
ATC Codes
M04AB01 — ProbenecidG01AE10 — Combinations of sulfonamides
Download (36.9 KB)

Clinical Trials

Clinical Trials
0Active Not RecruitingBasic SciencePre-Exposure Prophylaxis1
0RecruitingTreatmentCalcium Pyrophosphate Deposition Disease1
1CompletedNot AvailableBMI >30 kg/m21
1CompletedBasic ScienceHealthy Volunteers2
1CompletedBasic SciencePharmacokinetics in Healthy Volunteers1
1CompletedHealth Services ResearchAvian Influenza A Virus1
1CompletedOtherHealthy Volunteers2
1CompletedTreatmentBlood And Marrow Transplantation1
1CompletedTreatmentDiabetes Mellitus (DM) / Type 2 Diabetes Mellitus1
1CompletedTreatmentHealthy Volunteers2
1CompletedTreatmentType 2 Diabetes Mellitus1
1CompletedTreatmentUnspecified Adult Solid Tumor, Protocol Specific1
1WithdrawnTreatmentCytomegalovirus Retinitis / Human Immunodeficiency Virus (HIV) Infections / Infections, Cytomegalovirus1
1, 2CompletedTreatmentPediatric Traumatic Brain Injury1
2CompletedTreatmentBMI >30 kg/m2 / Hyperuricemia / Pre-Hypertension1
2CompletedTreatmentCytomegalovirus Retinitis / Human Immunodeficiency Virus (HIV) Infections1
2CompletedTreatmentHeart Failure With Reduced Ejection Fraction (HFrEF)1
3RecruitingTreatmentAntibiotic Resistant Infection / Complicated skin infection bacterial / Complicated Urinary Tract Infections / Urinary Tract Infections (UTIs)1
3RecruitingTreatmentAntibiotic Resistant Infection / Complicated skin infection bacterial / Intra Abdominal Infections1
3RecruitingTreatmentAntibiotic Resistant Infection / Uncomplicated Urinary Tract Infections / Urinary Tract Infections (UTIs)1
4CompletedNot AvailableFlu caused by Influenza1
4CompletedTreatmentCytomegalovirus Retinitis / Human Immunodeficiency Virus (HIV) Infections1
Not AvailableCompletedBasic ScienceBlood Pressures / BMI >27 kg/m2 / BMI >30 kg/m2 / Endothelial Function / Renal Function1
Not AvailableCompletedTreatmentCytomegalovirus Retinitis / Human Immunodeficiency Virus (HIV) Infections2
Not AvailableCompletedTreatmentHuman Immunodeficiency Virus (HIV) Infections2
Not AvailableCompletedTreatmentHuman Immunodeficiency Virus (HIV) Infections / Progressive Multifocal Leukoencephalopathy1
Not AvailableCompletedTreatmentKidney Diseases1


Not Available
  • Atlantic Biologicals Corporation
  • Caremark LLC
  • Concord Labs
  • Dispensing Solutions
  • Kaiser Foundation Hospital
  • Lannett Co. Inc.
  • Major Pharmaceuticals
  • Murfreesboro Pharmaceutical Nursing Supply
  • Mylan
  • Nucare Pharmaceuticals Inc.
  • PD-Rx Pharmaceuticals Inc.
  • Pharmedix
  • Physicians Total Care Inc.
  • Prescript Pharmaceuticals
  • Rising Pharmaceuticals
  • Sandhills Packaging Inc.
  • Southwood Pharmaceuticals
  • Watson Pharmaceuticals
Dosage forms
TabletOral500 mg
Capsule; tabletOral
TabletOral500 mg/1
Tablet, film coatedOral500 mg/1
Unit descriptionCostUnit
Probenecid 500 mg tablet1.37USD tablet
Colchicine-Probenecid 0.5-500 mg tablet0.87USD tablet
Benuryl 500 mg Tablet0.21USD tablet
DrugBank does not sell nor buy drugs. Pricing information is supplied for informational purposes only.
Not Available


Experimental Properties
melting point (°C)195 °CPhysProp
water solubility27.1 mg/LNot Available
logP3.21HANSCH,C ET AL. (1995)
pKa3.4SANGSTER (1994)
Predicted Properties
Water Solubility0.425 mg/mLALOGPS
pKa (Strongest Acidic)3.53ChemAxon
Physiological Charge-1ChemAxon
Hydrogen Acceptor Count4ChemAxon
Hydrogen Donor Count1ChemAxon
Polar Surface Area74.68 Å2ChemAxon
Rotatable Bond Count6ChemAxon
Refractivity73.81 m3·mol-1ChemAxon
Polarizability29.96 Å3ChemAxon
Number of Rings1ChemAxon
Rule of FiveYesChemAxon
Ghose FilterYesChemAxon
Veber's RuleNoChemAxon
MDDR-like RuleNoChemAxon
Predicted ADMET features
Human Intestinal Absorption+0.9972
Blood Brain Barrier+0.5486
Caco-2 permeable-0.6074
P-glycoprotein substrateNon-substrate0.626
P-glycoprotein inhibitor INon-inhibitor0.8323
P-glycoprotein inhibitor IINon-inhibitor0.9121
Renal organic cation transporterNon-inhibitor0.8253
CYP450 2C9 substrateNon-substrate0.7012
CYP450 2D6 substrateNon-substrate0.9116
CYP450 3A4 substrateNon-substrate0.6485
CYP450 1A2 substrateNon-inhibitor0.9045
CYP450 2C9 inhibitorNon-inhibitor0.9071
CYP450 2D6 inhibitorNon-inhibitor0.9231
CYP450 2C19 inhibitorNon-inhibitor0.9025
CYP450 3A4 inhibitorNon-inhibitor0.8962
CYP450 inhibitory promiscuityLow CYP Inhibitory Promiscuity0.9318
Ames testNon AMES toxic0.9133
BiodegradationNot ready biodegradable0.863
Rat acute toxicity2.2821 LD50, mol/kg Not applicable
hERG inhibition (predictor I)Weak inhibitor0.8521
hERG inhibition (predictor II)Non-inhibitor0.7885
ADMET data is predicted using admetSAR, a free tool for evaluating chemical ADMET properties. (23092397)


Mass Spec (NIST)
Download (8.48 KB)
SpectrumSpectrum TypeSplash Key
Predicted GC-MS Spectrum - GC-MSPredicted GC-MSNot Available
Predicted MS/MS Spectrum - 10V, Positive (Annotated)Predicted LC-MS/MSNot Available
Predicted MS/MS Spectrum - 20V, Positive (Annotated)Predicted LC-MS/MSNot Available
Predicted MS/MS Spectrum - 40V, Positive (Annotated)Predicted LC-MS/MSNot Available
Predicted MS/MS Spectrum - 10V, Negative (Annotated)Predicted LC-MS/MSNot Available
Predicted MS/MS Spectrum - 20V, Negative (Annotated)Predicted LC-MS/MSNot Available
Predicted MS/MS Spectrum - 40V, Negative (Annotated)Predicted LC-MS/MSNot Available
LC-MS/MS Spectrum - LC-ESI-qTof , PositiveLC-MS/MSNot Available
LC-MS/MS Spectrum - LC-ESI-qTof , PositiveLC-MS/MSNot Available
MS/MS Spectrum - , positiveLC-MS/MSsplash10-0f76-0190000000-f6f2df3671a359ea4574
MS/MS Spectrum - , positiveLC-MS/MSsplash10-0f76-0190000000-ce053a8c64308bc3ebbb
MS/MS Spectrum - , positiveLC-MS/MSsplash10-0fen-3950100000-c43ebdb497f6a0e8c974


This compound belongs to the class of organic compounds known as benzenesulfonamides. These are organic compounds containing a sulfonamide group that is S-linked to a benzene ring.
