Accession NumberDB01032  (APRD00167)
TypeSmall Molecule

The prototypical uricosuric agent. It inhibits the renal excretion of organic anions and reduces tubular reabsorption of urate. Probenecid has also been used to treat patients with renal impairment, and, because it reduces the renal tubular excretion of other drugs, has been used as an adjunct to antibacterial therapy. [PubChem]

4-((Dipropylamino)sulfonyl)benzoic acid
P-(Dipropylsulfamoyl)benzoic acid
Probenecid acid
External IDs HC 5006 / NSC-18786
Product Ingredients Not Available
Product Images
Approved Prescription Products
NameDosageStrengthRouteLabellerMarketing StartMarketing End
Benemid Tab 500mgTablet500 mgOralMerck Frosst Canada & Cie, Merck Frosst Canada & Co.1952-12-312000-08-03Canada
BenurylTablet500 mgOralValeant Canada Lp Valeant Canada S.E.C.1974-12-312016-07-08Canada
Approved Generic Prescription Products
NameDosageStrengthRouteLabellerMarketing StartMarketing End
ProbenecidTablet, film coated500 mg/1OralMylan Pharmaceuticals1976-01-13Not applicableUs
ProbenecidTablet, film coated500 mg/1OralAphena Pharma Solutions Tennessee, Inc.1976-01-13Not applicableUs
ProbenecidTablet, film coated500 mg/1OralHHS/Program Support Center/Supply Service Center1983-07-01Not applicableUs
ProbenecidTablet, film coated500 mg/1OralAmerincan Health Packaging2015-03-31Not applicableUs
ProbenecidTablet, film coated500 mg/1OralWatson Pharmaceuticals1983-07-01Not applicableUs
ProbenecidTablet500 mg/1OralWestminster2016-07-28Not applicableUs
ProbenecidTablet, film coated500 mg/1OralAphena Pharma Solutions Tennessee, Inc.1976-07-29Not applicableUs
ProbenecidTablet, film coated500 mg/1OralCarilion Materials Management1976-01-13Not applicableUs
ProbenecidTablet, film coated500 mg/1OralLannett Company, Inc.1976-07-29Not applicableUs
ProbenecidTablet, film coated500 mg/1OralMarlex Pharmaceuticals Inc1976-07-29Not applicableUs
ProbenecidTablet, film coated500 mg/1OralPhysicians Total Care, Inc.1995-03-28Not applicableUs00591 5347 01 nlmimage10 260e1360
Approved Over the Counter ProductsNot Available
Unapproved/Other Products Not Available
International Brands
BenecidNot Available
BenemidNot Available
ProbalanNot Available
ProbecidNot Available
ProbenNot Available
Brand mixtures
NameIngredientsDosageRouteLabellerMarketing StartMarketing End
Pro Biosan KitCapsule; TabletOralIcn Pharmaceuticals1979-12-311998-08-13Canada
Probenecid and ColchicineTabletOralWatson Pharmaceuticals1982-10-01Not applicableUs00591 5325 01 nlmimage10 240e1210
CAS number57-66-9
WeightAverage: 285.359
Monoisotopic: 285.103478791
Chemical FormulaC13H19NO4S
4-(dipropylsulfamoyl)benzoic acid

For the reduction of serum uric acid concentrations in chronic gouty arthritis and tophaceous gout in patients with frequent disabling gout attacks. Has also been effectively used to promote uric acid excretion in hyperuricemia secondary to the administration of thiazide and related diuretics.

Structured Indications

Probenecid is a uricosuric and renal tubular blocking agent and is used in combination with colchicine to treat chronic gouty arthritis when complicated by frequent, recurrent acute attacks of gout. It inhibits the reabsorption of urate at the proximal convoluted tubule, thus increasing the urinary excretion of uric acid and decreasing serum urate levels. Effective uricosuria reduces the miscible urate pool, retards urate deposition, and promotes resorption of urate deposits. At the proximal and distal tubles, probenecid competitively inhibits the secretion of many weak organic acids including penicillins, most cephalosporins, and some other β-lactam antibiotics. This results in an increase in the plasma concentrations of acidic drugs eliminated principally by renal secretion, but only a slight increase if the drug is eliminated mainly by filtration. Thus, the drug can be used for therapeutic advantages to increase concentrations of certain β-lactam antibiotics in the treatment of gonorrhea, neurosyphilis, or pelvic inflammatory disease (PID).

Mechanism of action

Probenecid inhibits the tubular reabsorption of urate, thus increasing the urinary excretion of uric acid and decreasing serum urate levels. Probenecid may also reduce plasma binding of urate and inhibit renal secretion of uric acid at subtherapeutic concentrations. The mechanism by which probenecid inhibits renal tubular transport is not known, but the drug may inhibit transport enzymes that require a source of high energy phosphate bonds and/or nonspecifically interfere with substrate access to protein receptor sites on the kidney tubules.

TargetKindPharmacological actionActionsOrganismUniProt ID
Solute carrier family 22 member 6Proteinyes
HumanQ4U2R8 details
Solute carrier family 22 member 11Proteinyes
HumanQ9NSA0 details
Solute carrier family 22 member 8Proteinyes
HumanQ8TCC7 details
HumanQ96RD7 details
Taste receptor type 2 member 16ProteinunknownNot AvailableHumanQ9NYV7 details
Related Articles
AbsorptionNot Available
Volume of distributionNot Available
Protein binding


MetabolismNot Available
Route of elimination

Excreted principally in the urine as monoacyl glucuronide and unchanged drug. Alkalinization of urine increases renal probenecid excretion.

