You are using an unsupported browser. Please upgrade your browser to a newer version to get the best experience on DrugBank.
Accession NumberDB00795  (APRD00152, DB08518)
TypeSmall Molecule
DescriptionA drug that is used in the management of inflammatory bowel diseases. Its activity is generally considered to lie in its metabolic breakdown product, 5-aminosalicylic acid (see mesalamine) released in the colon. (From Martindale, The Extra Pharmacopoeia, 30th ed, p907)
2-Hydroxy-5-((4-((2-pyridinylamino)sulfonyl)phenyl)azo)benzoic acid
2-Hydroxy-5-[4-(pyridin-2-ylsulfamoyl)-phenylazo]-benzoic acid
5-((P-(2-Pyridylsulfamoyl)phenyl)azo)salicylic acid
5-(4-(2-Pyridylsulfamoyl)phenylazo)-2-hydroxybenzoic acid
5-(P-(2-Pyridylsulfamyl)phenylazo)salicylic acid
External IDs SSZ
Product Ingredients Not Available
Approved Prescription Products
NameDosageStrengthRouteLabellerMarketing StartMarketing End
AzulfidineTablet500 mg/1OralPharmacia & Upjohn Inc1950-06-20Not applicableUs
Azulfidine En-tabsTablet, delayed release500 mg/1OralPharmacia & Upjohn Inc1950-06-20Not applicableUs
Orb-sulfasalazine ECTablet, delayed release500 mgOralOrbus Pharma IncNot applicableNot applicableCanada
PMS-sulfasalazine 500mg/tab USPTablet500 mgOralPharmascience Inc1984-12-31Not applicableCanada
PMS-sulfasalazine-E.C. Tab 500mgTablet, delayed release500 mgOralPharmascience Inc1984-12-31Not applicableCanada
Ratio-sulfasalazine EnTablet, delayed release500 mgOralRatiopharm Inc Division Of Teva Canada Limited1986-12-312008-08-01Canada
Ratio-sulfasalazine Tab 500mgTablet500 mgOralRatiopharm Inc Division Of Teva Canada Limited1986-12-312008-08-01Canada
S.A.S. Enteric 500mgTablet, delayed release500 mgOralIcn Pharmaceuticals1979-12-312005-04-26Canada
Salazopyrin En-tabs 500 mgTablet, delayed release500 mgOralPfizer1995-12-31Not applicableCanada
Salazopyrin Enema 3.0gm/100mlSuspension3 gRectalKabi Pharmacia Canada Inc.1994-12-311996-09-10Canada
Salazopyrin Enema 3gm/100mlEnema3 gRectalPfizer1996-12-312006-08-02Canada
Salazopyrin Tab 500mgTablet500 mgOralPfizer1995-12-31Not applicableCanada
Sas Enema 3gm/100mlEnema3 gRectalIcn Pharmaceuticals1984-12-312005-04-26Canada
Sas Tab 500mgTablet500 mgOralIcn Pharmaceuticals1973-12-312005-04-26Canada
SulfasalazineTablet500 mg/1OralAphena Pharma Solutions Tennessee, Inc.2003-07-01Not applicableUs
SulfasalazineTablet, delayed release500 mg/1OralGreenstone, Llc2005-05-05Not applicableUs
SulfasalazineTablet500 mg/1OralA S Medication Solutions2003-07-01Not applicableUs
SulfasalazineTablet500 mg/1OralGreenstone, Llc2003-07-01Not applicableUs
SulfasalazineTablet500 mg/1OralAvera Mc Kennan Hospital2015-03-17Not applicableUs
SulfasalazineTablet500 mg/1OralA S Medication Solutions2003-07-01Not applicableUs
SulfasalazineTablet500 mg/1OralKaiser Foundations Hospitals2015-04-07Not applicableUs
SulfasalazineTablet500 mg/1OralMajor2000-08-18Not applicableUs
Approved Generic Prescription Products
NameDosageStrengthRouteLabellerMarketing StartMarketing End
Apo Sulfasalazine Tab 500mgTablet500 mgOralApotex Corporation1978-12-31Not applicableCanada
SulfasalazineTablet500 mg/1OralRemedy Repack2011-04-192016-10-13Us
SulfasalazineTablet500 mg/1OralPreferreed Pharmaceuticals Inc.2010-06-09Not applicableUs
SulfasalazineTablet500 mg/1OralRemedy Repack2011-11-18Not applicableUs
SulfasalazineTablet500 mg/1OralAv Pak2014-01-14Not applicableUs
SulfasalazineTablet500 mg/1OralA S Medication Solutions1982-10-01Not applicableUs
SulfasalazineTablet500 mg/1OralActavis Pharma Company1982-10-01Not applicableUs
SulfasalazineTablet500 mg/1OralPd Rx Pharmaceuticals, Inc.2002-01-11Not applicableUs
SulfasalazineTablet500 mg/1OralRemedy Repack2017-01-30Not applicableUs
SulfasalazineTablet500 mg/1OralBlenheim Pharmacal, Inc.2013-11-18Not applicableUs
SulfasalazineTablet500 mg/1Oralbryant ranch prepack1982-10-01Not applicableUs
SulfasalazineTablet500 mg/1OralAidarex Pharmaceuticals LLC2002-01-11Not applicableUs
SulfasalazineTablet500 mg/1OralQualitest2002-01-11Not applicableUs
SulfasalazineTablet500 mg/1OralRemedy Repack2010-11-152016-10-13Us
SulfasalazineTablet500 mg/1OralRemedy Repack2013-01-08Not applicableUs
Sulfasalazine Delayed-releaseTablet, delayed release500 mg/1OralQualitest2002-01-11Not applicableUs
Approved Over the Counter ProductsNot Available
Unapproved/Other Products Not Available
International Brands
AsasurfanChoseido Pharmaceutical
BomeconFu Seng
DisalazinAC Farma
EminapyrinTaiyo Pharmaceutical
LanofenTaisho Yakuhin
Pyralin ENPfizer
SalazopirinaJaba Recordati
Salazopyrin ENPfizer
Salazopyrin EN-TabsPharmacia
SulfacolDrug International
ZopyrinHan Lim
Brand mixturesNot Available
CAS number599-79-1
WeightAverage: 398.393
Monoisotopic: 398.068490268
Chemical FormulaC18H14N4O5S
2-hydroxy-5-[(E)-2-{4-[(pyridin-2-yl)sulfamoyl]phenyl}diazen-1-yl]benzoic acid
IndicationFor the treatment of Crohn's disease and rheumatoid arthritis as a second-line agent.
Structured Indications
PharmacodynamicsSulfasalazine is an anti-inflammatory indicated for the treatment of ulcerative colitis and rheumatoid arthritis.
Mechanism of actionThe mode of action of Sulfasalazine or its metabolites, 5-aminosalicylic acid (5-ASA) and sulfapyridine (SP), is still under investigation, but may be related to the anti-inflammatory and/or immunomodulatory properties that have been observed in animal and in vitro models, to its affinity for connective tissue, and/or to the relatively high concentration it reaches in serous fluids, the liver and intestinal walls, as demonstrated in autoradiographic studies in animals. In ulcerative colitis, clinical studies utilizing rectal administration of Sulfasalazine, SP and 5-ASA have indicated that the major therapeutic action may reside in the 5-ASA moiety. The relative contribution of the parent drug and the major metabolites in rheumatoid arthritis is unknown.
TargetKindPharmacological actionActionsOrganismUniProt ID
Arachidonate 5-lipoxygenaseProteinyes
HumanP09917 details
Prostaglandin G/H synthase 2Proteinyes
HumanP35354 details
Prostaglandin G/H synthase 1Proteinyes
HumanP23219 details
Peroxisome proliferator-activated receptor gammaProteinyes
HumanP37231 details
Inhibitor of nuclear factor kappa-B kinase subunit alphaProteinunknown
HumanO15111 details
Inhibitor of nuclear factor kappa-B kinase subunit betaProteinunknown
HumanO14920 details
Cystine/glutamate transporterProteinunknown
HumanQ9UPY5 details
Acetyl-CoA acetyltransferase, mitochondrialProteinunknown
HumanP24752 details
Thromboxane-A synthaseProteinunknown
HumanP24557 details
Phospholipase A2Proteinunknown
HumanP04054 details
Related Articles
AbsorptionNot Available
Volume of distribution
  • 7.5 ± 1.6 L
Protein bindingNot Available
MetabolismNot Available
Route of eliminationThe majority of 5-ASA stays within the colonic lumen and is excreted as 5-ASA and acetyl-5-ASA with the feces.
Half life5-10 hours
  • 1 L/h [IV administration]
ToxicityNot Available
Affected organisms
  • Humans and other mammals
PathwaysNot Available
Pharmacogenomic Effects/ADRs
Interacting Gene/EnzymeSNP RS IDsAllele nameGenotypeDefining ChangeType(s)DescriptionDetails
Arylamine N-acetyltransferase 1NAT1*14A---G > A | T > A | C > AADR InferredIncreased risk of Sulfapyridine dose related adverse effects, including skin rash. Details
Arylamine N-acetyltransferase 1NAT1*14B---G > AADR InferredIncreased risk of Sulfapyridine dose related adverse effects, including skin rash. Details
Arylamine N-acetyltransferase 1NAT1*15---C > TADR InferredIncreased risk of Sulfapyridine dose related adverse effects, including skin rash. Details
Arylamine N-acetyltransferase 1NAT1*17---C > TADR InferredIncreased risk of Sulfapyridine dose related adverse effects, including skin rash. Details
Arylamine N-acetyltransferase 1NAT1*19A---C > TADR InferredIncreased risk of Sulfapyridine dose related adverse effects, including skin rash. Details
Arylamine N-acetyltransferase 1NAT1*19B---C > T | C > TADR InferredIncreased risk of Sulfapyridine dose related adverse effects, including skin rash. Details
Arylamine N-acetyltransferase 1NAT1*22---A > TADR InferredIncreased risk of Sulfapyridine dose related adverse effects, including skin rash. Details
Arylamine N-acetyltransferase 2NAT2*5A---T > C | C > TADR InferredIncreased risk of Sulfapyridine dose related adverse effects, including skin rash. Details
Arylamine N-acetyltransferase 2NAT2*5B---T > C | C > T | A > GADR InferredIncreased risk of Sulfapyridine dose related adverse effects, including skin rash. Details
Arylamine N-acetyltransferase 2NAT2*5C---T > C | A > GADR InferredIncreased risk of Sulfapyridine dose related adverse effects, including skin rash. Details
Arylamine N-acetyltransferase 2NAT2*5D---T > CADR InferredIncreased risk of Sulfapyridine dose related adverse effects, including skin rash. Details
Arylamine N-acetyltransferase 2NAT2*5E---T > C | G > AADR InferredIncreased risk of Sulfapyridine dose related adverse effects, including skin rash. Details
Arylamine N-acetyltransferase 2NAT2*5F---T > C | C > T | C > T | A > GADR InferredIncreased risk of Sulfapyridine dose related adverse effects, including skin rash. Details
Arylamine N-acetyltransferase 2NAT2*5G---T > C | C > T | C > T | A > GADR InferredIncreased risk of Sulfapyridine dose related adverse effects, including skin rash. Details
Arylamine N-acetyltransferase 2NAT2*5H---T > C | C > T | A > G | S287 FrameshiftADR InferredIncreased risk of Sulfapyridine dose related adverse effects, including skin rash. Details
Arylamine N-acetyltransferase 2NAT2*5I---T > C | C > T | A > T | A > GADR InferredIncreased risk of Sulfapyridine dose related adverse effects, including skin rash. Details
Arylamine N-acetyltransferase 2NAT2*5J---T > C | C > T | G > AADR InferredIncreased risk of Sulfapyridine dose related adverse effects, including skin rash. Details
Arylamine N-acetyltransferase 2NAT2*6A---G > A | C > TADR InferredIncreased risk of Sulfapyridine dose related adverse effects, including skin rash. Details
Arylamine N-acetyltransferase 2NAT2*6B---G > AADR InferredIncreased risk of Sulfapyridine dose related adverse effects, including skin rash. Details
Arylamine N-acetyltransferase 2NAT2*6C---G > A | C > T | A > GADR InferredIncreased risk of Sulfapyridine dose related adverse effects, including skin rash. Details
Arylamine N-acetyltransferase 2NAT2*6D---G > A | C > T | T > CADR InferredIncreased risk of Sulfapyridine dose related adverse effects, including skin rash. Details
Arylamine N-acetyltransferase 2NAT2*6E---G > A | C > TADR InferredIncreased risk of Sulfapyridine dose related adverse effects, including skin rash. Details
Arylamine N-acetyltransferase 2NAT2*7A---G > AADR InferredIncreased risk of Sulfapyridine dose related adverse effects, including skin rash. Details
Arylamine N-acetyltransferase 2NAT2*7B---G > A | C > TADR InferredIncreased risk of Sulfapyridine dose related adverse effects, including skin rash. Details
Arylamine N-acetyltransferase 2NAT2*10---G > AADR InferredIncreased risk of Sulfapyridine dose related adverse effects, including skin rash. Details
Arylamine N-acetyltransferase 2NAT2*12D---G > A | A > GADR InferredIncreased risk of Sulfapyridine dose related adverse effects, including skin rash. Details
Arylamine N-acetyltransferase 2NAT2*14A---G > AADR InferredIncreased risk of Sulfapyridine dose related adverse effects, including skin rash. Details
Arylamine N-acetyltransferase 2NAT2*14B---G > A | C > TADR InferredIncreased risk of Sulfapyridine dose related adverse effects, including skin rash. Details
Arylamine N-acetyltransferase 2NAT2*14C---G > A | T > C | C > T | A > GADR InferredIncreased risk of Sulfapyridine dose related adverse effects, including skin rash. Details
Arylamine N-acetyltransferase 2NAT2*14D---G > A | C > T | G > AADR InferredIncreased risk of Sulfapyridine dose related adverse effects, including skin rash. Details
Arylamine N-acetyltransferase 2NAT2*14E---G > A | A > GADR InferredIncreased risk of Sulfapyridine dose related adverse effects, including skin rash. Details
Arylamine N-acetyltransferase 2NAT2*14F---G > A | T > C | A > GADR InferredIncreased risk of Sulfapyridine dose related adverse effects, including skin rash. Details
Arylamine N-acetyltransferase 2NAT2*14G---G > A | C > T | A > GADR InferredIncreased risk of Sulfapyridine dose related adverse effects, including skin rash. Details
Arylamine N-acetyltransferase 2NAT2*17---A > CADR InferredIncreased risk of Sulfapyridine dose related adverse effects, including skin rash. Details
Arylamine N-acetyltransferase 2NAT2*19---C > TADR InferredIncreased risk of Sulfapyridine dose related adverse effects, including skin rash. Details
Glucose-6-phosphate 1-dehydrogenaseNot AvailableVilleurbanne---1000_1002delACCADR InferredIncreased risk of dose-related hemolytic anemia. Details
Glucose-6-phosphate 1-dehydrogenaseNot AvailableTorun---1006A->GADR InferredIncreased risk of dose-related hemolytic anemia. Details
Glucose-6-phosphate 1-dehydrogenaseNot AvailableSunderland---105_107delCATADR InferredIncreased risk of dose-related hemolytic anemia. Details
Glucose-6-phosphate 1-dehydrogenaseNot AvailableIwatsuki---1081G->AADR InferredIncreased risk of dose-related hemolytic anemia. Details
Glucose-6-phosphate 1-dehydrogenaseNot AvailableSerres---1082C->TADR InferredIncreased risk of dose-related hemolytic anemia. Details