Organic compounds
Super Class
Benzene and substituted derivatives
Sub Class
Direct Parent
Alternative Parents
Benzoic acids / Benzenesulfonyl compounds / Benzoyl derivatives / Organosulfonamides / Aminosulfonyl compounds / Monocarboxylic acids and derivatives / Carboxylic acids / Organopnictogen compounds / Organooxygen compounds / Organonitrogen compounds
show 2 more
Benzenesulfonamide / Benzoic acid or derivatives / Benzoic acid / Benzenesulfonyl group / Benzoyl / Organosulfonic acid amide / Organic sulfonic acid or derivatives / Aminosulfonyl compound / Sulfonyl / Organosulfonic acid or derivatives
show 12 more
Molecular Framework
Aromatic homomonocyclic compounds
External Descriptors
sulfonamide, benzoic acids (CHEBI:8426)


Pharmacological action
General Function
Sodium-independent organic anion transmembrane transporter activity
Specific Function
Involved in the renal elimination of endogenous and exogenous organic anions. Functions as organic anion exchanger when the uptake of one molecule of organic anion is coupled with an efflux of one ...
Gene Name
Uniprot ID
Uniprot Name
Solute carrier family 22 member 6
Molecular Weight
61815.78 Da
  1. Takeda M, Narikawa S, Hosoyamada M, Cha SH, Sekine T, Endou H: Characterization of organic anion transport inhibitors using cells stably expressing human organic anion transporters. Eur J Pharmacol. 2001 May 11;419(2-3):113-20. [PubMed:11426832]
  2. Jung KY, Takeda M, Kim DK, Tojo A, Narikawa S, Yoo BS, Hosoyamada M, Cha SH, Sekine T, Endou H: Characterization of ochratoxin A transport by human organic anion transporters. Life Sci. 2001 Sep 21;69(18):2123-35. [PubMed:11669456]
  3. Takeda M, Khamdang S, Narikawa S, Kimura H, Hosoyamada M, Cha SH, Sekine T, Endou H: Characterization of methotrexate transport and its drug interactions with human organic anion transporters. J Pharmacol Exp Ther. 2002 Aug;302(2):666-71. [PubMed:12130730]
  4. Hashimoto T, Narikawa S, Huang XL, Minematsu T, Usui T, Kamimura H, Endou H: Characterization of the renal tubular transport of zonampanel, a novel alpha-amino-3-hydroxy-5-methylisoxazole-4-propionic acid receptor antagonist, by human organic anion transporters. Drug Metab Dispos. 2004 Oct;32(10):1096-102. [PubMed:15377641]
  5. Chen X, Ji ZL, Chen YZ: TTD: Therapeutic Target Database. Nucleic Acids Res. 2002 Jan 1;30(1):412-5. [PubMed:11752352]
Pharmacological action
General Function
Sodium-independent organic anion transmembrane transporter activity
Specific Function
Mediates saturable uptake of estrone sulfate, dehydroepiandrosterone sulfate and related compounds.
Gene Name
Uniprot ID
Uniprot Name
Solute carrier family 22 member 11
Molecular Weight
59970.945 Da
  1. Enomoto A, Takeda M, Shimoda M, Narikawa S, Kobayashi Y, Kobayashi Y, Yamamoto T, Sekine T, Cha SH, Niwa T, Endou H: Interaction of human organic anion transporters 2 and 4 with organic anion transport inhibitors. J Pharmacol Exp Ther. 2002 Jun;301(3):797-802. [PubMed:12023506]
  2. Babu E, Takeda M, Narikawa S, Kobayashi Y, Enomoto A, Tojo A, Cha SH, Sekine T, Sakthisekaran D, Endou H: Role of human organic anion transporter 4 in the transport of ochratoxin A. Biochim Biophys Acta. 2002 Jun 12;1590(1-3):64-75. [PubMed:12063169]
  3. Takeda M, Khamdang S, Narikawa S, Kimura H, Hosoyamada M, Cha SH, Sekine T, Endou H: Characterization of methotrexate transport and its drug interactions with human organic anion transporters. J Pharmacol Exp Ther. 2002 Aug;302(2):666-71. [PubMed:12130730]
  4. Hashimoto T, Narikawa S, Huang XL, Minematsu T, Usui T, Kamimura H, Endou H: Characterization of the renal tubular transport of zonampanel, a novel alpha-amino-3-hydroxy-5-methylisoxazole-4-propionic acid receptor antagonist, by human organic anion transporters. Drug Metab Dispos. 2004 Oct;32(10):1096-102. [PubMed:15377641]
Pharmacological action
General Function
Sodium-independent organic anion transmembrane transporter activity
Specific Function
Plays an important role in the excretion/detoxification of endogenous and exogenous organic anions, especially from the brain and kidney. Involved in the transport basolateral of steviol, fexofenad...
Gene Name
Uniprot ID
Uniprot Name
Solute carrier family 22 member 8
Molecular Weight
59855.585 Da
  1. Kusuhara H, Sekine T, Utsunomiya-Tate N, Tsuda M, Kojima R, Cha SH, Sugiyama Y, Kanai Y, Endou H: Molecular cloning and characterization of a new multispecific organic anion transporter from rat brain. J Biol Chem. 1999 May 7;274(19):13675-80. [PubMed:10224140]
  2. Takeda M, Narikawa S, Hosoyamada M, Cha SH, Sekine T, Endou H: Characterization of organic anion transport inhibitors using cells stably expressing human organic anion transporters. Eur J Pharmacol. 2001 May 11;419(2-3):113-20. [PubMed:11426832]
  3. Jung KY, Takeda M, Kim DK, Tojo A, Narikawa S, Yoo BS, Hosoyamada M, Cha SH, Sekine T, Endou H: Characterization of ochratoxin A transport by human organic anion transporters. Life Sci. 2001 Sep 21;69(18):2123-35. [PubMed:11669456]
  4. Takeda M, Khamdang S, Narikawa S, Kimura H, Hosoyamada M, Cha SH, Sekine T, Endou H: Characterization of methotrexate transport and its drug interactions with human organic anion transporters. J Pharmacol Exp Ther. 2002 Aug;302(2):666-71. [PubMed:12130730]
  5. Sweet DH, Chan LM, Walden R, Yang XP, Miller DS, Pritchard JB: Organic anion transporter 3 (Slc22a8) is a dicarboxylate exchanger indirectly coupled to the Na+ gradient. Am J Physiol Renal Physiol. 2003 Apr;284(4):F763-9. Epub 2002 Dec 17. [PubMed:12488248]
  6. Berman HM, Westbrook J, Feng Z, Gilliland G, Bhat TN, Weissig H, Shindyalov IN, Bourne PE: The Protein Data Bank. Nucleic Acids Res. 2000 Jan 1;28(1):235-42. [PubMed:10592235]
Pharmacological action
General Function
Receptor binding
Specific Function
Structural component of the gap junctions and the hemichannels. May play a role as a Ca(2+)-leak channel to regulate ER Ca(2+) homeostasis.