Half life

6-12 hours

ClearanceNot Available
ToxicityNot Available
Affected organisms
  • Humans and other mammals
PathwaysNot Available
Pharmacogenomic Effects/ADRs
Interacting Gene/EnzymeAllele nameGenotype(s)Defining Change(s)Type(s)DescriptionDetails
Glucose-6-phosphate 1-dehydrogenaseVilleurbanneNot Available1000_1002delACCADR InferredIncreased risk of aplastic anemia, leukopenia and hemolytic anemia. Details
Glucose-6-phosphate 1-dehydrogenaseTorunNot Available1006A->GADR InferredIncreased risk of aplastic anemia, leukopenia and hemolytic anemia. Details
Glucose-6-phosphate 1-dehydrogenaseSunderlandNot Available105_107delCATADR InferredIncreased risk of aplastic anemia, leukopenia and hemolytic anemia. Details
Glucose-6-phosphate 1-dehydrogenaseIwatsukiNot Available1081G->AADR InferredIncreased risk of aplastic anemia, leukopenia and hemolytic anemia. Details
Glucose-6-phosphate 1-dehydrogenaseSerresNot Available1082C->TADR InferredIncreased risk of aplastic anemia, leukopenia and hemolytic anemia. Details
Glucose-6-phosphate 1-dehydrogenaseTondelaNot Available1084_1101delCTGAACGAGCGCAAGGCCADR InferredIncreased risk of aplastic anemia, leukopenia and hemolytic anemia. Details
Glucose-6-phosphate 1-dehydrogenaseLoma LindaNot Available1089C->AADR InferredIncreased risk of aplastic anemia, leukopenia and hemolytic anemia. Details
Glucose-6-phosphate 1-dehydrogenaseAachenNot Available1089C->GADR InferredIncreased risk of aplastic anemia, leukopenia and hemolytic anemia. Details
Glucose-6-phosphate 1-dehydrogenaseTenriNot Available1096A->GADR InferredIncreased risk of aplastic anemia, leukopenia and hemolytic anemia. Details
Glucose-6-phosphate 1-dehydrogenaseMontpellierNot Available1132G>AADR InferredIncreased risk of aplastic anemia, leukopenia and hemolytic anemia. Details
Glucose-6-phosphate 1-dehydrogenaseCalvo MackennaNot Available1138A->GADR InferredIncreased risk of aplastic anemia, leukopenia and hemolytic anemia. Details
Glucose-6-phosphate 1-dehydrogenaseRileyNot Available1139T->CADR InferredIncreased risk of aplastic anemia, leukopenia and hemolytic anemia. Details
Glucose-6-phosphate 1-dehydrogenaseOlomoucNot Available1141T->CADR InferredIncreased risk of aplastic anemia, leukopenia and hemolytic anemia. Details
Glucose-6-phosphate 1-dehydrogenaseTomahNot Available1153T->CADR InferredIncreased risk of aplastic anemia, leukopenia and hemolytic anemia. Details
Glucose-6-phosphate 1-dehydrogenaseLynwoodNot Available1154G->TADR InferredIncreased risk of aplastic anemia, leukopenia and hemolytic anemia. Details
Glucose-6-phosphate 1-dehydrogenaseMadridNot Available1155C->GADR InferredIncreased risk of aplastic anemia, leukopenia and hemolytic anemia. Details
Glucose-6-phosphate 1-dehydrogenaseIowa, Walter Reed, SpringfieldNot Available1156A->GADR InferredIncreased risk of aplastic anemia, leukopenia and hemolytic anemia. Details
Glucose-6-phosphate 1-dehydrogenaseBeverly Hills, Genova, Iwate, Niigata, YamaguchiNot Available1160G->AADR InferredIncreased risk of aplastic anemia, leukopenia and hemolytic anemia. Details
Glucose-6-phosphate 1-dehydrogenaseHartfordNot Available1162A->GADR InferredIncreased risk of aplastic anemia, leukopenia and hemolytic anemia. Details
Glucose-6-phosphate 1-dehydrogenasePrahaNot Available1166A->GADR InferredIncreased risk of aplastic anemia, leukopenia and hemolytic anemia. Details
Glucose-6-phosphate 1-dehydrogenaseKrakowNot Available1175T>CADR InferredIncreased risk of aplastic anemia, leukopenia and hemolytic anemia. Details
Glucose-6-phosphate 1-dehydrogenaseWisconsinNot Available1177C->GADR InferredIncreased risk of aplastic anemia, leukopenia and hemolytic anemia. Details
Glucose-6-phosphate 1-dehydrogenaseNashville, Anaheim, PorticiNot Available1178G->AADR InferredIncreased risk of aplastic anemia, leukopenia and hemolytic anemia. Details
Glucose-6-phosphate 1-dehydrogenaseAlhambraNot Available1180G->CADR InferredIncreased risk of aplastic anemia, leukopenia and hemolytic anemia. Details
Glucose-6-phosphate 1-dehydrogenaseBariNot Available1187C->TADR InferredIncreased risk of aplastic anemia, leukopenia and hemolytic anemia. Details
Glucose-6-phosphate 1-dehydrogenasePuerto LimonNot Available1192G->AADR InferredIncreased risk of aplastic anemia, leukopenia and hemolytic anemia. Details
Glucose-6-phosphate 1-dehydrogenaseCovao do LoboNot Available1205C>AADR InferredIncreased risk of aplastic anemia, leukopenia and hemolytic anemia. Details
Glucose-6-phosphate 1-dehydrogenaseClinicNot Available1215G->AADR InferredIncreased risk of aplastic anemia, leukopenia and hemolytic anemia. Details
Glucose-6-phosphate 1-dehydrogenaseUtrechtNot Available1225C->TADR InferredIncreased risk of aplastic anemia, leukopenia and hemolytic anemia. Details
Glucose-6-phosphate 1-dehydrogenaseSuwalkiNot Available1226C->GADR InferredIncreased risk of aplastic anemia, leukopenia and hemolytic anemia. Details
Glucose-6-phosphate 1-dehydrogenaseRiversideNot Available1228G->TADR InferredIncreased risk of aplastic anemia, leukopenia and hemolytic anemia. Details
Glucose-6-phosphate 1-dehydrogenaseJapan, ShinagawaNot Available1229G->AADR InferredIncreased risk of aplastic anemia, leukopenia and hemolytic anemia. Details
Glucose-6-phosphate 1-dehydrogenaseKawasakiNot Available1229G->CADR InferredIncreased risk of aplastic anemia, leukopenia and hemolytic anemia. Details
Glucose-6-phosphate 1-dehydrogenaseMunichNot Available1231A->GADR InferredIncreased risk of aplastic anemia, leukopenia and hemolytic anemia. Details
Glucose-6-phosphate 1-dehydrogenaseGeorgiaNot Available1284C->AADR InferredIncreased risk of aplastic anemia, leukopenia and hemolytic anemia. Details
Glucose-6-phosphate 1-dehydrogenaseSumareNot Available1292T->GADR InferredIncreased risk of aplastic anemia, leukopenia and hemolytic anemia. Details
Glucose-6-phosphate 1-dehydrogenaseTelti/KobeNot Available1318C->TADR InferredIncreased risk of aplastic anemia, leukopenia and hemolytic anemia. Details
Glucose-6-phosphate 1-dehydrogenaseSantiago de Cuba, MoriokaNot Available1339G->AADR InferredIncreased risk of aplastic anemia, leukopenia and hemolytic anemia. Details
Glucose-6-phosphate 1-dehydrogenaseHarimaNot Available1358T->AADR InferredIncreased risk of aplastic anemia, leukopenia and hemolytic anemia. Details
Glucose-6-phosphate 1-dehydrogenaseFiguera da FozNot Available1366G->CADR InferredIncreased risk of aplastic anemia, leukopenia and hemolytic anemia. Details
Glucose-6-phosphate 1-dehydrogenaseAmiensNot Available1367A>TADR InferredIncreased risk of aplastic anemia, leukopenia and hemolytic anemia. Details
Glucose-6-phosphate 1-dehydrogenaseBangkok NoiNot Available1376G->T, 1502T->GADR InferredIncreased risk of aplastic anemia, leukopenia and hemolytic anemia. Details
Glucose-6-phosphate 1-dehydrogenaseFukayaNot Available1462G->AADR InferredIncreased risk of aplastic anemia, leukopenia and hemolytic anemia. Details
Glucose-6-phosphate 1-dehydrogenaseCampinasNot Available1463G->TADR InferredIncreased risk of aplastic anemia, leukopenia and hemolytic anemia. Details
Glucose-6-phosphate 1-dehydrogenaseBuenos AiresNot Available1465C>TADR InferredIncreased risk of aplastic anemia, leukopenia and hemolytic anemia. Details
Glucose-6-phosphate 1-dehydrogenaseArakawaNot Available1466C->TADR InferredIncreased risk of aplastic anemia, leukopenia and hemolytic anemia. Details
Glucose-6-phosphate 1-dehydrogenaseBrightonNot Available1488_1490delGAAADR InferredIncreased risk of aplastic anemia, leukopenia and hemolytic anemia. Details
Glucose-6-phosphate 1-dehydrogenaseKozukataNot Available159G->CADR InferredIncreased risk of aplastic anemia, leukopenia and hemolytic anemia. Details
Glucose-6-phosphate 1-dehydrogenaseAmsterdamNot Available180_182delTCTADR InferredIncreased risk of aplastic anemia, leukopenia and hemolytic anemia. Details
Glucose-6-phosphate 1-dehydrogenaseNo nameNot Available202G->A, 376A->G, 1264C>GADR InferredIncreased risk of aplastic anemia, leukopenia and hemolytic anemia. Details
Glucose-6-phosphate 1-dehydrogenaseSwanseaNot Available224T->CADR InferredIncreased risk of aplastic anemia, leukopenia and hemolytic anemia. Details
Glucose-6-phosphate 1-dehydrogenaseUrayasuNot Available281_283delAGAADR InferredIncreased risk of aplastic anemia, leukopenia and hemolytic anemia. Details
Glucose-6-phosphate 1-dehydrogenaseVancouverNot Available317C->G544C->T592C->TADR InferredIncreased risk of aplastic anemia, leukopenia and hemolytic anemia. Details
Glucose-6-phosphate 1-dehydrogenaseMt SinaiNot Available376A->G, 1159C->TADR InferredIncreased risk of aplastic anemia, leukopenia and hemolytic anemia. Details
Glucose-6-phosphate 1-dehydrogenasePlymouthNot Available488G->AADR InferredIncreased risk of aplastic anemia, leukopenia and hemolytic anemia. Details
Glucose-6-phosphate 1-dehydrogenaseVolendamNot Available514C->TADR InferredIncreased risk of aplastic anemia, leukopenia and hemolytic anemia. Details
Glucose-6-phosphate 1-dehydrogenaseShinshuNot Available527A->GADR InferredIncreased risk of aplastic anemia, leukopenia and hemolytic anemia. Details
Glucose-6-phosphate 1-dehydrogenaseChikugoNot Available535A->TADR InferredIncreased risk of aplastic anemia, leukopenia and hemolytic anemia. Details
Glucose-6-phosphate 1-dehydrogenaseTsukuiNot Available561_563delCTCADR InferredIncreased risk of aplastic anemia, leukopenia and hemolytic anemia. Details
Glucose-6-phosphate 1-dehydrogenasePedoplis-CkaroNot Available573C>GADR InferredIncreased risk of aplastic anemia, leukopenia and hemolytic anemia. Details
Glucose-6-phosphate 1-dehydrogenaseSantiagoNot Available593G->CADR InferredIncreased risk of aplastic anemia, leukopenia and hemolytic anemia. Details
Glucose-6-phosphate 1-dehydrogenaseMinnesota, Marion, Gastonia, LeJeuneNot Available637G->TADR InferredIncreased risk of aplastic anemia, leukopenia and hemolytic anemia. Details
Glucose-6-phosphate 1-dehydrogenaseCincinnatiNot Available637G->T, 1037A->TADR InferredIncreased risk of aplastic anemia, leukopenia and hemolytic anemia. Details
Glucose-6-phosphate 1-dehydrogenaseHarilaouNot Available648T->GADR InferredIncreased risk of aplastic anemia, leukopenia and hemolytic anemia. Details
Glucose-6-phosphate 1-dehydrogenaseNorth DallasNot Available683_685delACAADR InferredIncreased risk of aplastic anemia, leukopenia and hemolytic anemia. Details
Glucose-6-phosphate 1-dehydrogenaseAsahikawaNot Available695G->AADR InferredIncreased risk of aplastic anemia, leukopenia and hemolytic anemia. Details
Glucose-6-phosphate 1-dehydrogenaseDurhamNot Available713A->GADR InferredIncreased risk of aplastic anemia, leukopenia and hemolytic anemia. Details
Glucose-6-phosphate 1-dehydrogenaseStonybrookNot Available724_729delGGCACTADR InferredIncreased risk of aplastic anemia, leukopenia and hemolytic anemia. Details
Glucose-6-phosphate 1-dehydrogenaseWayneNot Available769C->GADR InferredIncreased risk of aplastic anemia, leukopenia and hemolytic anemia. Details
Glucose-6-phosphate 1-dehydrogenaseAveiroNot Available806G->AADR InferredIncreased risk of aplastic anemia, leukopenia and hemolytic anemia. Details
Glucose-6-phosphate 1-dehydrogenaseCleveland CorumNot Available820G->AADR InferredIncreased risk of aplastic anemia, leukopenia and hemolytic anemia. Details
Glucose-6-phosphate 1-dehydrogenaseLilleNot Available821A>TADR InferredIncreased risk of aplastic anemia, leukopenia and hemolytic anemia. Details
Glucose-6-phosphate 1-dehydrogenaseBangkokNot Available825G>CADR InferredIncreased risk of aplastic anemia, leukopenia and hemolytic anemia. Details
Glucose-6-phosphate 1-dehydrogenaseSugaoNot Available826C->TADR InferredIncreased risk of aplastic anemia, leukopenia and hemolytic anemia. Details
Glucose-6-phosphate 1-dehydrogenaseLa JollaNot Available832T->CADR InferredIncreased risk of aplastic anemia, leukopenia and hemolytic anemia. Details
Glucose-6-phosphate 1-dehydrogenaseWexhamNot Available833C->TADR InferredIncreased risk of aplastic anemia, leukopenia and hemolytic anemia. Details
Glucose-6-phosphate 1-dehydrogenasePiotrkowNot Available851T>CADR InferredIncreased risk of aplastic anemia, leukopenia and hemolytic anemia. Details
Glucose-6-phosphate 1-dehydrogenaseWest VirginiaNot Available910G->TADR InferredIncreased risk of aplastic anemia, leukopenia and hemolytic anemia. Details
Glucose-6-phosphate 1-dehydrogenaseOmiyaNot Available921G->CADR InferredIncreased risk of aplastic anemia, leukopenia and hemolytic anemia. Details
Glucose-6-phosphate 1-dehydrogenaseNaraNot Available953_976delCCACCAAAGGGTACCTGGAC GACCADR InferredIncreased risk of aplastic anemia, leukopenia and hemolytic anemia. Details
Glucose-6-phosphate 1-dehydrogenaseManhattanNot Available962G->AADR InferredIncreased risk of aplastic anemia, leukopenia and hemolytic anemia. Details
Glucose-6-phosphate 1-dehydrogenaseRehevotNot Available964T->CADR InferredIncreased risk of aplastic anemia, leukopenia and hemolytic anemia. Details
Glucose-6-phosphate 1-dehydrogenaseHoniaraNot Available99A->G / 1360C->TADR InferredIncreased risk of aplastic anemia, leukopenia and hemolytic anemia. Details
Glucose-6-phosphate 1-dehydrogenaseTokyo, FukushimaNot Available1246G->AADR InferredIncreased risk of aplastic anemia, leukopenia and hemolytic anemia. Details
Glucose-6-phosphate 1-dehydrogenaseChathamNot Available1003G->AADR InferredIncreased risk of aplastic anemia, leukopenia and hemolytic anemia. Details
Glucose-6-phosphate 1-dehydrogenaseFushanNot Available1004C->AADR InferredIncreased risk of aplastic anemia, leukopenia and hemolytic anemia. Details
Glucose-6-phosphate 1-dehydrogenasePartenopeNot Available1052G->TADR InferredIncreased risk of aplastic anemia, leukopenia and hemolytic anemia. Details
Glucose-6-phosphate 1-dehydrogenaseIerapetraNot Available1057C->TADR InferredIncreased risk of aplastic anemia, leukopenia and hemolytic anemia. Details
Glucose-6-phosphate 1-dehydrogenaseAnadiaNot Available1193A->GADR InferredIncreased risk of aplastic anemia, leukopenia and hemolytic anemia. Details
Glucose-6-phosphate 1-dehydrogenaseAbenoNot Available1220A->CADR InferredIncreased risk of aplastic anemia, leukopenia and hemolytic anemia. Details
Glucose-6-phosphate 1-dehydrogenaseSurabayaNot Available1291G->AADR InferredIncreased risk of aplastic anemia, leukopenia and hemolytic anemia. Details
Glucose-6-phosphate 1-dehydrogenasePawneeNot Available1316G->CADR InferredIncreased risk of aplastic anemia, leukopenia and hemolytic anemia. Details
Glucose-6-phosphate 1-dehydrogenaseS. AntiocoNot Available1342A->GADR InferredIncreased risk of aplastic anemia, leukopenia and hemolytic anemia. Details
Glucose-6-phosphate 1-dehydrogenaseCassanoNot Available1347G->CADR InferredIncreased risk of aplastic anemia, leukopenia and hemolytic anemia. Details
Glucose-6-phosphate 1-dehydrogenaseHermoupolisNot Available1347G->C / 1360C->TADR InferredIncreased risk of aplastic anemia, leukopenia and hemolytic anemia. Details
Glucose-6-phosphate 1-dehydrogenaseUnion,Maewo, Chinese-2, KaloNot Available1360C->TADR InferredIncreased risk of aplastic anemia, leukopenia and hemolytic anemia. Details
Glucose-6-phosphate 1-dehydrogenaseAndalusNot Available1361G->AADR InferredIncreased risk of aplastic anemia, leukopenia and hemolytic anemia. Details
Glucose-6-phosphate 1-dehydrogenaseCosenzaNot Available1376G->CADR InferredIncreased risk of aplastic anemia, leukopenia and hemolytic anemia. Details
Glucose-6-phosphate 1-dehydrogenaseCanton, Taiwan- Hakka, Gifu-like, Agrigento-likeNot Available1376G->TADR InferredIncreased risk of aplastic anemia, leukopenia and hemolytic anemia. Details
Glucose-6-phosphate 1-dehydrogenaseFloresNot Available1387C->AADR InferredIncreased risk of aplastic anemia, leukopenia and hemolytic anemia. Details
Glucose-6-phosphate 1-dehydrogenaseKaiping, Anant, Dhon, Sapporo-like, WoseraNot Available1388G->AADR InferredIncreased risk of aplastic anemia, leukopenia and hemolytic anemia. Details
Glucose-6-phosphate 1-dehydrogenaseKamogawaNot Available169C->TADR InferredIncreased risk of aplastic anemia, leukopenia and hemolytic anemia. Details
Glucose-6-phosphate 1-dehydrogenaseCostanzoNot Available179T>CADR InferredIncreased risk of aplastic anemia, leukopenia and hemolytic anemia. Details
Glucose-6-phosphate 1-dehydrogenaseAmazoniaNot Available185C->AADR InferredIncreased risk of aplastic anemia, leukopenia and hemolytic anemia. Details
Glucose-6-phosphate 1-dehydrogenaseSongklanagarindNot Available196T->AADR InferredIncreased risk of aplastic anemia, leukopenia and hemolytic anemia. Details
Glucose-6-phosphate 1-dehydrogenaseHechiNot Available202G->A / 871G->AADR InferredIncreased risk of aplastic anemia, leukopenia and hemolytic anemia. Details
Glucose-6-phosphate 1-dehydrogenaseNamouruNot Available208T->CADR InferredIncreased risk of aplastic anemia, leukopenia and hemolytic anemia. Details
Glucose-6-phosphate 1-dehydrogenaseBao LocNot Available352T>CADR InferredIncreased risk of aplastic anemia, leukopenia and hemolytic anemia. Details
Glucose-6-phosphate 1-dehydrogenaseCrispimNot Available375G->T, 379G->T383T->C384C>TADR InferredIncreased risk of aplastic anemia, leukopenia and hemolytic anemia. Details
Glucose-6-phosphate 1-dehydrogenaseAcrokorinthosNot Available376A->G / 463C->GADR InferredIncreased risk of aplastic anemia, leukopenia and hemolytic anemia. Details
Glucose-6-phosphate 1-dehydrogenaseSanta MariaNot Available376A->G / 542A->TADR InferredIncreased risk of aplastic anemia, leukopenia and hemolytic anemia. Details
Glucose-6-phosphate 1-dehydrogenaseAnanindeuaNot Available376A->G / 871G->AADR InferredIncreased risk of aplastic anemia, leukopenia and hemolytic anemia. Details
Glucose-6-phosphate 1-dehydrogenaseVanua LavaNot Available383T->CADR InferredIncreased risk of aplastic anemia, leukopenia and hemolytic anemia. Details
Glucose-6-phosphate 1-dehydrogenaseValladolidNot Available406C->TADR InferredIncreased risk of aplastic anemia, leukopenia and hemolytic anemia. Details
Glucose-6-phosphate 1-dehydrogenaseBelemNot Available409C->TADR InferredIncreased risk of aplastic anemia, leukopenia and hemolytic anemia. Details
Glucose-6-phosphate 1-dehydrogenaseLiuzhouNot Available442G->AADR InferredIncreased risk of aplastic anemia, leukopenia and hemolytic anemia. Details
Glucose-6-phosphate 1-dehydrogenaseShenzenNot Available473G>AADR InferredIncreased risk of aplastic anemia, leukopenia and hemolytic anemia. Details
Glucose-6-phosphate 1-dehydrogenaseTaipei “Chinese- 3”Not Available493A->GADR InferredIncreased risk of aplastic anemia, leukopenia and hemolytic anemia. Details
Glucose-6-phosphate 1-dehydrogenaseToledoNot Available496C>TADR InferredIncreased risk of aplastic anemia, leukopenia and hemolytic anemia. Details
Glucose-6-phosphate 1-dehydrogenaseNaoneNot Available497G->AADR InferredIncreased risk of aplastic anemia, leukopenia and hemolytic anemia. Details
Glucose-6-phosphate 1-dehydrogenaseNankangNot Available517T->CADR InferredIncreased risk of aplastic anemia, leukopenia and hemolytic anemia. Details
Glucose-6-phosphate 1-dehydrogenaseMiaoliNot Available519C->GADR InferredIncreased risk of aplastic anemia, leukopenia and hemolytic anemia. Details
Glucose-6-phosphate 1-dehydrogenaseMediterranean, Dallas, Panama‚ Sassari, Cagliari, BirminghamNot Available563C->TADR InferredIncreased risk of aplastic anemia, leukopenia and hemolytic anemia. Details
Glucose-6-phosphate 1-dehydrogenaseCoimbra ShundeNot Available592C->TADR InferredIncreased risk of aplastic anemia, leukopenia and hemolytic anemia. Details
Glucose-6-phosphate 1-dehydrogenaseNilgiriNot Available593G>AADR InferredIncreased risk of aplastic anemia, leukopenia and hemolytic anemia. Details
Glucose-6-phosphate 1-dehydrogenaseRadlowoNot Available679C->TADR InferredIncreased risk of aplastic anemia, leukopenia and hemolytic anemia. Details
Glucose-6-phosphate 1-dehydrogenaseRoubaixNot Available811G>CADR InferredIncreased risk of aplastic anemia, leukopenia and hemolytic anemia. Details
Glucose-6-phosphate 1-dehydrogenaseHaikouNot Available835A->GADR InferredIncreased risk of aplastic anemia, leukopenia and hemolytic anemia. Details
Glucose-6-phosphate 1-dehydrogenaseChinese-1Not Available835A->TADR InferredIncreased risk of aplastic anemia, leukopenia and hemolytic anemia. Details
Glucose-6-phosphate 1-dehydrogenaseMizushimaNot Available848A>GADR InferredIncreased risk of aplastic anemia, leukopenia and hemolytic anemia. Details
Glucose-6-phosphate 1-dehydrogenaseOsakaNot Available853C->TADR InferredIncreased risk of aplastic anemia, leukopenia and hemolytic anemia. Details
Glucose-6-phosphate 1-dehydrogenaseViangchan, JammuNot Available871G->AADR InferredIncreased risk of aplastic anemia, leukopenia and hemolytic anemia. Details
Glucose-6-phosphate 1-dehydrogenaseSeoulNot Available916G->AADR InferredIncreased risk of aplastic anemia, leukopenia and hemolytic anemia. Details
Glucose-6-phosphate 1-dehydrogenaseLudhianaNot Available929G->AADR InferredIncreased risk of aplastic anemia, leukopenia and hemolytic anemia. Details
Glucose-6-phosphate 1-dehydrogenaseFarroupilhaNot Available977C->AADR InferredIncreased risk of aplastic anemia, leukopenia and hemolytic anemia. Details
Glucose-6-phosphate 1-dehydrogenaseChinese-5Not Available1024C->TADR InferredIncreased risk of aplastic anemia, leukopenia and hemolytic anemia. Details
Glucose-6-phosphate 1-dehydrogenaseRignanoNot Available130G>AADR InferredIncreased risk of aplastic anemia, leukopenia and hemolytic anemia. Details
Glucose-6-phosphate 1-dehydrogenaseOrissaNot Available131C->GADR InferredIncreased risk of aplastic anemia, leukopenia and hemolytic anemia. Details
Glucose-6-phosphate 1-dehydrogenaseG6PDNiceNot Available1380G>CADR InferredIncreased risk of aplastic anemia, leukopenia and hemolytic anemia. Details
Glucose-6-phosphate 1-dehydrogenaseKamiube, KeelungNot Available1387C->TADR InferredIncreased risk of aplastic anemia, leukopenia and hemolytic anemia. Details
Glucose-6-phosphate 1-dehydrogenaseNeapolisNot Available1400C->GADR InferredIncreased risk of aplastic anemia, leukopenia and hemolytic anemia. Details
Glucose-6-phosphate 1-dehydrogenaseAuresNot Available143T->CADR InferredIncreased risk of aplastic anemia, leukopenia and hemolytic anemia. Details
Glucose-6-phosphate 1-dehydrogenaseSplitNot Available1442C->GADR InferredIncreased risk of aplastic anemia, leukopenia and hemolytic anemia. Details
Glucose-6-phosphate 1-dehydrogenaseKambosNot Available148C->TADR InferredIncreased risk of aplastic anemia, leukopenia and hemolytic anemia. Details
Glucose-6-phosphate 1-dehydrogenasePalestrinaNot Available170G>AADR InferredIncreased risk of aplastic anemia, leukopenia and hemolytic anemia. Details
Glucose-6-phosphate 1-dehydrogenaseMetapontoNot Available172G->AADR InferredIncreased risk of aplastic anemia, leukopenia and hemolytic anemia. Details
Glucose-6-phosphate 1-dehydrogenaseMusashinoNot Available185C->TADR InferredIncreased risk of aplastic anemia, leukopenia and hemolytic anemia. Details
Glucose-6-phosphate 1-dehydrogenaseAsahiNot Available202G->AADR InferredIncreased risk of aplastic anemia, leukopenia and hemolytic anemia. Details
Glucose-6-phosphate 1-dehydrogenaseA- (202), Ferrara INot Available202G->A / 376A->GADR InferredIncreased risk of aplastic anemia, leukopenia and hemolytic anemia. Details
Glucose-6-phosphate 1-dehydrogenaseMurcia OristanoNot Available209A->GADR InferredIncreased risk of aplastic anemia, leukopenia and hemolytic anemia. Details
Glucose-6-phosphate 1-dehydrogenaseUbe KonanNot Available241C->TADR InferredIncreased risk of aplastic anemia, leukopenia and hemolytic anemia. Details
Glucose-6-phosphate 1-dehydrogenaseLagosantoNot Available242G->AADR InferredIncreased risk of aplastic anemia, leukopenia and hemolytic anemia. Details
Glucose-6-phosphate 1-dehydrogenaseGuangzhouNot Available274C->TADR InferredIncreased risk of aplastic anemia, leukopenia and hemolytic anemia. Details
Glucose-6-phosphate 1-dehydrogenaseHammersmithNot Available323T->AADR InferredIncreased risk of aplastic anemia, leukopenia and hemolytic anemia. Details
Glucose-6-phosphate 1-dehydrogenaseSinnaiNot Available34G->TADR InferredIncreased risk of aplastic anemia, leukopenia and hemolytic anemia. Details
Glucose-6-phosphate 1-dehydrogenaseA- (680)Not Available376A->G / 680G->TADR InferredIncreased risk of aplastic anemia, leukopenia and hemolytic anemia. Details
Glucose-6-phosphate 1-dehydrogenaseA- (968), Betica,Selma, GuantanamoNot Available376A->G / 968T->CADR InferredIncreased risk of aplastic anemia, leukopenia and hemolytic anemia. Details
Glucose-6-phosphate 1-dehydrogenaseSalerno PyrgosNot Available383T>GADR InferredIncreased risk of aplastic anemia, leukopenia and hemolytic anemia. Details
Glucose-6-phosphate 1-dehydrogenaseQuing YanNot Available392G->TADR InferredIncreased risk of aplastic anemia, leukopenia and hemolytic anemia. Details
Glucose-6-phosphate 1-dehydrogenaseLagesNot Available40G->AADR InferredIncreased risk of aplastic anemia, leukopenia and hemolytic anemia. Details
Glucose-6-phosphate 1-dehydrogenaseIleshaNot Available466G->AADR InferredIncreased risk of aplastic anemia, leukopenia and hemolytic anemia. Details
Glucose-6-phosphate 1-dehydrogenaseMahidolNot Available487G->AADR InferredIncreased risk of aplastic anemia, leukopenia and hemolytic anemia. Details
Glucose-6-phosphate 1-dehydrogenaseMalagaNot Available542A->TADR InferredIncreased risk of aplastic anemia, leukopenia and hemolytic anemia. Details
Glucose-6-phosphate 1-dehydrogenaseSibariNot Available634A->GADR InferredIncreased risk of aplastic anemia, leukopenia and hemolytic anemia. Details
Glucose-6-phosphate 1-dehydrogenaseMexico CityNot Available680G->AADR InferredIncreased risk of aplastic anemia, leukopenia and hemolytic anemia. Details
Glucose-6-phosphate 1-dehydrogenaseNanningNot Available703C->TADR InferredIncreased risk of aplastic anemia, leukopenia and hemolytic anemia. Details
Glucose-6-phosphate 1-dehydrogenaseSeattle, Lodi, Modena, Ferrara II, Athens-likeNot Available844G->CADR InferredIncreased risk of aplastic anemia, leukopenia and hemolytic anemia. Details
Glucose-6-phosphate 1-dehydrogenaseBajo MaumereNot Available844G->TADR InferredIncreased risk of aplastic anemia, leukopenia and hemolytic anemia. Details
Glucose-6-phosphate 1-dehydrogenaseMontalbanoNot Available854G->AADR InferredIncreased risk of aplastic anemia, leukopenia and hemolytic anemia. Details
Glucose-6-phosphate 1-dehydrogenaseKalyan-Kerala, Jamnaga, RohiniNot Available949G->AADR InferredIncreased risk of aplastic anemia, leukopenia and hemolytic anemia. Details
Glucose-6-phosphate 1-dehydrogenaseGaoheNot Available95A->GADR InferredIncreased risk of aplastic anemia, leukopenia and hemolytic anemia. Details
Drug Interactions
DrugInteractionDrug group
AcebutololThe serum concentration of Acebutolol can be increased when it is combined with Probenecid.Approved
AceclofenacThe serum concentration of Aceclofenac can be increased when it is combined with Probenecid.Approved
