
Logo pink
Are you a
new drug developer?
Contact us to learn more about our customized products and solutions.
Accession Number
Small Molecule
Approved, Investigational

Dabrafenib mesylate (Tafinlar) is a reversible ATP-competitive kinase inhibitor and targets the MAPK pathway. It was approved on May 29, 2013 for the treatment of melanoma 7.

In May 2018, Tafinlar (dabrafenib) and Mekinist (Trametinib) in combination have been approved to treat anaplastic thyroid cancer caused by an abnormal BRAF V600E gene 5.

  • Dabrafenib
External IDs
GSK-2118436 / GSK-2118436A / GSK2118436 / GSK2118436A
Product Ingredients
IngredientUNIICASInChI Key
Dabrafenib mesylateB6DC89I63E1195768-06-9YKGMKSIHIVVYKY-UHFFFAOYSA-N
Prescription Products
NameDosageStrengthRouteLabellerMarketing StartMarketing End
TafinlarCapsule50 mg/1OralNovartis Pharmaceuticals Corporation2016-04-12Not applicableUs
TafinlarCapsule75 mg/1OralGlaxosmithkline Inc2013-06-10Not applicableUs
TafinlarCapsule75 mgOralNovartis2013-08-28Not applicableCanada
TafinlarCapsule50 mg/1OralGlaxosmithkline Inc2013-06-10Not applicableUs
TafinlarCapsule50 mgOralNovartis2013-08-28Not applicableCanada
TafinlarCapsule75 mg/1OralGlaxosmithkline Inc2013-06-102018-05-31Us
TafinlarCapsule75 mg/1OralNovartis Pharmaceuticals Corporation2016-04-01Not applicableUs
TafinlarCapsule50 mg/1OralGlaxosmithkline Inc2013-06-102018-08-31Us
Additional Data Available
  • Application Number
    Application Number

    A unique ID assigned by the FDA when a product is submitted for approval by the labeller.

    Learn more
  • Product Code
    Product Code

    A governmentally-recognized ID which uniquely identifies the product within its regulatory market.

    Learn more
CAS number
Average: 519.562
Monoisotopic: 519.101050904
Chemical Formula
InChI Key



Tafinlar is a kinase inhibitor that was initially indicated as a single agent for the treatment of patients with unresectable or metastatic melanoma with BRAF V600E mutation as detected by an FDA-approved test Label.

Tafinlar in combination with Trametinib is indicated for the treatment of patients with unresectable or metastatic melanoma with BRAF V600E or V600K mutations as detected by an FDA-approved test. The use in combination is based on the demonstration of durable response rate. Improvement in disease-related symptoms or overall survival has not been demonstrated for Tafinlar in combination with trametinib Label.

In May 2018, Tafinlar (dabrafenib) and Mekinist (Trametinib) have been approved in combination to treat anaplastic thyroid cancer caused by an abnormal BRAF V600E gene 3.

Associated Conditions

Dabrafenib causes an inhibition of phosphorylated extracellular signal-regulated kinase (ERK). This indicates a decrease in cell proliferation. Furthermore, within 24 hours of administration, downstream mediators of the MAPK pathway were inhibited Label.

The melanoma approval for use with Mekinist is based on results from COMBI-AD, a Phase III study of 870 patients with Stage III BRAF V600E/K mutation-positive melanoma treated with Tafinlar + Mekinist after complete surgical resection. Patients received doses of Tafinlar (150 mg BID) + Mekinist (2 mg QD) combination (n = 438) or matching placebos (n = 432). After a median follow-up of 2.8 years, the primary endpoint of relapse-free survival (RFS) was met 5. Thus, Tafinlar in combination with Mekinist treats melanoma.

In the case of thyroid cancer, Dabrafenib plus Trametinib is the first regimen demonstrated to have potent clinical activity in BRAF V600E–mutated anaplastic thyroid cancer and is well tolerated. These findings represent a meaningful therapeutic advance for this orphan disease 8.

Mechanism of action

Dabrafenib is an orally bioavailable inhibitor of B-raf (BRAF) protein with antineoplastic activity. Dabrafenib selectively binds to and inhibits the activity of B-raf, which may inhibit the proliferation of tumor cells which contain a mutated BRAF gene. B-raf belongs to the raf/mil family of serine/threonine protein kinases and plays a role in regulating the MAP kinase/Extracellular Signal-regulated Kinases signaling pathway, which may be constitutively activated due to BRAF gene mutations Label.

ASerine/threonine-protein kinase B-raf
ARAF proto-oncogene serine/threonine-protein kinase
USerine/threonine-protein kinase SIK1
USerine/threonine-protein kinase Nek11
ULIM domain kinase 1
Additional Data Available
Adverse Effects

Comprehensive structured data on known drug adverse effects with statistical prevalence. MedDRA and ICD10 ids are provided for adverse effect conditions and symptoms.

Learn more
Additional Data Available

Structured data covering drug contraindications. Each contraindication describes a scenario in which the drug is not to be used. Includes restrictions on co-administration, contraindicated populations, and more.

Learn more
Additional Data Available
Blackbox Warnings

Structured data representing warnings from the black box section of drug labels. These warnings cover important and dangerous risks, contraindications, or adverse effects.

Learn more

After oral administration, median time to achieve peak plasma concentration (Tmax) is 2 hours. Mean absolute bioavailability of oral dabrafenib is 95% 2.

Volume of distribution

Apparent volume of distribution (Vd/F) = 70.3 L Label. Distribution to the brain is restricted because dabrafenib is a substrate and undergoes efflux by P-glycoprotein and breast cancer resistance protein Label.

Protein binding

99.7% bound to human plasma protein Label.