Glucose-6-phosphate 1-dehydrogenaseNot AvailableTondela---1084_1101delCTGAACGAGCGCAAGGCCADR InferredIncreased risk of dose-related hemolytic anemia. Details
Glucose-6-phosphate 1-dehydrogenaseNot AvailableLoma Linda---1089C->AADR InferredIncreased risk of dose-related hemolytic anemia. Details
Glucose-6-phosphate 1-dehydrogenaseNot AvailableAachen---1089C->GADR InferredIncreased risk of dose-related hemolytic anemia. Details
Glucose-6-phosphate 1-dehydrogenaseNot AvailableTenri---1096A->GADR InferredIncreased risk of dose-related hemolytic anemia. Details
Glucose-6-phosphate 1-dehydrogenaseNot AvailableMontpellier---1132G>AADR InferredIncreased risk of dose-related hemolytic anemia. Details
Glucose-6-phosphate 1-dehydrogenaseNot AvailableCalvo Mackenna---1138A->GADR InferredIncreased risk of dose-related hemolytic anemia. Details
Glucose-6-phosphate 1-dehydrogenaseNot AvailableRiley---1139T->CADR InferredIncreased risk of dose-related hemolytic anemia. Details
Glucose-6-phosphate 1-dehydrogenaseNot AvailableOlomouc---1141T->CADR InferredIncreased risk of dose-related hemolytic anemia. Details
Glucose-6-phosphate 1-dehydrogenaseNot AvailableTomah---1153T->CADR InferredIncreased risk of dose-related hemolytic anemia. Details
Glucose-6-phosphate 1-dehydrogenaseNot AvailableLynwood---1154G->TADR InferredIncreased risk of dose-related hemolytic anemia. Details
Glucose-6-phosphate 1-dehydrogenaseNot AvailableMadrid---1155C->GADR InferredIncreased risk of dose-related hemolytic anemia. Details
Glucose-6-phosphate 1-dehydrogenaseNot AvailableIowa, Walter Reed, Springfield---1156A->GADR InferredIncreased risk of dose-related hemolytic anemia. Details
Glucose-6-phosphate 1-dehydrogenaseNot AvailableBeverly Hills, Genova, Iwate, Niigata, Yamaguchi---1160G->AADR InferredIncreased risk of dose-related hemolytic anemia. Details
Glucose-6-phosphate 1-dehydrogenaseNot AvailableHartford---1162A->GADR InferredIncreased risk of dose-related hemolytic anemia. Details
Glucose-6-phosphate 1-dehydrogenaseNot AvailablePraha---1166A->GADR InferredIncreased risk of dose-related hemolytic anemia. Details
Glucose-6-phosphate 1-dehydrogenaseNot AvailableKrakow---1175T>CADR InferredIncreased risk of dose-related hemolytic anemia. Details
Glucose-6-phosphate 1-dehydrogenaseNot AvailableWisconsin---1177C->GADR InferredIncreased risk of dose-related hemolytic anemia. Details
Glucose-6-phosphate 1-dehydrogenaseNot AvailableNashville, Anaheim, Portici---1178G->AADR InferredIncreased risk of dose-related hemolytic anemia. Details
Glucose-6-phosphate 1-dehydrogenaseNot AvailableAlhambra---1180G->CADR InferredIncreased risk of dose-related hemolytic anemia. Details
Glucose-6-phosphate 1-dehydrogenaseNot AvailableBari---1187C->TADR InferredIncreased risk of dose-related hemolytic anemia. Details
Glucose-6-phosphate 1-dehydrogenaseNot AvailablePuerto Limon---1192G->AADR InferredIncreased risk of dose-related hemolytic anemia. Details
Glucose-6-phosphate 1-dehydrogenaseNot AvailableCovao do Lobo---1205C>AADR InferredIncreased risk of dose-related hemolytic anemia. Details
Glucose-6-phosphate 1-dehydrogenaseNot AvailableClinic---1215G->AADR InferredIncreased risk of dose-related hemolytic anemia. Details
Glucose-6-phosphate 1-dehydrogenaseNot AvailableUtrecht---1225C->TADR InferredIncreased risk of dose-related hemolytic anemia. Details
Glucose-6-phosphate 1-dehydrogenaseNot AvailableSuwalki---1226C->GADR InferredIncreased risk of dose-related hemolytic anemia. Details
Glucose-6-phosphate 1-dehydrogenaseNot AvailableRiverside---1228G->TADR InferredIncreased risk of dose-related hemolytic anemia. Details
Glucose-6-phosphate 1-dehydrogenaseNot AvailableJapan, Shinagawa---1229G->AADR InferredIncreased risk of dose-related hemolytic anemia. Details
Glucose-6-phosphate 1-dehydrogenaseNot AvailableKawasaki---1229G->CADR InferredIncreased risk of dose-related hemolytic anemia. Details
Glucose-6-phosphate 1-dehydrogenaseNot AvailableMunich---1231A->GADR InferredIncreased risk of dose-related hemolytic anemia. Details
Glucose-6-phosphate 1-dehydrogenaseNot AvailableGeorgia---1284C->AADR InferredIncreased risk of dose-related hemolytic anemia. Details
Glucose-6-phosphate 1-dehydrogenaseNot AvailableSumare---1292T->GADR InferredIncreased risk of dose-related hemolytic anemia. Details
Glucose-6-phosphate 1-dehydrogenaseNot AvailableTelti/Kobe---1318C->TADR InferredIncreased risk of dose-related hemolytic anemia. Details
Glucose-6-phosphate 1-dehydrogenaseNot AvailableSantiago de Cuba, Morioka---1339G->AADR InferredIncreased risk of dose-related hemolytic anemia. Details
Glucose-6-phosphate 1-dehydrogenaseNot AvailableHarima---1358T->AADR InferredIncreased risk of dose-related hemolytic anemia. Details
Glucose-6-phosphate 1-dehydrogenaseNot AvailableFiguera da Foz---1366G->CADR InferredIncreased risk of dose-related hemolytic anemia. Details
Glucose-6-phosphate 1-dehydrogenaseNot AvailableAmiens---1367A>TADR InferredIncreased risk of dose-related hemolytic anemia. Details
Glucose-6-phosphate 1-dehydrogenaseNot AvailableBangkok Noi---1376G->T, 1502T->GADR InferredIncreased risk of dose-related hemolytic anemia. Details
Glucose-6-phosphate 1-dehydrogenaseNot AvailableFukaya---1462G->AADR InferredIncreased risk of dose-related hemolytic anemia. Details
Glucose-6-phosphate 1-dehydrogenaseNot AvailableCampinas---1463G->TADR InferredIncreased risk of dose-related hemolytic anemia. Details
Glucose-6-phosphate 1-dehydrogenaseNot AvailableBuenos Aires---1465C>TADR InferredIncreased risk of dose-related hemolytic anemia. Details
Glucose-6-phosphate 1-dehydrogenaseNot AvailableArakawa---1466C->TADR InferredIncreased risk of dose-related hemolytic anemia. Details
Glucose-6-phosphate 1-dehydrogenaseNot AvailableBrighton---1488_1490delGAAADR InferredIncreased risk of dose-related hemolytic anemia. Details
Glucose-6-phosphate 1-dehydrogenaseNot AvailableKozukata---159G->CADR InferredIncreased risk of dose-related hemolytic anemia. Details
Glucose-6-phosphate 1-dehydrogenaseNot AvailableAmsterdam---180_182delTCTADR InferredIncreased risk of dose-related hemolytic anemia. Details
Glucose-6-phosphate 1-dehydrogenaseNot AvailableNo name---202G->A, 376A->G, 1264C>GADR InferredIncreased risk of dose-related hemolytic anemia. Details
Glucose-6-phosphate 1-dehydrogenaseNot AvailableSwansea---224T->CADR InferredIncreased risk of dose-related hemolytic anemia. Details
Glucose-6-phosphate 1-dehydrogenaseNot AvailableUrayasu---281_283delAGAADR InferredIncreased risk of dose-related hemolytic anemia. Details
Glucose-6-phosphate 1-dehydrogenaseNot AvailableVancouver---317C->G544C->T592C->TADR InferredIncreased risk of dose-related hemolytic anemia. Details
Glucose-6-phosphate 1-dehydrogenaseNot AvailableMt Sinai---376A->G, 1159C->TADR InferredIncreased risk of dose-related hemolytic anemia. Details
Glucose-6-phosphate 1-dehydrogenaseNot AvailablePlymouth---488G->AADR InferredIncreased risk of dose-related hemolytic anemia. Details
Glucose-6-phosphate 1-dehydrogenaseNot AvailableVolendam---514C->TADR InferredIncreased risk of dose-related hemolytic anemia. Details
Glucose-6-phosphate 1-dehydrogenaseNot AvailableShinshu---527A->GADR InferredIncreased risk of dose-related hemolytic anemia. Details
Glucose-6-phosphate 1-dehydrogenaseNot AvailableChikugo---535A->TADR InferredIncreased risk of dose-related hemolytic anemia. Details
Glucose-6-phosphate 1-dehydrogenaseNot AvailableTsukui---561_563delCTCADR InferredIncreased risk of dose-related hemolytic anemia. Details
Glucose-6-phosphate 1-dehydrogenaseNot AvailablePedoplis-Ckaro---573C>GADR InferredIncreased risk of dose-related hemolytic anemia. Details
Glucose-6-phosphate 1-dehydrogenaseNot AvailableSantiago---593G->CADR InferredIncreased risk of dose-related hemolytic anemia. Details
Glucose-6-phosphate 1-dehydrogenaseNot AvailableMinnesota, Marion, Gastonia, LeJeune---637G->TADR InferredIncreased risk of dose-related hemolytic anemia. Details
Glucose-6-phosphate 1-dehydrogenaseNot AvailableCincinnati---637G->T, 1037A->TADR InferredIncreased risk of dose-related hemolytic anemia. Details
Glucose-6-phosphate 1-dehydrogenaseNot AvailableHarilaou---648T->GADR InferredIncreased risk of dose-related hemolytic anemia. Details
Glucose-6-phosphate 1-dehydrogenaseNot AvailableNorth Dallas---683_685delACAADR InferredIncreased risk of dose-related hemolytic anemia. Details
Glucose-6-phosphate 1-dehydrogenaseNot AvailableAsahikawa---695G->AADR InferredIncreased risk of dose-related hemolytic anemia. Details
Glucose-6-phosphate 1-dehydrogenaseNot AvailableDurham---713A->GADR InferredIncreased risk of dose-related hemolytic anemia. Details
Glucose-6-phosphate 1-dehydrogenaseNot AvailableStonybrook---724_729delGGCACTADR InferredIncreased risk of dose-related hemolytic anemia. Details
Glucose-6-phosphate 1-dehydrogenaseNot AvailableWayne---769C->GADR InferredIncreased risk of dose-related hemolytic anemia. Details
Glucose-6-phosphate 1-dehydrogenaseNot AvailableAveiro---806G->AADR InferredIncreased risk of dose-related hemolytic anemia. Details
Glucose-6-phosphate 1-dehydrogenaseNot AvailableCleveland Corum---820G->AADR InferredIncreased risk of dose-related hemolytic anemia. Details
Glucose-6-phosphate 1-dehydrogenaseNot AvailableLille---821A>TADR InferredIncreased risk of dose-related hemolytic anemia. Details
Glucose-6-phosphate 1-dehydrogenaseNot AvailableBangkok---825G>CADR InferredIncreased risk of dose-related hemolytic anemia. Details
Glucose-6-phosphate 1-dehydrogenaseNot AvailableSugao---826C->TADR InferredIncreased risk of dose-related hemolytic anemia. Details
Glucose-6-phosphate 1-dehydrogenaseNot AvailableLa Jolla---832T->CADR InferredIncreased risk of dose-related hemolytic anemia. Details
Glucose-6-phosphate 1-dehydrogenaseNot AvailableWexham---833C->TADR InferredIncreased risk of dose-related hemolytic anemia. Details
Glucose-6-phosphate 1-dehydrogenaseNot AvailablePiotrkow---851T>CADR InferredIncreased risk of dose-related hemolytic anemia. Details
Glucose-6-phosphate 1-dehydrogenaseNot AvailableWest Virginia---910G->TADR InferredIncreased risk of dose-related hemolytic anemia. Details
Glucose-6-phosphate 1-dehydrogenaseNot AvailableOmiya---921G->CADR InferredIncreased risk of dose-related hemolytic anemia. Details
Glucose-6-phosphate 1-dehydrogenaseNot AvailableNara---953_976delCCACCAAAGGGTACCTGGAC GACCADR InferredIncreased risk of dose-related hemolytic anemia. Details
Glucose-6-phosphate 1-dehydrogenaseNot AvailableManhattan---962G->AADR InferredIncreased risk of dose-related hemolytic anemia. Details
Glucose-6-phosphate 1-dehydrogenaseNot AvailableRehevot---964T->CADR InferredIncreased risk of dose-related hemolytic anemia. Details
Glucose-6-phosphate 1-dehydrogenaseNot AvailableHoniara---99A->G, 1360C->TADR InferredIncreased risk of dose-related hemolytic anemia. Details
Glucose-6-phosphate 1-dehydrogenaseNot AvailableTokyo, Fukushima---1246G->AADR InferredIncreased risk of dose-related hemolytic anemia. Details
Glucose-6-phosphate 1-dehydrogenaseNot AvailableChatham---1003G->AADR InferredIncreased risk of dose-related hemolytic anemia. Details
Glucose-6-phosphate 1-dehydrogenaseNot AvailableFushan---1004C->AADR InferredIncreased risk of dose-related hemolytic anemia. Details
Glucose-6-phosphate 1-dehydrogenaseNot AvailablePartenope---1052G->TADR InferredIncreased risk of dose-related hemolytic anemia. Details
Glucose-6-phosphate 1-dehydrogenaseNot AvailableIerapetra---1057C->TADR InferredIncreased risk of dose-related hemolytic anemia. Details
Glucose-6-phosphate 1-dehydrogenaseNot AvailableAnadia---1193A->GADR InferredIncreased risk of dose-related hemolytic anemia. Details
Glucose-6-phosphate 1-dehydrogenaseNot AvailableAbeno---1220A->CADR InferredIncreased risk of dose-related hemolytic anemia. Details
Glucose-6-phosphate 1-dehydrogenaseNot AvailableSurabaya---1291G->AADR InferredIncreased risk of dose-related hemolytic anemia. Details
Glucose-6-phosphate 1-dehydrogenaseNot AvailablePawnee---1316G->CADR InferredIncreased risk of dose-related hemolytic anemia. Details
Glucose-6-phosphate 1-dehydrogenaseNot AvailableS. Antioco---1342A->GADR InferredIncreased risk of dose-related hemolytic anemia. Details
Glucose-6-phosphate 1-dehydrogenaseNot AvailableCassano---1347G->CADR InferredIncreased risk of dose-related hemolytic anemia. Details
Glucose-6-phosphate 1-dehydrogenaseNot AvailableHermoupolis---1347G->C, 1360C->TADR InferredIncreased risk of dose-related hemolytic anemia. Details
Glucose-6-phosphate 1-dehydrogenaseNot AvailableUnion,Maewo, Chinese-2, Kalo---1360C->TADR InferredIncreased risk of dose-related hemolytic anemia. Details
Glucose-6-phosphate 1-dehydrogenaseNot AvailableAndalus---1361G->AADR InferredIncreased risk of dose-related hemolytic anemia. Details
Glucose-6-phosphate 1-dehydrogenaseNot AvailableCosenza---1376G->CADR InferredIncreased risk of dose-related hemolytic anemia. Details
Glucose-6-phosphate 1-dehydrogenaseNot AvailableCanton, Taiwan- Hakka, Gifu-like, Agrigento-like---1376G->TADR InferredIncreased risk of dose-related hemolytic anemia. Details
Glucose-6-phosphate 1-dehydrogenaseNot AvailableFlores---1387C->AADR InferredIncreased risk of dose-related hemolytic anemia. Details
Glucose-6-phosphate 1-dehydrogenaseNot AvailableKaiping, Anant, Dhon, Sapporo-like, Wosera---1388G->AADR InferredIncreased risk of dose-related hemolytic anemia. Details
Glucose-6-phosphate 1-dehydrogenaseNot AvailableKamogawa---169C->TADR InferredIncreased risk of dose-related hemolytic anemia. Details