Gene Name
Uniprot ID
Uniprot Name
Molecular Weight
48049.555 Da
  1. Silverman W, Locovei S, Dahl G: Probenecid, a gout remedy, inhibits pannexin 1 channels. Am J Physiol Cell Physiol. 2008 Sep;295(3):C761-7. doi: 10.1152/ajpcell.00227.2008. Epub 2008 Jul 2. [PubMed:18596212]
  2. Ransford GA, Fregien N, Qiu F, Dahl G, Conner GE, Salathe M: Pannexin 1 contributes to ATP release in airway epithelia. Am J Respir Cell Mol Biol. 2009 Nov;41(5):525-34. doi: 10.1165/rcmb.2008-0367OC. Epub 2009 Feb 12. [PubMed:19213873]
  3. Ma W, Hui H, Pelegrin P, Surprenant A: Pharmacological characterization of pannexin-1 currents expressed in mammalian cells. J Pharmacol Exp Ther. 2009 Feb;328(2):409-18. doi: 10.1124/jpet.108.146365. Epub 2008 Nov 20. [PubMed:19023039]
  4. Silverman WR, de Rivero Vaccari JP, Locovei S, Qiu F, Carlsson SK, Scemes E, Keane RW, Dahl G: The pannexin 1 channel activates the inflammasome in neurons and astrocytes. J Biol Chem. 2009 Jul 3;284(27):18143-51. doi: 10.1074/jbc.M109.004804. Epub 2009 May 5. [PubMed:19416975]
  5. Bunse S, Locovei S, Schmidt M, Qiu F, Zoidl G, Dahl G, Dermietzel R: The potassium channel subunit Kvbeta3 interacts with pannexin 1 and attenuates its sensitivity to changes in redox potentials. FEBS J. 2009 Nov;276(21):6258-70. doi: 10.1111/j.1742-4658.2009.07334.x. Epub 2009 Sep 24. [PubMed:19780818]
Pharmacological action
General Function
Gustducin-coupled receptor implicated in the perception of bitter compounds in the oral cavity and the gastrointestinal tract. Signals through PLCB2 and the calcium-regulated cation channel TRPM5.
Specific Function
Bitter taste receptor activity
Gene Name
Uniprot ID
Uniprot Name
Taste receptor type 2 member 16
Molecular Weight
33985.52 Da
  1. Greene TA, Alarcon S, Thomas A, Berdougo E, Doranz BJ, Breslin PA, Rucker JB: Probenecid inhibits the human bitter taste receptor TAS2R16 and suppresses bitter perception of salicin. PLoS One. 2011;6(5):e20123. doi: 10.1371/journal.pone.0020123. Epub 2011 May 24. [PubMed:21629661]


Pharmacological action
General Function
Steroid hydroxylase activity
Specific Function
Responsible for the metabolism of a number of therapeutic agents such as the anticonvulsant drug S-mephenytoin, omeprazole, proguanil, certain barbiturates, diazepam, propranolol, citalopram and im...
Gene Name
Uniprot ID
Uniprot Name
Cytochrome P450 2C19
Molecular Weight
55930.545 Da
  1. Preissner S, Kroll K, Dunkel M, Senger C, Goldsobel G, Kuzman D, Guenther S, Winnenburg R, Schroeder M, Preissner R: SuperCYP: a comprehensive database on Cytochrome P450 enzymes including a tool for analysis of CYP-drug interactions. Nucleic Acids Res. 2010 Jan;38(Database issue):D237-43. doi: 10.1093/nar/gkp970. Epub 2009 Nov 24. [PubMed:19934256]
  2. Runkel R, Mroszczak E, Chaplin M, Sevelius H, Segre E: Naproxen-probenecid interaction. Clin Pharmacol Ther. 1978 Dec;24(6):706-13. [PubMed:710028]
  3. Drug Interactions: Cytochrome P450 Drug Interaction Table [Link]
  4. CYP2C19 inhibitors document [File]
Pharmacological action
General Function
Steroid hydroxylase activity
Specific Function
Cytochromes P450 are a group of heme-thiolate monooxygenases. In liver microsomes, this enzyme is involved in an NADPH-dependent electron transport pathway. It oxidizes a variety of structurally un...
Gene Name
Uniprot ID
Uniprot Name
Cytochrome P450 2C8
Molecular Weight
55824.275 Da
  1. Preissner S, Kroll K, Dunkel M, Senger C, Goldsobel G, Kuzman D, Guenther S, Winnenburg R, Schroeder M, Preissner R: SuperCYP: a comprehensive database on Cytochrome P450 enzymes including a tool for analysis of CYP-drug interactions. Nucleic Acids Res. 2010 Jan;38(Database issue):D237-43. doi: 10.1093/nar/gkp970. Epub 2009 Nov 24. [PubMed:19934256]
  2. Kim KA, Oh SO, Park PW, Park JY: Effect of probenecid on the pharmacokinetics of carbamazepine in healthy subjects. Eur J Clin Pharmacol. 2005 Jun;61(4):275-80. Epub 2005 May 25. [PubMed:15915352]
Pharmacological action
General Function
Vitamin d3 25-hydroxylase activity
Specific Function
Cytochromes P450 are a group of heme-thiolate monooxygenases. In liver microsomes, this enzyme is involved in an NADPH-dependent electron transport pathway. It performs a variety of oxidation react...
Gene Name
Uniprot ID
Uniprot Name
Cytochrome P450 3A4
Molecular Weight
57342.67 Da
  1. Preissner S, Kroll K, Dunkel M, Senger C, Goldsobel G, Kuzman D, Guenther S, Winnenburg R, Schroeder M, Preissner R: SuperCYP: a comprehensive database on Cytochrome P450 enzymes including a tool for analysis of CYP-drug interactions. Nucleic Acids Res. 2010 Jan;38(Database issue):D237-43. doi: 10.1093/nar/gkp970. Epub 2009 Nov 24. [PubMed:19934256]
Pharmacological action
General Function
Steroid binding
Specific Function
UDPGT is of major importance in the conjugation and subsequent elimination of potentially toxic xenobiotics and endogenous compounds. This isoform glucuronidates bilirubin IX-alpha to form both the...