AcetaminophenThe serum concentration of Acetaminophen can be increased when it is combined with Probenecid.Approved
AcetohexamideThe protein binding of Acetohexamide can be decreased when combined with Probenecid.Withdrawn
Acetylsalicylic acidThe therapeutic efficacy of Probenecid can be decreased when used in combination with Acetylsalicylic acid.Approved, Vet Approved
AdapaleneThe serum concentration of Adapalene can be increased when it is combined with Probenecid.Approved
AfatinibThe serum concentration of Afatinib can be increased when it is combined with Probenecid.Approved
AldosteroneThe serum concentration of Aldosterone can be increased when it is combined with Probenecid.Experimental
AlitretinoinThe serum concentration of Alitretinoin can be increased when it is combined with Probenecid.Approved, Investigational
AmbrisentanThe serum concentration of Ambrisentan can be increased when it is combined with Probenecid.Approved, Investigational
Ambroxol acefyllinateThe serum concentration of Ambroxol acefyllinate can be increased when it is combined with Probenecid.Experimental
AmdinocillinThe serum concentration of Amdinocillin can be increased when it is combined with Probenecid.Withdrawn
AminophyllineThe serum concentration of Aminophylline can be increased when it is combined with Probenecid.Approved
Aminosalicylic AcidThe therapeutic efficacy of Probenecid can be decreased when used in combination with Aminosalicylic Acid.Approved
AmitriptylineThe serum concentration of Amitriptyline can be increased when it is combined with Probenecid.Approved
AmoxicillinThe serum concentration of Amoxicillin can be increased when it is combined with Probenecid.Approved, Vet Approved
AmpicillinThe serum concentration of Ampicillin can be increased when it is combined with Probenecid.Approved, Vet Approved
AndrographolideThe serum concentration of HMPL-004 can be increased when it is combined with Probenecid.Investigational
AnisodamineThe serum concentration of Anisodamine can be increased when it is combined with Probenecid.Investigational
AntipyrineThe serum concentration of Antipyrine can be increased when it is combined with Probenecid.Approved
ApixabanThe serum concentration of Apixaban can be increased when it is combined with Probenecid.Approved
ApocyninThe serum concentration of Acetovanillone can be increased when it is combined with Probenecid.Investigational
ApremilastThe serum concentration of Apremilast can be increased when it is combined with Probenecid.Approved, Investigational
AripiprazoleThe serum concentration of Aripiprazole can be decreased when it is combined with Probenecid.Approved, Investigational
Arsenic trioxideThe serum concentration of Arsenic trioxide can be increased when it is combined with Probenecid.Approved, Investigational
AtazanavirThe serum concentration of Atazanavir can be increased when it is combined with Probenecid.Approved, Investigational
AtenololThe serum concentration of Atenolol can be increased when it is combined with Probenecid.Approved
AvibactamThe serum concentration of Avibactam can be increased when it is combined with Probenecid.Approved
AxitinibThe serum concentration of Axitinib can be increased when it is combined with Probenecid.Approved, Investigational
AzapropazoneThe serum concentration of Azapropazone can be increased when it is combined with Probenecid.Withdrawn
AzelastineThe serum concentration of Azelastine can be increased when it is combined with Probenecid.Approved
AzidocillinThe serum concentration of Azidocillin can be increased when it is combined with Probenecid.Approved
AzlocillinThe serum concentration of Azlocillin can be increased when it is combined with Probenecid.Approved
BacampicillinThe serum concentration of Bacampicillin can be increased when it is combined with Probenecid.Approved
BalsalazideThe serum concentration of Balsalazide can be increased when it is combined with Probenecid.Approved, Investigational
BenoxaprofenThe serum concentration of Benoxaprofen can be increased when it is combined with Probenecid.Withdrawn
Benzathine benzylpenicillinThe serum concentration of Benzathine benzylpenicillin can be increased when it is combined with Probenecid.Approved, Vet Approved
Benzoic AcidThe serum concentration of Benzoic Acid can be increased when it is combined with Probenecid.Approved
BenzylpenicillinThe serum concentration of Benzylpenicillin can be increased when it is combined with Probenecid.Approved, Vet Approved
Benzylpenicilloyl PolylysineThe serum concentration of Benzylpenicilloyl Polylysine can be increased when it is combined with Probenecid.Approved
BetamethasoneThe serum concentration of Betamethasone can be increased when it is combined with Probenecid.Approved, Vet Approved
Betulinic AcidThe serum concentration of Betulinic Acid can be increased when it is combined with Probenecid.Investigational
BoceprevirThe serum concentration of Boceprevir can be increased when it is combined with Probenecid.Withdrawn
BosutinibThe serum concentration of Bosutinib can be increased when it is combined with Probenecid.Approved
Brentuximab vedotinThe serum concentration of Brentuximab vedotin can be increased when it is combined with Probenecid.Approved
BromfenacThe serum concentration of Bromfenac can be increased when it is combined with Probenecid.Approved
BromocriptineThe serum concentration of Bromocriptine can be increased when it is combined with Probenecid.Approved, Investigational
BucillamineThe serum concentration of Bucillamine can be increased when it is combined with Probenecid.Investigational
BumetanideThe risk or severity of adverse effects can be increased when Probenecid is combined with Bumetanide.Approved
CabazitaxelThe serum concentration of Cabazitaxel can be increased when it is combined with Probenecid.Approved
CaffeineThe serum concentration of Caffeine can be increased when it is combined with Probenecid.Approved
CamptothecinThe serum concentration of Camptothecin can be increased when it is combined with Probenecid.Experimental
CanagliflozinThe serum concentration of Canagliflozin can be increased when it is combined with Probenecid.Approved
CarbamazepineThe serum concentration of Carbamazepine can be increased when it is combined with Probenecid.Approved, Investigational
CarbenicillinThe serum concentration of Carbenicillin can be increased when it is combined with Probenecid.Approved
Carbenicillin indanylThe serum concentration of Carindacillin can be increased when it is combined with Probenecid.Approved
CarfilzomibThe serum concentration of Carfilzomib can be increased when it is combined with Probenecid.Approved
CarprofenThe serum concentration of Carprofen can be increased when it is combined with Probenecid.Approved, Vet Approved, Withdrawn
CastanospermineThe serum concentration of Castanospermine can be increased when it is combined with Probenecid.Experimental
CefacetrileThe serum concentration of Cefacetrile can be increased when it is combined with Probenecid.Approved
CefaclorThe serum concentration of Cefaclor can be increased when it is combined with Probenecid.Approved
CefadroxilThe serum concentration of Cefadroxil can be increased when it is combined with Probenecid.Approved, Vet Approved, Withdrawn
CefalotinThe serum concentration of Cefalotin can be increased when it is combined with Probenecid.Approved, Vet Approved
CefamandoleThe serum concentration of Cefamandole can be increased when it is combined with Probenecid.Approved
CefapirinThe serum concentration of Cefapirin can be increased when it is combined with Probenecid.Approved, Vet Approved
CefazolinThe serum concentration of Cefazolin can be increased when it is combined with Probenecid.Approved
CefiximeThe serum concentration of Cefixime can be increased when it is combined with Probenecid.Approved
CefmenoximeThe serum concentration of Cefmenoxime can be increased when it is combined with Probenecid.Approved
CefmetazoleThe serum concentration of Cefmetazole can be increased when it is combined with Probenecid.Approved
CefminoxThe serum concentration of Cefminox can be increased when it is combined with Probenecid.Approved
CefonicidThe serum concentration of Cefonicid can be increased when it is combined with Probenecid.Approved
CefoperazoneThe serum concentration of Cefoperazone can be increased when it is combined with Probenecid.Approved
CeforanideThe serum concentration of Ceforanide can be increased when it is combined with Probenecid.Approved
CefotaximeThe serum concentration of Cefotaxime can be increased when it is combined with Probenecid.Approved
CefotetanThe serum concentration of Cefotetan can be increased when it is combined with Probenecid.Approved
CefotiamThe serum concentration of Cefotiam can be increased when it is combined with Probenecid.Approved
CefoxitinThe serum concentration of Cefoxitin can be increased when it is combined with Probenecid.Approved
CefpodoximeThe serum concentration of Cefpodoxime can be increased when it is combined with Probenecid.Approved, Vet Approved
CefradineThe serum concentration of Cefradine can be increased when it is combined with Probenecid.Approved
CefroxadineThe serum concentration of Cefroxadine can be increased when it is combined with Probenecid.Withdrawn
CeftazidimeThe serum concentration of Ceftazidime can be increased when it is combined with Probenecid.Approved
CeftizoximeThe serum concentration of Ceftizoxime can be increased when it is combined with Probenecid.Approved
CeftriaxoneThe serum concentration of Ceftriaxone can be increased when it is combined with Probenecid.Approved
CefuroximeThe serum concentration of Cefuroxime can be increased when it is combined with Probenecid.Approved
CelecoxibThe serum concentration of Celecoxib can be increased when it is combined with Probenecid.Approved, Investigational
CephalexinThe serum concentration of Cephalexin can be increased when it is combined with Probenecid.Approved, Vet Approved
CephaloglycinThe serum concentration of Cephaloglycin can be increased when it is combined with Probenecid.Approved
CephaloridineThe serum concentration of Cephaloridine can be increased when it is combined with Probenecid.Approved, Withdrawn
CeritinibThe serum concentration of Ceritinib can be increased when it is combined with Probenecid.Approved
CerivastatinThe serum concentration of Cerivastatin can be increased when it is combined with Probenecid.Withdrawn
ChloroquineThe serum concentration of Chloroquine can be increased when it is combined with Probenecid.Approved, Vet Approved
ChlorpromazineThe serum concentration of Chlorpromazine can be increased when it is combined with Probenecid.Approved, Vet Approved
ChlorpropamideThe protein binding of Chlorpropamide can be decreased when combined with Probenecid.Approved
Choline magnesium trisalicylateThe serum concentration of Trisalicylate-choline can be increased when it is combined with Probenecid.Approved
CilostazolThe serum concentration of Cilostazol can be increased when it is combined with Probenecid.Approved
CimetidineThe serum concentration of Cimetidine can be increased when it is combined with Probenecid.Approved
CinoxacinThe serum concentration of Cinoxacin can be increased when it is combined with Probenecid.Approved, Withdrawn
CiprofloxacinThe serum concentration of Ciprofloxacin can be increased when it is combined with Probenecid.Approved, Investigational
CisplatinThe serum concentration of Cisplatin can be increased when it is combined with Probenecid.Approved
CitalopramThe serum concentration of Citalopram can be increased when it is combined with Probenecid.Approved
ClarithromycinThe serum concentration of Clarithromycin can be increased when it is combined with Probenecid.Approved
ClobazamThe serum concentration of Clobazam can be increased when it is combined with Probenecid.Approved, Illicit
ClomifeneThe serum concentration of Clomifene can be increased when it is combined with Probenecid.Approved, Investigational
ClonidineThe serum concentration of Clonidine can be increased when it is combined with Probenecid.Approved
ClonixinThe serum concentration of Clonixin can be increased when it is combined with Probenecid.Approved
ClopidogrelThe serum concentration of Clopidogrel can be increased when it is combined with Probenecid.Approved, Nutraceutical
CloxacillinThe serum concentration of Cloxacillin can be increased when it is combined with Probenecid.Approved, Vet Approved
ClozapineThe serum concentration of Clozapine can be increased when it is combined with Probenecid.Approved
CobimetinibThe serum concentration of Cobimetinib can be increased when it is combined with Probenecid.Approved
ColchicineThe serum concentration of Colchicine can be increased when it is combined with Probenecid.Approved
Conjugated estrogensThe serum concentration of Conjugated Equine Estrogens can be increased when it is combined with Probenecid.Approved
CrizotinibThe serum concentration of Crizotinib can be increased when it is combined with Probenecid.Approved
CurcuminThe serum concentration of Curcumin can be increased when it is combined with Probenecid.Investigational
CyclacillinThe serum concentration of Cyclacillin can be increased when it is combined with Probenecid.Approved
CyclosporineThe serum concentration of Cyclosporine can be increased when it is combined with Probenecid.Approved, Investigational, Vet Approved
D-LimoneneThe serum concentration of D-Limonene can be increased when it is combined with Probenecid.Investigational
Dabigatran etexilateThe serum concentration of the active metabolites of Dabigatran etexilate can be increased when Dabigatran etexilate is used in combination with Probenecid.Approved
DabrafenibThe serum concentration of Dabrafenib can be increased when it is combined with Probenecid.Approved
DactinomycinThe serum concentration of Dactinomycin can be increased when it is combined with Probenecid.Approved
DapagliflozinThe serum concentration of Dapagliflozin can be increased when it is combined with Probenecid.Approved
DapsoneThe serum concentration of Dapsone can be increased when it is combined with Probenecid.Approved, Investigational
DasatinibThe serum concentration of Dasatinib can be increased when it is combined with Probenecid.Approved, Investigational
DaunorubicinThe serum concentration of Daunorubicin can be increased when it is combined with Probenecid.Approved
DebrisoquinThe serum concentration of Debrisoquin can be increased when it is combined with Probenecid.Approved
dersalazineThe therapeutic efficacy of Probenecid can be decreased when used in combination with dersalazine.Investigational
DexamethasoneThe serum concentration of Dexamethasone can be increased when it is combined with Probenecid.Approved, Investigational, Vet Approved
DexketoprofenThe serum concentration of Dexketoprofen can be increased when it is combined with Probenecid.Approved
DiazepamThe serum concentration of Diazepam can be increased when it is combined with Probenecid.Approved, Illicit, Vet Approved
DiclofenacThe serum concentration of Diclofenac can be increased when it is combined with Probenecid.Approved, Vet Approved
DicloxacillinThe serum concentration of Dicloxacillin can be increased when it is combined with Probenecid.Approved, Vet Approved
DiethylstilbestrolThe serum concentration of Diethylstilbestrol can be increased when it is combined with Probenecid.Approved
DiflunisalThe therapeutic efficacy of Probenecid can be decreased when used in combination with Diflunisal.Approved
DigitoxinThe serum concentration of Digitoxin can be increased when it is combined with Probenecid.Approved
DigoxinThe serum concentration of Digoxin can be increased when it is combined with Probenecid.Approved
DihydrotestosteroneThe serum concentration of Dihydrotestosterone can be increased when it is combined with Probenecid.Illicit
DiltiazemThe serum concentration of Diltiazem can be increased when it is combined with Probenecid.Approved
DipyridamoleThe serum concentration of Dipyridamole can be increased when it is combined with Probenecid.Approved
DocetaxelThe serum concentration of Docetaxel can be increased when it is combined with Probenecid.Approved, Investigational
DomperidoneThe serum concentration of Domperidone can be increased when it is combined with Probenecid.Approved, Investigational, Vet Approved
DoripenemThe serum concentration of Doripenem can be increased when it is combined with Probenecid.Approved, Investigational
DoxorubicinThe serum concentration of Doxorubicin can be increased when it is combined with Probenecid.Approved, Investigational
DroxicamThe serum concentration of Droxicam can be increased when it is combined with Probenecid.Approved
DuvelisibThe serum concentration of Duvelisib can be increased when it is combined with Probenecid.Investigational
DyphyllineThe serum concentration of Dyphylline can be increased when it is combined with Probenecid.Approved
E-6201The serum concentration of E6201 can be increased when it is combined with Probenecid.Investigational
EbselenThe serum concentration of Ebselen can be increased when it is combined with Probenecid.Investigational
EdoxabanThe serum concentration of Edoxaban can be increased when it is combined with Probenecid.Approved
EletriptanThe serum concentration of Eletriptan can be increased when it is combined with Probenecid.Approved, Investigational
EnoxacinThe serum concentration of Enoxacin can be increased when it is combined with Probenecid.Approved
EpinastineThe serum concentration of Epinastine can be increased when it is combined with Probenecid.Approved, Investigational
EpirizoleThe serum concentration of Epirizole can be increased when it is combined with Probenecid.Approved
ErlotinibThe serum concentration of Erlotinib can be increased when it is combined with Probenecid.Approved, Investigational
ErtapenemThe serum concentration of Ertapenem can be increased when it is combined with Probenecid.Approved, Investigational
ErythromycinThe serum concentration of Erythromycin can be increased when it is combined with Probenecid.Approved, Vet Approved
EstradiolThe serum concentration of Estradiol can be increased when it is combined with Probenecid.Approved, Investigational, Vet Approved
EstriolThe serum concentration of Estriol can be increased when it is combined with Probenecid.Approved, Vet Approved
EstroneThe serum concentration of Estrone can be increased when it is combined with Probenecid.Approved
Etacrynic acidThe risk or severity of adverse effects can be increased when Probenecid is combined with Etacrynic acid.Approved
EtanerceptThe serum concentration of Etanercept can be increased when it is combined with Probenecid.Approved, Investigational
Ethinyl EstradiolThe serum concentration of Ethinyl Estradiol can be increased when it is combined with Probenecid.Approved
EtodolacThe serum concentration of Etodolac can be increased when it is combined with Probenecid.Approved, Investigational, Vet Approved
EtofenamateThe serum concentration of Etofenamate can be increased when it is combined with Probenecid.Approved
EtoposideThe serum concentration of Etoposide can be increased when it is combined with Probenecid.Approved
EtoricoxibThe serum concentration of Etoricoxib can be increased when it is combined with Probenecid.Approved, Investigational
Evening primrose oilThe serum concentration of Evening primrose oil can be increased when it is combined with Probenecid.Approved
EverolimusThe serum concentration of Everolimus can be increased when it is combined with Probenecid.Approved
exisulindThe serum concentration of exisulind can be increased when it is combined with Probenecid.Investigational
EzetimibeThe serum concentration of Ezetimibe can be increased when it is combined with Probenecid.Approved
FenbufenThe serum concentration of Fenbufen can be increased when it is combined with Probenecid.Approved
FenoprofenThe serum concentration of Fenoprofen can be increased when it is combined with Probenecid.Approved
FesoterodineThe serum concentration of Fesoterodine can be increased when it is combined with Probenecid.Approved
FexofenadineThe serum concentration of Fexofenadine can be increased when it is combined with Probenecid.Approved
FidaxomicinThe serum concentration of Fidaxomicin can be increased when it is combined with Probenecid.Approved
FleroxacinThe serum concentration of Fleroxacin can be increased when it is combined with Probenecid.Approved
FloctafenineThe serum concentration of Floctafenine can be increased when it is combined with Probenecid.Approved, Withdrawn
FlucloxacillinThe serum concentration of Flucloxacillin can be increased when it is combined with Probenecid.Approved
FlumequineThe serum concentration of Flumequine can be increased when it is combined with Probenecid.Withdrawn
FlunixinThe serum concentration of Flunixin can be increased when it is combined with Probenecid.Vet Approved
FlurbiprofenThe serum concentration of Flurbiprofen can be increased when it is combined with Probenecid.Approved, Investigational
Fluticasone furoateThe serum concentration of Fluticasone furoate can be increased when it is combined with Probenecid.Approved
FurosemideThe risk or severity of adverse effects can be increased when Probenecid is combined with Furosemide.Approved, Vet Approved
GanciclovirThe serum concentration of Ganciclovir can be increased when it is combined with Probenecid.Approved, Investigational
GarenoxacinThe serum concentration of Garenoxacin can be increased when it is combined with Probenecid.Investigational
GatifloxacinThe serum concentration of Gatifloxacin can be increased when it is combined with Probenecid.Approved, Investigational
GefitinibThe serum concentration of Gefitinib can be increased when it is combined with Probenecid.Approved, Investigational
GemcitabineThe serum concentration of Gemcitabine can be increased when it is combined with Probenecid.Approved
GemifloxacinProbenecid may decrease the excretion rate of Gemifloxacin which could result in a higher serum level.Approved, Investigational
GlibornurideThe protein binding of Glibornuride can be decreased when combined with Probenecid.Withdrawn
GliclazideThe protein binding of Gliclazide can be decreased when combined with Probenecid.Approved
GlimepirideThe protein binding of Glimepiride can be decreased when combined with Probenecid.Approved
GlipizideThe protein binding of Glipizide can be decreased when combined with Probenecid.Approved
GliquidoneThe protein binding of Gliquidone can be decreased when combined with Probenecid.Approved
GlisoxepideThe protein binding of Glisoxepide can be decreased when combined with Probenecid.Approved
GlyburideThe protein binding of Glyburide can be decreased when combined with Probenecid.Approved
Glycerol PhenylbutyrateThe serum concentration of the active metabolites of Glycerol Phenylbutyrate can be increased when Glycerol Phenylbutyrate is used in combination with Probenecid.Approved
GrazoprevirThe serum concentration of Grazoprevir can be increased when it is combined with Probenecid.Approved
GrepafloxacinThe serum concentration of Grepafloxacin can be increased when it is combined with Probenecid.Withdrawn
HaloperidolThe serum concentration of Haloperidol can be increased when it is combined with Probenecid.Approved
HigenamineThe serum concentration of Higenamine can be increased when it is combined with Probenecid.Investigational
HydrocortisoneThe serum concentration of Hydrocortisone can be increased when it is combined with Probenecid.Approved, Vet Approved
IbuprofenThe serum concentration of Ibuprofen can be increased when it is combined with Probenecid.Approved
IbuproxamThe serum concentration of Ibuproxam can be increased when it is combined with Probenecid.Withdrawn
IcatibantThe serum concentration of Icatibant can be increased when it is combined with Probenecid.Approved
IdelalisibThe serum concentration of Idelalisib can be increased when it is combined with Probenecid.Approved
ImatinibThe serum concentration of Imatinib can be increased when it is combined with Probenecid.Approved
ImipenemThe serum concentration of Imipenem can be increased when it is combined with Probenecid.Approved
ImipramineThe serum concentration of Imipramine can be increased when it is combined with Probenecid.Approved
IndacaterolThe serum concentration of Indacaterol can be increased when it is combined with Probenecid.Approved
IndinavirThe serum concentration of Indinavir can be increased when it is combined with Probenecid.Approved
IndomethacinThe serum concentration of Indomethacin can be increased when it is combined with Probenecid.Approved, Investigational
IndoprofenThe serum concentration of Indoprofen can be increased when it is combined with Probenecid.Withdrawn
IrinotecanThe serum concentration of Irinotecan can be increased when it is combined with Probenecid.Approved, Investigational
IsoxicamThe serum concentration of Isoxicam can be increased when it is combined with Probenecid.Withdrawn
IvermectinThe serum concentration of Ivermectin can be increased when it is combined with Probenecid.Approved, Vet Approved
KebuzoneThe serum concentration of Kebuzone can be increased when it is combined with Probenecid.Experimental
KetazolamThe serum concentration of Ketazolam can be increased when it is combined with Probenecid.Approved
KetoconazoleThe serum concentration of Ketoconazole can be increased when it is combined with Probenecid.Approved, Investigational
KetoprofenThe serum concentration of Ketoprofen can be increased when it is combined with Probenecid.Approved, Vet Approved
KetorolacThe serum concentration of Ketorolac can be increased when it is combined with Probenecid.Approved
LamivudineThe serum concentration of Lamivudine can be increased when it is combined with Probenecid.Approved, Investigational
LamotrigineThe serum concentration of Lamotrigine can be increased when it is combined with Probenecid.Approved, Investigational
LansoprazoleThe serum concentration of Lansoprazole can be increased when it is combined with Probenecid.Approved, Investigational
LedipasvirThe serum concentration of Ledipasvir can be increased when it is combined with Probenecid.Approved
LeflunomideThe serum concentration of Leflunomide can be increased when it is combined with Probenecid.Approved, Investigational
LenalidomideThe serum concentration of Lenalidomide can be increased when it is combined with Probenecid.Approved
LenvatinibThe serum concentration of Lenvatinib can be increased when it is combined with Probenecid.Approved
LevetiracetamThe serum concentration of Levetiracetam can be increased when it is combined with Probenecid.Approved, Investigational
LevofloxacinThe serum concentration of Levofloxacin can be increased when it is combined with Probenecid.Approved, Investigational
LevomilnacipranThe serum concentration of Levomilnacipran can be increased when it is combined with Probenecid.Approved
LinagliptinThe serum concentration of Linagliptin can be increased when it is combined with Probenecid.Approved