Glucose-6-phosphate 1-dehydrogenaseNot AvailableCostanzo---179T>CADR InferredIncreased risk of dose-related hemolytic anemia. Details
Glucose-6-phosphate 1-dehydrogenaseNot AvailableAmazonia---185C->AADR InferredIncreased risk of dose-related hemolytic anemia. Details
Glucose-6-phosphate 1-dehydrogenaseNot AvailableSongklanagarind---196T->AADR InferredIncreased risk of dose-related hemolytic anemia. Details
Glucose-6-phosphate 1-dehydrogenaseNot AvailableHechi---202G->A, 871G->AADR InferredIncreased risk of dose-related hemolytic anemia. Details
Glucose-6-phosphate 1-dehydrogenaseNot AvailableNamouru---208T->CADR InferredIncreased risk of dose-related hemolytic anemia. Details
Glucose-6-phosphate 1-dehydrogenaseNot AvailableBao Loc---352T>CADR InferredIncreased risk of dose-related hemolytic anemia. Details
Glucose-6-phosphate 1-dehydrogenaseNot AvailableCrispim---375G->T, 379G->T383T->C384C>TADR InferredIncreased risk of dose-related hemolytic anemia. Details
Glucose-6-phosphate 1-dehydrogenaseNot AvailableAcrokorinthos---376A->G, 463C->GADR InferredIncreased risk of dose-related hemolytic anemia. Details
Glucose-6-phosphate 1-dehydrogenaseNot AvailableSanta Maria---376A->G, 542A->TADR InferredIncreased risk of dose-related hemolytic anemia. Details
Glucose-6-phosphate 1-dehydrogenaseNot AvailableAnanindeua---376A->G, 871G->AADR InferredIncreased risk of dose-related hemolytic anemia. Details
Glucose-6-phosphate 1-dehydrogenaseNot AvailableVanua Lava---383T->CADR InferredIncreased risk of dose-related hemolytic anemia. Details
Glucose-6-phosphate 1-dehydrogenaseNot AvailableValladolid---406C->TADR InferredIncreased risk of dose-related hemolytic anemia. Details
Glucose-6-phosphate 1-dehydrogenaseNot AvailableBelem---409C->TADR InferredIncreased risk of dose-related hemolytic anemia. Details
Glucose-6-phosphate 1-dehydrogenaseNot AvailableLiuzhou---442G->AADR InferredIncreased risk of dose-related hemolytic anemia. Details
Glucose-6-phosphate 1-dehydrogenaseNot AvailableShenzen---473G>AADR InferredIncreased risk of dose-related hemolytic anemia. Details
Glucose-6-phosphate 1-dehydrogenaseNot AvailableTaipei “Chinese- 3”---493A->GADR InferredIncreased risk of dose-related hemolytic anemia. Details
Glucose-6-phosphate 1-dehydrogenaseNot AvailableToledo---496C>TADR InferredIncreased risk of dose-related hemolytic anemia. Details
Glucose-6-phosphate 1-dehydrogenaseNot AvailableNaone---497G->AADR InferredIncreased risk of dose-related hemolytic anemia. Details
Glucose-6-phosphate 1-dehydrogenaseNot AvailableNankang---517T->CADR InferredIncreased risk of dose-related hemolytic anemia. Details
Glucose-6-phosphate 1-dehydrogenaseNot AvailableMiaoli---519C->GADR InferredIncreased risk of dose-related hemolytic anemia. Details
Glucose-6-phosphate 1-dehydrogenaseNot AvailableMediterranean, Dallas, Panama‚ Sassari, Cagliari, Birmingham---563C->TADR InferredIncreased risk of dose-related hemolytic anemia. Details
Glucose-6-phosphate 1-dehydrogenaseNot AvailableCoimbra Shunde---592C->TADR InferredIncreased risk of dose-related hemolytic anemia. Details
Glucose-6-phosphate 1-dehydrogenaseNot AvailableNilgiri---593G>AADR InferredIncreased risk of dose-related hemolytic anemia. Details
Glucose-6-phosphate 1-dehydrogenaseNot AvailableRadlowo---679C->TADR InferredIncreased risk of dose-related hemolytic anemia. Details
Glucose-6-phosphate 1-dehydrogenaseNot AvailableRoubaix---811G>CADR InferredIncreased risk of dose-related hemolytic anemia. Details
Glucose-6-phosphate 1-dehydrogenaseNot AvailableHaikou---835A->GADR InferredIncreased risk of dose-related hemolytic anemia. Details
Glucose-6-phosphate 1-dehydrogenaseNot AvailableChinese-1---835A->TADR InferredIncreased risk of dose-related hemolytic anemia. Details
Glucose-6-phosphate 1-dehydrogenaseNot AvailableMizushima---848A>GADR InferredIncreased risk of dose-related hemolytic anemia. Details
Glucose-6-phosphate 1-dehydrogenaseNot AvailableOsaka---853C->TADR InferredIncreased risk of dose-related hemolytic anemia. Details
Glucose-6-phosphate 1-dehydrogenaseNot AvailableViangchan, Jammu---871G->AADR InferredIncreased risk of dose-related hemolytic anemia. Details
Glucose-6-phosphate 1-dehydrogenaseNot AvailableSeoul---916G->AADR InferredIncreased risk of dose-related hemolytic anemia. Details
Glucose-6-phosphate 1-dehydrogenaseNot AvailableLudhiana---929G->AADR InferredIncreased risk of dose-related hemolytic anemia. Details
Glucose-6-phosphate 1-dehydrogenaseNot AvailableFarroupilha---977C->AADR InferredIncreased risk of dose-related hemolytic anemia. Details
Glucose-6-phosphate 1-dehydrogenaseNot AvailableChinese-5---1024C->TADR InferredIncreased risk of dose-related hemolytic anemia. Details
Glucose-6-phosphate 1-dehydrogenaseNot AvailableRignano---130G>AADR InferredIncreased risk of dose-related hemolytic anemia. Details
Glucose-6-phosphate 1-dehydrogenaseNot AvailableOrissa---131C->GADR InferredIncreased risk of dose-related hemolytic anemia. Details
Glucose-6-phosphate 1-dehydrogenaseNot AvailableG6PDNice---1380G>CADR InferredIncreased risk of dose-related hemolytic anemia. Details
Glucose-6-phosphate 1-dehydrogenaseNot AvailableKamiube, Keelung---1387C->TADR InferredIncreased risk of dose-related hemolytic anemia. Details
Glucose-6-phosphate 1-dehydrogenaseNot AvailableNeapolis---1400C->GADR InferredIncreased risk of dose-related hemolytic anemia. Details
Glucose-6-phosphate 1-dehydrogenaseNot AvailableAures---143T->CADR InferredIncreased risk of dose-related hemolytic anemia. Details
Glucose-6-phosphate 1-dehydrogenaseNot AvailableSplit---1442C->GADR InferredIncreased risk of dose-related hemolytic anemia. Details
Glucose-6-phosphate 1-dehydrogenaseNot AvailableKambos---148C->TADR InferredIncreased risk of dose-related hemolytic anemia. Details
Glucose-6-phosphate 1-dehydrogenaseNot AvailablePalestrina---170G>AADR InferredIncreased risk of dose-related hemolytic anemia. Details
Glucose-6-phosphate 1-dehydrogenaseNot AvailableMetaponto---172G->AADR InferredIncreased risk of dose-related hemolytic anemia. Details
Glucose-6-phosphate 1-dehydrogenaseNot AvailableMusashino---185C->TADR InferredIncreased risk of dose-related hemolytic anemia. Details
Glucose-6-phosphate 1-dehydrogenaseNot AvailableAsahi---202G->AADR InferredIncreased risk of dose-related hemolytic anemia. Details
Glucose-6-phosphate 1-dehydrogenaseNot AvailableA- (202), Ferrara I---202G->A, 376A->GADR InferredIncreased risk of dose-related hemolytic anemia. Details
Glucose-6-phosphate 1-dehydrogenaseNot AvailableMurcia Oristano---209A->GADR InferredIncreased risk of dose-related hemolytic anemia. Details
Glucose-6-phosphate 1-dehydrogenaseNot AvailableUbe Konan---241C->TADR InferredIncreased risk of dose-related hemolytic anemia. Details
Glucose-6-phosphate 1-dehydrogenaseNot AvailableLagosanto---242G->AADR InferredIncreased risk of dose-related hemolytic anemia. Details
Glucose-6-phosphate 1-dehydrogenaseNot AvailableGuangzhou---274C->TADR InferredIncreased risk of dose-related hemolytic anemia. Details
Glucose-6-phosphate 1-dehydrogenaseNot AvailableHammersmith---323T->AADR InferredIncreased risk of dose-related hemolytic anemia. Details
Glucose-6-phosphate 1-dehydrogenaseNot AvailableSinnai---34G->TADR InferredIncreased risk of dose-related hemolytic anemia. Details
Glucose-6-phosphate 1-dehydrogenaseNot AvailableA- (680)---376A->G, 680G->TADR InferredIncreased risk of dose-related hemolytic anemia. Details
Glucose-6-phosphate 1-dehydrogenaseNot AvailableA- (968), Betica,Selma, Guantanamo---376A->G, 968T->CADR InferredIncreased risk of dose-related hemolytic anemia. Details
Glucose-6-phosphate 1-dehydrogenaseNot AvailableSalerno Pyrgos---383T>GADR InferredIncreased risk of dose-related hemolytic anemia. Details
Glucose-6-phosphate 1-dehydrogenaseNot AvailableQuing Yan---392G->TADR InferredIncreased risk of dose-related hemolytic anemia. Details
Glucose-6-phosphate 1-dehydrogenaseNot AvailableLages---40G->AADR InferredIncreased risk of dose-related hemolytic anemia. Details
Glucose-6-phosphate 1-dehydrogenaseNot AvailableIlesha---466G->AADR InferredIncreased risk of dose-related hemolytic anemia. Details
Glucose-6-phosphate 1-dehydrogenaseNot AvailableMahidol---487G->AADR InferredIncreased risk of dose-related hemolytic anemia. Details
Glucose-6-phosphate 1-dehydrogenaseNot AvailableMalaga---542A->TADR InferredIncreased risk of dose-related hemolytic anemia. Details
Glucose-6-phosphate 1-dehydrogenaseNot AvailableSibari---634A->GADR InferredIncreased risk of dose-related hemolytic anemia. Details
Glucose-6-phosphate 1-dehydrogenaseNot AvailableMexico City---680G->AADR InferredIncreased risk of dose-related hemolytic anemia. Details
Glucose-6-phosphate 1-dehydrogenaseNot AvailableNanning---703C->TADR InferredIncreased risk of dose-related hemolytic anemia. Details
Glucose-6-phosphate 1-dehydrogenaseNot AvailableSeattle, Lodi, Modena, Ferrara II, Athens-like---844G->CADR InferredIncreased risk of dose-related hemolytic anemia. Details
Glucose-6-phosphate 1-dehydrogenaseNot AvailableBajo Maumere---844G->TADR InferredIncreased risk of dose-related hemolytic anemia. Details
Glucose-6-phosphate 1-dehydrogenaseNot AvailableMontalbano---854G->AADR InferredIncreased risk of dose-related hemolytic anemia. Details
Glucose-6-phosphate 1-dehydrogenaseNot AvailableKalyan-Kerala, Jamnaga, Rohini---949G->AADR InferredIncreased risk of dose-related hemolytic anemia. Details
Glucose-6-phosphate 1-dehydrogenaseNot AvailableGaohe---95A->GADR InferredIncreased risk of dose-related hemolytic anemia. Details
Drug Interactions
DrugInteractionDrug group
16-BromoepiandrosteroneThe risk or severity of adverse effects can be increased when Sulfasalazine is combined with 16-Bromoepiandrosterone.Investigational
19-norandrostenedioneThe risk or severity of adverse effects can be increased when Sulfasalazine is combined with 19-norandrostenedione.Experimental, Illicit
4-AndrostenedioneThe risk or severity of adverse effects can be increased when Sulfasalazine is combined with 4-Androstenedione.Experimental, Illicit
5-androstenedioneThe risk or severity of adverse effects can be increased when Sulfasalazine is combined with 5-androstenedione.Experimental, Illicit
AbciximabSulfasalazine may increase the anticoagulant activities of Abciximab.Approved
AcebutololSulfasalazine may decrease the antihypertensive activities of Acebutolol.Approved
AceclofenacAceclofenac may increase the nephrotoxic activities of Sulfasalazine.Approved
AcenocoumarolSulfasalazine may increase the anticoagulant activities of Acenocoumarol.Approved
AcetovanilloneAcetovanillone may increase the nephrotoxic activities of Sulfasalazine.Investigational
AcetyldigitoxinThe serum concentration of Acetyldigitoxin can be decreased when it is combined with Sulfasalazine.Approved
Acetylsalicylic acidAcetylsalicylic acid may increase the nephrotoxic activities of Sulfasalazine.Approved, Vet Approved
AclarubicinSulfasalazine may decrease the excretion rate of Aclarubicin which could result in a higher serum level.Investigational
AdapaleneAdapalene may increase the nephrotoxic activities of Sulfasalazine.Approved
AlclometasoneThe risk or severity of adverse effects can be increased when Sulfasalazine is combined with Alclometasone.Approved
AldosteroneThe risk or severity of adverse effects can be increased when Sulfasalazine is combined with Aldosterone.Experimental
Alendronic acidThe risk or severity of adverse effects can be increased when Sulfasalazine is combined with Alendronic acid.Approved
AliskirenSulfasalazine may decrease the antihypertensive activities of Aliskiren.Approved, Investigational
AlprenololSulfasalazine may decrease the antihypertensive activities of Alprenolol.Approved, Withdrawn
AlprostadilThe therapeutic efficacy of Alprostadil can be decreased when used in combination with Sulfasalazine.Approved, Investigational
AmcinonideThe risk or severity of adverse effects can be increased when Sulfasalazine is combined with Amcinonide.Approved
AmikacinSulfasalazine may decrease the excretion rate of Amikacin which could result in a higher serum level.Approved, Vet Approved
AmilorideSulfasalazine may decrease the antihypertensive activities of Amiloride.Approved
AmrubicinSulfasalazine may decrease the excretion rate of Amrubicin which could result in a higher serum level.Approved, Investigational
AncrodSulfasalazine may increase the anticoagulant activities of Ancrod.Investigational
AnecortaveThe risk or severity of adverse effects can be increased when Sulfasalazine is combined with Anecortave.Investigational
AnisodamineAnisodamine may increase the nephrotoxic activities of Sulfasalazine.Investigational
annamycinSulfasalazine may decrease the excretion rate of annamycin which could result in a higher serum level.Investigational
AntipyrineAntipyrine may increase the nephrotoxic activities of Sulfasalazine.Approved
Antithrombin III humanSulfasalazine may increase the anticoagulant activities of Antithrombin III human.Approved
AOP200704Sulfasalazine may decrease the antihypertensive activities of Aop200704.Investigational
ApixabanSulfasalazine may increase the anticoagulant activities of Apixaban.Approved
ApramycinSulfasalazine may decrease the excretion rate of Apramycin which could result in a higher serum level.Experimental, Vet Approved
ApremilastApremilast may increase the nephrotoxic activities of Sulfasalazine.Approved, Investigational