Dabrafenib is metabolized in the liver. The biotransformation process of this drug is primarily regulated by CYP2C8 and CYP3A4 to form hydroxy-debrafenib. This metabolite is further oxidized via CYP3A4 to form carboxy-dabrafenib and subsequently excreted in bile and urine. Carboxy-dabrafenib can also undergo decarboxylation to form desmethyl-dabrafenib, which may be reabsorbed from the gastrointestinal tract. Desmethyl-dabrafenib is further metabolized by CYP3A4 to oxidative metabolites 2, Label.

Route of elimination

Fecal excretion is the major route of elimination accounting for 71% of radioactive dose while urinary excretion accounted for 23% of total radioactivity as metabolites only Label.

Half life

The average terminal half-life of dabrafenib is 8 hours after oral dosing Label.


The clearance of dabrafenib is 17.0 L/h after single dosing and 34.4 L/h after 2 weeks of twice daily dosing Label


LD50 in rats is > 2000 mg/kg MSDS.

The most common side effects of Daretinib (Tafinlar) as a single agent include: hyperkeratosis, headache, pyrexia, arthralgia, papilloma, alopecia, and palmar-plantar erythrodysesthesia syndrome Label.

The most common adverse reactions (≥20%) for Tafinlar in combination with Trametinib are pyrexia, chills, fatigue, rash, nausea, vomiting, diarrhea, abdominal pain, peripheral edema, cough, headache, arthralgia, night sweats, decreased appetite, constipation, and myalgia Label.

The following is a list of toxicities that may occur with the combination of Daretinib and Trametinib:

New primary malignancies: These may occur when Tafinlar is administered as a single agent or in combination with Trametinib. Monitor patients for new malignancies prior to initiation of therapy, while on therapy, and following discontinuation of TAFINLAR or the combination therapy. Tumor Promotion in BRAF Wild-Type Melanoma: Increased cell proliferation can occur with BRAF inhibitors Label.

Hemorrhage: Major hemorrhagic events can occur in patients receiving TAFINLAR in combination with trametinib. Monitor for signs and symptoms of bleeding Label.

Venous Thromboembolism: Deep vein thrombosis and pulmonary embolism can occur in patients receiving the drug combination Label.

*Cardiomyopathy *: Assess LVEF before treatment with TAFINLAR in combination with trametinib, after one month of treatment, then every 2 to 3 months thereafter Label.

Ocular toxicities: Perform an ophthalmologic evaluation for any visual disturbances Label.

Serious Febrile Reactions: Incidence and severity of pyrexia are increased with TAFINLAR in combination with trametinib Label.

Serious Skin Toxicity: Monitor for skin toxicities and for secondary infections. Discontinue for intolerable Grade 2, or Grade 3 or 4 rash not improving within 3 weeks despite the interruption of TAFINLAR Label.

Hyperglycemia: Monitor serum glucose levels in patients with pre-existing diabetes or hyperglycemia Label.

Glucose-6-Phosphate Dehydrogenase Deficiency: Closely monitor for hemolytic anemia Label.

Embryofetal Toxicity: Can cause fetal harm. Advise females of reproductive potential of potential risk to a fetus. TAFINLAR may render hormonal contraceptives less effective and an alternative method of contraception should be used Label.