LisofyllineThe serum concentration of Lisofylline can be increased when it is combined with Probenecid.Investigational
LomefloxacinThe serum concentration of Lomefloxacin can be increased when it is combined with Probenecid.Approved
LoperamideThe serum concentration of Loperamide can be increased when it is combined with Probenecid.Approved
LorazepamThe serum concentration of Lorazepam can be increased when it is combined with Probenecid.Approved
LornoxicamThe serum concentration of Lornoxicam can be increased when it is combined with Probenecid.Approved
LosartanThe serum concentration of Losartan can be increased when it is combined with Probenecid.Approved
LoxoprofenThe serum concentration of Loxoprofen can be increased when it is combined with Probenecid.Approved
LumiracoxibThe serum concentration of Lumiracoxib can be increased when it is combined with Probenecid.Approved, Investigational
Magnesium salicylateThe serum concentration of Magnesium salicylate can be increased when it is combined with Probenecid.Approved
MannitolThe serum concentration of Mannitol can be increased when it is combined with Probenecid.Approved, Investigational
MasoprocolThe serum concentration of Masoprocol can be increased when it is combined with Probenecid.Approved
MecamylamineThe risk or severity of adverse effects can be increased when Probenecid is combined with Mecamylamine.Approved
Meclofenamic acidThe serum concentration of Meclofenamic acid can be increased when it is combined with Probenecid.Approved, Vet Approved
Mefenamic acidThe serum concentration of Mefenamic acid can be increased when it is combined with Probenecid.Approved
MeloxicamThe serum concentration of Meloxicam can be increased when it is combined with Probenecid.Approved, Vet Approved
MeropenemThe serum concentration of Meropenem can be increased when it is combined with Probenecid.Approved, Investigational
MesalazineThe therapeutic efficacy of Probenecid can be decreased when used in combination with Mesalazine.Approved
MetamizoleThe serum concentration of Metamizole can be increased when it is combined with Probenecid.Withdrawn
MethotrexateThe serum concentration of Methotrexate can be increased when it is combined with Probenecid.Approved
MethylprednisoloneThe serum concentration of Methylprednisolone can be increased when it is combined with Probenecid.Approved, Vet Approved
MeticillinThe serum concentration of Meticillin can be increased when it is combined with Probenecid.Approved
MetoprololThe serum concentration of Metoprolol can be increased when it is combined with Probenecid.Approved, Investigational
MezlocillinThe serum concentration of Mezlocillin can be increased when it is combined with Probenecid.Approved
MidazolamThe serum concentration of Midazolam can be increased when it is combined with Probenecid.Approved, Illicit
MinoxidilThe serum concentration of Minoxidil can be increased when it is combined with Probenecid.Approved
MirabegronThe serum concentration of Mirabegron can be increased when it is combined with Probenecid.Approved
MitoxantroneThe serum concentration of Mitoxantrone can be increased when it is combined with Probenecid.Approved, Investigational
MizoribineThe serum concentration of Mizoribine can be increased when it is combined with Probenecid.Investigational
MorphineThe serum concentration of Morphine can be increased when it is combined with Probenecid.Approved, Investigational
MoxifloxacinThe serum concentration of Moxifloxacin can be increased when it is combined with Probenecid.Approved, Investigational
Mycophenolate mofetilThe serum concentration of Mycophenolate mofetil can be increased when it is combined with Probenecid.Approved, Investigational
Mycophenolic acidThe serum concentration of Mycophenolic acid can be increased when it is combined with Probenecid.Approved
NabumetoneThe serum concentration of Nabumetone can be increased when it is combined with Probenecid.Approved
NadololThe serum concentration of Nadolol can be increased when it is combined with Probenecid.Approved
NafamostatThe serum concentration of Nafamostat can be increased when it is combined with Probenecid.Approved, Investigational
NafcillinThe serum concentration of Nafcillin can be increased when it is combined with Probenecid.Approved
NaftifineThe serum concentration of Naftifine can be increased when it is combined with Probenecid.Approved
Nalidixic AcidThe serum concentration of Nalidixic Acid can be increased when it is combined with Probenecid.Approved
NaloxegolThe serum concentration of Naloxegol can be increased when it is combined with Probenecid.Approved
NaloxoneThe serum concentration of Naloxone can be increased when it is combined with Probenecid.Approved, Vet Approved
NaproxenThe serum concentration of Naproxen can be increased when it is combined with Probenecid.Approved, Vet Approved
NelfinavirThe serum concentration of Nelfinavir can be increased when it is combined with Probenecid.Approved
NemonoxacinThe serum concentration of Nemonoxacin can be increased when it is combined with Probenecid.Investigational
NepafenacThe serum concentration of Nepafenac can be increased when it is combined with Probenecid.Approved
NicardipineThe serum concentration of Nicardipine can be increased when it is combined with Probenecid.Approved
NifedipineThe serum concentration of Nifedipine can be increased when it is combined with Probenecid.Approved
Niflumic AcidThe serum concentration of Niflumic Acid can be increased when it is combined with Probenecid.Approved
NilotinibThe serum concentration of Nilotinib can be increased when it is combined with Probenecid.Approved, Investigational
NimesulideThe serum concentration of Nimesulide can be increased when it is combined with Probenecid.Approved, Withdrawn
NintedanibThe serum concentration of Nintedanib can be increased when it is combined with Probenecid.Approved
NitroaspirinThe therapeutic efficacy of Probenecid can be decreased when used in combination with Nitroaspirin.Investigational
NitrofurantoinThe serum concentration of Nitrofurantoin can be increased when it is combined with Probenecid.Approved, Vet Approved
NizatidineThe serum concentration of Nizatidine can be increased when it is combined with Probenecid.Approved
NorfloxacinThe serum concentration of Norfloxacin can be increased when it is combined with Probenecid.Approved
OfloxacinThe serum concentration of Ofloxacin can be increased when it is combined with Probenecid.Approved
OlanzapineThe serum concentration of Olanzapine can be increased when it is combined with Probenecid.Approved, Investigational
OlopatadineThe serum concentration of Olopatadine can be increased when it is combined with Probenecid.Approved
OlsalazineThe serum concentration of Olsalazine can be increased when it is combined with Probenecid.Approved
OmbitasvirThe serum concentration of Ombitasvir can be increased when it is combined with Probenecid.Approved
OrgoteinThe serum concentration of Orgotein can be increased when it is combined with Probenecid.Vet Approved
OseltamivirThe serum concentration of the active metabolites of Oseltamivir can be increased when Oseltamivir is used in combination with Probenecid.Approved
OsimertinibThe serum concentration of Osimertinib can be increased when it is combined with Probenecid.Approved
OxacillinThe serum concentration of Oxacillin can be increased when it is combined with Probenecid.Approved
OxaprozinThe serum concentration of Oxaprozin can be increased when it is combined with Probenecid.Approved
OxyphenbutazoneThe serum concentration of Oxyphenbutazone can be increased when it is combined with Probenecid.Withdrawn
PaclitaxelThe serum concentration of Paclitaxel can be increased when it is combined with Probenecid.Approved, Vet Approved
PanobinostatThe serum concentration of Panobinostat can be increased when it is combined with Probenecid.Approved, Investigational
ParecoxibThe serum concentration of Parecoxib can be increased when it is combined with Probenecid.Approved
PazopanibThe serum concentration of Pazopanib can be increased when it is combined with Probenecid.Approved
PazufloxacinThe serum concentration of Pazufloxacin can be increased when it is combined with Probenecid.Investigational
PefloxacinThe serum concentration of Pefloxacin can be increased when it is combined with Probenecid.Approved
PegloticaseThe risk or severity of adverse effects can be increased when Probenecid is combined with Pegloticase.Approved
PhenobarbitalThe serum concentration of Phenobarbital can be increased when it is combined with Probenecid.Approved
PhenoxymethylpenicillinThe serum concentration of Phenoxymethylpenicillin can be increased when it is combined with Probenecid.Approved, Vet Approved
Phenylacetic acidThe serum concentration of Phenylacetic acid can be increased when it is combined with Probenecid.Approved
PhenylbutazoneThe serum concentration of Phenylbutazone can be increased when it is combined with Probenecid.Approved, Vet Approved
Phenylbutyric acidThe serum concentration of the active metabolites of Sodium phenylbutyrate can be increased when Sodium phenylbutyrate is used in combination with Probenecid.Approved, Investigational
PhenytoinThe serum concentration of Phenytoin can be increased when it is combined with Probenecid.Approved, Vet Approved
PimecrolimusThe serum concentration of Pimecrolimus can be increased when it is combined with Probenecid.Approved, Investigational
PiperacillinThe serum concentration of Piperacillin can be increased when it is combined with Probenecid.Approved
PiretanideThe risk or severity of adverse effects can be increased when Probenecid is combined with Piretanide.Experimental
PirfenidoneThe serum concentration of Pirfenidone can be increased when it is combined with Probenecid.Investigational
PiroxicamThe serum concentration of Piroxicam can be increased when it is combined with Probenecid.Approved, Investigational
PitavastatinThe serum concentration of Pitavastatin can be increased when it is combined with Probenecid.Approved
PivampicillinThe serum concentration of Pivampicillin can be increased when it is combined with Probenecid.Approved
PivmecillinamThe serum concentration of Pivmecillinam can be increased when it is combined with Probenecid.Approved
PomalidomideThe serum concentration of Pomalidomide can be increased when it is combined with Probenecid.Approved
PonatinibThe serum concentration of Ponatinib can be increased when it is combined with Probenecid.Approved
PralatrexateThe serum concentration of Pralatrexate can be increased when it is combined with Probenecid.Approved
PravastatinThe serum concentration of Pravastatin can be increased when it is combined with Probenecid.Approved
PrazosinThe serum concentration of Prazosin can be increased when it is combined with Probenecid.Approved
PrednisoloneThe serum concentration of Prednisolone can be increased when it is combined with Probenecid.Approved, Vet Approved
PrednisoneThe serum concentration of Prednisone can be increased when it is combined with Probenecid.Approved, Vet Approved
Procaine benzylpenicillinThe serum concentration of Procaine benzylpenicillin can be increased when it is combined with Probenecid.Approved, Vet Approved
ProgesteroneThe serum concentration of Progesterone can be increased when it is combined with Probenecid.Approved, Vet Approved
PropacetamolThe serum concentration of the active metabolites of Propacetamol can be increased when Propacetamol is used in combination with Probenecid.Approved
PropranololThe serum concentration of Propranolol can be increased when it is combined with Probenecid.Approved, Investigational
PrucaloprideThe serum concentration of Prucalopride can be increased when it is combined with Probenecid.Approved
PrulifloxacinThe serum concentration of Prulifloxacin can be increased when it is combined with Probenecid.Investigational
PTC299The serum concentration of PTC299 can be increased when it is combined with Probenecid.Investigational
QuetiapineThe serum concentration of Quetiapine can be increased when it is combined with Probenecid.Approved
QuinidineThe serum concentration of Quinidine can be increased when it is combined with Probenecid.Approved
QuinineThe serum concentration of Quinine can be increased when it is combined with Probenecid.Approved
RanitidineThe serum concentration of Ranitidine can be increased when it is combined with Probenecid.Approved
RanolazineThe serum concentration of Ranolazine can be increased when it is combined with Probenecid.Approved, Investigational
ReserpineThe serum concentration of Reserpine can be increased when it is combined with Probenecid.Approved
ResveratrolThe serum concentration of Resveratrol can be increased when it is combined with Probenecid.Experimental, Investigational
RifampicinThe serum concentration of Rifampicin can be increased when it is combined with Probenecid.Approved
RifaximinThe serum concentration of Rifaximin can be increased when it is combined with Probenecid.Approved, Investigational
RisperidoneThe serum concentration of Risperidone can be increased when it is combined with Probenecid.Approved, Investigational
RitonavirThe serum concentration of Ritonavir can be increased when it is combined with Probenecid.Approved, Investigational
RivaroxabanThe serum concentration of Rivaroxaban can be increased when it is combined with Probenecid.Approved
RofecoxibThe serum concentration of Rofecoxib can be increased when it is combined with Probenecid.Investigational, Withdrawn
RomidepsinThe serum concentration of Romidepsin can be increased when it is combined with Probenecid.Approved, Investigational
RosoxacinThe serum concentration of Rosoxacin can be increased when it is combined with Probenecid.Approved
SalicylamideThe serum concentration of Salicylamide can be increased when it is combined with Probenecid.Approved
Salicylic acidThe therapeutic efficacy of Probenecid can be decreased when used in combination with Salicylic acid.Approved, Vet Approved
SalsalateThe serum concentration of Salsalate can be increased when it is combined with Probenecid.Approved
SaquinavirThe serum concentration of Saquinavir can be increased when it is combined with Probenecid.Approved, Investigational
SaxagliptinThe serum concentration of Saxagliptin can be decreased when it is combined with Probenecid.Approved
SelexipagThe serum concentration of Selexipag can be increased when it is combined with Probenecid.Approved
SeratrodastThe serum concentration of Seratrodast can be increased when it is combined with Probenecid.Approved
SilodosinThe serum concentration of Silodosin can be increased when it is combined with Probenecid.Approved
SimeprevirThe serum concentration of Simeprevir can be increased when it is combined with Probenecid.Approved
SitagliptinThe serum concentration of Sitagliptin can be increased when it is combined with Probenecid.Approved, Investigational
SofosbuvirThe serum concentration of Sofosbuvir can be increased when it is combined with Probenecid.Approved
SorafenibThe serum concentration of Sorafenib can be increased when it is combined with Probenecid.Approved, Investigational
SparfloxacinThe serum concentration of Sparfloxacin can be increased when it is combined with Probenecid.Approved
SphingosineThe serum concentration of Sphingosine can be increased when it is combined with Probenecid.Experimental
SRT501The serum concentration of SRT501 can be increased when it is combined with Probenecid.Investigational
SulbactamThe serum concentration of Sulbactam can be increased when it is combined with Probenecid.Approved
SulfasalazineThe serum concentration of Sulfasalazine can be increased when it is combined with Probenecid.Approved
SulindacThe serum concentration of Sulindac can be increased when it is combined with Probenecid.Approved
SultamicillinThe serum concentration of Sultamicillin can be increased when it is combined with Probenecid.Investigational
SuprofenThe serum concentration of Suprofen can be increased when it is combined with Probenecid.Approved, Withdrawn
TacrolimusThe serum concentration of Tacrolimus can be increased when it is combined with Probenecid.Approved, Investigational
TamoxifenThe serum concentration of Tamoxifen can be increased when it is combined with Probenecid.Approved
Taurocholic AcidThe serum concentration of Taurocholic Acid can be increased when it is combined with Probenecid.Experimental
TazobactamThe serum concentration of Tazobactam can be increased when it is combined with Probenecid.Approved
Technetium Tc-99m sestamibiThe serum concentration of Technetium Tc-99m sestamibi can be increased when it is combined with Probenecid.Approved
TelaprevirThe serum concentration of Telaprevir can be increased when it is combined with Probenecid.Withdrawn
TemafloxacinThe serum concentration of Temafloxacin can be increased when it is combined with Probenecid.Withdrawn
TemsirolimusThe serum concentration of Temsirolimus can be increased when it is combined with Probenecid.Approved
TenoxicamThe serum concentration of Tenoxicam can be increased when it is combined with Probenecid.Approved
TepoxalinThe serum concentration of Tepoxalin can be increased when it is combined with Probenecid.Vet Approved
TeriflunomideThe serum concentration of Teriflunomide can be increased when it is combined with Probenecid.Approved
TheophyllineThe serum concentration of Theophylline can be increased when it is combined with Probenecid.Approved
Tiaprofenic acidThe serum concentration of Tiaprofenic acid can be increased when it is combined with Probenecid.Approved
TicagrelorThe serum concentration of Ticagrelor can be increased when it is combined with Probenecid.Approved
TicarcillinThe serum concentration of Ticarcillin can be increased when it is combined with Probenecid.Approved, Vet Approved
TimololThe serum concentration of Timolol can be increased when it is combined with Probenecid.Approved
TinoridineThe serum concentration of Tinoridine can be increased when it is combined with Probenecid.Investigational
TolazamideThe protein binding of Tolazamide can be decreased when combined with Probenecid.Approved
TolbutamideThe protein binding of Tolbutamide can be decreased when combined with Probenecid.Approved
Tolfenamic AcidThe serum concentration of Tolfenamic Acid can be increased when it is combined with Probenecid.Approved
TolmetinThe serum concentration of Tolmetin can be increased when it is combined with Probenecid.Approved
TolvaptanThe serum concentration of Tolvaptan can be increased when it is combined with Probenecid.Approved
TopotecanThe serum concentration of Topotecan can be increased when it is combined with Probenecid.Approved, Investigational
TorasemideThe risk or severity of adverse effects can be increased when Probenecid is combined with Torasemide.Approved
ToremifeneThe serum concentration of Toremifene can be increased when it is combined with Probenecid.Approved, Investigational
TranilastThe serum concentration of Tranilast can be increased when it is combined with Probenecid.Approved, Investigational
Trastuzumab emtansineThe serum concentration of Trastuzumab emtansine can be increased when it is combined with Probenecid.Approved
TrovafloxacinThe serum concentration of Trovafloxacin can be increased when it is combined with Probenecid.Approved, Withdrawn
UlipristalThe serum concentration of Ulipristal can be increased when it is combined with Probenecid.Approved
UmeclidiniumThe serum concentration of Umeclidinium can be increased when it is combined with Probenecid.Approved
ValdecoxibThe serum concentration of Valdecoxib can be increased when it is combined with Probenecid.Investigational, Withdrawn
ValganciclovirThe serum concentration of Valganciclovir can be increased when it is combined with Probenecid.Approved, Investigational
VecuroniumThe serum concentration of Vecuronium can be increased when it is combined with Probenecid.Approved
VenetoclaxThe serum concentration of Venetoclax can be increased when it is combined with Probenecid.Approved
VenlafaxineThe serum concentration of Venlafaxine can be increased when it is combined with Probenecid.Approved
VerapamilThe serum concentration of Verapamil can be increased when it is combined with Probenecid.Approved
VinblastineThe serum concentration of Vinblastine can be increased when it is combined with Probenecid.Approved
VincristineThe serum concentration of Vincristine can be increased when it is combined with Probenecid.Approved, Investigational
VismodegibThe serum concentration of Vismodegib can be increased when it is combined with Probenecid.Approved
ZaltoprofenThe serum concentration of Zaltoprofen can be increased when it is combined with Probenecid.Approved
ZidovudineThe metabolism of Zidovudine can be decreased when combined with Probenecid.Approved
ZileutonThe serum concentration of Zileuton can be increased when it is combined with Probenecid.Approved, Investigational, Withdrawn
ZomepiracThe serum concentration of Zomepirac can be increased when it is combined with Probenecid.Withdrawn
Food Interactions
  • Increase liquid intake, avoid alcohol.
  • Take with food to reduce irritation.
Synthesis ReferenceNot Available
General References
  1. Butler D: Wartime tactic doubles power of scarce bird-flu drug. Nature. 2005 Nov 3;438(7064):6. [PubMed:16267514 ]
External Links
ATC CodesM04AB01 — ProbenecidG01AE10 — Combinations of sulfonamides
AHFS Codes
  • 40:40.00
PDB EntriesNot Available
FDA labelNot Available
MSDSDownload (36.9 KB)
Clinical Trials
Clinical Trials
0RecruitingBasic SciencePre-Exposure Prophylaxis1
0RecruitingTreatmentCalcium Pyrophosphate Deposition Disease1
1CompletedNot AvailableBMI >30 kg/m21
1CompletedBasic ScienceHealthy Volunteers2
1CompletedBasic SciencePharmacokinetics in Healthy Volunteers1
1CompletedHealth Services ResearchAvian Influenza A Virus1
1CompletedOtherHealthy Volunteers1
1CompletedTreatmentBlood And Marrow Transplantation1
1CompletedTreatmentHealthy Volunteers2
1CompletedTreatmentUnspecified Adult Solid Tumor, Protocol Specific1
1WithdrawnTreatmentCytomegalovirus Retinitis / Human Immunodeficiency Virus (HIV) Infections / Infections, Cytomegalovirus1
1, 2CompletedTreatmentPediatric Traumatic Brain Injury1
2CompletedTreatmentCytomegalovirus Retinitis / Human Immunodeficiency Virus (HIV) Infections1
2CompletedTreatmentHeart Failure With Reduced Ejection Fraction (HFrEF)1
4CompletedNot AvailableFlu caused by Influenza1
4CompletedTreatmentCytomegalovirus Retinitis / Human Immunodeficiency Virus (HIV) Infections1
Not AvailableCompletedBasic ScienceBlood Pressures / BMI >27 kg/m2 / BMI >30 kg/m2 / Endothelial Function / Renal Function1
Not AvailableCompletedTreatmentCytomegalovirus Retinitis / Human Immunodeficiency Virus (HIV) Infections2
Not AvailableCompletedTreatmentHuman Immunodeficiency Virus (HIV) Infections2
Not AvailableCompletedTreatmentHuman Immunodeficiency Virus (HIV) Infections / Progressive Multifocal Leukoencephalopathy1
Not AvailableCompletedTreatmentKidney Diseases1
ManufacturersNot Available
Dosage forms
TabletOral500 mg
Capsule; tabletOral
TabletOral500 mg/1
Tablet, film coatedOral500 mg/1
Unit descriptionCostUnit
Probenecid 500 mg tablet1.37USD tablet
Colchicine-Probenecid 0.5-500 mg tablet0.87USD tablet
Benuryl 500 mg Tablet0.21USD tablet
DrugBank does not sell nor buy drugs. Pricing information is supplied for informational purposes only.
PatentsNot Available
Experimental Properties
melting point (°C)195 °CPhysProp
water solubility27.1 mg/LNot Available
logP3.21HANSCH,C ET AL. (1995)
pKa3.4SANGSTER (1994)
Predicted Properties
Water Solubility0.425 mg/mLALOGPS
pKa (Strongest Acidic)3.53ChemAxon
Physiological Charge-1ChemAxon
Hydrogen Acceptor Count4ChemAxon
Hydrogen Donor Count1ChemAxon
Polar Surface Area74.68 Å2ChemAxon
Rotatable Bond Count6ChemAxon
Refractivity73.81 m3·mol-1ChemAxon
Polarizability29.96 Å3ChemAxon
Number of Rings1ChemAxon
Rule of FiveYesChemAxon
Ghose FilterYesChemAxon
Veber's RuleNoChemAxon
MDDR-like RuleNoChemAxon
Predicted ADMET features
Human Intestinal Absorption+0.9972
Blood Brain Barrier+0.5486
Caco-2 permeable-0.6074
P-glycoprotein substrateNon-substrate0.626
P-glycoprotein inhibitor INon-inhibitor0.8323
P-glycoprotein inhibitor IINon-inhibitor0.9121
Renal organic cation transporterNon-inhibitor0.8253
CYP450 2C9 substrateNon-substrate0.7012
CYP450 2D6 substrateNon-substrate0.9116
CYP450 3A4 substrateNon-substrate0.6485
CYP450 1A2 substrateNon-inhibitor0.9045
CYP450 2C9 inhibitorNon-inhibitor0.9071
CYP450 2D6 inhibitorNon-inhibitor0.9231
CYP450 2C19 inhibitorNon-inhibitor0.9025
CYP450 3A4 inhibitorNon-inhibitor0.8962
CYP450 inhibitory promiscuityLow CYP Inhibitory Promiscuity0.9318
Ames testNon AMES toxic0.9133
BiodegradationNot ready biodegradable0.863
Rat acute toxicity2.2821 LD50, mol/kg Not applicable
hERG inhibition (predictor I)Weak inhibitor0.8521
hERG inhibition (predictor II)Non-inhibitor0.7885
ADMET data is predicted using admetSAR, a free tool for evaluating chemical ADMET properties. (23092397 )
Mass Spec (NIST)Download (8.48 KB)
Spectrum TypeDescriptionSplash Key
Predicted GC-MSPredicted GC-MS Spectrum - GC-MSNot Available
LC-MS/MSLC-MS/MS Spectrum - LC-ESI-qTof , PositiveNot Available
LC-MS/MSLC-MS/MS Spectrum - LC-ESI-qTof , PositiveNot Available
LC-MS/MSLC-MS/MS Spectrum - , positivesplash10-0f76-0190000000-f6f2df3671a359ea4574View in MoNA
LC-MS/MSLC-MS/MS Spectrum - , positivesplash10-0f76-0190000000-ce053a8c64308bc3ebbbView in MoNA
LC-MS/MSLC-MS/MS Spectrum - , positivesplash10-0fen-3950100000-c43ebdb497f6a0e8c974View in MoNA
Predicted LC-MS/MSPredicted LC-MS/MS Spectrum - 10V, PositiveNot Available
Predicted LC-MS/MSPredicted LC-MS/MS Spectrum - 20V, PositiveNot Available
Predicted LC-MS/MSPredicted LC-MS/MS Spectrum - 40V, PositiveNot Available
Predicted LC-MS/MSPredicted LC-MS/MS Spectrum - 10V, NegativeNot Available
Predicted LC-MS/MSPredicted LC-MS/MS Spectrum - 20V, NegativeNot Available
Predicted LC-MS/MSPredicted LC-MS/MS Spectrum - 40V, NegativeNot Available
DescriptionThis compound belongs to the class of chemical entities known as benzenesulfonamides. These are organic compounds containing a sulfonamide group that is S-linked to a benzene ring.
KingdomChemical entities
Super ClassOrganic compounds
Sub ClassBenzene and substituted derivatives
Direct ParentBenzenesulfonamides
Alternative ParentsBenzoic acids / Benzenesulfonyl compounds / Benzoyl derivatives / Organosulfonamides / Aminosulfonyl compounds / Monocarboxylic acids and derivatives / Carboxylic acids / Organopnictogen compounds / Organooxygen compounds / Organonitrogen compounds
SubstituentsBenzenesulfonamide / Benzoic acid or derivatives / Benzoic acid / Benzenesulfonyl group / Benzoyl / Organosulfonic acid amide / Organic sulfonic acid or derivatives / Aminosulfonyl compound / Sulfonyl / Organosulfonic acid or derivatives
Molecular FrameworkAromatic homomonocyclic compounds
External Descriptorssulfonamide, benzoic acids (CHEBI:8426 )