ArbekacinSulfasalazine may decrease the excretion rate of Arbekacin which could result in a higher serum level.Approved
ArdeparinThe risk or severity of adverse effects can be increased when Sulfasalazine is combined with Ardeparin.Approved, Withdrawn
ArgatrobanSulfasalazine may increase the anticoagulant activities of Argatroban.Approved, Investigational
ArotinololSulfasalazine may decrease the antihypertensive activities of Arotinolol.Approved
AtenololSulfasalazine may decrease the antihypertensive activities of Atenolol.Approved
AzapropazoneAzapropazone may increase the nephrotoxic activities of Sulfasalazine.Withdrawn
AzathioprineThe metabolism of Azathioprine can be decreased when combined with Sulfasalazine.Approved
AzelastineAzelastine may increase the nephrotoxic activities of Sulfasalazine.Approved
Azilsartan medoxomilThe risk or severity of adverse effects can be increased when Azilsartan medoxomil is combined with Sulfasalazine.Approved
BalsalazideSulfasalazine may increase the nephrotoxic activities of Balsalazide.Approved, Investigational
BecaplerminSulfasalazine may increase the anticoagulant activities of Becaplermin.Approved, Investigational
BeclomethasoneThe risk or severity of adverse effects can be increased when Sulfasalazine is combined with Beclomethasone.Investigational
Beclomethasone dipropionateThe risk or severity of adverse effects can be increased when Sulfasalazine is combined with Beclomethasone dipropionate.Approved, Investigational
BefunololSulfasalazine may decrease the antihypertensive activities of Befunolol.Experimental
BemiparinThe risk or severity of adverse effects can be increased when Sulfasalazine is combined with Bemiparin.Approved
BenazeprilThe risk or severity of adverse effects can be increased when Benazepril is combined with Sulfasalazine.Approved, Investigational
BendroflumethiazideThe therapeutic efficacy of Bendroflumethiazide can be decreased when used in combination with Sulfasalazine.Approved
BenoxaprofenBenoxaprofen may increase the nephrotoxic activities of Sulfasalazine.Withdrawn
BeraprostThe therapeutic efficacy of Beraprost can be decreased when used in combination with Sulfasalazine.Investigational
BetamethasoneThe risk or severity of adverse effects can be increased when Sulfasalazine is combined with Betamethasone.Approved, Vet Approved
BetaxololSulfasalazine may decrease the antihypertensive activities of Betaxolol.Approved
Betulinic AcidBetulinic Acid may increase the nephrotoxic activities of Sulfasalazine.Investigational
BevantololSulfasalazine may decrease the antihypertensive activities of Bevantolol.Approved
BimatoprostThe therapeutic efficacy of Bimatoprost can be decreased when used in combination with Sulfasalazine.Approved, Investigational
BisoprololSulfasalazine may decrease the antihypertensive activities of Bisoprolol.Approved
BivalirudinSulfasalazine may increase the anticoagulant activities of Bivalirudin.Approved, Investigational
BopindololSulfasalazine may decrease the antihypertensive activities of Bopindolol.Approved
BromfenacBromfenac may increase the nephrotoxic activities of Sulfasalazine.Approved
BucillamineBucillamine may increase the nephrotoxic activities of Sulfasalazine.Investigational
BucindololSulfasalazine may decrease the antihypertensive activities of Bucindolol.Investigational
BudesonideThe risk or severity of adverse effects can be increased when Sulfasalazine is combined with Budesonide.Approved
BufuralolSulfasalazine may decrease the antihypertensive activities of Bufuralol.Experimental, Investigational
BumetanideSulfasalazine may decrease the diuretic activities of Bumetanide.Approved
BupranololSulfasalazine may decrease the antihypertensive activities of Bupranolol.Approved
CandesartanThe risk or severity of adverse effects can be increased when Candesartan is combined with Sulfasalazine.Approved
CandoxatrilThe risk or severity of adverse effects can be increased when Candoxatril is combined with Sulfasalazine.Experimental
CaptoprilThe risk or severity of adverse effects can be increased when Captopril is combined with Sulfasalazine.Approved
Carboprost TromethamineThe therapeutic efficacy of Carboprost Tromethamine can be decreased when used in combination with Sulfasalazine.Approved
CarprofenCarprofen may increase the nephrotoxic activities of Sulfasalazine.Approved, Vet Approved, Withdrawn
CarteololSulfasalazine may decrease the antihypertensive activities of Carteolol.Approved
CarvedilolSulfasalazine may decrease the antihypertensive activities of Carvedilol.Approved, Investigational
CastanospermineCastanospermine may increase the nephrotoxic activities of Sulfasalazine.Experimental
CelecoxibThe risk or severity of adverse effects can be increased when Sulfasalazine is combined with Celecoxib.Approved, Investigational
CeliprololSulfasalazine may decrease the antihypertensive activities of Celiprolol.Approved, Investigational
CertoparinThe risk or severity of adverse effects can be increased when Sulfasalazine is combined with Certoparin.Approved
ChloroquineChloroquine may increase the nephrotoxic activities of Sulfasalazine.Approved, Vet Approved
ChlorothiazideThe therapeutic efficacy of Chlorothiazide can be decreased when used in combination with Sulfasalazine.Approved, Vet Approved
ChlorthalidoneThe therapeutic efficacy of Chlorthalidone can be decreased when used in combination with Sulfasalazine.Approved
CholestyramineCholestyramine can cause a decrease in the absorption of Sulfasalazine resulting in a reduced serum concentration and potentially a decrease in efficacy.Approved
CiclesonideThe risk or severity of adverse effects can be increased when Sulfasalazine is combined with Ciclesonide.Approved, Investigational
CilazaprilThe risk or severity of adverse effects can be increased when Cilazapril is combined with Sulfasalazine.Approved
CinoxacinSulfasalazine may increase the neuroexcitatory activities of Cinoxacin.Approved, Withdrawn
CiprofloxacinSulfasalazine may increase the neuroexcitatory activities of Ciprofloxacin.Approved, Investigational
Citric AcidSulfasalazine may increase the anticoagulant activities of Citric Acid.Nutraceutical, Vet Approved
ClobetasolThe risk or severity of adverse effects can be increased when Sulfasalazine is combined with Clobetasol.Investigational
Clobetasol propionateThe risk or severity of adverse effects can be increased when Sulfasalazine is combined with Clobetasol propionate.Approved
ClocortoloneThe risk or severity of adverse effects can be increased when Sulfasalazine is combined with Clocortolone.Approved
ClodronateThe risk or severity of adverse effects can be increased when Sulfasalazine is combined with Clodronate.Approved, Investigational, Vet Approved
ClonixinClonixin may increase the nephrotoxic activities of Sulfasalazine.Approved
CloprostenolThe therapeutic efficacy of Cloprostenol can be decreased when used in combination with Sulfasalazine.Vet Approved
ColesevelamColesevelam can cause a decrease in the absorption of Sulfasalazine resulting in a reduced serum concentration and potentially a decrease in efficacy.Approved
ColestipolColestipol can cause a decrease in the absorption of Sulfasalazine resulting in a reduced serum concentration and potentially a decrease in efficacy.Approved
Cortisone acetateThe risk or severity of adverse effects can be increased when Sulfasalazine is combined with Cortisone acetate.Approved
CurcuminCurcumin may increase the nephrotoxic activities of Sulfasalazine.Investigational
CyclosporineSulfasalazine may increase the nephrotoxic activities of Cyclosporine.Approved, Investigational, Vet Approved
D-LimoneneD-Limonene may increase the nephrotoxic activities of Sulfasalazine.Investigational
Dabigatran etexilateSulfasalazine may increase the anticoagulant activities of Dabigatran etexilate.Approved
DalteparinThe risk or severity of adverse effects can be increased when Sulfasalazine is combined with Dalteparin.Approved
DanaparoidSulfasalazine may increase the anticoagulant activities of Danaparoid.Approved, Withdrawn
DaunorubicinSulfasalazine may decrease the excretion rate of Daunorubicin which could result in a higher serum level.Approved
DeferasiroxThe risk or severity of adverse effects can be increased when Sulfasalazine is combined with Deferasirox.Approved, Investigational
dehydroepiandrosterone sulfateThe risk or severity of adverse effects can be increased when Sulfasalazine is combined with dehydroepiandrosterone sulfate.Investigational
DesirudinSulfasalazine may increase the anticoagulant activities of Desirudin.Approved
DeslanosideThe serum concentration of Deslanoside can be decreased when it is combined with Sulfasalazine.Approved
DesmopressinThe risk or severity of adverse effects can be increased when Sulfasalazine is combined with Desmopressin.Approved
DesoximetasoneThe risk or severity of adverse effects can be increased when Sulfasalazine is combined with Desoximetasone.Approved
Desoxycorticosterone acetateThe risk or severity of adverse effects can be increased when Sulfasalazine is combined with Desoxycorticosterone acetate.Approved
Desoxycorticosterone PivalateThe risk or severity of adverse effects can be increased when Sulfasalazine is combined with Desoxycorticosterone Pivalate.Experimental, Vet Approved
DexamethasoneThe risk or severity of adverse effects can be increased when Sulfasalazine is combined with Dexamethasone.Approved, Investigational, Vet Approved
Dexamethasone isonicotinateThe risk or severity of adverse effects can be increased when Sulfasalazine is combined with Dexamethasone isonicotinate.Vet Approved
DexketoprofenThe risk or severity of adverse effects can be increased when Dexketoprofen is combined with Sulfasalazine.Approved
DextranSulfasalazine may increase the anticoagulant activities of Dextran.Approved, Vet Approved
Dextran 40Sulfasalazine may increase the anticoagulant activities of Dextran 40.Approved
Dextran 70Sulfasalazine may increase the anticoagulant activities of Dextran 70.Approved
Dextran 75Sulfasalazine may increase the anticoagulant activities of Dextran 75.Approved
DiclofenacThe risk or severity of adverse effects can be increased when Diclofenac is combined with Sulfasalazine.Approved, Vet Approved
DiclofenacDiclofenac may increase the nephrotoxic activities of Sulfasalazine.Approved, Vet Approved
DicoumarolSulfasalazine may increase the anticoagulant activities of Dicoumarol.Approved
DiflorasoneThe risk or severity of adverse effects can be increased when Sulfasalazine is combined with Diflorasone.Approved
DiflunisalDiflunisal may increase the nephrotoxic activities of Sulfasalazine.Approved
DifluocortoloneThe risk or severity of adverse effects can be increased when Sulfasalazine is combined with Difluocortolone.Approved
DifluprednateThe risk or severity of adverse effects can be increased when Sulfasalazine is combined with Difluprednate.Approved
DigitoxinThe serum concentration of Digitoxin can be decreased when it is combined with Sulfasalazine.Approved
DigoxinThe serum concentration of Digoxin can be increased when it is combined with Sulfasalazine.Approved
DihydrostreptomycinSulfasalazine may decrease the excretion rate of Dihydrostreptomycin which could result in a higher serum level.Vet Approved
DinoprostThe therapeutic efficacy of Dinoprost can be decreased when used in combination with Sulfasalazine.Investigational
Dinoprost TromethamineThe therapeutic efficacy of Dinoprost Tromethamine can be decreased when used in combination with Sulfasalazine.Approved, Vet Approved
DinoprostoneThe therapeutic efficacy of Dinoprostone can be decreased when used in combination with Sulfasalazine.Approved
DoxorubicinSulfasalazine may decrease the excretion rate of Doxorubicin which could result in a higher serum level.Approved, Investigational
DrospirenoneSulfasalazine may increase the hyperkalemic activities of Drospirenone.Approved
DroxicamDroxicam may increase the nephrotoxic activities of Sulfasalazine.Approved
DuvelisibDuvelisib may increase the nephrotoxic activities of Sulfasalazine.Investigational
E6201E6201 may increase the nephrotoxic activities of Sulfasalazine.Investigational
EbselenEbselen may increase the nephrotoxic activities of Sulfasalazine.Investigational
Edetic AcidSulfasalazine may increase the anticoagulant activities of Edetic Acid.Approved, Vet Approved
EdoxabanSulfasalazine may increase the anticoagulant activities of Edoxaban.Approved
EltrombopagThe serum concentration of Sulfasalazine can be increased when it is combined with Eltrombopag.Approved
EnalaprilThe risk or severity of adverse effects can be increased when Enalapril is combined with Sulfasalazine.Approved, Vet Approved
EnalaprilatThe risk or severity of adverse effects can be increased when Enalaprilat is combined with Sulfasalazine.Approved
EnoxacinSulfasalazine may increase the neuroexcitatory activities of Enoxacin.Approved
EnoxaparinThe risk or severity of adverse effects can be increased when Sulfasalazine is combined with Enoxaparin.Approved
EpirizoleEpirizole may increase the nephrotoxic activities of Sulfasalazine.Approved
EpirubicinSulfasalazine may decrease the excretion rate of Epirubicin which could result in a higher serum level.Approved
EplerenoneSulfasalazine may decrease the antihypertensive activities of Eplerenone.Approved
EpoprostenolThe therapeutic efficacy of Epoprostenol can be decreased when used in combination with Sulfasalazine.Approved