Affected organisms
  • Humans and other mammals
Not Available
Pharmacogenomic Effects/ADRs
Interacting Gene/EnzymeAllele nameGenotype(s)Defining Change(s)Type(s)DescriptionDetails
Glucose-6-phosphate 1-dehydrogenaseVilleurbanneNot Available1000_1002delACCADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseTorunNot Available1006A->GADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseSunderlandNot Available105_107delCATADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseIwatsukiNot Available1081G->AADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseSerresNot Available1082C->TADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseTondelaNot Available1084_1101delCTGAACGAGCGCAAGGCCADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseLoma LindaNot Available1089C->AADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseAachenNot Available1089C->GADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseTenriNot Available1096A->GADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseMontpellierNot Available1132G>AADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseCalvo MackennaNot Available1138A->GADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseRileyNot Available1139T->CADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseOlomoucNot Available1141T->CADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseTomahNot Available1153T->CADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseLynwoodNot Available1154G->TADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseMadridNot Available1155C->GADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseIowa, Walter Reed, SpringfieldNot Available1156A->GADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseBeverly Hills, Genova, Iwate, Niigata, YamaguchiNot Available1160G->AADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseHartfordNot Available1162A->GADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenasePrahaNot Available1166A->GADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseKrakowNot Available1175T>CADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseWisconsinNot Available1177C->GADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseNashville, Anaheim, PorticiNot Available1178G->AADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseAlhambraNot Available1180G->CADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseBariNot Available1187C->TADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenasePuerto LimonNot Available1192G->AADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseCovao do LoboNot Available1205C>AADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseClinicNot Available1215G->AADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseUtrechtNot Available1225C->TADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseSuwalkiNot Available1226C->GADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseRiversideNot Available1228G->TADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseJapan, ShinagawaNot Available1229G->AADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseKawasakiNot Available1229G->CADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseMunichNot Available1231A->GADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseGeorgiaNot Available1284C->AADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseSumareNot Available1292T->GADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseTelti/KobeNot Available1318C->TADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseSantiago de Cuba, MoriokaNot Available1339G->AADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseHarimaNot Available1358T->AADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseFiguera da FozNot Available1366G->CADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseAmiensNot Available1367A>TADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseBangkok NoiNot Available1376G->T, 1502T->GADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseFukayaNot Available1462G->AADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseCampinasNot Available1463G->TADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseBuenos AiresNot Available1465C>TADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseArakawaNot Available1466C->TADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseBrightonNot Available1488_1490delGAAADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseKozukataNot Available159G->CADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseAmsterdamNot Available180_182delTCTADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseNo nameNot Available202G->A, 376A->G, 1264C>GADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseSwanseaNot Available224T->CADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseUrayasuNot Available281_283delAGAADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseVancouverNot Available317C->G544C->T592C->TADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseMt SinaiNot Available376A->G, 1159C->TADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenasePlymouthNot Available488G->AADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseVolendamNot Available514C->TADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseShinshuNot Available527A->GADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseChikugoNot Available535A->TADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseTsukuiNot Available561_563delCTCADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenasePedoplis-CkaroNot Available573C>GADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseSantiagoNot Available593G->CADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseMinnesota, Marion, Gastonia, LeJeuneNot Available637G->TADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseCincinnatiNot Available637G->T, 1037A->TADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseHarilaouNot Available648T->GADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseNorth DallasNot Available683_685delACAADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseAsahikawaNot Available695G->AADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseDurhamNot Available713A->GADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseStonybrookNot Available724_729delGGCACTADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseWayneNot Available769C->GADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseAveiroNot Available806G->AADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseCleveland CorumNot Available820G->AADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseLilleNot Available821A>TADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseBangkokNot Available825G>CADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseSugaoNot Available826C->TADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseLa JollaNot Available832T->CADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseWexhamNot Available833C->TADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenasePiotrkowNot Available851T>CADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseWest VirginiaNot Available910G->TADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseOmiyaNot Available921G->CADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseNaraNot Available953_976delCCACCAAAGGGTACCTGGAC GACCADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseManhattanNot Available962G->AADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseRehevotNot Available964T->CADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseHoniaraNot Available99A->G / 1360C->TADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseTokyo, FukushimaNot Available1246G->AADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseChathamNot Available1003G->AADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseFushanNot Available1004C->AADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenasePartenopeNot Available1052G->TADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseIerapetraNot Available1057C->TADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseAnadiaNot Available1193A->GADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseAbenoNot Available1220A->CADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseSurabayaNot Available1291G->AADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenasePawneeNot Available1316G->CADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseS. AntiocoNot Available1342A->GADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseCassanoNot Available1347G->CADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseHermoupolisNot Available1347G->C / 1360C->TADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseUnion,Maewo, Chinese-2, KaloNot Available1360C->TADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseAndalusNot Available1361G->AADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseCosenzaNot Available1376G->CADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseCanton, Taiwan- Hakka, Gifu-like, Agrigento-likeNot Available1376G->TADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseFloresNot Available1387C->AADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseKaiping, Anant, Dhon, Sapporo-like, WoseraNot Available1388G->AADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseKamogawaNot Available169C->TADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseCostanzoNot Available179T>CADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseAmazoniaNot Available185C->AADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseSongklanagarindNot Available196T->AADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseHechiNot Available202G->A / 871G->AADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseNamouruNot Available208T->CADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseBao LocNot Available352T>CADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseCrispimNot Available375G->T, 379G->T383T->C384C>TADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseAcrokorinthosNot Available376A->G / 463C->GADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseSanta MariaNot Available376A->G / 542A->TADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseAnanindeuaNot Available376A->G / 871G->AADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseVanua LavaNot Available383T->CADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseValladolidNot Available406C->TADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseBelemNot Available409C->TADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseLiuzhouNot Available442G->AADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseShenzenNot Available473G>AADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseTaipei “Chinese- 3”Not Available493A->GADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseToledoNot Available496C>TADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseNaoneNot Available497G->AADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseNankangNot Available517T->CADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseMiaoliNot Available519C->GADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseMediterranean, Dallas, Panama‚ Sassari, Cagliari, BirminghamNot Available563C->TADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseCoimbra ShundeNot Available592C->TADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseNilgiriNot Available593G>AADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseRadlowoNot Available679C->TADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseRoubaixNot Available811G>CADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseHaikouNot Available835A->GADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseChinese-1Not Available835A->TADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseMizushimaNot Available848A>GADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseOsakaNot Available853C->TADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseViangchan, JammuNot Available871G->AADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseSeoulNot Available916G->AADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseLudhianaNot Available929G->AADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseFarroupilhaNot Available977C->AADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseChinese-5Not Available1024C->TADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseRignanoNot Available130G>AADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseOrissaNot Available131C->GADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseG6PDNiceNot Available1380G>CADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseKamiube, KeelungNot Available1387C->TADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseNeapolisNot Available1400C->GADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseAuresNot Available143T->CADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseSplitNot Available1442C->GADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseKambosNot Available148C->TADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenasePalestrinaNot Available170G>AADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseMetapontoNot Available172G->AADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseMusashinoNot Available185C->TADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseAsahiNot Available202G->AADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseA- (202), Ferrara INot Available202G->A / 376A->GADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseMurcia OristanoNot Available209A->GADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseUbe KonanNot Available241C->TADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseLagosantoNot Available242G->AADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseGuangzhouNot Available274C->TADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseHammersmithNot Available323T->AADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseSinnaiNot Available34G->TADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseA- (680)Not Available376A->G / 680G->TADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseA- (968), Betica,Selma, GuantanamoNot Available376A->G / 968T->CADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseSalerno PyrgosNot Available383T>GADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseQuing YanNot Available392G->TADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseLagesNot Available40G->AADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseIleshaNot Available466G->AADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseMahidolNot Available487G->AADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseMalagaNot Available542A->TADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseSibariNot Available634A->GADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseMexico CityNot Available680G->AADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseNanningNot Available703C->TADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseSeattle, Lodi, Modena, Ferrara II, Athens-likeNot Available844G->CADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseBajo MaumereNot Available844G->TADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseMontalbanoNot Available854G->AADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseKalyan-Kerala, Jamnaga, RohiniNot Available949G->AADR InferredIncreased risk of hemolytic anemia.Details
Glucose-6-phosphate 1-dehydrogenaseGaoheNot Available95A->GADR InferredIncreased risk of hemolytic anemia.Details