Pharmacological action
General Function:
Sodium-independent organic anion transmembrane transporter activity
Specific Function:
Involved in the renal elimination of endogenous and exogenous organic anions. Functions as organic anion exchanger when the uptake of one molecule of organic anion is coupled with an efflux of one molecule of endogenous dicarboxylic acid (glutarate, ketoglutarate, etc). Mediates the sodium-independent uptake of 2,3-dimercapto-1-propanesulfonic acid (DMPS) (By similarity). Mediates the sodium-in...
Gene Name:
Uniprot ID:
Uniprot Name:
Solute carrier family 22 member 6
Molecular Weight:
61815.78 Da
  1. Takeda M, Narikawa S, Hosoyamada M, Cha SH, Sekine T, Endou H: Characterization of organic anion transport inhibitors using cells stably expressing human organic anion transporters. Eur J Pharmacol. 2001 May 11;419(2-3):113-20. [PubMed:11426832 ]
  2. Jung KY, Takeda M, Kim DK, Tojo A, Narikawa S, Yoo BS, Hosoyamada M, Cha SH, Sekine T, Endou H: Characterization of ochratoxin A transport by human organic anion transporters. Life Sci. 2001 Sep 21;69(18):2123-35. [PubMed:11669456 ]
  3. Takeda M, Khamdang S, Narikawa S, Kimura H, Hosoyamada M, Cha SH, Sekine T, Endou H: Characterization of methotrexate transport and its drug interactions with human organic anion transporters. J Pharmacol Exp Ther. 2002 Aug;302(2):666-71. [PubMed:12130730 ]
  4. Hashimoto T, Narikawa S, Huang XL, Minematsu T, Usui T, Kamimura H, Endou H: Characterization of the renal tubular transport of zonampanel, a novel alpha-amino-3-hydroxy-5-methylisoxazole-4-propionic acid receptor antagonist, by human organic anion transporters. Drug Metab Dispos. 2004 Oct;32(10):1096-102. [PubMed:15377641 ]
  5. Chen X, Ji ZL, Chen YZ: TTD: Therapeutic Target Database. Nucleic Acids Res. 2002 Jan 1;30(1):412-5. [PubMed:11752352 ]
Pharmacological action
General Function:
Sodium-independent organic anion transmembrane transporter activity
Specific Function:
Mediates saturable uptake of estrone sulfate, dehydroepiandrosterone sulfate and related compounds.
Gene Name:
Uniprot ID:
Uniprot Name:
Solute carrier family 22 member 11
Molecular Weight:
59970.945 Da
  1. Enomoto A, Takeda M, Shimoda M, Narikawa S, Kobayashi Y, Kobayashi Y, Yamamoto T, Sekine T, Cha SH, Niwa T, Endou H: Interaction of human organic anion transporters 2 and 4 with organic anion transport inhibitors. J Pharmacol Exp Ther. 2002 Jun;301(3):797-802. [PubMed:12023506 ]
  2. Babu E, Takeda M, Narikawa S, Kobayashi Y, Enomoto A, Tojo A, Cha SH, Sekine T, Sakthisekaran D, Endou H: Role of human organic anion transporter 4 in the transport of ochratoxin A. Biochim Biophys Acta. 2002 Jun 12;1590(1-3):64-75. [PubMed:12063169 ]
  3. Takeda M, Khamdang S, Narikawa S, Kimura H, Hosoyamada M, Cha SH, Sekine T, Endou H: Characterization of methotrexate transport and its drug interactions with human organic anion transporters. J Pharmacol Exp Ther. 2002 Aug;302(2):666-71. [PubMed:12130730 ]
  4. Hashimoto T, Narikawa S, Huang XL, Minematsu T, Usui T, Kamimura H, Endou H: Characterization of the renal tubular transport of zonampanel, a novel alpha-amino-3-hydroxy-5-methylisoxazole-4-propionic acid receptor antagonist, by human organic anion transporters. Drug Metab Dispos. 2004 Oct;32(10):1096-102. [PubMed:15377641 ]
Pharmacological action
General Function:
Sodium-independent organic anion transmembrane transporter activity
Specific Function:
Plays an important role in the excretion/detoxification of endogenous and exogenous organic anions, especially from the brain and kidney. Involved in the transport basolateral of steviol, fexofenadine. Transports benzylpenicillin (PCG), estrone-3-sulfate (E1S), cimetidine (CMD), 2,4-dichloro-phenoxyacetate (2,4-D), p-amino-hippurate (PAH), acyclovir (ACV) and ochratoxin (OTA).
Gene Name:
Uniprot ID:
Uniprot Name:
Solute carrier family 22 member 8
Molecular Weight:
59855.585 Da
  1. Kusuhara H, Sekine T, Utsunomiya-Tate N, Tsuda M, Kojima R, Cha SH, Sugiyama Y, Kanai Y, Endou H: Molecular cloning and characterization of a new multispecific organic anion transporter from rat brain. J Biol Chem. 1999 May 7;274(19):13675-80. [PubMed:10224140 ]
  2. Takeda M, Narikawa S, Hosoyamada M, Cha SH, Sekine T, Endou H: Characterization of organic anion transport inhibitors using cells stably expressing human organic anion transporters. Eur J Pharmacol. 2001 May 11;419(2-3):113-20. [PubMed:11426832 ]
  3. Jung KY, Takeda M, Kim DK, Tojo A, Narikawa S, Yoo BS, Hosoyamada M, Cha SH, Sekine T, Endou H: Characterization of ochratoxin A transport by human organic anion transporters. Life Sci. 2001 Sep 21;69(18):2123-35. [PubMed:11669456 ]
  4. Takeda M, Khamdang S, Narikawa S, Kimura H, Hosoyamada M, Cha SH, Sekine T, Endou H: Characterization of methotrexate transport and its drug interactions with human organic anion transporters. J Pharmacol Exp Ther. 2002 Aug;302(2):666-71. [PubMed:12130730 ]
  5. Sweet DH, Chan LM, Walden R, Yang XP, Miller DS, Pritchard JB: Organic anion transporter 3 (Slc22a8) is a dicarboxylate exchanger indirectly coupled to the Na+ gradient. Am J Physiol Renal Physiol. 2003 Apr;284(4):F763-9. Epub 2002 Dec 17. [PubMed:12488248 ]
  6. Berman HM, Westbrook J, Feng Z, Gilliland G, Bhat TN, Weissig H, Shindyalov IN, Bourne PE: The Protein Data Bank. Nucleic Acids Res. 2000 Jan 1;28(1):235-42. [PubMed:10592235 ]
Pharmacological action
General Function:
Receptor binding
Specific Function:
Structural component of the gap junctions and the hemichannels. May play a role as a Ca(2+)-leak channel to regulate ER Ca(2+) homeostasis.
Gene Name:
Uniprot ID:
Uniprot Name:
Molecular Weight:
48049.555 Da
  1. Silverman W, Locovei S, Dahl G: Probenecid, a gout remedy, inhibits pannexin 1 channels. Am J Physiol Cell Physiol. 2008 Sep;295(3):C761-7. doi: 10.1152/ajpcell.00227.2008. Epub 2008 Jul 2. [PubMed:18596212 ]
  2. Ransford GA, Fregien N, Qiu F, Dahl G, Conner GE, Salathe M: Pannexin 1 contributes to ATP release in airway epithelia. Am J Respir Cell Mol Biol. 2009 Nov;41(5):525-34. doi: 10.1165/rcmb.2008-0367OC. Epub 2009 Feb 12. [PubMed:19213873 ]
  3. Ma W, Hui H, Pelegrin P, Surprenant A: Pharmacological characterization of pannexin-1 currents expressed in mammalian cells. J Pharmacol Exp Ther. 2009 Feb;328(2):409-18. doi: 10.1124/jpet.108.146365. Epub 2008 Nov 20. [PubMed:19023039 ]
  4. Silverman WR, de Rivero Vaccari JP, Locovei S, Qiu F, Carlsson SK, Scemes E, Keane RW, Dahl G: The pannexin 1 channel activates the inflammasome in neurons and astrocytes. J Biol Chem. 2009 Jul 3;284(27):18143-51. doi: 10.1074/jbc.M109.004804. Epub 2009 May 5. [PubMed:19416975 ]
  5. Bunse S, Locovei S, Schmidt M, Qiu F, Zoidl G, Dahl G, Dermietzel R: The potassium channel subunit Kvbeta3 interacts with pannexin 1 and attenuates its sensitivity to changes in redox potentials. FEBS J. 2009 Nov;276(21):6258-70. doi: 10.1111/j.1742-4658.2009.07334.x. Epub 2009 Sep 24. [PubMed:19780818 ]
Pharmacological action
General Function:
Gustducin-coupled receptor implicated in the perception of bitter compounds in the oral cavity and the gastrointestinal tract. Signals through PLCB2 and the calcium-regulated cation channel TRPM5.
Specific Function:
Bitter taste receptor activity
Gene Name:
Uniprot ID:
Uniprot Name:
Taste receptor type 2 member 16
Molecular Weight:
33985.52 Da
  1. Greene TA, Alarcon S, Thomas A, Berdougo E, Doranz BJ, Breslin PA, Rucker JB: Probenecid inhibits the human bitter taste receptor TAS2R16 and suppresses bitter perception of salicin. PLoS One. 2011;6(5):e20123. doi: 10.1371/journal.pone.0020123. Epub 2011 May 24. [PubMed:21629661 ]