EprosartanThe risk or severity of adverse effects can be increased when Eprosartan is combined with Sulfasalazine.Approved
EquileninThe risk or severity of adverse effects can be increased when Sulfasalazine is combined with Equilenin.Experimental
EquilinThe risk or severity of adverse effects can be increased when Sulfasalazine is combined with Equilin.Approved
EsmololSulfasalazine may decrease the antihypertensive activities of Esmolol.Approved
EstroneThe risk or severity of adverse effects can be increased when Sulfasalazine is combined with Estrone.Approved
Estrone sulfateThe risk or severity of adverse effects can be increased when Sulfasalazine is combined with Estrone sulfate.Approved
Etacrynic acidSulfasalazine may decrease the diuretic activities of Etacrynic acid.Approved
EtanerceptEtanercept may increase the nephrotoxic activities of Sulfasalazine.Approved, Investigational
Ethyl biscoumacetateSulfasalazine may increase the anticoagulant activities of Ethyl biscoumacetate.Withdrawn
Etidronic acidThe risk or severity of adverse effects can be increased when Sulfasalazine is combined with Etidronic acid.Approved
EtodolacThe risk or severity of adverse effects can be increased when Sulfasalazine is combined with Etodolac.Approved, Investigational, Vet Approved
EtofenamateEtofenamate may increase the nephrotoxic activities of Sulfasalazine.Approved
EtoricoxibThe risk or severity of adverse effects can be increased when Sulfasalazine is combined with Etoricoxib.Approved, Investigational
Evening primrose oilEvening primrose oil may increase the nephrotoxic activities of Sulfasalazine.Approved
exisulindexisulind may increase the nephrotoxic activities of Sulfasalazine.Investigational
FenbufenFenbufen may increase the nephrotoxic activities of Sulfasalazine.Approved
FenoprofenFenoprofen may increase the nephrotoxic activities of Sulfasalazine.Approved
FenprostaleneThe therapeutic efficacy of Fenprostalene can be decreased when used in combination with Sulfasalazine.Vet Approved
FleroxacinSulfasalazine may increase the neuroexcitatory activities of Fleroxacin.Approved
FloctafenineThe risk or severity of adverse effects can be increased when Floctafenine is combined with Sulfasalazine.Approved, Withdrawn
fluasteroneThe risk or severity of adverse effects can be increased when Sulfasalazine is combined with fluasterone.Investigational
FludrocortisoneThe risk or severity of adverse effects can be increased when Sulfasalazine is combined with Fludrocortisone.Approved
FluindioneSulfasalazine may increase the anticoagulant activities of Fluindione.Investigational
FlumequineSulfasalazine may increase the neuroexcitatory activities of Flumequine.Withdrawn
FlumethasoneThe risk or severity of adverse effects can be increased when Sulfasalazine is combined with Flumethasone.Approved, Vet Approved
FlunisolideThe risk or severity of adverse effects can be increased when Sulfasalazine is combined with Flunisolide.Approved, Investigational
FlunixinFlunixin may increase the nephrotoxic activities of Sulfasalazine.Vet Approved
Fluocinolone AcetonideThe risk or severity of adverse effects can be increased when Sulfasalazine is combined with Fluocinolone Acetonide.Approved, Investigational, Vet Approved
FluocinonideThe risk or severity of adverse effects can be increased when Sulfasalazine is combined with Fluocinonide.Approved, Investigational
FluocortoloneThe risk or severity of adverse effects can be increased when Sulfasalazine is combined with Fluocortolone.Approved, Withdrawn
FluorometholoneThe risk or severity of adverse effects can be increased when Sulfasalazine is combined with Fluorometholone.Approved
FluprednideneThe risk or severity of adverse effects can be increased when Sulfasalazine is combined with Fluprednidene.Approved, Withdrawn
FluprednisoloneThe risk or severity of adverse effects can be increased when Sulfasalazine is combined with Fluprednisolone.Approved
FluprostenolThe therapeutic efficacy of Fluprostenol can be decreased when used in combination with Sulfasalazine.Vet Approved
FlurandrenolideThe risk or severity of adverse effects can be increased when Sulfasalazine is combined with Flurandrenolide.Approved
FlurbiprofenFlurbiprofen may increase the nephrotoxic activities of Sulfasalazine.Approved, Investigational
Fluticasone furoateThe risk or severity of adverse effects can be increased when Sulfasalazine is combined with Fluticasone furoate.Approved
Fluticasone PropionateThe risk or severity of adverse effects can be increased when Sulfasalazine is combined with Fluticasone Propionate.Approved
Folic AcidThe serum concentration of Folic Acid can be decreased when it is combined with Sulfasalazine.Approved, Nutraceutical, Vet Approved
FondaparinuxSulfasalazine may increase the anticoagulant activities of Fondaparinux.Investigational
Fondaparinux sodiumSulfasalazine may increase the anticoagulant activities of Fondaparinux sodium.Approved, Investigational
ForasartanThe risk or severity of adverse effects can be increased when Forasartan is combined with Sulfasalazine.Experimental
FormestaneThe risk or severity of adverse effects can be increased when Sulfasalazine is combined with Formestane.Approved, Investigational, Withdrawn
FosinoprilThe risk or severity of adverse effects can be increased when Fosinopril is combined with Sulfasalazine.Approved
FramycetinSulfasalazine may decrease the excretion rate of Framycetin which could result in a higher serum level.Approved
FurosemideSulfasalazine may decrease the diuretic activities of Furosemide.Approved, Vet Approved
GabexateSulfasalazine may increase the anticoagulant activities of Gabexate.Approved, Investigational
GarenoxacinSulfasalazine may increase the neuroexcitatory activities of Garenoxacin.Investigational
GatifloxacinSulfasalazine may increase the neuroexcitatory activities of Gatifloxacin.Approved, Investigational
GemeprostThe therapeutic efficacy of Gemeprost can be decreased when used in combination with Sulfasalazine.Approved, Withdrawn
GemifloxacinSulfasalazine may increase the neuroexcitatory activities of Gemifloxacin.Approved, Investigational
GeneticinSulfasalazine may decrease the excretion rate of Geneticin which could result in a higher serum level.Experimental
GentamicinSulfasalazine may decrease the excretion rate of Gentamicin which could result in a higher serum level.Approved, Vet Approved
GENTAMICIN C1ASulfasalazine may decrease the excretion rate of GENTAMICIN C1A which could result in a higher serum level.Experimental
GrepafloxacinSulfasalazine may increase the neuroexcitatory activities of Grepafloxacin.Withdrawn
HaloperidolThe risk or severity of adverse effects can be increased when Sulfasalazine is combined with Haloperidol.Approved
HE3286The risk or severity of adverse effects can be increased when Sulfasalazine is combined with HE3286.Investigational
HeparinThe risk or severity of adverse effects can be increased when Sulfasalazine is combined with Heparin.Approved, Investigational
HigenamineHigenamine may increase the nephrotoxic activities of Sulfasalazine.Investigational
HMPL-004HMPL-004 may increase the nephrotoxic activities of Sulfasalazine.Investigational
HydralazineSulfasalazine may decrease the antihypertensive activities of Hydralazine.Approved
HydrochlorothiazideThe therapeutic efficacy of Hydrochlorothiazide can be decreased when used in combination with Sulfasalazine.Approved, Vet Approved
HydrocortisoneThe risk or severity of adverse effects can be increased when Sulfasalazine is combined with Hydrocortisone.Approved, Vet Approved
HydroflumethiazideThe therapeutic efficacy of Hydroflumethiazide can be decreased when used in combination with Sulfasalazine.Approved
Hygromycin BSulfasalazine may decrease the excretion rate of Hygromycin B which could result in a higher serum level.Vet Approved
IbandronateThe risk or severity of adverse effects can be increased when Sulfasalazine is combined with Ibandronate.Approved, Investigational
IbuprofenIbuprofen may increase the nephrotoxic activities of Sulfasalazine.Approved
IbuproxamIbuproxam may increase the nephrotoxic activities of Sulfasalazine.Withdrawn
IcatibantIcatibant may increase the nephrotoxic activities of Sulfasalazine.Approved
IdarubicinSulfasalazine may decrease the excretion rate of Idarubicin which could result in a higher serum level.Approved
idraparinuxSulfasalazine may increase the anticoagulant activities of idraparinux.Investigational
IloprostThe therapeutic efficacy of Iloprost can be decreased when used in combination with Sulfasalazine.Approved, Investigational
ImidaprilThe risk or severity of adverse effects can be increased when Imidapril is combined with Sulfasalazine.Investigational
IndapamideThe therapeutic efficacy of Indapamide can be decreased when used in combination with Sulfasalazine.Approved
IndenololSulfasalazine may decrease the antihypertensive activities of Indenolol.Withdrawn
IndomethacinIndomethacin may increase the nephrotoxic activities of Sulfasalazine.Approved, Investigational
IndoprofenIndoprofen may increase the nephrotoxic activities of Sulfasalazine.Withdrawn
INNO-206Sulfasalazine may decrease the excretion rate of INNO-206 which could result in a higher serum level.Investigational
IrbesartanThe risk or severity of adverse effects can be increased when Irbesartan is combined with Sulfasalazine.Approved, Investigational
IsoxicamIsoxicam may increase the nephrotoxic activities of Sulfasalazine.Withdrawn
IstaroximeThe risk or severity of adverse effects can be increased when Sulfasalazine is combined with Istaroxime.Investigational
KanamycinSulfasalazine may decrease the excretion rate of Kanamycin which could result in a higher serum level.Approved, Vet Approved
KebuzoneKebuzone may increase the nephrotoxic activities of Sulfasalazine.Experimental
KetoprofenKetoprofen may increase the nephrotoxic activities of Sulfasalazine.Approved, Vet Approved
KetorolacThe risk or severity of adverse effects can be increased when Ketorolac is combined with Sulfasalazine.Approved
KetorolacKetorolac may increase the nephrotoxic activities of Sulfasalazine.Approved
LabetalolSulfasalazine may decrease the antihypertensive activities of Labetalol.Approved
LatanoprostThe therapeutic efficacy of Latanoprost can be decreased when used in combination with Sulfasalazine.Approved, Investigational
LeflunomideLeflunomide may increase the nephrotoxic activities of Sulfasalazine.Approved, Investigational
LepirudinSulfasalazine may increase the anticoagulant activities of Lepirudin.Approved
LevobunololSulfasalazine may decrease the antihypertensive activities of Levobunolol.Approved
LevofloxacinSulfasalazine may increase the neuroexcitatory activities of Levofloxacin.Approved, Investigational
LimaprostThe therapeutic efficacy of Limaprost can be decreased when used in combination with Sulfasalazine.Approved
LisinoprilThe risk or severity of adverse effects can be increased when Lisinopril is combined with Sulfasalazine.Approved, Investigational
LisofyllineLisofylline may increase the nephrotoxic activities of Sulfasalazine.Investigational
LithiumThe serum concentration of Lithium can be increased when it is combined with Sulfasalazine.Approved
LomefloxacinSulfasalazine may increase the neuroexcitatory activities of Lomefloxacin.Approved
LornoxicamLornoxicam may increase the nephrotoxic activities of Sulfasalazine.Approved
LosartanThe risk or severity of adverse effects can be increased when Losartan is combined with Sulfasalazine.Approved
LoxoprofenLoxoprofen may increase the nephrotoxic activities of Sulfasalazine.Approved
LubiprostoneThe therapeutic efficacy of Lubiprostone can be decreased when used in combination with Sulfasalazine.Approved, Investigational
LumiracoxibThe risk or severity of adverse effects can be increased when Sulfasalazine is combined with Lumiracoxib.Approved, Investigational
LuprostiolThe therapeutic efficacy of Luprostiol can be decreased when used in combination with Sulfasalazine.Vet Approved
Magnesium salicylateMagnesium salicylate may increase the nephrotoxic activities of Sulfasalazine.Approved
MasoprocolMasoprocol may increase the nephrotoxic activities of Sulfasalazine.Approved
ME-609The risk or severity of adverse effects can be increased when Sulfasalazine is combined with ME-609.Investigational
MecamylamineThe risk or severity of adverse effects can be increased when Sulfasalazine is combined with Mecamylamine.Approved
Meclofenamic acidMeclofenamic acid may increase the nephrotoxic activities of Sulfasalazine.Approved, Vet Approved
MedrysoneThe risk or severity of adverse effects can be increased when Sulfasalazine is combined with Medrysone.Approved
Mefenamic acidMefenamic acid may increase the nephrotoxic activities of Sulfasalazine.Approved
MelengestrolThe risk or severity of adverse effects can be increased when Sulfasalazine is combined with Melengestrol.Vet Approved
MeloxicamMeloxicam may increase the nephrotoxic activities of Sulfasalazine.Approved, Vet Approved
MercaptopurineThe metabolism of Mercaptopurine can be decreased when combined with Sulfasalazine.Approved
MesalazineMesalazine may increase the nephrotoxic activities of Sulfasalazine.Approved
MetamizoleMetamizole may increase the nephrotoxic activities of Sulfasalazine.Withdrawn
MethotrexateSulfasalazine may increase the hepatotoxic activities of Methotrexate.Approved