Drug Interactions
This information should not be interpreted without the help of a healthcare provider. If you believe you are experiencing an interaction, contact a healthcare provider immediately. The absence of an interaction does not necessarily mean no interactions exist.
(R)-warfarinThe serum concentration of (R)-warfarin can be decreased when it is combined with Dabrafenib.
(S)-WarfarinThe serum concentration of (S)-Warfarin can be decreased when it is combined with Dabrafenib.
2,4-thiazolidinedioneThe therapeutic efficacy of 2,4-thiazolidinedione can be decreased when used in combination with Dabrafenib.
4-hydroxycoumarinThe metabolism of 4-hydroxycoumarin can be increased when combined with Dabrafenib.
9-aminocamptothecinThe metabolism of 9-aminocamptothecin can be increased when combined with Dabrafenib.
AbemaciclibDabrafenib may decrease the excretion rate of Abemaciclib which could result in a higher serum level.
AbexinostatThe risk or severity of QTc prolongation can be increased when Dabrafenib is combined with Abexinostat.
AbirateroneThe metabolism of Dabrafenib can be decreased when combined with Abiraterone.
AcarboseThe therapeutic efficacy of Acarbose can be decreased when used in combination with Dabrafenib.
AcebutololThe risk or severity of QTc prolongation can be increased when Dabrafenib is combined with Acebutolol.
Additional Data Available
  • Extended Description
    Extended Description

    Extended description of the mechanism of action and particular properties of each drug interaction.

    Learn more
  • Severity

    A severity rating for each drug interaction, from minor to major.

    Learn more
  • Evidence Level
    Evidence Level

    A rating for the strength of the evidence supporting each drug interaction.

    Learn more
  • Action

    An effect category for each drug interaction. Know how this interaction affects the subject drug.

    Learn more
Food Interactions
  • When taken with a fatty meal, Cmax and AUC decreased. Tmax is also prolonged compared to the fasted condition.


General References
  1. Gibney GT, Zager JS: Clinical development of dabrafenib in BRAF mutant melanoma and other malignancies. Expert Opin Drug Metab Toxicol. 2013 Jul;9(7):893-9. doi: 10.1517/17425255.2013.794220. Epub 2013 Apr 29. [PubMed:23621583]
  2. Dabrafenib [Link]
  3. Drug Duo, Tafinlar and Mekinist, Approved for Aggressive Thyroid Cancer [Link]
  4. FDA grants regular approval to dabrafenib and trametinib combination for metastatic NSCLC with BRAF V600E mutation [Link]
  5. Novartis receives FDA approval of Tafinlar® + Mekinist® for adjuvant treatment of BRAF V600-mutant melanoma [Link]
  6. Dabrafenib [Link]
  7. Cancer. gov Dabrafenib [Link]
  8. Dabrafenib and Trametinib Treatment in Patients With Locally Advanced or Metastatic BRAF V600–Mutant Anaplastic Thyroid Cancer [Link]
  9. NZ DrugSafe Tafinlar [File]
  10. Monograph, Tafinlar [File]
External Links
PubChem Compound
PubChem Substance
RxList Drug Page Drug Page
ATC Codes
L01XE23 — Dabrafenib
AHFS Codes
  • 10:00.00 — Antineoplastic Agents
PDB Entries
4xv2 / 5csw / 5hie
FDA label
Download (418 KB)