Pharmacological action
General Function:
Steroid hydroxylase activity
Specific Function:
Cytochromes P450 are a group of heme-thiolate monooxygenases. In liver microsomes, this enzyme is involved in an NADPH-dependent electron transport pathway. It oxidizes a variety of structurally unrelated compounds, including steroids, fatty acids, and xenobiotics. This enzyme contributes to the wide pharmacokinetics variability of the metabolism of drugs such as S-warfarin, diclofenac, phenyto...
Gene Name:
Uniprot ID:
Uniprot Name:
Cytochrome P450 2C9
Molecular Weight:
55627.365 Da
  1. Preissner S, Kroll K, Dunkel M, Senger C, Goldsobel G, Kuzman D, Guenther S, Winnenburg R, Schroeder M, Preissner R: SuperCYP: a comprehensive database on Cytochrome P450 enzymes including a tool for analysis of CYP-drug interactions. Nucleic Acids Res. 2010 Jan;38(Database issue):D237-43. doi: 10.1093/nar/gkp970. Epub 2009 Nov 24. [PubMed:19934256 ]
  2. Drug Interactions: Cytochrome P450 Drug Interaction Table [Link]
Pharmacological action
General Function:
Steroid hydroxylase activity
Specific Function:
Responsible for the metabolism of a number of therapeutic agents such as the anticonvulsant drug S-mephenytoin, omeprazole, proguanil, certain barbiturates, diazepam, propranolol, citalopram and imipramine.
Gene Name:
Uniprot ID:
Uniprot Name:
Cytochrome P450 2C19
Molecular Weight:
55930.545 Da
  1. Preissner S, Kroll K, Dunkel M, Senger C, Goldsobel G, Kuzman D, Guenther S, Winnenburg R, Schroeder M, Preissner R: SuperCYP: a comprehensive database on Cytochrome P450 enzymes including a tool for analysis of CYP-drug interactions. Nucleic Acids Res. 2010 Jan;38(Database issue):D237-43. doi: 10.1093/nar/gkp970. Epub 2009 Nov 24. [PubMed:19934256 ]
  2. Drug Interactions: Cytochrome P450 Drug Interaction Table [Link]
Pharmacological action
General Function:
Steroid hydroxylase activity
Specific Function:
Cytochromes P450 are a group of heme-thiolate monooxygenases. In liver microsomes, this enzyme is involved in an NADPH-dependent electron transport pathway. It oxidizes a variety of structurally unrelated compounds, including steroids, fatty acids, and xenobiotics. In the epoxidation of arachidonic acid it generates only 14,15- and 11,12-cis-epoxyeicosatrienoic acids. It is the principal enzyme...
Gene Name:
Uniprot ID:
Uniprot Name:
Cytochrome P450 2C8
Molecular Weight:
55824.275 Da
  1. Preissner S, Kroll K, Dunkel M, Senger C, Goldsobel G, Kuzman D, Guenther S, Winnenburg R, Schroeder M, Preissner R: SuperCYP: a comprehensive database on Cytochrome P450 enzymes including a tool for analysis of CYP-drug interactions. Nucleic Acids Res. 2010 Jan;38(Database issue):D237-43. doi: 10.1093/nar/gkp970. Epub 2009 Nov 24. [PubMed:19934256 ]
Pharmacological action
General Function:
Vitamin d3 25-hydroxylase activity
Specific Function:
Cytochromes P450 are a group of heme-thiolate monooxygenases. In liver microsomes, this enzyme is involved in an NADPH-dependent electron transport pathway. It performs a variety of oxidation reactions (e.g. caffeine 8-oxidation, omeprazole sulphoxidation, midazolam 1'-hydroxylation and midazolam 4-hydroxylation) of structurally unrelated compounds, including steroids, fatty acids, and xenobiot...
Gene Name:
Uniprot ID:
Uniprot Name:
Cytochrome P450 3A4
Molecular Weight:
57342.67 Da
  1. Preissner S, Kroll K, Dunkel M, Senger C, Goldsobel G, Kuzman D, Guenther S, Winnenburg R, Schroeder M, Preissner R: SuperCYP: a comprehensive database on Cytochrome P450 enzymes including a tool for analysis of CYP-drug interactions. Nucleic Acids Res. 2010 Jan;38(Database issue):D237-43. doi: 10.1093/nar/gkp970. Epub 2009 Nov 24. [PubMed:19934256 ]