MethyclothiazideThe therapeutic efficacy of Methyclothiazide can be decreased when used in combination with Sulfasalazine.Approved
MethylprednisoloneThe risk or severity of adverse effects can be increased when Sulfasalazine is combined with Methylprednisolone.Approved, Vet Approved
MetipranololSulfasalazine may decrease the antihypertensive activities of Metipranolol.Approved
MetolazoneThe therapeutic efficacy of Metolazone can be decreased when used in combination with Sulfasalazine.Approved
MetoprololSulfasalazine may decrease the antihypertensive activities of Metoprolol.Approved, Investigational
MetrizamideSulfasalazine may decrease the excretion rate of Metrizamide which could result in a higher serum level.Approved
MisoprostolThe therapeutic efficacy of Misoprostol can be decreased when used in combination with Sulfasalazine.Approved
MizoribineMizoribine may increase the nephrotoxic activities of Sulfasalazine.Investigational
MoexiprilThe risk or severity of adverse effects can be increased when Moexipril is combined with Sulfasalazine.Approved
MometasoneThe risk or severity of adverse effects can be increased when Sulfasalazine is combined with Mometasone.Approved, Vet Approved
MorniflumateThe risk or severity of adverse effects can be increased when Morniflumate is combined with Sulfasalazine.Approved
MoxifloxacinSulfasalazine may increase the neuroexcitatory activities of Moxifloxacin.Approved, Investigational
Mycophenolate mofetilMycophenolate mofetil may increase the nephrotoxic activities of Sulfasalazine.Approved, Investigational
Mycophenolic acidMycophenolic acid may increase the nephrotoxic activities of Sulfasalazine.Approved
NabumetoneThe risk or severity of adverse effects can be increased when Sulfasalazine is combined with Nabumetone.Approved
NadololSulfasalazine may decrease the antihypertensive activities of Nadolol.Approved
NadroparinThe risk or severity of adverse effects can be increased when Sulfasalazine is combined with Nadroparin.Approved
NafamostatNafamostat may increase the nephrotoxic activities of Sulfasalazine.Approved, Investigational
NaftifineNaftifine may increase the nephrotoxic activities of Sulfasalazine.Approved
Nalidixic AcidSulfasalazine may increase the neuroexcitatory activities of Nalidixic Acid.Approved
NaproxenNaproxen may increase the nephrotoxic activities of Sulfasalazine.Approved, Vet Approved
NCX 1022The risk or severity of adverse effects can be increased when Sulfasalazine is combined with NCX 1022.Investigational
NCX 4016NCX 4016 may increase the nephrotoxic activities of Sulfasalazine.Investigational
NeamineSulfasalazine may decrease the excretion rate of Neamine which could result in a higher serum level.Experimental
NemonoxacinSulfasalazine may increase the neuroexcitatory activities of Nemonoxacin.Investigational
NeomycinSulfasalazine may decrease the excretion rate of Neomycin which could result in a higher serum level.Approved, Vet Approved
NepafenacNepafenac may increase the nephrotoxic activities of Sulfasalazine.Approved
NetilmicinSulfasalazine may decrease the excretion rate of Netilmicin which could result in a higher serum level.Approved
Niflumic AcidNiflumic Acid may increase the nephrotoxic activities of Sulfasalazine.Approved
NimesulideNimesulide may increase the nephrotoxic activities of Sulfasalazine.Approved, Withdrawn
NitroaspirinNitroaspirin may increase the nephrotoxic activities of Sulfasalazine.Investigational
NorfloxacinSulfasalazine may increase the neuroexcitatory activities of Norfloxacin.Approved
OfloxacinSulfasalazine may increase the neuroexcitatory activities of Ofloxacin.Approved
OleandrinThe serum concentration of Anvirzel can be decreased when it is combined with Sulfasalazine.Experimental
Oleoyl estroneThe risk or severity of adverse effects can be increased when Sulfasalazine is combined with Oleoyl estrone.Investigational
OlmesartanThe risk or severity of adverse effects can be increased when Olmesartan is combined with Sulfasalazine.Approved, Investigational
OlopatadineOlopatadine may increase the nephrotoxic activities of Sulfasalazine.Approved
OlsalazineSulfasalazine may increase the nephrotoxic activities of Olsalazine.Approved
Omacetaxine mepesuccinateThe risk or severity of adverse effects can be increased when Sulfasalazine is combined with Omacetaxine mepesuccinate.Approved
OmapatrilatThe risk or severity of adverse effects can be increased when Omapatrilat is combined with Sulfasalazine.Investigational
OrgoteinOrgotein may increase the nephrotoxic activities of Sulfasalazine.Vet Approved
OtamixabanSulfasalazine may increase the anticoagulant activities of Otamixaban.Investigational
OuabainThe serum concentration of Ouabain can be decreased when it is combined with Sulfasalazine.Approved
OxaprozinOxaprozin may increase the nephrotoxic activities of Sulfasalazine.Approved
OxprenololSulfasalazine may decrease the antihypertensive activities of Oxprenolol.Approved
OxyphenbutazoneOxyphenbutazone may increase the nephrotoxic activities of Sulfasalazine.Withdrawn
PamidronateThe risk or severity of adverse effects can be increased when Sulfasalazine is combined with Pamidronate.Approved
ParamethasoneThe risk or severity of adverse effects can be increased when Sulfasalazine is combined with Paramethasone.Approved
ParecoxibThe risk or severity of adverse effects can be increased when Sulfasalazine is combined with Parecoxib.Approved
ParnaparinThe risk or severity of adverse effects can be increased when Sulfasalazine is combined with Parnaparin.Approved
ParomomycinSulfasalazine may decrease the excretion rate of Paromomycin which could result in a higher serum level.Approved, Investigational
PazopanibThe serum concentration of Pazopanib can be increased when it is combined with Sulfasalazine.Approved
PazufloxacinSulfasalazine may increase the neuroexcitatory activities of Pazufloxacin.Investigational
PefloxacinSulfasalazine may increase the neuroexcitatory activities of Pefloxacin.Approved
PenbutololSulfasalazine may decrease the antihypertensive activities of Penbutolol.Approved, Investigational
Pentosan PolysulfateSulfasalazine may increase the anticoagulant activities of Pentosan Polysulfate.Approved
PerindoprilThe risk or severity of adverse effects can be increased when Perindopril is combined with Sulfasalazine.Approved
PhenindioneSulfasalazine may increase the anticoagulant activities of Phenindione.Approved
PhenprocoumonSulfasalazine may increase the anticoagulant activities of Phenprocoumon.Approved
PhenylbutazonePhenylbutazone may increase the nephrotoxic activities of Sulfasalazine.Approved, Vet Approved
PimecrolimusPimecrolimus may increase the nephrotoxic activities of Sulfasalazine.Approved, Investigational
PindololSulfasalazine may decrease the antihypertensive activities of Pindolol.Approved
PirarubicinSulfasalazine may decrease the excretion rate of Pirarubicin which could result in a higher serum level.Investigational
PiretanideSulfasalazine may decrease the diuretic activities of Piretanide.Experimental
PirfenidonePirfenidone may increase the nephrotoxic activities of Sulfasalazine.Investigational
PiroxicamPiroxicam may increase the nephrotoxic activities of Sulfasalazine.Approved, Investigational
PlicamycinSulfasalazine may decrease the excretion rate of Plicamycin which could result in a higher serum level.Approved, Withdrawn
PolythiazideThe therapeutic efficacy of Polythiazide can be decreased when used in combination with Sulfasalazine.Approved
PractololSulfasalazine may decrease the antihypertensive activities of Practolol.Approved
PralatrexateThe serum concentration of Pralatrexate can be increased when it is combined with Sulfasalazine.Approved
PrasteroneThe risk or severity of adverse effects can be increased when Sulfasalazine is combined with Prasterone.Approved, Nutraceutical
PrednicarbateThe risk or severity of adverse effects can be increased when Sulfasalazine is combined with Prednicarbate.Approved
PrednisoloneThe risk or severity of adverse effects can be increased when Sulfasalazine is combined with Prednisolone.Approved, Vet Approved
PrednisoneThe risk or severity of adverse effects can be increased when Sulfasalazine is combined with Prednisone.Approved, Vet Approved
PregnenoloneThe risk or severity of adverse effects can be increased when Sulfasalazine is combined with Pregnenolone.Experimental
ProbenecidThe serum concentration of Sulfasalazine can be increased when it is combined with Probenecid.Approved
PropacetamolPropacetamol may increase the nephrotoxic activities of Sulfasalazine.Approved
PropranololSulfasalazine may decrease the antihypertensive activities of Propranolol.Approved, Investigational
Prostaglandin B2The therapeutic efficacy of Prostaglandin B2 can be decreased when used in combination with Sulfasalazine.Experimental
Prostaglandin D2The therapeutic efficacy of Prostaglandin D2 can be decreased when used in combination with Sulfasalazine.Experimental, Investigational
Prostaglandin G2The therapeutic efficacy of Prostaglandin G2 can be decreased when used in combination with Sulfasalazine.Experimental
ProstaleneThe therapeutic efficacy of Prostalene can be decreased when used in combination with Sulfasalazine.Vet Approved
Protein CSulfasalazine may increase the anticoagulant activities of Protein C.Approved
Protein S humanSulfasalazine may increase the anticoagulant activities of Protein S human.Approved
ProtocatechualdehydeSulfasalazine may increase the anticoagulant activities of Protocatechualdehyde.Approved
PrulifloxacinSulfasalazine may increase the neuroexcitatory activities of Prulifloxacin.Investigational
PTC299PTC299 may increase the nephrotoxic activities of Sulfasalazine.Investigational
PuromycinSulfasalazine may decrease the excretion rate of Puromycin which could result in a higher serum level.Experimental
QuinaprilThe risk or severity of adverse effects can be increased when Quinapril is combined with Sulfasalazine.Approved, Investigational
QuinethazoneThe therapeutic efficacy of Quinethazone can be decreased when used in combination with Sulfasalazine.Approved
RamiprilThe risk or severity of adverse effects can be increased when Ramipril is combined with Sulfasalazine.Approved
RescinnamineThe risk or severity of adverse effects can be increased when Rescinnamine is combined with Sulfasalazine.Approved
ResveratrolResveratrol may increase the nephrotoxic activities of Sulfasalazine.Experimental, Investigational
ReviparinThe risk or severity of adverse effects can be increased when Sulfasalazine is combined with Reviparin.Approved
RibostamycinSulfasalazine may decrease the excretion rate of Ribostamycin which could result in a higher serum level.Approved
RimexoloneThe risk or severity of adverse effects can be increased when Sulfasalazine is combined with Rimexolone.Approved
RisedronateThe risk or severity of adverse effects can be increased when Sulfasalazine is combined with Risedronate.Approved, Investigational
RivaroxabanSulfasalazine may increase the anticoagulant activities of Rivaroxaban.Approved
RofecoxibThe risk or severity of adverse effects can be increased when Sulfasalazine is combined with Rofecoxib.Investigational, Withdrawn
RolapitantThe serum concentration of Sulfasalazine can be increased when it is combined with Rolapitant.Approved
RosoxacinSulfasalazine may increase the neuroexcitatory activities of Rosoxacin.Approved
SacubitrilThe risk or severity of adverse effects can be increased when Sacubitril is combined with Sulfasalazine.Approved
SalicylamideSalicylamide may increase the nephrotoxic activities of Sulfasalazine.Approved
Salicylic acidSalicylic acid may increase the nephrotoxic activities of Sulfasalazine.Approved, Vet Approved
SalsalateSalsalate may increase the nephrotoxic activities of Sulfasalazine.Approved
SaprisartanThe risk or severity of adverse effects can be increased when Saprisartan is combined with Sulfasalazine.Experimental
SaralasinThe risk or severity of adverse effects can be increased when Saralasin is combined with Sulfasalazine.Investigational
SeratrodastSeratrodast may increase the nephrotoxic activities of Sulfasalazine.Approved, Investigational
SisomicinSulfasalazine may decrease the excretion rate of Sisomicin which could result in a higher serum level.Investigational
SotalolSulfasalazine may decrease the antihypertensive activities of Sotalol.Approved
SP1049CSulfasalazine may decrease the excretion rate of SP1049C which could result in a higher serum level.Investigational
SparfloxacinSulfasalazine may increase the neuroexcitatory activities of Sparfloxacin.Approved
SpectinomycinSulfasalazine may decrease the excretion rate of Spectinomycin which could result in a higher serum level.Approved, Vet Approved
SpiraprilThe risk or severity of adverse effects can be increased when Spirapril is combined with Sulfasalazine.Approved
SpironolactoneSulfasalazine may decrease the antihypertensive activities of Spironolactone.Approved
SRT501SRT501 may increase the nephrotoxic activities of Sulfasalazine.Investigational
StreptomycinSulfasalazine may decrease the excretion rate of Streptomycin which could result in a higher serum level.Approved, Vet Approved
StreptozocinSulfasalazine may decrease the excretion rate of Streptozocin which could result in a higher serum level.Approved
SulindacSulindac may increase the nephrotoxic activities of Sulfasalazine.Approved