Clinical Trials

Clinical Trials
1Active Not RecruitingTreatmentBRAF V600E Mutation Present / BRAF V600K Mutation Present / Metastatic Malignant Neoplasm in the Thyroid Gland / Metastatic Thyroid Gland Carcinoma / Recurrent Thyroid Gland Carcinoma / Unresectable Thyroid Gland Carcinoma1
1Active Not RecruitingTreatmentBRAF V600E Mutation Present / BRAF V600K Mutation Present / Metastatic Malignant Solid Neoplasm / Metastatic Melanoma / Metastatic Solid Neoplasm / Recurrent Malignant Solid Neoplasm / Recurrent Melanoma / Recurrent Solid Neoplasm / Solid Neoplasms / Stage III Cutaneous Melanoma AJCC v7 / Stage IIIA Cutaneous Melanoma AJCC v7 / Stage IIIA Skin Melanoma / Stage IIIB Cutaneous Melanoma AJCC v7 / Stage IIIB Skin Melanoma / Stage IIIC Cutaneous Melanoma AJCC v7 / Stage IIIC Skin Melanoma / Stage IV Cutaneous Melanoma AJCC v6 and v7 / Stage IV Skin Melanoma / Stages III Skin Melanoma / Unresectable Solid Neoplasm1
1Active Not RecruitingTreatmentBRAF V600E Mutation Present / BRAF V600K Mutation Present / Metastatic Melanoma / Stage III Cutaneous Melanoma AJCC v7 / Stage IIIA Cutaneous Melanoma AJCC v7 / Stage IIIA Skin Melanoma / Stage IIIB Cutaneous Melanoma AJCC v7 / Stage IIIB Skin Melanoma / Stage IIIC Cutaneous Melanoma AJCC v7 / Stage IIIC Skin Melanoma / Stage IV Cutaneous Melanoma AJCC v6 and v7 / Stage IV Skin Melanoma / Stages III Skin Melanoma1
1Active Not RecruitingTreatmentNeoplasms, Brain1
1CompletedBasic ScienceHepatic Impairment1
1CompletedTreatmentTumors, Solid1
1CompletedTreatmentUnspecified Adult Solid Tumor, Protocol Specific1
1Not Yet RecruitingTreatmentBRAF NP_004324.2:p.V600E / BRAF V600K Mutation Present / Thyroid Gland Anaplastic Carcinoma1
1RecruitingBasic ScienceImpaired Renal Function1
1RecruitingTreatmentBRAF Gene Mutation / Melanoma1
1RecruitingTreatmentMultiple Myeloma (MM)1
1TerminatedTreatmentAdult Solid Neoplasm / BRAF Gene Mutation / Hepatic Complications / Renal Failure / Solid Neoplasms1
1TerminatedTreatmentStage III or IV Melanoma1
1WithdrawnTreatmentMetastatic Melanoma1
1, 2Active Not RecruitingTreatmentMelanoma / Tumors, Solid1
1, 2CompletedTreatmentAdvanced Malignancy / Advanced Solid Tumors / Malignancies / Melanoma / Oncology / Oncology Patients / Tumors1
1, 2RecruitingTreatmentAdvanced BRAF Mutant Melanoma1
1, 2RecruitingTreatmentBRAF V600E Mutation Present / BRAF V600K Mutation Present / Metastatic Melanoma / Recurrent Melanoma / Solid Neoplasms / Stage III Cutaneous Melanoma AJCC v7 / Stage IIIA Cutaneous Melanoma AJCC v7 / Stage IIIA Skin Melanoma / Stage IIIB Cutaneous Melanoma AJCC v7 / Stage IIIB Skin Melanoma / Stage IIIC Cutaneous Melanoma AJCC v7 / Stage IIIC Skin Melanoma / Stage IV Cutaneous Melanoma AJCC v6 and v7 / Stage IV Skin Melanoma1
1, 2RecruitingTreatmentMalignancies1
1, 2RecruitingTreatmentMelanoma5
1, 2RecruitingTreatmentMetastatic Melanoma1
1, 2SuspendedTreatmentAdult Solid Neoplasm / Recurrent Colon Carcinoma / Recurrent Melanoma / Recurrent Ovarian Carcinoma / Stage IIIC Colon Cancer / Stage IIIC Ovarian Cancer / Stage IIIC Skin Melanoma / Stage IV Skin Melanoma1
1, 2TerminatedTreatmentMelanoma1
2Active Not RecruitingTreatmentAmeloblastoma / BRAF Gene Mutation1
2Active Not RecruitingTreatmentBRAF V600E Mutation Present / BRAF V600K Mutation Present / Recurrent Melanoma / Stage III Cutaneous Melanoma AJCC v7 / Stage IIIA Cutaneous Melanoma AJCC v7 / Stage IIIA Skin Melanoma / Stage IIIB Cutaneous Melanoma AJCC v7 / Stage IIIB Skin Melanoma / Stage IIIC Cutaneous Melanoma AJCC v7 / Stage IIIC Skin Melanoma / Stage IV Cutaneous Melanoma AJCC v6 and v7 / Stage IV Skin Melanoma / Stages III Skin Melanoma / Unresectable Melanoma1
2Active Not RecruitingTreatmentFollicular Thyroid Cancer / Insular Thyroid Cancer / Recurrent Thyroid Cancer / Thyroid Papillary Carcinoma1
2Active Not RecruitingTreatmentMalignancies3
2Active Not RecruitingTreatmentMalignancies / Melanoma1
2Active Not RecruitingTreatmentMelanoma1
2Active Not RecruitingTreatmentMelanoma / Metastatic Brain Tumors1
2Active Not RecruitingTreatmentTumors, Solid1
2CompletedTreatmentBRAF Mutant Melanoma / Stage III Melanoma / Stage IV Melanoma / Unresectable Melanoma1
2CompletedTreatmentBRAF V600E Mutation1
2CompletedTreatmentMalignant Melanoma1
2CompletedTreatmentMelanoma and Brain Metastases2
2CompletedTreatmentMetastatic Cancers1
2Not Yet RecruitingTreatmentBRAF NP_004324.2:p.V600X / Erdheim-Chester Disease (ECD)1
2RecruitingTreatmentAdvanced Malignant Neoplasm / Advanced Malignant Solid Neoplasm / Bladder Carcinoma / Carcinoma, Breast / Carcinoma, Colorectal / Carcinoma, Pancreatic / Cervical Carcinoma / Colon Carcinoma / Endometrial Carcinoma / Esophageal Carcinoma / Gastric Carcinoma / Gliomas / Head and Neck Carcinoma / Liver and Intrahepatic Bile Duct Carcinoma / Lung, Carcinoma / Malignant Lymphomas / Malignant Uterine Neoplasm / Melanoma / Ovarian Carcinoma / Plasma Cell Myeloma / Prostate Cancer / Rectal Carcinoma / Recurrent Bladder Carcinoma / Recurrent Breast Carcinoma / Recurrent Cervical Carcinoma / Recurrent Colon Carcinoma / Recurrent Colorectal Carcinoma / Recurrent Esophageal Carcinoma / Recurrent Gastric Carcinoma / Recurrent Gliomas / Recurrent Head and Neck Carcinoma / Recurrent Liver Carcinoma / Recurrent Lung Carcinoma / Recurrent Lymphoma / Recurrent Malignant Solid Neoplasm / Recurrent Melanoma / Recurrent Ovarian Carcinoma / Recurrent Pancreatic Carcinoma / Recurrent Plasma Cell Myeloma / Recurrent Prostate Carcinoma / Recurrent Rectal Carcinoma / Recurrent Skin Carcinoma / Recurrent Solid Neoplasm / Recurrent Thyroid Gland Carcinoma / Recurrent Uterine Corpus Carcinoma / Refractory Lymphomas / Refractory Malignant Neoplasm / Refractory Malignant Solid Neoplasm / Refractory Plasma Cell Myeloma / Renal Carcinoma / Skin Carcinoma / Solid Neoplasms / Thyroid Gland Carcinoma / Uterine Corpus Cancer1