Gene Name
Uniprot ID
Uniprot Name
UDP-glucuronosyltransferase 1-1
Molecular Weight
59590.91 Da
  1. Uchaipichat V, Mackenzie PI, Guo XH, Gardner-Stephen D, Galetin A, Houston JB, Miners JO: Human udp-glucuronosyltransferases: isoform selectivity and kinetics of 4-methylumbelliferone and 1-naphthol glucuronidation, effects of organic solvents, and inhibition by diclofenac and probenecid. Drug Metab Dispos. 2004 Apr;32(4):413-23. doi: 10.1124/dmd.32.4.413. [PubMed:15039294]


Pharmacological action
General Function
Toxic substance binding
Specific Function
Serum albumin, the main protein of plasma, has a good binding capacity for water, Ca(2+), Na(+), K(+), fatty acids, hormones, bilirubin and drugs. Its main function is the regulation of the colloid...
Gene Name
Uniprot ID
Uniprot Name
Serum albumin
Molecular Weight
69365.94 Da
  1. Dundee JW, Halliday NJ, McMurray TJ: Aspirin and probenecid pretreatment influences the potency of thiopentone and the onset of action of midazolam. Eur J Anaesthesiol. 1986 May;3(3):247-51. [PubMed:3780693]
  2. Gewirtz DA, Holt SA: Protein binding as a component of drug interaction in cellular pharmacokinetic studies. Effects of probenecid on transport and accumulation of methotrexate in Ehrlich ascites tumor cells in vitro. Biochem Pharmacol. 1985 Mar 15;34(6):747-54. [PubMed:3977951]
  3. Hansen-Moller J, Schmit U: Rapid high-performance liquid chromatographic assay for the simultaneous determination of probenecid and its glucuronide in urine. Irreversible binding of probenecid to serum albumin. J Pharm Biomed Anal. 1991;9(1):65-73. [PubMed:2043725]


Pharmacological action
General Function
Quaternary ammonium group transmembrane transporter activity
Specific Function
Mediates tubular uptake of organic compounds from circulation. Mediates the influx of agmatine, dopamine, noradrenaline (norepinephrine), serotonin, choline, famotidine, ranitidine, histamin, creat...
Gene Name
Uniprot ID
Uniprot Name
Solute carrier family 22 member 2
Molecular Weight
62579.99 Da
  1. Arndt P, Volk C, Gorboulev V, Budiman T, Popp C, Ulzheimer-Teuber I, Akhoundova A, Koppatz S, Bamberg E, Nagel G, Koepsell H: Interaction of cations, anions, and weak base quinine with rat renal cation transporter rOCT2 compared with rOCT1. Am J Physiol Renal Physiol. 2001 Sep;281(3):F454-68. [PubMed:11502595]
Pharmacological action
General Function
Secondary active organic cation transmembrane transporter activity
Specific Function
Translocates a broad array of organic cations with various structures and molecular weights including the model compounds 1-methyl-4-phenylpyridinium (MPP), tetraethylammonium (TEA), N-1-methylnico...
Gene Name
Uniprot ID
Uniprot Name
Solute carrier family 22 member 1
Molecular Weight
61153.345 Da
  1. Arndt P, Volk C, Gorboulev V, Budiman T, Popp C, Ulzheimer-Teuber I, Akhoundova A, Koppatz S, Bamberg E, Nagel G, Koepsell H: Interaction of cations, anions, and weak base quinine with rat renal cation transporter rOCT2 compared with rOCT1. Am J Physiol Renal Physiol. 2001 Sep;281(3):F454-68. [PubMed:11502595]
  2. Yang X, Ma Z, Zhou S, Weng Y, Lei H, Zeng S, Li L, Jiang H: Multiple Drug Transporters Are Involved in Renal Secretion of Entecavir. Antimicrob Agents Chemother. 2016 Sep 23;60(10):6260-70. doi: 10.1128/AAC.00986-16. Print 2016 Oct. [PubMed:27503646]
Pharmacological action
General Function
Organic anion transmembrane transporter activity
Specific Function
May act as an inducible transporter in the biliary and intestinal excretion of organic anions. Acts as an alternative route for the export of bile acids and glucuronides from cholestatic hepatocyte...
Gene Name
Uniprot ID
Uniprot Name
Canalicular multispecific organic anion transporter 2
Molecular Weight
169341.14 Da
  1. Zelcer N, Saeki T, Reid G, Beijnen JH, Borst P: Characterization of drug transport by the human multidrug resistance protein 3 (ABCC3). J Biol Chem. 2001 Dec 7;276(49):46400-7. [PubMed:11581266]
  2. Zeng H, Chen ZS, Belinsky MG, Rea PA, Kruh GD: Transport of methotrexate (MTX) and folates by multidrug resistance protein (MRP) 3 and MRP1: effect of polyglutamylation on MTX transport. Cancer Res. 2001 Oct 1;61(19):7225-32. [PubMed:11585759]
  3. Zamek-Gliszczynski MJ, Xiong H, Patel NJ, Turncliff RZ, Pollack GM, Brouwer KL: Pharmacokinetics of 5 (and 6)-carboxy-2',7'-dichlorofluorescein and its diacetate promoiety in the liver. J Pharmacol Exp Ther. 2003 Feb;304(2):801-9. [PubMed:12538836]
Pharmacological action
General Function
Atpase activity, coupled to transmembrane movement of substances
Specific Function
May be an organic anion pump relevant to cellular detoxification.
Gene Name
Uniprot ID
Uniprot Name
Multidrug resistance-associated protein 4
Molecular Weight
149525.33 Da
  1. van Aubel RA, Smeets PH, Peters JG, Bindels RJ, Russel FG: The MRP4/ABCC4 gene encodes a novel apical organic anion transporter in human kidney proximal tubules: putative efflux pump for urinary cAMP and cGMP. J Am Soc Nephrol. 2002 Mar;13(3):595-603. [PubMed:11856762]
  2. Chen ZS, Lee K, Walther S, Raftogianis RB, Kuwano M, Zeng H, Kruh GD: Analysis of methotrexate and folate transport by multidrug resistance protein 4 (ABCC4): MRP4 is a component of the methotrexate efflux system. Cancer Res. 2002 Jun 1;62(11):3144-50. [PubMed:12036927]
  3. Rius M, Nies AT, Hummel-Eisenbeiss J, Jedlitschky G, Keppler D: Cotransport of reduced glutathione with bile salts by MRP4 (ABCC4) localized to the basolateral hepatocyte membrane. Hepatology. 2003 Aug;38(2):374-84. [PubMed:12883481]
Pharmacological action
General Function
Organic anion transmembrane transporter activity
Specific Function
Acts as a multispecific organic anion pump which can transport nucleotide analogs.