Pharmacological action
General Function:
Toxic substance binding
Specific Function:
Serum albumin, the main protein of plasma, has a good binding capacity for water, Ca(2+), Na(+), K(+), fatty acids, hormones, bilirubin and drugs. Its main function is the regulation of the colloidal osmotic pressure of blood. Major zinc transporter in plasma, typically binds about 80% of all plasma zinc.
Gene Name:
Uniprot ID:
Uniprot Name:
Serum albumin
Molecular Weight:
69365.94 Da
  1. Dundee JW, Halliday NJ, McMurray TJ: Aspirin and probenecid pretreatment influences the potency of thiopentone and the onset of action of midazolam. Eur J Anaesthesiol. 1986 May;3(3):247-51. [PubMed:3780693 ]
  2. Gewirtz DA, Holt SA: Protein binding as a component of drug interaction in cellular pharmacokinetic studies. Effects of probenecid on transport and accumulation of methotrexate in Ehrlich ascites tumor cells in vitro. Biochem Pharmacol. 1985 Mar 15;34(6):747-54. [PubMed:3977951 ]
  3. Hansen-Moller J, Schmit U: Rapid high-performance liquid chromatographic assay for the simultaneous determination of probenecid and its glucuronide in urine. Irreversible binding of probenecid to serum albumin. J Pharm Biomed Anal. 1991;9(1):65-73. [PubMed:2043725 ]