2RecruitingTreatmentAnaplastic Astrocytoma (AA) / Anaplastic Ependymoma / Anaplastic Ganglioglioma / Anaplastic Hemangiopericytoma / Anaplastic Oligoastrocytoma / Anaplastic Oligodendroglioma (AO) / Anaplastic Pleomorphic Xanthoastrocytoma / Angiocentric glioma / Astrocytomas / Central Neurocytoma / Cerebellar Iponeurocytoma / Chordoid Glioma of Third Ventricle / Choroid Plexus Carcinoma / Desmoplastic Infantile Astrocytoma and Ganglioglioma / Diffuse Astrocytoma / Dysplastic Gangliocytoma of Cerebrellum / Extraventricular Neurocytoma / Gangliocytoma / Ganglioglioma / Giant Cell Astrocytoma / Giant Cell Glioblastoma / Glioblastomas / Gliosarcoma / Malignant Meningloma / Medulloblastomas / MPNST / Oligodendroglioma, Childhood / Papillary Glioneuronal Tumor / Perineurioma / Pilocytic Astrocytoma / Pineal Parenchymal Tumor / Pinealoblastoma / Pleomorphic Xanthoastrocytoma / PNET / Rhabdoid Tumors / Rosette-forming Glioneurona Tumor1
2RecruitingTreatmentAnaplastic Astrocytoma (AA) / Anaplastic Ganglioglioma / Anaplastic Pleomorphic Xanthoastrocytoma / BRAF NP_004324.2:p.V600X / Glioblastomas / H3 K27M Negative / Malignant Gliomas / WHO Grade III Glioma1
2RecruitingTreatmentBRAF Gene Mutation / BRAF wt Allele / Melanoma / Stage III Cutaneous Melanoma AJCC v7 / Stage IIIA Cutaneous Melanoma AJCC v7 / Stage IIIB Cutaneous Melanoma AJCC v7 / Stage IIIC Cutaneous Melanoma AJCC v7 / Stage IV Cutaneous Melanoma AJCC v6 and v71
2RecruitingTreatmentBRAF Gene Mutation / Melanoma (Skin) / Melanoma Stage IIIb-IVM1a / Melanoma Stage IIIb-IVM1B / Metastasis Skin / Tumor Skin1
2RecruitingTreatmentBRAF V600E Mutation Present / BRAF V600K Mutation Present / Malignant Melanoma Stage IV / Melanoma / Metastatic Melanoma / Stage IIIB Cutaneous Melanoma AJCC v7 / Stage IIIC Cutaneous Melanoma AJCC v71
2RecruitingTreatmentMalignancies / Neoplasms / Tumors1
2RecruitingTreatmentMetastatic Colorectal Cancers1
2RecruitingTreatmentMetastatic Melanoma2
2RecruitingTreatmentMetastatic Radioactive Iodine Refractory Thyroid Cancer Patients With RAS or BRAF Mutation1
2RecruitingTreatmentRare Tumor / Refractory Tumors1
2RecruitingTreatmentStage III Melanoma / Stage IV Melanoma1
2TerminatedOtherRecurrent Melanoma / Stage IIB Melanoma (Locally Advanced) / Stage IIC Melanoma (Locally Advanced) / Stage IIIA Melanoma / Stage IIIB Melanoma / Stage IIIc Melanoma / Stage IV Melanoma (Limited, Resectable)1
2TerminatedTreatmentBRAFV600E Melanoma Patients1
2TerminatedTreatmentMalignant Melanoma1
2TerminatedTreatmentMelanoma and Brain Metastases1
2TerminatedTreatmentMetastatic Melanoma (Carrying BRAF V600 Mutation)1
2WithdrawnTreatmentLung Cancer Non-Small Cell Cancer (NSCLC)1
3Active Not RecruitingTreatmentMelanoma2
3RecruitingHealth Services ResearchSoft Tissue Sarcoma (STS)1
3RecruitingTreatmentBRAF NP_004324.2:p.V600X / BRAF V600E Mutation Present / BRAF V600K Mutation Present / Metastatic Melanoma / Progressive Disease / Recurrent Melanoma / Stage III Cutaneous Melanoma AJCC v7 / Stage IIIA Cutaneous Melanoma AJCC v7 / Stage IIIA Skin Melanoma / Stage IIIB Cutaneous Melanoma AJCC v7 / Stage IIIB Skin Melanoma / Stage IIIC Cutaneous Melanoma AJCC v7 / Stage IIIC Skin Melanoma / Stage IV Cutaneous Melanoma AJCC v6 and v7 / Stage IV Skin Melanoma / Stages III Skin Melanoma / Unresectable Cutaneous Melanoma1
3RecruitingTreatmentMalignant Melanoma1
4Not Yet RecruitingTreatmentAnaplastic Astrocytoma (AA) / Anaplastic Ganglioglioma / Anaplastic Oligodendroglioma (AO) / Anaplastic Pleomorphic Xanthoastrocytoma / Angiocentric glioma / Astrocytomas / Central Neurocytoma / Cerebellar Liponeurocytoma / Chordoid Glioma of Third Ventricle / Desmoplastic Infantile Astrocytoma and Ganglioglioma / Diffuse Astrocytoma / Dysplastic Gangliocytoma of Cerebrellum / Extraventricular Neurocytoma / Gangliocytoma / Ganglioglioma / Giant Cell Astrocytoma / Glioblastomas / Neurofibromatosis Type 1 / Oligodendroglioma, Childhood / Papillary Glioneuronal Tumor / Pilocytic Astrocytoma / Pleomorphic Xanthoastrocytoma / Rosette-forming Glioneurona Tumor1
4RecruitingTreatmentHigh Grade Glioma (HGG) / Lung Cancer Non-Small Cell Cancer (NSCLC) / Melanoma / Rare Cancers / Tumors, Solid1
Not AvailableCompletedNot AvailableMalignant Melanoma Stage IIIc / Malignant Melanoma Stage IV1
Not AvailableCompletedNot AvailableUnresecable Stage IIIc or IV Melanoma1
Not AvailableCompletedTreatmentPapillary Thyroid Carcinoma1
Not AvailableNot Yet RecruitingNot AvailableMelanoma1