Gene Name
Uniprot ID
Uniprot Name
Multidrug resistance-associated protein 5
Molecular Weight
160658.8 Da
  1. Jedlitschky G, Burchell B, Keppler D: The multidrug resistance protein 5 functions as an ATP-dependent export pump for cyclic nucleotides. J Biol Chem. 2000 Sep 29;275(39):30069-74. [PubMed:10893247]
Pharmacological action
General Function
Symporter activity
Specific Function
Proton-coupled monocarboxylate transporter. Catalyzes the rapid transport across the plasma membrane of many monocarboxylates such as lactate, pyruvate, branched-chain oxo acids derived from leucin...
Gene Name
Uniprot ID
Uniprot Name
Monocarboxylate transporter 2
Molecular Weight
52199.745 Da
  1. Broer S, Broer A, Schneider HP, Stegen C, Halestrap AP, Deitmer JW: Characterization of the high-affinity monocarboxylate transporter MCT2 in Xenopus laevis oocytes. Biochem J. 1999 Aug 1;341 ( Pt 3):529-35. [PubMed:10417314]
Pharmacological action
General Function
Symporter activity
Specific Function
Sodium-ion dependent, high affinity carnitine transporter. Involved in the active cellular uptake of carnitine. Transports one sodium ion with one molecule of carnitine. Also transports organic cat...
Gene Name
Uniprot ID
Uniprot Name
Solute carrier family 22 member 5
Molecular Weight
62751.08 Da
  1. Ohashi R, Tamai I, Yabuuchi H, Nezu JI, Oku A, Sai Y, Shimane M, Tsuji A: Na(+)-dependent carnitine transport by organic cation transporter (OCTN2): its pharmacological and toxicological relevance. J Pharmacol Exp Ther. 1999 Nov;291(2):778-84. [PubMed:10525100]
Pharmacological action
General Function
Transporter activity
Specific Function
Isoform 1: May participate directly in the active transport of drugs into subcellular organelles or influence drug distribution indirectly. Transports glutathione conjugates as leukotriene-c4 (LTC4...
Gene Name
Uniprot ID
Uniprot Name
Multidrug resistance-associated protein 6
Molecular Weight
164904.81 Da
  1. Ilias A, Urban Z, Seidl TL, Le Saux O, Sinko E, Boyd CD, Sarkadi B, Varadi A: Loss of ATP-dependent transport activity in pseudoxanthoma elasticum-associated mutants of human ABCC6 (MRP6). J Biol Chem. 2002 May 10;277(19):16860-7. Epub 2002 Mar 5. [PubMed:11880368]
Pharmacological action
General Function
Transporter activity
Specific Function
Mediates export of organic anions and drugs from the cytoplasm. Mediates ATP-dependent transport of glutathione and glutathione conjugates, leukotriene C4, estradiol-17-beta-o-glucuronide, methotre...
Gene Name
Uniprot ID
Uniprot Name
Multidrug resistance-associated protein 1
Molecular Weight
171589.5 Da
  1. Hong J, Lambert JD, Lee SH, Sinko PJ, Yang CS: Involvement of multidrug resistance-associated proteins in regulating cellular levels of (-)-epigallocatechin-3-gallate and its methyl metabolites. Biochem Biophys Res Commun. 2003 Oct 10;310(1):222-7. [PubMed:14511674]
  2. Ilias A, Urban Z, Seidl TL, Le Saux O, Sinko E, Boyd CD, Sarkadi B, Varadi A: Loss of ATP-dependent transport activity in pseudoxanthoma elasticum-associated mutants of human ABCC6 (MRP6). J Biol Chem. 2002 May 10;277(19):16860-7. Epub 2002 Mar 5. [PubMed:11880368]
  3. Payen L, Delugin L, Courtois A, Trinquart Y, Guillouzo A, Fardel O: Reversal of MRP-mediated multidrug resistance in human lung cancer cells by the antiprogestatin drug RU486. Biochem Biophys Res Commun. 1999 May 19;258(3):513-8. [PubMed:10329417]
  4. Bakos E, Evers R, Sinko E, Varadi A, Borst P, Sarkadi B: Interactions of the human multidrug resistance proteins MRP1 and MRP2 with organic anions. Mol Pharmacol. 2000 Apr;57(4):760-8. [PubMed:10727523]
  5. Hooijberg JH, Broxterman HJ, Kool M, Assaraf YG, Peters GJ, Noordhuis P, Scheper RJ, Borst P, Pinedo HM, Jansen G: Antifolate resistance mediated by the multidrug resistance proteins MRP1 and MRP2. Cancer Res. 1999 Jun 1;59(11):2532-5. [PubMed:10363967]
  6. Legrand O, Simonin G, Beauchamp-Nicoud A, Zittoun R, Marie JP: Simultaneous activity of MRP1 and Pgp is correlated with in vitro resistance to daunorubicin and with in vivo resistance in adult acute myeloid leukemia. Blood. 1999 Aug 1;94(3):1046-56. [PubMed:10419897]
  7. Legrand O, Simonin G, Perrot JY, Zittoun R, Marie JP: Both Pgp and MRP1 activities using calcein-AM contribute to drug resistance in AML. Adv Exp Med Biol. 1999;457:161-75. [PubMed:10500791]
  8. Evers R, de Haas M, Sparidans R, Beijnen J, Wielinga PR, Lankelma J, Borst P: Vinblastine and sulfinpyrazone export by the multidrug resistance protein MRP2 is associated with glutathione export. Br J Cancer. 2000 Aug;83(3):375-83. [PubMed:10917554]
  9. Issandou M, Grand-Perret T: Multidrug resistance P-glycoprotein is not involved in cholesterol esterification. Biochem Biophys Res Commun. 2000 Dec 20;279(2):369-77. [PubMed:11118294]
  10. Gao J, Murase O, Schowen RL, Aube J, Borchardt RT: A functional assay for quantitation of the apparent affinities of ligands of P-glycoprotein in Caco-2 cells. Pharm Res. 2001 Feb;18(2):171-6. [PubMed:11405287]
Pharmacological action
General Function
Sodium-independent organic anion transmembrane transporter activity
Specific Function
Mediates the Na(+)-independent transport of organic anions such as sulfobromophthalein (BSP) and conjugated (taurocholate) and unconjugated (cholate) bile acids (By similarity). Selectively inhibit...