Pharmacological action
General Function:
Quaternary ammonium group transmembrane transporter activity
Specific Function:
Mediates tubular uptake of organic compounds from circulation. Mediates the influx of agmatine, dopamine, noradrenaline (norepinephrine), serotonin, choline, famotidine, ranitidine, histamin, creatinine, amantadine, memantine, acriflavine, 4-[4-(dimethylamino)-styryl]-N-methylpyridinium ASP, amiloride, metformin, N-1-methylnicotinamide (NMN), tetraethylammonium (TEA), 1-methyl-4-phenylpyridiniu...
Gene Name:
Uniprot ID:
Uniprot Name:
Solute carrier family 22 member 2
Molecular Weight:
62579.99 Da
  1. Arndt P, Volk C, Gorboulev V, Budiman T, Popp C, Ulzheimer-Teuber I, Akhoundova A, Koppatz S, Bamberg E, Nagel G, Koepsell H: Interaction of cations, anions, and weak base quinine with rat renal cation transporter rOCT2 compared with rOCT1. Am J Physiol Renal Physiol. 2001 Sep;281(3):F454-68. [PubMed:11502595 ]
Pharmacological action
General Function:
Secondary active organic cation transmembrane transporter activity
Specific Function:
Translocates a broad array of organic cations with various structures and molecular weights including the model compounds 1-methyl-4-phenylpyridinium (MPP), tetraethylammonium (TEA), N-1-methylnicotinamide (NMN), 4-(4-(dimethylamino)styryl)-N-methylpyridinium (ASP), the endogenous compounds choline, guanidine, histamine, epinephrine, adrenaline, noradrenaline and dopamine, and the drugs quinine...
Gene Name:
Uniprot ID:
Uniprot Name:
Solute carrier family 22 member 1
Molecular Weight:
61153.345 Da
  1. Arndt P, Volk C, Gorboulev V, Budiman T, Popp C, Ulzheimer-Teuber I, Akhoundova A, Koppatz S, Bamberg E, Nagel G, Koepsell H: Interaction of cations, anions, and weak base quinine with rat renal cation transporter rOCT2 compared with rOCT1. Am J Physiol Renal Physiol. 2001 Sep;281(3):F454-68. [PubMed:11502595 ]
Pharmacological action
General Function:
Organic anion transmembrane transporter activity
Specific Function:
May act as an inducible transporter in the biliary and intestinal excretion of organic anions. Acts as an alternative route for the export of bile acids and glucuronides from cholestatic hepatocytes (By similarity).
Gene Name:
Uniprot ID:
Uniprot Name:
Canalicular multispecific organic anion transporter 2
Molecular Weight:
169341.14 Da
  1. Zelcer N, Saeki T, Reid G, Beijnen JH, Borst P: Characterization of drug transport by the human multidrug resistance protein 3 (ABCC3). J Biol Chem. 2001 Dec 7;276(49):46400-7. [PubMed:11581266 ]
  2. Zeng H, Chen ZS, Belinsky MG, Rea PA, Kruh GD: Transport of methotrexate (MTX) and folates by multidrug resistance protein (MRP) 3 and MRP1: effect of polyglutamylation on MTX transport. Cancer Res. 2001 Oct 1;61(19):7225-32. [PubMed:11585759 ]
  3. Zamek-Gliszczynski MJ, Xiong H, Patel NJ, Turncliff RZ, Pollack GM, Brouwer KL: Pharmacokinetics of 5 (and 6)-carboxy-2',7'-dichlorofluorescein and its diacetate promoiety in the liver. J Pharmacol Exp Ther. 2003 Feb;304(2):801-9. [PubMed:12538836 ]
Pharmacological action
General Function:
Atpase activity, coupled to transmembrane movement of substances
Specific Function:
May be an organic anion pump relevant to cellular detoxification.
Gene Name:
Uniprot ID:
Uniprot Name:
Multidrug resistance-associated protein 4
Molecular Weight:
149525.33 Da
  1. van Aubel RA, Smeets PH, Peters JG, Bindels RJ, Russel FG: The MRP4/ABCC4 gene encodes a novel apical organic anion transporter in human kidney proximal tubules: putative efflux pump for urinary cAMP and cGMP. J Am Soc Nephrol. 2002 Mar;13(3):595-603. [PubMed:11856762 ]
  2. Chen ZS, Lee K, Walther S, Raftogianis RB, Kuwano M, Zeng H, Kruh GD: Analysis of methotrexate and folate transport by multidrug resistance protein 4 (ABCC4): MRP4 is a component of the methotrexate efflux system. Cancer Res. 2002 Jun 1;62(11):3144-50. [PubMed:12036927 ]
  3. Rius M, Nies AT, Hummel-Eisenbeiss J, Jedlitschky G, Keppler D: Cotransport of reduced glutathione with bile salts by MRP4 (ABCC4) localized to the basolateral hepatocyte membrane. Hepatology. 2003 Aug;38(2):374-84. [PubMed:12883481 ]
Pharmacological action
General Function:
Organic anion transmembrane transporter activity
Specific Function:
Acts as a multispecific organic anion pump which can transport nucleotide analogs.
Gene Name:
Uniprot ID:
Uniprot Name:
Multidrug resistance-associated protein 5
Molecular Weight:
160658.8 Da
  1. Jedlitschky G, Burchell B, Keppler D: The multidrug resistance protein 5 functions as an ATP-dependent export pump for cyclic nucleotides. J Biol Chem. 2000 Sep 29;275(39):30069-74. [PubMed:10893247 ]
Pharmacological action
General Function:
Symporter activity
Specific Function:
Proton-coupled monocarboxylate transporter. Catalyzes the rapid transport across the plasma membrane of many monocarboxylates such as lactate, pyruvate, branched-chain oxo acids derived from leucine, valine and isoleucine, and the ketone bodies acetoacetate, beta-hydroxybutyrate and acetate. Functions as high-affinity pyruvate transporter.
Gene Name:
Uniprot ID:
Uniprot Name:
Monocarboxylate transporter 2
Molecular Weight:
52199.745 Da
  1. Broer S, Broer A, Schneider HP, Stegen C, Halestrap AP, Deitmer JW: Characterization of the high-affinity monocarboxylate transporter MCT2 in Xenopus laevis oocytes. Biochem J. 1999 Aug 1;341 ( Pt 3):529-35. [PubMed:10417314 ]
Pharmacological action
General Function:
Symporter activity
Specific Function:
Sodium-ion dependent, high affinity carnitine transporter. Involved in the active cellular uptake of carnitine. Transports one sodium ion with one molecule of carnitine. Also transports organic cations such as tetraethylammonium (TEA) without the involvement of sodium. Also relative uptake activity ratio of carnitine to TEA is 11.3.
Gene Name:
Uniprot ID:
Uniprot Name:
Solute carrier family 22 member 5
Molecular Weight:
62751.08 Da
  1. Ohashi R, Tamai I, Yabuuchi H, Nezu JI, Oku A, Sai Y, Shimane M, Tsuji A: Na(+)-dependent carnitine transport by organic cation transporter (OCTN2): its pharmacological and toxicological relevance. J Pharmacol Exp Ther. 1999 Nov;291(2):778-84. [PubMed:10525100 ]
Pharmacological action
General Function:
Transporter activity
Specific Function:
Isoform 1: May participate directly in the active transport of drugs into subcellular organelles or influence drug distribution indirectly. Transports glutathione conjugates as leukotriene-c4 (LTC4) and N-ethylmaleimide S-glutathione (NEM-GS).Isoform 2: Inhibits TNF-alpha-mediated apoptosis through blocking one or more caspases.
Gene Name:
Uniprot ID:
Uniprot Name:
Multidrug resistance-associated protein 6
Molecular Weight:
164904.81 Da
  1. Ilias A, Urban Z, Seidl TL, Le Saux O, Sinko E, Boyd CD, Sarkadi B, Varadi A: Loss of ATP-dependent transport activity in pseudoxanthoma elasticum-associated mutants of human ABCC6 (MRP6). J Biol Chem. 2002 May 10;277(19):16860-7. Epub 2002 Mar 5. [PubMed:11880368 ]
Pharmacological action
General Function:
Xenobiotic-transporting atpase activity
Specific Function:
Energy-dependent efflux pump responsible for decreased drug accumulation in multidrug-resistant cells.
Gene Name:
Uniprot ID:
Uniprot Name:
Multidrug resistance protein 1
Molecular Weight:
141477.255 Da
  1. Gao J, Murase O, Schowen RL, Aube J, Borchardt RT: A functional assay for quantitation of the apparent affinities of ligands of P-glycoprotein in Caco-2 cells. Pharm Res. 2001 Feb;18(2):171-6. [PubMed:11405287 ]
  2. Honda Y, Ushigome F, Koyabu N, Morimoto S, Shoyama Y, Uchiumi T, Kuwano M, Ohtani H, Sawada Y: Effects of grapefruit juice and orange juice components on P-glycoprotein- and MRP2-mediated drug efflux. Br J Pharmacol. 2004 Dec;143(7):856-64. Epub 2004 Oct 25. [PubMed:15504753 ]
  3. Minderman H, Brooks TA, O'Loughlin KL, Ojima I, Bernacki RJ, Baer MR: Broad-spectrum modulation of ATP-binding cassette transport proteins by the taxane derivatives ortataxel (IDN-5109, BAY 59-8862) and tRA96023. Cancer Chemother Pharmacol. 2004 May;53(5):363-9. Epub 2004 Jan 27. [PubMed:15060738 ]
Pharmacological action
General Function:
Transporter activity
Specific Function:
Mediates export of organic anions and drugs from the cytoplasm. Mediates ATP-dependent transport of glutathione and glutathione conjugates, leukotriene C4, estradiol-17-beta-o-glucuronide, methotrexate, antiviral drugs and other xenobiotics. Confers resistance to anticancer drugs. Hydrolyzes ATP with low efficiency.
Gene Name:
Uniprot ID:
Uniprot Name:
Multidrug resistance-associated protein 1
Molecular Weight:
171589.5 Da
  1. Hong J, Lambert JD, Lee SH, Sinko PJ, Yang CS: Involvement of multidrug resistance-associated proteins in regulating cellular levels of (-)-epigallocatechin-3-gallate and its methyl metabolites. Biochem Biophys Res Commun. 2003 Oct 10;310(1):222-7. [PubMed:14511674 ]
  2. Ilias A, Urban Z, Seidl TL, Le Saux O, Sinko E, Boyd CD, Sarkadi B, Varadi A: Loss of ATP-dependent transport activity in pseudoxanthoma elasticum-associated mutants of human ABCC6 (MRP6). J Biol Chem. 2002 May 10;277(19):16860-7. Epub 2002 Mar 5. [PubMed:11880368 ]
  3. Payen L, Delugin L, Courtois A, Trinquart Y, Guillouzo A, Fardel O: Reversal of MRP-mediated multidrug resistance in human lung cancer cells by the antiprogestatin drug RU486. Biochem Biophys Res Commun. 1999 May 19;258(3):513-8. [PubMed:10329417 ]
  4. Bakos E, Evers R, Sinko E, Varadi A, Borst P, Sarkadi B: Interactions of the human multidrug resistance proteins MRP1 and MRP2 with organic anions. Mol Pharmacol. 2000 Apr;57(4):760-8. [PubMed:10727523 ]
  5. Hooijberg JH, Broxterman HJ, Kool M, Assaraf YG, Peters GJ, Noordhuis P, Scheper RJ, Borst P, Pinedo HM, Jansen G: Antifolate resistance mediated by the multidrug resistance proteins MRP1 and MRP2. Cancer Res. 1999 Jun 1;59(11):2532-5. [PubMed:10363967 ]
  6. Legrand O, Simonin G, Beauchamp-Nicoud A, Zittoun R, Marie JP: Simultaneous activity of MRP1 and Pgp is correlated with in vitro resistance to daunorubicin and with in vivo resistance in adult acute myeloid leukemia. Blood. 1999 Aug 1;94(3):1046-56. [PubMed:10419897 ]
  7. Legrand O, Simonin G, Perrot JY, Zittoun R, Marie JP: Both Pgp and MRP1 activities using calcein-AM contribute to drug resistance in AML. Adv Exp Med Biol. 1999;457:161-75. [PubMed:10500791 ]
  8. Evers R, de Haas M, Sparidans R, Beijnen J, Wielinga PR, Lankelma J, Borst P: Vinblastine and sulfinpyrazone export by the multidrug resistance protein MRP2 is associated with glutathione export. Br J Cancer. 2000 Aug;83(3):375-83. [PubMed:10917554 ]
  9. Issandou M, Grand-Perret T: Multidrug resistance P-glycoprotein is not involved in cholesterol esterification. Biochem Biophys Res Commun. 2000 Dec 20;279(2):369-77. [PubMed:11118294 ]
Pharmacological action
General Function:
Sodium-independent organic anion transmembrane transporter activity
Specific Function:
Mediates the Na(+)-independent transport of organic anions such as sulfobromophthalein (BSP) and conjugated (taurocholate) and unconjugated (cholate) bile acids (By similarity). Selectively inhibited by the grapefruit juice component naringin.
Gene Name:
Uniprot ID:
Uniprot Name:
Solute carrier organic anion transporter family member 1A2
Molecular Weight:
74144.105 Da
  1. Sugiyama D, Kusuhara H, Shitara Y, Abe T, Meier PJ, Sekine T, Endou H, Suzuki H, Sugiyama Y: Characterization of the efflux transport of 17beta-estradiol-D-17beta-glucuronide from the brain across the blood-brain barrier. J Pharmacol Exp Ther. 2001 Jul;298(1):316-22. [PubMed:11408557 ]
  2. Kullak-Ublick GA, Hagenbuch B, Stieger B, Wolkoff AW, Meier PJ: Functional characterization of the basolateral rat liver organic anion transporting polypeptide. Hepatology. 1994 Aug;20(2):411-6. [PubMed:8045503 ]
Pharmacological action
General Function:
Symporter activity
Specific Function:
Proton-coupled monocarboxylate transporter. Catalyzes the rapid transport across the plasma membrane of many monocarboxylates such as lactate, pyruvate, branched-chain oxo acids derived from leucine, valine and isoleucine, and the ketone bodies acetoacetate, beta-hydroxybutyrate and acetate. Depending on the tissue and on cicumstances, mediates the import or export of lactic acid and ketone bod...
Gene Name:
Uniprot ID:
Uniprot Name:
Monocarboxylate transporter 1
Molecular Weight:
53943.685 Da
  1. Broer S, Broer A, Schneider HP, Stegen C, Halestrap AP, Deitmer JW: Characterization of the high-affinity monocarboxylate transporter MCT2 in Xenopus laevis oocytes. Biochem J. 1999 Aug 1;341 ( Pt 3):529-35. [PubMed:10417314 ]
Pharmacological action
General Function:
Virus receptor activity
Specific Function:
The hepatic sodium/bile acid uptake system exhibits broad substrate specificity and transports various non-bile acid organic compounds as well. It is strictly dependent on the extracellular presence of sodium.(Microbial infection) Acts as a receptor for hepatitis B virus.
Gene Name:
Uniprot ID:
Uniprot Name:
Sodium/bile acid cotransporter
Molecular Weight:
38118.64 Da
  1. Hagenbuch B, Stieger B, Foguet M, Lubbert H, Meier PJ: Functional expression cloning and characterization of the hepatocyte Na+/bile acid cotransport system. Proc Natl Acad Sci U S A. 1991 Dec 1;88(23):10629-33. [PubMed:1961729 ]
Pharmacological action
General Function:
Sodium-independent organic anion transmembrane transporter activity
Specific Function:
Involved in the renal elimination of endogenous and exogenous organic anions. Functions as organic anion exchanger when the uptake of one molecule of organic anion is coupled with an efflux of one molecule of endogenous dicarboxylic acid (glutarate, ketoglutarate, etc). Mediates the sodium-independent uptake of 2,3-dimercapto-1-propanesulfonic acid (DMPS) (By similarity). Mediates the sodium-in...
Gene Name:
Uniprot ID:
Uniprot Name:
Solute carrier family 22 member 6
Molecular Weight:
61815.78 Da
  1. Cihlar T, Ho ES: Fluorescence-based assay for the interaction of small molecules with the human renal organic anion transporter 1. Anal Biochem. 2000 Jul 15;283(1):49-55. [PubMed:10929807 ]
  2. Mulato AS, Ho ES, Cihlar T: Nonsteroidal anti-inflammatory drugs efficiently reduce the transport and cytotoxicity of adefovir mediated by the human renal organic anion transporter 1. J Pharmacol Exp Ther. 2000 Oct;295(1):10-5. [PubMed:10991954 ]
  3. Takeda M, Narikawa S, Hosoyamada M, Cha SH, Sekine T, Endou H: Characterization of organic anion transport inhibitors using cells stably expressing human organic anion transporters. Eur J Pharmacol. 2001 May 11;419(2-3):113-20. [PubMed:11426832 ]
  4. Jung KY, Takeda M, Kim DK, Tojo A, Narikawa S, Yoo BS, Hosoyamada M, Cha SH, Sekine T, Endou H: Characterization of ochratoxin A transport by human organic anion transporters. Life Sci. 2001 Sep 21;69(18):2123-35. [PubMed:11669456 ]
  5. Ichida K, Hosoyamada M, Kimura H, Takeda M, Utsunomiya Y, Hosoya T, Endou H: Urate transport via human PAH transporter hOAT1 and its gene structure. Kidney Int. 2003 Jan;63(1):143-55. [PubMed:12472777 ]
  6. Takeda M, Khamdang S, Narikawa S, Kimura H, Hosoyamada M, Cha SH, Sekine T, Endou H: Characterization of methotrexate transport and its drug interactions with human organic anion transporters. J Pharmacol Exp Ther. 2002 Aug;302(2):666-71. [PubMed:12130730 ]
  7. Lu R, Chan BS, Schuster VL: Cloning of the human kidney PAH transporter: narrow substrate specificity and regulation by protein kinase C. Am J Physiol. 1999 Feb;276(2 Pt 2):F295-303. [PubMed:9950961 ]
  8. Race JE, Grassl SM, Williams WJ, Holtzman EJ: Molecular cloning and characterization of two novel human renal organic anion transporters (hOAT1 and hOAT3). Biochem Biophys Res Commun. 1999 Feb 16;255(2):508-14. [PubMed:10049739 ]
  9. Khamdang S, Takeda M, Shimoda M, Noshiro R, Narikawa S, Huang XL, Enomoto A, Piyachaturawat P, Endou H: Interactions of human- and rat-organic anion transporters with pravastatin and cimetidine. J Pharmacol Sci. 2004 Feb;94(2):197-202. [PubMed:14978359 ]
  10. Kuze K, Graves P, Leahy A, Wilson P, Stuhlmann H, You G: Heterologous expression and functional characterization of a mouse renal organic anion transporter in mammalian cells. J Biol Chem. 1999 Jan 15;274(3):1519-24. [PubMed:9880528 ]
  11. Uwai Y, Saito H, Inui K: Interaction between methotrexate and nonsteroidal anti-inflammatory drugs in organic anion transporter. Eur J Pharmacol. 2000 Dec 1;409(1):31-6. [PubMed:11099697 ]
  12. Tsuda M, Sekine T, Takeda M, Cha SH, Kanai Y, Kimura M, Endou H: Transport of ochratoxin A by renal multispecific organic anion transporter 1. J Pharmacol Exp Ther. 1999 Jun;289(3):1301-5. [PubMed:10336520 ]
  13. Takeda M, Tojo A, Sekine T, Hosoyamada M, Kanai Y, Endou H: Role of organic anion transporter 1 (OAT1) in cephaloridine (CER)-induced nephrotoxicity. Kidney Int. 1999 Dec;56(6):2128-36. [PubMed:10594788 ]
  14. Sugiyama D, Kusuhara H, Shitara Y, Abe T, Meier PJ, Sekine T, Endou H, Suzuki H, Sugiyama Y: Characterization of the efflux transport of 17beta-estradiol-D-17beta-glucuronide from the brain across the blood-brain barrier. J Pharmacol Exp Ther. 2001 Jul;298(1):316-22. [PubMed:11408557 ]
  15. Uwai Y, Iwamoto K: Transport of aminopterin by human organic anion transporters hOAT1 and hOAT3: Comparison with methotrexate. Drug Metab Pharmacokinet. 2010;25(2):163-9. [PubMed:20460822 ]
Pharmacological action
General Function:
Sodium-independent organic anion transmembrane transporter activity
Specific Function:
Not Available
Gene Name:
Uniprot ID:
Uniprot Name:
Solute carrier family 22 member 10
Molecular Weight:
60256.57 Da
  1. Youngblood GL, Sweet DH: Identification and functional assessment of the novel murine organic anion transporter Oat5 (Slc22a19) expressed in kidney. Am J Physiol Renal Physiol. 2004 Aug;287(2):F236-44. Epub 2004 Apr 6. [PubMed:15068970 ]
Pharmacological action
General Function:
Sodium-independent organic anion transmembrane transporter activity
Specific Function:
Plays an important role in the excretion/detoxification of endogenous and exogenous organic anions, especially from the brain and kidney. Involved in the transport basolateral of steviol, fexofenadine. Transports benzylpenicillin (PCG), estrone-3-sulfate (E1S), cimetidine (CMD), 2,4-dichloro-phenoxyacetate (2,4-D), p-amino-hippurate (PAH), acyclovir (ACV) and ochratoxin (OTA).
Gene Name:
Uniprot ID:
Uniprot Name:
Solute carrier family 22 member 8
Molecular Weight:
59855.585 Da
  1. Cha SH, Sekine T, Fukushima JI, Kanai Y, Kobayashi Y, Goya T, Endou H: Identification and characterization of human organic anion transporter 3 expressing predominantly in the kidney. Mol Pharmacol. 2001 May;59(5):1277-86. [PubMed:11306713 ]
  2. Takeda M, Narikawa S, Hosoyamada M, Cha SH, Sekine T, Endou H: Characterization of organic anion transport inhibitors using cells stably expressing human organic anion transporters. Eur J Pharmacol. 2001 May 11;419(2-3):113-20. [PubMed:11426832 ]
  3. Jung KY, Takeda M, Kim DK, Tojo A, Narikawa S, Yoo BS, Hosoyamada M, Cha SH, Sekine T, Endou H: Characterization of ochratoxin A transport by human organic anion transporters. Life Sci. 2001 Sep 21;69(18):2123-35. [PubMed:11669456 ]
  4. Takeda M, Khamdang S, Narikawa S, Kimura H, Hosoyamada M, Cha SH, Sekine T, Endou H: Characterization of methotrexate transport and its drug interactions with human organic anion transporters. J Pharmacol Exp Ther. 2002 Aug;302(2):666-71. [PubMed:12130730 ]
  5. Khamdang S, Takeda M, Shimoda M, Noshiro R, Narikawa S, Huang XL, Enomoto A, Piyachaturawat P, Endou H: Interactions of human- and rat-organic anion transporters with pravastatin and cimetidine. J Pharmacol Sci. 2004 Feb;94(2):197-202. [PubMed:14978359 ]
  6. Ohtsuki S, Kikkawa T, Mori S, Hori S, Takanaga H, Otagiri M, Terasaki T: Mouse reduced in osteosclerosis transporter functions as an organic anion transporter 3 and is localized at abluminal membrane of blood-brain barrier. J Pharmacol Exp Ther. 2004 Jun;309(3):1273-81. Epub 2004 Feb 4. [PubMed:14762099 ]
  7. Mori S, Takanaga H, Ohtsuki S, Deguchi T, Kang YS, Hosoya K, Terasaki T: Rat organic anion transporter 3 (rOAT3) is responsible for brain-to-blood efflux of homovanillic acid at the abluminal membrane of brain capillary endothelial cells. J Cereb Blood Flow Metab. 2003 Apr;23(4):432-40. [PubMed:12679720 ]
  8. Kusuhara H, Sekine T, Utsunomiya-Tate N, Tsuda M, Kojima R, Cha SH, Sugiyama Y, Kanai Y, Endou H: Molecular cloning and characterization of a new multispecific organic anion transporter from rat brain. J Biol Chem. 1999 May 7;274(19):13675-80. [PubMed:10224140 ]
  9. Sugiyama D, Kusuhara H, Shitara Y, Abe T, Meier PJ, Sekine T, Endou H, Suzuki H, Sugiyama Y: Characterization of the efflux transport of 17beta-estradiol-D-17beta-glucuronide from the brain across the blood-brain barrier. J Pharmacol Exp Ther. 2001 Jul;298(1):316-22. [PubMed:11408557 ]
  10. Nagata Y, Kusuhara H, Endou H, Sugiyama Y: Expression and functional characterization of rat organic anion transporter 3 (rOat3) in the choroid plexus. Mol Pharmacol. 2002 May;61(5):982-8. [PubMed:11961115 ]
  11. Uwai Y, Iwamoto K: Transport of aminopterin by human organic anion transporters hOAT1 and hOAT3: Comparison with methotrexate. Drug Metab Pharmacokinet. 2010;25(2):163-9. [PubMed:20460822 ]
  12. Lai Y, Sampson KE, Balogh LM, Brayman TG, Cox SR, Adams WJ, Kumar V, Stevens JC: Preclinical and clinical evidence for the collaborative transport and renal secretion of an oxazolidinone antibiotic by organic anion transporter 3 (OAT3/SLC22A8) and multidrug and toxin extrusion protein 1 (MATE1/SLC47A1). J Pharmacol Exp Ther. 2010 Sep 1;334(3):936-44. doi: 10.1124/jpet.110.170753. Epub 2010 Jun 2. [PubMed:20519552 ]
Pharmacological action
General Function:
Organic anion transmembrane transporter activity
Specific Function:
Mediates hepatobiliary excretion of numerous organic anions. May function as a cellular cisplatin transporter.
Gene Name:
Uniprot ID:
Uniprot Name:
Canalicular multispecific organic anion transporter 1
Molecular Weight:
174205.64 Da
  1. Hong J, Lambert JD, Lee SH, Sinko PJ, Yang CS: Involvement of multidrug resistance-associated proteins in regulating cellular levels of (-)-epigallocatechin-3-gallate and its methyl metabolites. Biochem Biophys Res Commun. 2003 Oct 10;310(1):222-7. [PubMed:14511674 ]
  2. Ilias A, Urban Z, Seidl TL, Le Saux O, Sinko E, Boyd CD, Sarkadi B, Varadi A: Loss of ATP-dependent transport activity in pseudoxanthoma elasticum-associated mutants of human ABCC6 (MRP6). J Biol Chem. 2002 May 10;277(19):16860-7. Epub 2002 Mar 5. [PubMed:11880368 ]
  3. Bakos E, Evers R, Sinko E, Varadi A, Borst P, Sarkadi B: Interactions of the human multidrug resistance proteins MRP1 and MRP2 with organic anions. Mol Pharmacol. 2000 Apr;57(4):760-8. [PubMed:10727523 ]
  4. Horikawa M, Kato Y, Tyson CA, Sugiyama Y: The potential for an interaction between MRP2 (ABCC2) and various therapeutic agents: probenecid as a candidate inhibitor of the biliary excretion of irinotecan metabolites. Drug Metab Pharmacokinet. 2002;17(1):23-33. [PubMed:15618649 ]
  5. Zamek-Gliszczynski MJ, Xiong H, Patel NJ, Turncliff RZ, Pollack GM, Brouwer KL: Pharmacokinetics of 5 (and 6)-carboxy-2',7'-dichlorofluorescein and its diacetate promoiety in the liver. J Pharmacol Exp Ther. 2003 Feb;304(2):801-9. [PubMed:12538836 ]
  6. Dahan A, Sabit H, Amidon GL: The H2 receptor antagonist nizatidine is a P-glycoprotein substrate: characterization of its intestinal epithelial cell efflux transport. AAPS J. 2009 Jun;11(2):205-13. doi: 10.1208/s12248-009-9092-5. Epub 2009 Mar 25. [PubMed:19319690 ]
  7. Chen C, Scott D, Hanson E, Franco J, Berryman E, Volberg M, Liu X: Impact of Mrp2 on the biliary excretion and intestinal absorption of furosemide, probenecid, and methotrexate using Eisai hyperbilirubinemic rats. Pharm Res. 2003 Jan;20(1):31-7. [PubMed:12608533 ]
Pharmacological action
General Function:
Purine nucleotide transmembrane transporter activity
Specific Function:
Participates in physiological processes involving bile acids, conjugated steroids and cyclic nucleotides. Enhances the cellular extrusion of cAMP and cGMP. Stimulates the ATP-dependent uptake of a range of physiological and synthetic lipophilic anions, including the glutathione S-conjugates leukotriene C4 and dinitrophenyl S-glutathione, steroid sulfates such as dehydroepiandrosterone 3-sulfate...
Gene Name:
Uniprot ID:
Uniprot Name:
ATP-binding cassette sub-family C member 11
Molecular Weight:
154299.625 Da
  1. Chen ZS, Guo Y, Belinsky MG, Kotova E, Kruh GD: Transport of bile acids, sulfated steroids, estradiol 17-beta-D-glucuronide, and leukotriene C4 by human multidrug resistance protein 8 (ABCC11). Mol Pharmacol. 2005 Feb;67(2):545-57. Epub 2004 Nov 10. [PubMed:15537867 ]
Pharmacological action
General Function:
Sodium-independent organic anion transmembrane transporter activity
Specific Function:
Mediates saturable uptake of estrone sulfate, dehydroepiandrosterone sulfate and related compounds.
Gene Name:
Uniprot ID:
Uniprot Name:
Solute carrier family 22 member 11
Molecular Weight:
59970.945 Da
  1. Enomoto A, Takeda M, Shimoda M, Narikawa S, Kobayashi Y, Kobayashi Y, Yamamoto T, Sekine T, Cha SH, Niwa T, Endou H: Interaction of human organic anion transporters 2 and 4 with organic anion transport inhibitors. J Pharmacol Exp Ther. 2002 Jun;301(3):797-802. [PubMed:12023506 ]
  2. Babu E, Takeda M, Narikawa S, Kobayashi Y, Enomoto A, Tojo A, Cha SH, Sekine T, Sakthisekaran D, Endou H: Role of human organic anion transporter 4 in the transport of ochratoxin A. Biochim Biophys Acta. 2002 Jun 12;1590(1-3):64-75. [PubMed:12063169 ]
  3. Takeda M, Khamdang S, Narikawa S, Kimura H, Hosoyamada M, Cha SH, Sekine T, Endou H: Characterization of methotrexate transport and its drug interactions with human organic anion transporters. J Pharmacol Exp Ther. 2002 Aug;302(2):666-71. [PubMed:12130730 ]
  4. Khamdang S, Takeda M, Shimoda M, Noshiro R, Narikawa S, Huang XL, Enomoto A, Piyachaturawat P, Endou H: Interactions of human- and rat-organic anion transporters with pravastatin and cimetidine. J Pharmacol Sci. 2004 Feb;94(2):197-202. [PubMed:14978359 ]
Pharmacological action
General Function:
Thyroid hormone transmembrane transporter activity
Specific Function:
Mediates the Na(+)-independent high affinity transport of organic anions such as the thyroid hormones thyroxine (T4) and rT3. Other potential substrates, such as triiodothyronine (T3), 17-beta-glucuronosyl estradiol, estrone-3-sulfate and sulfobromophthalein (BSP) are transported with much lower efficiency. May play a signifiant role in regulating T4 flux into and out of the brain (By similarity).
Gene Name:
Uniprot ID:
Uniprot Name:
Solute carrier organic anion transporter family member 1C1
Molecular Weight:
78695.625 Da
  1. Tohyama K, Kusuhara H, Sugiyama Y: Involvement of multispecific organic anion transporter, Oatp14 (Slc21a14), in the transport of thyroxine across the blood-brain barrier. Endocrinology. 2004 Sep;145(9):4384-91. Epub 2004 May 27. [PubMed:15166123 ]
Pharmacological action
General Function:
Sodium-independent organic anion transmembrane transporter activity
Specific Function:
Mediates sodium-independent multispecific organic anion transport. Transport of prostaglandin E2, prostaglandin F2, tetracycline, bumetanide, estrone sulfate, glutarate, dehydroepiandrosterone sulfate, allopurinol, 5-fluorouracil, paclitaxel, L-ascorbic acid, salicylate, ethotrexate, and alpha-ketoglutarate.
Gene Name:
Uniprot ID:
Uniprot Name:
Solute carrier family 22 member 7
Molecular Weight:
60025.025 Da
  1. Enomoto A, Takeda M, Shimoda M, Narikawa S, Kobayashi Y, Kobayashi Y, Yamamoto T, Sekine T, Cha SH, Niwa T, Endou H: Interaction of human organic anion transporters 2 and 4 with organic anion transport inhibitors. J Pharmacol Exp Ther. 2002 Jun;301(3):797-802. [PubMed:12023506 ]
  2. Khamdang S, Takeda M, Shimoda M, Noshiro R, Narikawa S, Huang XL, Enomoto A, Piyachaturawat P, Endou H: Interactions of human- and rat-organic anion transporters with pravastatin and cimetidine. J Pharmacol Sci. 2004 Feb;94(2):197-202. [PubMed:14978359 ]
Pharmacological action
General Function:
Urate transmembrane transporter activity
Specific Function:
Required for efficient urate re-absorption in the kidney. Regulates blood urate levels. Mediates saturable urate uptake by facilitating the exchange of urate against organic anions.
Gene Name:
Uniprot ID:
Uniprot Name:
Solute carrier family 22 member 12
Molecular Weight:
59629.57 Da
  1. Shin HJ, Takeda M, Enomoto A, Fujimura M, Miyazaki H, Anzai N, Endou H: Interactions of urate transporter URAT1 in human kidney with uricosuric drugs. Nephrology (Carlton). 2011 Feb;16(2):156-62. doi: 10.1111/j.1440-1797.2010.01368.x. [PubMed:21272127 ]
Pharmacological action
General Function:
Sugar:proton symporter activity
Specific Function:
Transport urate and fructose. May have a role in the urate reabsorption by proximal tubules. Also transports glucose at low rate.
Gene Name:
Uniprot ID:
Uniprot Name:
Solute carrier family 2, facilitated glucose transporter member 9
Molecular Weight:
58701.205 Da
  1. Link [Link]
Drug created on June 13, 2005 07:24 / Updated on September 01, 2017 10:35