SulodexideSulfasalazine may increase the anticoagulant activities of Sulodexide.Approved, Investigational
SulprostoneThe therapeutic efficacy of Sulprostone can be decreased when used in combination with Sulfasalazine.Investigational
SuprofenSuprofen may increase the nephrotoxic activities of Sulfasalazine.Approved, Withdrawn
TacrolimusSulfasalazine may increase the nephrotoxic activities of Tacrolimus.Approved, Investigational
TafluprostThe therapeutic efficacy of Tafluprost can be decreased when used in combination with Sulfasalazine.Approved
TalniflumateThe risk or severity of adverse effects can be increased when Talniflumate is combined with Sulfasalazine.Approved
TasosartanThe risk or severity of adverse effects can be increased when Tasosartan is combined with Sulfasalazine.Approved
Technetium tc 99m etidronateThe risk or severity of adverse effects can be increased when Sulfasalazine is combined with Technetium tc 99m etidronate.Approved
Technetium Tc-99m MedronateThe risk or severity of adverse effects can be increased when Sulfasalazine is combined with Technetium Tc-99m Medronate.Approved
TelmisartanThe risk or severity of adverse effects can be increased when Telmisartan is combined with Sulfasalazine.Approved, Investigational
TemafloxacinSulfasalazine may increase the neuroexcitatory activities of Temafloxacin.Withdrawn
TemocaprilThe risk or severity of adverse effects can be increased when Temocapril is combined with Sulfasalazine.Experimental, Investigational
TenofovirThe risk or severity of adverse effects can be increased when Sulfasalazine is combined with Tenofovir.Approved, Investigational
TenoxicamTenoxicam may increase the nephrotoxic activities of Sulfasalazine.Approved
TepoxalinTepoxalin may increase the nephrotoxic activities of Sulfasalazine.Vet Approved
TeriflunomideThe serum concentration of Sulfasalazine can be increased when it is combined with Teriflunomide.Approved
Tiaprofenic acidTiaprofenic acid may increase the nephrotoxic activities of Sulfasalazine.Approved
Tiludronic acidThe risk or severity of adverse effects can be increased when Sulfasalazine is combined with Tiludronate.Approved, Vet Approved
TimololSulfasalazine may decrease the antihypertensive activities of Timolol.Approved
TinoridineTinoridine may increase the nephrotoxic activities of Sulfasalazine.Investigational
TinzaparinThe risk or severity of adverse effects can be increased when Sulfasalazine is combined with Tinzaparin.Approved
TioguanineThe metabolism of Tioguanine can be decreased when combined with Sulfasalazine.Approved
TixocortolThe risk or severity of adverse effects can be increased when Sulfasalazine is combined with Tixocortol.Approved
TobramycinSulfasalazine may decrease the excretion rate of Tobramycin which could result in a higher serum level.Approved, Investigational
Tolfenamic AcidTolfenamic Acid may increase the nephrotoxic activities of Sulfasalazine.Approved
TolmetinTolmetin may increase the nephrotoxic activities of Sulfasalazine.Approved
TopotecanThe serum concentration of Topotecan can be increased when it is combined with Sulfasalazine.Approved, Investigational
TorasemideSulfasalazine may decrease the diuretic activities of Torasemide.Approved
TrandolaprilThe risk or severity of adverse effects can be increased when Trandolapril is combined with Sulfasalazine.Approved
TranilastTranilast may increase the nephrotoxic activities of Sulfasalazine.Approved, Investigational
TravoprostThe therapeutic efficacy of Travoprost can be decreased when used in combination with Sulfasalazine.Approved
TreprostinilThe risk or severity of adverse effects can be increased when Treprostinil is combined with Sulfasalazine.Approved, Investigational
TriamcinoloneThe risk or severity of adverse effects can be increased when Sulfasalazine is combined with Triamcinolone.Approved, Vet Approved
TriamtereneSulfasalazine may decrease the antihypertensive activities of Triamterene.Approved
TrichlormethiazideThe therapeutic efficacy of Trichlormethiazide can be decreased when used in combination with Sulfasalazine.Approved, Vet Approved
Trisalicylate-cholineTrisalicylate-choline may increase the nephrotoxic activities of Sulfasalazine.Approved
TrovafloxacinSulfasalazine may increase the neuroexcitatory activities of Trovafloxacin.Approved, Withdrawn
UnoprostoneThe therapeutic efficacy of Unoprostone can be decreased when used in combination with Sulfasalazine.Approved
ValdecoxibThe risk or severity of adverse effects can be increased when Sulfasalazine is combined with Valdecoxib.Investigational, Withdrawn
ValrubicinSulfasalazine may decrease the excretion rate of Valrubicin which could result in a higher serum level.Approved
ValsartanThe risk or severity of adverse effects can be increased when Valsartan is combined with Sulfasalazine.Approved, Investigational
VancomycinThe serum concentration of Vancomycin can be increased when it is combined with Sulfasalazine.Approved
WarfarinSulfasalazine may increase the anticoagulant activities of Warfarin.Approved
XimelagatranSulfasalazine may increase the anticoagulant activities of Ximelagatran.Approved, Investigational, Withdrawn
YM150Sulfasalazine may increase the anticoagulant activities of Ym150.Investigational
ZaltoprofenZaltoprofen may increase the nephrotoxic activities of Sulfasalazine.Approved
ZileutonZileuton may increase the nephrotoxic activities of Sulfasalazine.Approved, Investigational, Withdrawn
Zoledronic acidThe risk or severity of adverse effects can be increased when Sulfasalazine is combined with Zoledronic acid.Approved
ZomepiracZomepirac may increase the nephrotoxic activities of Sulfasalazine.Withdrawn
ZorubicinSulfasalazine may decrease the excretion rate of Zorubicin which could result in a higher serum level.Experimental
Food Interactions
  • May take Vitamin D.
  • Take with a full glass of water No iron, zinc or fluoride within 2 hours of taking this medication.
  • Take with food.
Synthesis ReferenceNot Available
General ReferencesNot Available
External Links
ATC CodesA07EC01
AHFS Codes
  • 08:12.20
PDB EntriesNot Available
FDA labelDownload (796 KB)
MSDSDownload (72.8 KB)
Clinical Trials
Clinical Trials
1CompletedBasic ScienceAdministration, Oral / Magnetic Resonance Imaging (MRI) / Pharmacokinetics1
1CompletedBasic ScienceChemotherapy-Induced Nausea and Vomiting (CINV)1
1CompletedBasic ScienceIntestinal Obstruction2
2RecruitingTreatmentAnkylosing Spondylitis (AS)1
2RecruitingTreatmentPainful Neuropathy1
2RecruitingTreatmentRheumatoid Arthritis1
2Unknown StatusTreatmentModerate to Severe Active Axial Spondyloarthritis1
2, 3Unknown StatusTreatmentEarly Ankylosing Spondylitis1
3Active Not RecruitingSupportive CareDiarrhea / Gastrointestinal Complications / Unspecified Adult Solid Tumor, Protocol Specific1
3CompletedTreatmentRheumatoid Arthritis5
4Active Not RecruitingTreatmentRheumatoid Arthritis1
4CompletedTreatmentAnkylosing Spondylitis (AS)1
4CompletedTreatmentRheumatoid Arthritis2
4Not Yet RecruitingTreatmentAnkylosing Spondylitis (AS)1
4RecruitingTreatmentRheumatoid Arthritis3
4TerminatedTreatmentArthritis, Juvenile Rheumatoid1
Not AvailableCompletedBasic ScienceCoronary Artery Disease1
Not AvailableCompletedTreatmentAlcohol Dependence1
Not AvailableCompletedTreatmentRheumatoid Arthritis1
Not AvailableCompletedTreatmentTumor, Brain1
Not AvailableRecruitingTreatmentRecurrence (Disease Attribute)1
  • Pharmacia and upjohn co
  • Vintage pharmaceuticals inc
  • Watson laboratories inc
  • Solvay pharmaceuticals
  • Heritage pharmaceuticals inc
  • Mutual pharmaceutical co inc
  • Sandoz inc
  • Superpharm corp
Dosage forms
TabletOral500 mg/1
Tablet, delayed releaseOral500 mg/1
Tablet, delayed releaseOral500 mg
SuspensionRectal3 g
EnemaRectal3 g
TabletOral500 mg
Unit descriptionCostUnit
Sulfasalazine powder2.14USD g
Azulfidine EN-tabs 500 mg Enteric Coated Tabs0.73USD tab
Azulfidine entab 500 mg0.69USD tablet
Azulfidine 500 mg tablet0.59USD tablet
Salazopyrin En-Tabs 500 mg Enteric-Coated Tablet0.45USD tablet
Sulfasalazine 500 mg Enteric Coated Tabs0.4USD tab
Pms-Sulfasalazine 500 mg Enteric-Coated Tablet0.34USD tablet
Salazopyrin 500 mg Tablet0.28USD tablet
Sulfasalazine 500 mg tablet0.25USD tablet
Sulfazine 500 mg tablet0.25USD tablet
Pms-Sulfasalazine 500 mg Tablet0.22USD tablet
DrugBank does not sell nor buy drugs. Pricing information is supplied for informational purposes only.
PatentsNot Available
Experimental Properties
melting point220 dec °CPhysProp
logP2.5Not Available
Caco2 permeability-6.33ADME Research, USCD
Predicted Properties
Water Solubility0.0464 mg/mLALOGPS
pKa (Strongest Acidic)3.3ChemAxon
pKa (Strongest Basic)2.4ChemAxon
Physiological Charge-2ChemAxon
Hydrogen Acceptor Count8ChemAxon
Hydrogen Donor Count3ChemAxon
Polar Surface Area141.31 Å2ChemAxon
Rotatable Bond Count5ChemAxon
Refractivity104.6 m3·mol-1ChemAxon
Polarizability39.69 Å3ChemAxon
Number of Rings3ChemAxon
Rule of FiveYesChemAxon
Ghose FilterYesChemAxon
Veber's RuleYesChemAxon
MDDR-like RuleYesChemAxon
Predicted ADMET features
Human Intestinal Absorption+0.9156
Blood Brain Barrier-0.7294
Caco-2 permeable-0.6893
P-glycoprotein substrateNon-substrate0.8405
P-glycoprotein inhibitor INon-inhibitor0.9096
P-glycoprotein inhibitor IINon-inhibitor0.853
Renal organic cation transporterNon-inhibitor0.8956
CYP450 2C9 substrateNon-substrate0.6445
CYP450 2D6 substrateNon-substrate0.9116
CYP450 3A4 substrateNon-substrate0.7557
CYP450 1A2 substrateNon-inhibitor0.9046
CYP450 2C9 inhibitorInhibitor0.8948
CYP450 2D6 inhibitorNon-inhibitor0.9231
CYP450 2C19 inhibitorNon-inhibitor0.923
CYP450 3A4 inhibitorNon-inhibitor0.8309
CYP450 inhibitory promiscuityLow CYP Inhibitory Promiscuity0.8895
Ames testNon AMES toxic0.9133
BiodegradationNot ready biodegradable0.9472
Rat acute toxicity1.4383 LD50, mol/kg Not applicable
hERG inhibition (predictor I)Weak inhibitor0.939
hERG inhibition (predictor II)Non-inhibitor0.821
ADMET data is predicted using admetSAR, a free tool for evaluating chemical ADMET properties. (23092397 )
Mass Spec (NIST)Not Available
Spectrum TypeDescriptionSplash Key
Predicted LC-MS/MSPredicted LC-MS/MS Spectrum - 10V, PositiveNot Available
Predicted LC-MS/MSPredicted LC-MS/MS Spectrum - 20V, PositiveNot Available
Predicted LC-MS/MSPredicted LC-MS/MS Spectrum - 40V, PositiveNot Available
Predicted LC-MS/MSPredicted LC-MS/MS Spectrum - 10V, NegativeNot Available
Predicted LC-MS/MSPredicted LC-MS/MS Spectrum - 20V, NegativeNot Available
Predicted LC-MS/MSPredicted LC-MS/MS Spectrum - 40V, NegativeNot Available
DescriptionThis compound belongs to the class of chemical entities known as azobenzenes. These are organonitrogen aromatic compounds that contain a central azo group, where each nitrogen atom is conjugated to a benzene ring.
KingdomChemical entities
Super ClassOrganic compounds
ClassOrganoheterocyclic compounds
Sub ClassAzobenzenes
Direct ParentAzobenzenes
Alternative Parents
  • Azobenzene
  • Benzenesulfonamide
  • Hydroxybenzoic acid
  • Salicylic acid or derivatives
  • Salicylic acid
  • Benzoic acid or derivatives
  • Benzoic acid
  • Benzenesulfonyl group
  • Benzoyl
  • 1-hydroxy-2-unsubstituted benzenoid
  • Phenol
  • Monocyclic benzene moiety
  • Pyridine
  • Imidolactam
  • Benzenoid
  • Organosulfonic acid amide
  • Heteroaromatic compound
  • Vinylogous acid
  • Organic sulfonic acid or derivatives
  • Organosulfonic acid or derivatives
  • Aminosulfonyl compound
  • Sulfonyl
  • Azo compound
  • Azacycle
  • Monocarboxylic acid or derivatives
  • Carboxylic acid
  • Carboxylic acid derivative
  • Organic 1,3-dipolar compound
  • Propargyl-type 1,3-dipolar organic compound
  • Organosulfur compound
  • Organooxygen compound
  • Organonitrogen compound
  • Hydrocarbon derivative
  • Organic nitrogen compound
  • Organic oxygen compound
  • Organopnictogen compound
  • Organic oxide
  • Aromatic heteromonocyclic compound
Molecular FrameworkAromatic heteromonocyclic compounds
External Descriptors


Pharmacological action
General Function:
Iron ion binding
Specific Function:
Catalyzes the first step in leukotriene biosynthesis, and thereby plays a role in inflammatory processes.
Gene Name:
Uniprot ID:
Molecular Weight:
77982.595 Da
  1. Nielsen OH, Bukhave K, Elmgreen J, Ahnfelt-Ronne I: Inhibition of 5-lipoxygenase pathway of arachidonic acid metabolism in human neutrophils by sulfasalazine and 5-aminosalicylic acid. Dig Dis Sci. 1987 Jun;32(6):577-82. [PubMed:2882965 ]
  2. Allgayer H, Eisenburg J, Paumgartner G: Soybean lipoxygenase inhibition: studies with the sulphasalazine metabolites N-acetylaminosalicylic acid, 5-aminosalicylic acid and sulphapyridine. Eur J Clin Pharmacol. 1984;26(4):449-51. [PubMed:6428914 ]
  3. Sircar JC, Schwender CF, Carethers ME: Inhibition of soybean lipoxygenase by sulfasalazine and 5-aminosalicylic acid: a possible mode of action in ulcerative colitis. Biochem Pharmacol. 1983 Jan 1;32(1):170-2. [PubMed:6131674 ]
Pharmacological action
General Function:
Prostaglandin-endoperoxide synthase activity
Specific Function:
Converts arachidonate to prostaglandin H2 (PGH2), a committed step in prostanoid synthesis. Constitutively expressed in some tissues in physiological conditions, such as the endothelium, kidney and brain, and in pathological conditions, such as in cancer. PTGS2 is responsible for production of inflammatory prostaglandins. Up-regulation of PTGS2 is also associated with increased cell adhesion, p...