Gene Name
Uniprot ID
Uniprot Name
Solute carrier organic anion transporter family member 1A2
Molecular Weight
74144.105 Da
  1. Sugiyama D, Kusuhara H, Shitara Y, Abe T, Meier PJ, Sekine T, Endou H, Suzuki H, Sugiyama Y: Characterization of the efflux transport of 17beta-estradiol-D-17beta-glucuronide from the brain across the blood-brain barrier. J Pharmacol Exp Ther. 2001 Jul;298(1):316-22. [PubMed:11408557]
  2. Kullak-Ublick GA, Hagenbuch B, Stieger B, Wolkoff AW, Meier PJ: Functional characterization of the basolateral rat liver organic anion transporting polypeptide. Hepatology. 1994 Aug;20(2):411-6. [PubMed:8045503]
Pharmacological action
General Function
Symporter activity
Specific Function
Proton-coupled monocarboxylate transporter. Catalyzes the rapid transport across the plasma membrane of many monocarboxylates such as lactate, pyruvate, branched-chain oxo acids derived from leucin...
Gene Name
Uniprot ID
Uniprot Name
Monocarboxylate transporter 1
Molecular Weight
53943.685 Da
  1. Broer S, Broer A, Schneider HP, Stegen C, Halestrap AP, Deitmer JW: Characterization of the high-affinity monocarboxylate transporter MCT2 in Xenopus laevis oocytes. Biochem J. 1999 Aug 1;341 ( Pt 3):529-35. [PubMed:10417314]
Pharmacological action
General Function
Virus receptor activity
Specific Function
The hepatic sodium/bile acid uptake system exhibits broad substrate specificity and transports various non-bile acid organic compounds as well. It is strictly dependent on the extracellular presenc...
Gene Name
Uniprot ID
Uniprot Name
Sodium/bile acid cotransporter
Molecular Weight
38118.64 Da
  1. Hagenbuch B, Stieger B, Foguet M, Lubbert H, Meier PJ: Functional expression cloning and characterization of the hepatocyte Na+/bile acid cotransport system. Proc Natl Acad Sci U S A. 1991 Dec 1;88(23):10629-33. [PubMed:1961729]
Pharmacological action
General Function
Sodium-independent organic anion transmembrane transporter activity
Specific Function
Involved in the renal elimination of endogenous and exogenous organic anions. Functions as organic anion exchanger when the uptake of one molecule of organic anion is coupled with an efflux of one ...
Gene Name
Uniprot ID
Uniprot Name
Solute carrier family 22 member 6
Molecular Weight
61815.78 Da
  1. Cihlar T, Ho ES: Fluorescence-based assay for the interaction of small molecules with the human renal organic anion transporter 1. Anal Biochem. 2000 Jul 15;283(1):49-55. [PubMed:10929807]
  2. Mulato AS, Ho ES, Cihlar T: Nonsteroidal anti-inflammatory drugs efficiently reduce the transport and cytotoxicity of adefovir mediated by the human renal organic anion transporter 1. J Pharmacol Exp Ther. 2000 Oct;295(1):10-5. [PubMed:10991954]
  3. Takeda M, Narikawa S, Hosoyamada M, Cha SH, Sekine T, Endou H: Characterization of organic anion transport inhibitors using cells stably expressing human organic anion transporters. Eur J Pharmacol. 2001 May 11;419(2-3):113-20. [PubMed:11426832]
  4. Jung KY, Takeda M, Kim DK, Tojo A, Narikawa S, Yoo BS, Hosoyamada M, Cha SH, Sekine T, Endou H: Characterization of ochratoxin A transport by human organic anion transporters. Life Sci. 2001 Sep 21;69(18):2123-35. [PubMed:11669456]
  5. Ichida K, Hosoyamada M, Kimura H, Takeda M, Utsunomiya Y, Hosoya T, Endou H: Urate transport via human PAH transporter hOAT1 and its gene structure. Kidney Int. 2003 Jan;63(1):143-55. [PubMed:12472777]
  6. Takeda M, Khamdang S, Narikawa S, Kimura H, Hosoyamada M, Cha SH, Sekine T, Endou H: Characterization of methotrexate transport and its drug interactions with human organic anion transporters. J Pharmacol Exp Ther. 2002 Aug;302(2):666-71. [PubMed:12130730]
  7. Lu R, Chan BS, Schuster VL: Cloning of the human kidney PAH transporter: narrow substrate specificity and regulation by protein kinase C. Am J Physiol. 1999 Feb;276(2 Pt 2):F295-303. [PubMed:9950961]
  8. Race JE, Grassl SM, Williams WJ, Holtzman EJ: Molecular cloning and characterization of two novel human renal organic anion transporters (hOAT1 and hOAT3). Biochem Biophys Res Commun. 1999 Feb 16;255(2):508-14. [PubMed:10049739]
  9. Khamdang S, Takeda M, Shimoda M, Noshiro R, Narikawa S, Huang XL, Enomoto A, Piyachaturawat P, Endou H: Interactions of human- and rat-organic anion transporters with pravastatin and cimetidine. J Pharmacol Sci. 2004 Feb;94(2):197-202. [PubMed:14978359]
  10. Kuze K, Graves P, Leahy A, Wilson P, Stuhlmann H, You G: Heterologous expression and functional characterization of a mouse renal organic anion transporter in mammalian cells. J Biol Chem. 1999 Jan 15;274(3):1519-24. [PubMed:9880528]
  11. Uwai Y, Saito H, Inui K: Interaction between methotrexate and nonsteroidal anti-inflammatory drugs in organic anion transporter. Eur J Pharmacol. 2000 Dec 1;409(1):31-6. [PubMed:11099697]
  12. Tsuda M, Sekine T, Takeda M, Cha SH, Kanai Y, Kimura M, Endou H: Transport of ochratoxin A by renal multispecific organic anion transporter 1. J Pharmacol Exp Ther. 1999 Jun;289(3):1301-5. [PubMed:10336520]
  13. Takeda M, Tojo A, Sekine T, Hosoyamada M, Kanai Y, Endou H: Role of organic anion transporter 1 (OAT1) in cephaloridine (CER)-induced nephrotoxicity. Kidney Int. 1999 Dec;56(6):2128-36. [PubMed:10594788]
  14. Sugiyama D, Kusuhara H, Shitara Y, Abe T, Meier PJ, Sekine T, Endou H, Suzuki H, Sugiyama Y: Characterization of the efflux transport of 17beta-estradiol-D-17beta-glucuronide from the brain across the blood-brain barrier. J Pharmacol Exp Ther. 2001 Jul;298(1):316-22. [PubMed:11408557]
  15. Uwai Y, Iwamoto K: Transport of aminopterin by human organic anion transporters hOAT1 and hOAT3: Comparison with methotrexate. Drug Metab Pharmacokinet. 2010;25(2):163-9. [PubMed:20460822]
Pharmacological action
General Function
Sodium-independent organic anion transmembrane transporter activity
Specific Function
Not Available
Gene Name
Uniprot ID
Uniprot Name
Solute carrier family 22 member 10
Molecular Weight
60256.57 Da
  1. Youngblood GL, Sweet DH: Identification and functional assessment of the novel murine organic anion transporter Oat5 (Slc22a19) expressed in kidney. Am J Physiol Renal Physiol. 2004 Aug;287(2):F236-44. Epub 2004 Apr 6. [PubMed:15068970]
Pharmacological action
General Function
Sodium-independent organic anion transmembrane transporter activity
Specific Function
Plays an important role in the excretion/detoxification of endogenous and exogenous organic anions, especially from the brain and kidney. Involved in the transport basolateral of steviol, fexofenad...