Not Available
Not Available
Dosage forms
CapsuleOral50 mg
CapsuleOral50 mg/1
CapsuleOral75 mg
CapsuleOral75 mg/1
Not Available
Patent NumberPediatric ExtensionApprovedExpires (estimated)
Additional Data Available
  • Filed On
    Filed On

    The date on which a patent was filed with the relevant government.

    Learn more


Experimental Properties
water solubilityvery slightly soluble at pH 1
Predicted Properties
Water Solubility0.00327 mg/mLALOGPS
pKa (Strongest Acidic)7.16ChemAxon
pKa (Strongest Basic)2.91ChemAxon
Physiological Charge0ChemAxon
Hydrogen Acceptor Count6ChemAxon
Hydrogen Donor Count2ChemAxon
Polar Surface Area110.86 Å2ChemAxon
Rotatable Bond Count5ChemAxon
Refractivity127.51 m3·mol-1ChemAxon
Polarizability49.71 Å3ChemAxon
Number of Rings4ChemAxon
Rule of FiveNoChemAxon
Ghose FilterNoChemAxon
Veber's RuleNoChemAxon
MDDR-like RuleNoChemAxon
Predicted ADMET features
Human Intestinal Absorption+0.9944
Blood Brain Barrier+0.7232
Caco-2 permeable+0.5069
P-glycoprotein substrateNon-substrate0.7965
P-glycoprotein inhibitor INon-inhibitor0.6468
P-glycoprotein inhibitor IINon-inhibitor0.7039
Renal organic cation transporterNon-inhibitor0.8694
CYP450 2C9 substrateNon-substrate0.8233
CYP450 2D6 substrateNon-substrate0.7346
CYP450 3A4 substrateNon-substrate0.5834
CYP450 1A2 substrateInhibitor0.5219
CYP450 2C9 inhibitorInhibitor0.5
CYP450 2D6 inhibitorNon-inhibitor0.8459
CYP450 2C19 inhibitorNon-inhibitor0.5
CYP450 3A4 inhibitorInhibitor0.7531
CYP450 inhibitory promiscuityHigh CYP Inhibitory Promiscuity0.8612
Ames testNon AMES toxic0.7078
BiodegradationNot ready biodegradable1.0
Rat acute toxicity2.4329 LD50, mol/kg Not applicable
hERG inhibition (predictor I)Weak inhibitor0.9848
hERG inhibition (predictor II)Non-inhibitor0.7704
ADMET data is predicted using admetSAR, a free tool for evaluating chemical ADMET properties. (23092397)


Mass Spec (NIST)
Not Available
SpectrumSpectrum TypeSplash Key
Predicted MS/MS Spectrum - 10V, Positive (Annotated)Predicted LC-MS/MSNot Available
Predicted MS/MS Spectrum - 20V, Positive (Annotated)Predicted LC-MS/MSNot Available
Predicted MS/MS Spectrum - 40V, Positive (Annotated)Predicted LC-MS/MSNot Available
Predicted MS/MS Spectrum - 10V, Negative (Annotated)Predicted LC-MS/MSNot Available
Predicted MS/MS Spectrum - 20V, Negative (Annotated)Predicted LC-MS/MSNot Available
Predicted MS/MS Spectrum - 40V, Negative (Annotated)Predicted LC-MS/MSNot Available


This compound belongs to the class of organic compounds known as sulfanilides. These are organic aromatic compounds containing a sulfanilide moiety, with the general structure RS(=O)(=O)NC1=CC=CC=C1.
Organic compounds
Super Class
Benzene and substituted derivatives
Sub Class
Direct Parent
Alternative Parents
Benzenesulfonamides / Benzenesulfonyl compounds / 2,4,5-trisubstituted thiazoles / Fluorobenzenes / Aminopyrimidines and derivatives / Organosulfonamides / Aryl fluorides / Heteroaromatic compounds / Aminosulfonyl compounds / Azacyclic compounds
show 5 more
Benzenesulfonamide / Sulfanilide / Benzenesulfonyl group / 2,4,5-trisubstituted 1,3-thiazole / Aminopyrimidine / Fluorobenzene / Halobenzene / Aryl fluoride / Aryl halide / Pyrimidine
show 22 more
Molecular Framework
Aromatic heteromonocyclic compounds
External Descriptors
organofluorine compound, aminopyrimidine, sulfonamide, 1,3-thiazole (CHEBI:75045)