Gene Name:
Uniprot ID:
Molecular Weight:
68995.625 Da
  1. Mifflin RC, Saada JI, Di Mari JF, Valentich JD, Adegboyega PA, Powell DW: Aspirin-mediated COX-2 transcript stabilization via sustained p38 activation in human intestinal myofibroblasts. Mol Pharmacol. 2004 Feb;65(2):470-8. [PubMed:14742690 ]
  2. Generini S, Fiori G, Matucci Cerinic M: Therapy of spondylarthropathy in inflammatory bowel disease. Clin Exp Rheumatol. 2002 Nov-Dec;20(6 Suppl 28):S88-94. [PubMed:12463455 ]
  3. Distrutti E, Sediari L, Mencarelli A, Renga B, Orlandi S, Russo G, Caliendo G, Santagada V, Cirino G, Wallace JL, Fiorucci S: 5-Amino-2-hydroxybenzoic acid 4-(5-thioxo-5H-[1,2]dithiol-3yl)-phenyl ester (ATB-429), a hydrogen sulfide-releasing derivative of mesalamine, exerts antinociceptive effects in a model of postinflammatory hypersensitivity. J Pharmacol Exp Ther. 2006 Oct;319(1):447-58. Epub 2006 Jul 19. [PubMed:16855178 ]
  4. Cipolla G, Crema F, Sacco S, Moro E, de Ponti F, Frigo G: Nonsteroidal anti-inflammatory drugs and inflammatory bowel disease: current perspectives. Pharmacol Res. 2002 Jul;46(1):1-6. [PubMed:12208114 ]
  5. Pruzanski W, Stefanski E, Vadas P, Ramamurthy NS: Inhibition of extracellular release of proinflammatory secretory phospholipase A2 (sPLA2) by sulfasalazine: a novel mechanism of anti-inflammatory activity. Biochem Pharmacol. 1997 Jun 15;53(12):1901-7. [PubMed:9256165 ]
Pharmacological action
General Function:
Prostaglandin-endoperoxide synthase activity
Specific Function:
Converts arachidonate to prostaglandin H2 (PGH2), a committed step in prostanoid synthesis. Involved in the constitutive production of prostanoids in particular in the stomach and platelets. In gastric epithelial cells, it is a key step in the generation of prostaglandins, such as prostaglandin E2 (PGE2), which plays an important role in cytoprotection. In platelets, it is involved in the gener...
Gene Name:
Uniprot ID:
Molecular Weight:
68685.82 Da
  1. Allgayer H: Review article: mechanisms of action of mesalazine in preventing colorectal carcinoma in inflammatory bowel disease. Aliment Pharmacol Ther. 2003 Sep;18 Suppl 2:10-4. [PubMed:12950415 ]
Pharmacological action
General Function:
Zinc ion binding
Specific Function:
Nuclear receptor that binds peroxisome proliferators such as hypolipidemic drugs and fatty acids. Once activated by a ligand, the nuclear receptor binds to DNA specific PPAR response elements (PPRE) and modulates the transcription of its target genes, such as acyl-CoA oxidase. It therefore controls the peroxisomal beta-oxidation pathway of fatty acids. Key regulator of adipocyte differentiation...
Gene Name:
Uniprot ID:
Molecular Weight:
57619.58 Da
  1. Rousseaux C, Lefebvre B, Dubuquoy L, Lefebvre P, Romano O, Auwerx J, Metzger D, Wahli W, Desvergne B, Naccari GC, Chavatte P, Farce A, Bulois P, Cortot A, Colombel JF, Desreumaux P: Intestinal antiinflammatory effect of 5-aminosalicylic acid is dependent on peroxisome proliferator-activated receptor-gamma. J Exp Med. 2005 Apr 18;201(8):1205-15. Epub 2005 Apr 11. [PubMed:15824083 ]
  2. Schwab M, Reynders V, Loitsch S, Shastri YM, Steinhilber D, Schroder O, Stein J: PPARgamma is involved in mesalazine-mediated induction of apoptosis and inhibition of cell growth in colon cancer cells. Carcinogenesis. 2008 Jul;29(7):1407-14. doi: 10.1093/carcin/bgn118. Epub 2008 Jun 9. [PubMed:18544567 ]
  3. Linard C, Gremy O, Benderitter M: Reduction of peroxisome proliferation-activated receptor gamma expression by gamma-irradiation as a mechanism contributing to inflammatory response in rat colon: modulation by the 5-aminosalicylic acid agonist. J Pharmacol Exp Ther. 2008 Mar;324(3):911-20. Epub 2007 Dec 12. [PubMed:18077625 ]
  4. Desreumaux P, Ghosh S: Review article: mode of action and delivery of 5-aminosalicylic acid - new evidence. Aliment Pharmacol Ther. 2006 Sep;24 Suppl 1:2-9. [PubMed:16939423 ]
Pharmacological action
General Function:
Scaffold protein binding
Specific Function:
Serine kinase that plays an essential role in the NF-kappa-B signaling pathway which is activated by multiple stimuli such as inflammatory cytokines, bacterial or viral products, DNA damages or other cellular stresses. Acts as part of the canonical IKK complex in the conventional pathway of NF-kappa-B activation and phosphorylates inhibitors of NF-kappa-B on serine residues. These modifications...
Gene Name:
Uniprot ID:
Molecular Weight:
84638.88 Da
  1. Weber CK, Liptay S, Wirth T, Adler G, Schmid RM: Suppression of NF-kappaB activity by sulfasalazine is mediated by direct inhibition of IkappaB kinases alpha and beta. Gastroenterology. 2000 Nov;119(5):1209-18. [PubMed:11054378 ]
  2. Allgayer H: Review article: mechanisms of action of mesalazine in preventing colorectal carcinoma in inflammatory bowel disease. Aliment Pharmacol Ther. 2003 Sep;18 Suppl 2:10-4. [PubMed:12950415 ]
Pharmacological action
General Function:
Scaffold protein binding
Specific Function:
Serine kinase that plays an essential role in the NF-kappa-B signaling pathway which is activated by multiple stimuli such as inflammatory cytokines, bacterial or viral products, DNA damages or other cellular stresses. Acts as part of the canonical IKK complex in the conventional pathway of NF-kappa-B activation and phosphorylates inhibitors of NF-kappa-B on 2 critical serine residues. These mo...
Gene Name:
Uniprot ID:
Molecular Weight:
86563.245 Da
  1. Weber CK, Liptay S, Wirth T, Adler G, Schmid RM: Suppression of NF-kappaB activity by sulfasalazine is mediated by direct inhibition of IkappaB kinases alpha and beta. Gastroenterology. 2000 Nov;119(5):1209-18. [PubMed:11054378 ]
  2. Allgayer H: Review article: mechanisms of action of mesalazine in preventing colorectal carcinoma in inflammatory bowel disease. Aliment Pharmacol Ther. 2003 Sep;18 Suppl 2:10-4. [PubMed:12950415 ]
Pharmacological action
General Function:
Cystine:glutamate antiporter activity
Specific Function:
Sodium-independent, high-affinity exchange of anionic amino acids with high specificity for anionic form of cystine and glutamate.
Gene Name:
Uniprot ID:
Molecular Weight:
55422.44 Da
  1. Chen X, Ji ZL, Chen YZ: TTD: Therapeutic Target Database. Nucleic Acids Res. 2002 Jan 1;30(1):412-5. [PubMed:11752352 ]
  2. Gout PW, Buckley AR, Simms CR, Bruchovsky N: Sulfasalazine, a potent suppressor of lymphoma growth by inhibition of the x(c)- cystine transporter: a new action for an old drug. Leukemia. 2001 Oct;15(10):1633-40. [PubMed:11587223 ]
Pharmacological action
General Function:
Metal ion binding
Specific Function:
Plays a major role in ketone body metabolism.
Gene Name:
Uniprot ID:
Molecular Weight:
45199.2 Da
  1. Overington JP, Al-Lazikani B, Hopkins AL: How many drug targets are there? Nat Rev Drug Discov. 2006 Dec;5(12):993-6. [PubMed:17139284 ]
  2. Imming P, Sinning C, Meyer A: Drugs, their targets and the nature and number of drug targets. Nat Rev Drug Discov. 2006 Oct;5(10):821-34. [PubMed:17016423 ]
  3. Faison LD, White HL: Sulfasalazine inhibits lyso-PAF: acetyl-COA acetyltransferase. Prostaglandins. 1992 Sep;44(3):245-9. [PubMed:1357724 ]
Pharmacological action
General Function:
Thromboxane-a synthase activity
Specific Function:
Not Available
Gene Name:
Uniprot ID:
Molecular Weight:
60517.69 Da
  1. Stenson WF, Lobos E: Inhibition of platelet thromboxane synthetase by sulfasalazine. Biochem Pharmacol. 1983 Jul 15;32(14):2205-9. [PubMed:6135423 ]
Pharmacological action
General Function:
Receptor binding
Specific Function:
PA2 catalyzes the calcium-dependent hydrolysis of the 2-acyl groups in 3-sn-phosphoglycerides, this releases glycerophospholipids and arachidonic acid that serve as the precursors of signal molecules.
Gene Name:
Uniprot ID:
Molecular Weight:
16359.535 Da
  1. Pruzanski W, Stefanski E, Vadas P, Ramamurthy NS: Inhibition of extracellular release of proinflammatory secretory phospholipase A2 (sPLA2) by sulfasalazine: a novel mechanism of anti-inflammatory activity. Biochem Pharmacol. 1997 Jun 15;53(12):1901-7. [PubMed:9256165 ]


Pharmacological action
General Function:
Oxygen binding
Specific Function:
Cytochromes P450 are a group of heme-thiolate monooxygenases. In liver microsomes, this enzyme is involved in an NADPH-dependent electron transport pathway. It oxidizes a variety of structurally unrelated compounds, including steroids, fatty acids, and xenobiotics.
Gene Name:
Uniprot ID:
Molecular Weight:
57108.065 Da
  1. Preissner S, Kroll K, Dunkel M, Senger C, Goldsobel G, Kuzman D, Guenther S, Winnenburg R, Schroeder M, Preissner R: SuperCYP: a comprehensive database on Cytochrome P450 enzymes including a tool for analysis of CYP-drug interactions. Nucleic Acids Res. 2010 Jan;38(Database issue):D237-43. doi: 10.1093/nar/gkp970. Epub 2009 Nov 24. [PubMed:19934256 ]


Pharmacological action
General Function:
Xenobiotic-transporting atpase activity
Specific Function:
High-capacity urate exporter functioning in both renal and extrarenal urate excretion. Plays a role in porphyrin homeostasis as it is able to mediates the export of protoporhyrin IX (PPIX) both from mitochondria to cytosol and from cytosol to extracellular space, and cellular export of hemin, and heme. Xenobiotic transporter that may play an important role in the exclusion of xenobiotics from t...
Gene Name:
Uniprot ID:
Molecular Weight:
72313.47 Da
  1. Karlsson JE, Heddle C, Rozkov A, Rotticci-Mulder J, Tuvesson O, Hilgendorf C, Andersson TB: High-activity p-glycoprotein, multidrug resistance protein 2, and breast cancer resistance protein membrane vesicles prepared from transiently transfected human embryonic kidney 293-epstein-barr virus nuclear antigen cells. Drug Metab Dispos. 2010 Apr;38(4):705-14. doi: 10.1124/dmd.109.028886. Epub 2010 Jan 13. [PubMed:20071452 ]
  2. Shukla S, Zaher H, Hartz A, Bauer B, Ware JA, Ambudkar SV: Curcumin inhibits the activity of ABCG2/BCRP1, a multidrug resistance-linked ABC drug transporter in mice. Pharm Res. 2009 Feb;26(2):480-7. doi: 10.1007/s11095-008-9735-8. Epub 2008 Oct 9. [PubMed:18841445 ]
  3. Dahan A, Amidon GL: Small intestinal efflux mediated by MRP2 and BCRP shifts sulfasalazine intestinal permeability from high to low, enabling its colonic targeting. Am J Physiol Gastrointest Liver Physiol. 2009 Aug;297(2):G371-7. doi: 10.1152/ajpgi.00102.2009. Epub 2009 Jun 18. [PubMed:19541926 ]
Pharmacological action
General Function:
Organic anion transmembrane transporter activity
Specific Function:
Mediates hepatobiliary excretion of numerous organic anions. May function as a cellular cisplatin transporter.
Gene Name:
Uniprot ID:
Molecular Weight:
174205.64 Da
  1. Dahan A, Amidon GL: Small intestinal efflux mediated by MRP2 and BCRP shifts sulfasalazine intestinal permeability from high to low, enabling its colonic targeting. Am J Physiol Gastrointest Liver Physiol. 2009 Aug;297(2):G371-7. doi: 10.1152/ajpgi.00102.2009. Epub 2009 Jun 18. [PubMed:19541926 ]
Pharmacological action
General Function:
Methotrexate transporter activity
Specific Function:
Has been shown to act both as an intestinal proton-coupled high-affinity folate transporter and as an intestinal heme transporter which mediates heme uptake from the gut lumen into duodenal epithelial cells. The iron is then released from heme and may be transported into the bloodstream. Dietary heme iron is an important nutritional source of iron. Shows a higher affinity for folate than heme.
Gene Name:
Uniprot ID:
Molecular Weight:
49770.04 Da
  1. Nakai Y, Inoue K, Abe N, Hatakeyama M, Ohta KY, Otagiri M, Hayashi Y, Yuasa H: Functional characterization of human proton-coupled folate transporter/heme carrier protein 1 heterologously expressed in mammalian cells as a folate transporter. J Pharmacol Exp Ther. 2007 Aug;322(2):469-76. Epub 2007 May 2. [PubMed:17475902 ]
comments powered by Disqus
Drug created on June 13, 2005 07:24 / Updated on April 21, 2017 11:00