Gene Name
Uniprot ID
Uniprot Name
Solute carrier family 22 member 8
Molecular Weight
59855.585 Da
  1. Cha SH, Sekine T, Fukushima JI, Kanai Y, Kobayashi Y, Goya T, Endou H: Identification and characterization of human organic anion transporter 3 expressing predominantly in the kidney. Mol Pharmacol. 2001 May;59(5):1277-86. [PubMed:11306713]
  2. Takeda M, Narikawa S, Hosoyamada M, Cha SH, Sekine T, Endou H: Characterization of organic anion transport inhibitors using cells stably expressing human organic anion transporters. Eur J Pharmacol. 2001 May 11;419(2-3):113-20. [PubMed:11426832]
  3. Jung KY, Takeda M, Kim DK, Tojo A, Narikawa S, Yoo BS, Hosoyamada M, Cha SH, Sekine T, Endou H: Characterization of ochratoxin A transport by human organic anion transporters. Life Sci. 2001 Sep 21;69(18):2123-35. [PubMed:11669456]
  4. Takeda M, Khamdang S, Narikawa S, Kimura H, Hosoyamada M, Cha SH, Sekine T, Endou H: Characterization of methotrexate transport and its drug interactions with human organic anion transporters. J Pharmacol Exp Ther. 2002 Aug;302(2):666-71. [PubMed:12130730]
  5. Khamdang S, Takeda M, Shimoda M, Noshiro R, Narikawa S, Huang XL, Enomoto A, Piyachaturawat P, Endou H: Interactions of human- and rat-organic anion transporters with pravastatin and cimetidine. J Pharmacol Sci. 2004 Feb;94(2):197-202. [PubMed:14978359]
  6. Ohtsuki S, Kikkawa T, Mori S, Hori S, Takanaga H, Otagiri M, Terasaki T: Mouse reduced in osteosclerosis transporter functions as an organic anion transporter 3 and is localized at abluminal membrane of blood-brain barrier. J Pharmacol Exp Ther. 2004 Jun;309(3):1273-81. Epub 2004 Feb 4. [PubMed:14762099]
  7. Mori S, Takanaga H, Ohtsuki S, Deguchi T, Kang YS, Hosoya K, Terasaki T: Rat organic anion transporter 3 (rOAT3) is responsible for brain-to-blood efflux of homovanillic acid at the abluminal membrane of brain capillary endothelial cells. J Cereb Blood Flow Metab. 2003 Apr;23(4):432-40. [PubMed:12679720]
  8. Kusuhara H, Sekine T, Utsunomiya-Tate N, Tsuda M, Kojima R, Cha SH, Sugiyama Y, Kanai Y, Endou H: Molecular cloning and characterization of a new multispecific organic anion transporter from rat brain. J Biol Chem. 1999 May 7;274(19):13675-80. [PubMed:10224140]
  9. Sugiyama D, Kusuhara H, Shitara Y, Abe T, Meier PJ, Sekine T, Endou H, Suzuki H, Sugiyama Y: Characterization of the efflux transport of 17beta-estradiol-D-17beta-glucuronide from the brain across the blood-brain barrier. J Pharmacol Exp Ther. 2001 Jul;298(1):316-22. [PubMed:11408557]
  10. Nagata Y, Kusuhara H, Endou H, Sugiyama Y: Expression and functional characterization of rat organic anion transporter 3 (rOat3) in the choroid plexus. Mol Pharmacol. 2002 May;61(5):982-8. [PubMed:11961115]
  11. Uwai Y, Iwamoto K: Transport of aminopterin by human organic anion transporters hOAT1 and hOAT3: Comparison with methotrexate. Drug Metab Pharmacokinet. 2010;25(2):163-9. [PubMed:20460822]
  12. Lai Y, Sampson KE, Balogh LM, Brayman TG, Cox SR, Adams WJ, Kumar V, Stevens JC: Preclinical and clinical evidence for the collaborative transport and renal secretion of an oxazolidinone antibiotic by organic anion transporter 3 (OAT3/SLC22A8) and multidrug and toxin extrusion protein 1 (MATE1/SLC47A1). J Pharmacol Exp Ther. 2010 Sep 1;334(3):936-44. doi: 10.1124/jpet.110.170753. Epub 2010 Jun 2. [PubMed:20519552]
Pharmacological action
General Function
Organic anion transmembrane transporter activity
Specific Function
Mediates hepatobiliary excretion of numerous organic anions. May function as a cellular cisplatin transporter.
Gene Name
Uniprot ID
Uniprot Name
Canalicular multispecific organic anion transporter 1
Molecular Weight
174205.64 Da
  1. Hong J, Lambert JD, Lee SH, Sinko PJ, Yang CS: Involvement of multidrug resistance-associated proteins in regulating cellular levels of (-)-epigallocatechin-3-gallate and its methyl metabolites. Biochem Biophys Res Commun. 2003 Oct 10;310(1):222-7. [PubMed:14511674]
  2. Ilias A, Urban Z, Seidl TL, Le Saux O, Sinko E, Boyd CD, Sarkadi B, Varadi A: Loss of ATP-dependent transport activity in pseudoxanthoma elasticum-associated mutants of human ABCC6 (MRP6). J Biol Chem. 2002 May 10;277(19):16860-7. Epub 2002 Mar 5. [PubMed:11880368]
  3. Bakos E, Evers R, Sinko E, Varadi A, Borst P, Sarkadi B: Interactions of the human multidrug resistance proteins MRP1 and MRP2 with organic anions. Mol Pharmacol. 2000 Apr;57(4):760-8. [PubMed:10727523]
  4. Horikawa M, Kato Y, Tyson CA, Sugiyama Y: The potential for an interaction between MRP2 (ABCC2) and various therapeutic agents: probenecid as a candidate inhibitor of the biliary excretion of irinotecan metabolites. Drug Metab Pharmacokinet. 2002;17(1):23-33. [PubMed:15618649]
  5. Zamek-Gliszczynski MJ, Xiong H, Patel NJ, Turncliff RZ, Pollack GM, Brouwer KL: Pharmacokinetics of 5 (and 6)-carboxy-2',7'-dichlorofluorescein and its diacetate promoiety in the liver. J Pharmacol Exp Ther. 2003 Feb;304(2):801-9. [PubMed:12538836]
  6. Dahan A, Sabit H, Amidon GL: The H2 receptor antagonist nizatidine is a P-glycoprotein substrate: characterization of its intestinal epithelial cell efflux transport. AAPS J. 2009 Jun;11(2):205-13. doi: 10.1208/s12248-009-9092-5. Epub 2009 Mar 25. [PubMed:19319690]
  7. Chen C, Scott D, Hanson E, Franco J, Berryman E, Volberg M, Liu X: Impact of Mrp2 on the biliary excretion and intestinal absorption of furosemide, probenecid, and methotrexate using Eisai hyperbilirubinemic rats. Pharm Res. 2003 Jan;20(1):31-7. [PubMed:12608533]
  8. Honda Y, Ushigome F, Koyabu N, Morimoto S, Shoyama Y, Uchiumi T, Kuwano M, Ohtani H, Sawada Y: Effects of grapefruit juice and orange juice components on P-glycoprotein- and MRP2-mediated drug efflux. Br J Pharmacol. 2004 Dec;143(7):856-64. Epub 2004 Oct 25. [PubMed:15504753]
  9. Minderman H, Brooks TA, O'Loughlin KL, Ojima I, Bernacki RJ, Baer MR: Broad-spectrum modulation of ATP-binding cassette transport proteins by the taxane derivatives ortataxel (IDN-5109, BAY 59-8862) and tRA96023. Cancer Chemother Pharmacol. 2004 May;53(5):363-9. Epub 2004 Jan 27. [PubMed:15060738]
Pharmacological action
General Function
Purine nucleotide transmembrane transporter activity
Specific Function
Participates in physiological processes involving bile acids, conjugated steroids and cyclic nucleotides. Enhances the cellular extrusion of cAMP and cGMP. Stimulates the ATP-dependent uptake of a ...
Gene Name
Uniprot ID
Uniprot Name
ATP-binding cassette sub-family C member 11
Molecular Weight
154299.625 Da
  1. Chen ZS, Guo Y, Belinsky MG, Kotova E, Kruh GD: Transport of bile acids, sulfated steroids, estradiol 17-beta-D-glucuronide, and leukotriene C4 by human multidrug resistance protein 8 (ABCC11). Mol Pharmacol. 2005 Feb;67(2):545-57. Epub 2004 Nov 10. [PubMed:15537867]
Pharmacological action
General Function
Sodium-independent organic anion transmembrane transporter activity
Specific Function
Mediates saturable uptake of estrone sulfate, dehydroepiandrosterone sulfate and related compounds.
Gene Name
Uniprot ID
Uniprot Name
Solute carrier family 22 member 11
Molecular Weight
59970.945 Da
  1. Enomoto A, Takeda M, Shimoda M, Narikawa S, Kobayashi Y, Kobayashi Y, Yamamoto T, Sekine T, Cha SH, Niwa T, Endou H: Interaction of human organic anion transporters 2 and 4 with organic anion transport inhibitors. J Pharmacol Exp Ther. 2002 Jun;301(3):797-802. [PubMed:12023506]
  2. Babu E, Takeda M, Narikawa S, Kobayashi Y, Enomoto A, Tojo A, Cha SH, Sekine T, Sakthisekaran D, Endou H: Role of human organic anion transporter 4 in the transport of ochratoxin A. Biochim Biophys Acta. 2002 Jun 12;1590(1-3):64-75. [PubMed:12063169]
  3. Takeda M, Khamdang S, Narikawa S, Kimura H, Hosoyamada M, Cha SH, Sekine T, Endou H: Characterization of methotrexate transport and its drug interactions with human organic anion transporters. J Pharmacol Exp Ther. 2002 Aug;302(2):666-71. [PubMed:12130730]
  4. Khamdang S, Takeda M, Shimoda M, Noshiro R, Narikawa S, Huang XL, Enomoto A, Piyachaturawat P, Endou H: Interactions of human- and rat-organic anion transporters with pravastatin and cimetidine. J Pharmacol Sci. 2004 Feb;94(2):197-202. [PubMed:14978359]
Pharmacological action
General Function
Thyroid hormone transmembrane transporter activity
Specific Function
Mediates the Na(+)-independent high affinity transport of organic anions such as the thyroid hormones thyroxine (T4) and rT3. Other potential substrates, such as triiodothyronine (T3), 17-beta-gluc...
Gene Name
Uniprot ID
Uniprot Name
Solute carrier organic anion transporter family member 1C1
Molecular Weight
78695.625 Da
  1. Tohyama K, Kusuhara H, Sugiyama Y: Involvement of multispecific organic anion transporter, Oatp14 (Slc21a14), in the transport of thyroxine across the blood-brain barrier. Endocrinology. 2004 Sep;145(9):4384-91. Epub 2004 May 27. [PubMed:15166123]
Pharmacological action
General Function
Sodium-independent organic anion transmembrane transporter activity
Specific Function
Mediates sodium-independent multispecific organic anion transport. Transport of prostaglandin E2, prostaglandin F2, tetracycline, bumetanide, estrone sulfate, glutarate, dehydroepiandrosterone sulf...
Gene Name
Uniprot ID
Uniprot Name
Solute carrier family 22 member 7
Molecular Weight
60025.025 Da
  1. Enomoto A, Takeda M, Shimoda M, Narikawa S, Kobayashi Y, Kobayashi Y, Yamamoto T, Sekine T, Cha SH, Niwa T, Endou H: Interaction of human organic anion transporters 2 and 4 with organic anion transport inhibitors. J Pharmacol Exp Ther. 2002 Jun;301(3):797-802. [PubMed:12023506]
  2. Khamdang S, Takeda M, Shimoda M, Noshiro R, Narikawa S, Huang XL, Enomoto A, Piyachaturawat P, Endou H: Interactions of human- and rat-organic anion transporters with pravastatin and cimetidine. J Pharmacol Sci. 2004 Feb;94(2):197-202. [PubMed:14978359]
Pharmacological action
General Function
Urate transmembrane transporter activity
Specific Function
Required for efficient urate re-absorption in the kidney. Regulates blood urate levels. Mediates saturable urate uptake by facilitating the exchange of urate against organic anions.
Gene Name
Uniprot ID
Uniprot Name
Solute carrier family 22 member 12
Molecular Weight
59629.57 Da
  1. Shin HJ, Takeda M, Enomoto A, Fujimura M, Miyazaki H, Anzai N, Endou H: Interactions of urate transporter URAT1 in human kidney with uricosuric drugs. Nephrology (Carlton). 2011 Feb;16(2):156-62. doi: 10.1111/j.1440-1797.2010.01368.x. [PubMed:21272127]
Pharmacological action
General Function
Sugar:proton symporter activity
Specific Function
Transport urate and fructose. May have a role in the urate reabsorption by proximal tubules. Also transports glucose at low rate.
Gene Name
Uniprot ID
Uniprot Name
Solute carrier family 2, facilitated glucose transporter member 9
Molecular Weight
58701.205 Da
  1. Link [Link]

Drug created on June 13, 2005 07:24 / Updated on December 18, 2018 11:07