Pharmacological action
General Function
Protein serine/threonine kinase activity
Specific Function
Protein kinase involved in the transduction of mitogenic signals from the cell membrane to the nucleus. May play a role in the postsynaptic responses of hippocampal neuron. Phosphorylates MAP2K1, a...
Gene Name
Uniprot ID
Uniprot Name
Serine/threonine-protein kinase B-raf
Molecular Weight
84436.135 Da
  1. Gibney GT, Zager JS: Clinical development of dabrafenib in BRAF mutant melanoma and other malignancies. Expert Opin Drug Metab Toxicol. 2013 Jul;9(7):893-9. doi: 10.1517/17425255.2013.794220. Epub 2013 Apr 29. [PubMed:23621583]
  2. Dabrafenib [Link]
Pharmacological action
General Function
Protein serine/threonine kinase activity
Specific Function
Serine/threonine-protein kinase that acts as a regulatory link between the membrane-associated Ras GTPases and the MAPK/ERK cascade, and this critical regulatory link functions as a switch determin...
Gene Name
Uniprot ID
Uniprot Name
RAF proto-oncogene serine/threonine-protein kinase
Molecular Weight
73051.025 Da
  1. Dabrafenib [Link]
  2. Monograph, Tafinlar [File]
Pharmacological action
General Function
Protein serine/threonine kinase activity
Specific Function
Serine/threonine-protein kinase involved in various processes such as cell cycle regulation, gluconeogenesis and lipogenesis regulation, muscle growth and differentiation and tumor suppression. Pho...
Gene Name
Uniprot ID
Uniprot Name
Serine/threonine-protein kinase SIK1
Molecular Weight
84901.25 Da
  1. Dabrafenib [Link]
  2. Monograph, Tafinlar [File]
Pharmacological action
General Function
Protein serine/threonine kinase activity
Specific Function
Protein kinase which plays an important role in the G2/M checkpoint response to DNA damage. Controls degradation of CDC25A by directly phosphorylating it on residues whose phosphorylation is requir...
Gene Name
Uniprot ID
Uniprot Name
Serine/threonine-protein kinase Nek11
Molecular Weight
74191.62 Da
  1. Dabrafenib [Link]
  2. Monograph, Tafinlar [File]
Pharmacological action
General Function
Zinc ion binding
Specific Function
Serine/threonine-protein kinase that plays an essential role in the regulation of actin filament dynamics. Acts downstream of several Rho family GTPase signal transduction pathways. Activated by up...
Gene Name
Uniprot ID
Uniprot Name
LIM domain kinase 1
Molecular Weight
72584.4 Da
  1. Dabrafenib [Link]
  2. Monograph, Tafinlar [File]


Pharmacological action
General Function
Vitamin d3 25-hydroxylase activity
Specific Function
Cytochromes P450 are a group of heme-thiolate monooxygenases. In liver microsomes, this enzyme is involved in an NADPH-dependent electron transport pathway. It performs a variety of oxidation react...
Gene Name
Uniprot ID
Uniprot Name
Cytochrome P450 3A4
Molecular Weight
57342.67 Da
Pharmacological action
General Function
Steroid hydroxylase activity
Specific Function
Cytochromes P450 are a group of heme-thiolate monooxygenases. In liver microsomes, this enzyme is involved in an NADPH-dependent electron transport pathway. It oxidizes a variety of structurally un...
Gene Name
Uniprot ID
Uniprot Name
Cytochrome P450 2C8
Molecular Weight
55824.275 Da
  1. Backman JT, Filppula AM, Niemi M, Neuvonen PJ: Role of Cytochrome P450 2C8 in Drug Metabolism and Interactions. Pharmacol Rev. 2016 Jan;68(1):168-241. doi: 10.1124/pr.115.011411. [PubMed:26721703]
Pharmacological action
General Function
Steroid hydroxylase activity
Specific Function
Cytochromes P450 are a group of heme-thiolate monooxygenases. In liver microsomes, this enzyme is involved in an NADPH-dependent electron transport pathway. It oxidizes a variety of structurally un...
Gene Name
Uniprot ID
Uniprot Name
Cytochrome P450 2B6
Molecular Weight
56277.81 Da
  1. Lawrence SK, Nguyen D, Bowen C, Richards-Peterson L, Skordos KW: The metabolic drug-drug interaction profile of Dabrafenib: in vitro investigations and quantitative extrapolation of the P450-mediated DDI risk. Drug Metab Dispos. 2014 Jul;42(7):1180-90. doi: 10.1124/dmd.114.057778. Epub 2014 Apr 18. [PubMed:24748562]
Pharmacological action
General Function
Steroid hydroxylase activity
Specific Function
Cytochromes P450 are a group of heme-thiolate monooxygenases. In liver microsomes, this enzyme is involved in an NADPH-dependent electron transport pathway. It oxidizes a variety of structurally un...
Gene Name
Uniprot ID
Uniprot Name
Cytochrome P450 2C9
Molecular Weight
55627.365 Da
  1. Suttle AB, Grossmann KF, Ouellet D, Richards-Peterson LE, Aktan G, Gordon MS, LoRusso PM, Infante JR, Sharma S, Kendra K, Patel M, Pant S, Arkenau HT, Middleton MR, Blackman SC, Botbyl J, Carson SW: Assessment of the drug interaction potential and single- and repeat-dose pharmacokinetics of the BRAF inhibitor dabrafenib. J Clin Pharmacol. 2015 Apr;55(4):392-400. doi: 10.1002/jcph.437. Epub 2014 Dec 30. [PubMed:25449654]
  2. Brody T. (2018). FDA's Drugreview Process and the Package Label. Academic Press.
  3. EMA Label: Tafinlar (dabrafenib mesilate) Summary of Product Characteristics [File]


Pharmacological action
General Function
Xenobiotic-transporting atpase activity
Specific Function
Energy-dependent efflux pump responsible for decreased drug accumulation in multidrug-resistant cells.
Gene Name
Uniprot ID
Uniprot Name
Multidrug resistance protein 1
Molecular Weight
141477.255 Da
  1. Mittapalli RK, Vaidhyanathan S, Dudek AZ, Elmquist WF: Mechanisms limiting distribution of the threonine-protein kinase B-RaF(V600E) inhibitor dabrafenib to the brain: implications for the treatment of melanoma brain metastases. J Pharmacol Exp Ther. 2013 Mar;344(3):655-64. doi: 10.1124/jpet.112.201475. Epub 2012 Dec 17. [PubMed:23249624]
Pharmacological action
General Function
Xenobiotic-transporting atpase activity
Specific Function
High-capacity urate exporter functioning in both renal and extrarenal urate excretion. Plays a role in porphyrin homeostasis as it is able to mediates the export of protoporhyrin IX (PPIX) both fro...
Gene Name
Uniprot ID
Uniprot Name
ATP-binding cassette sub-family G member 2
Molecular Weight
72313.47 Da
  1. Mittapalli RK, Vaidhyanathan S, Dudek AZ, Elmquist WF: Mechanisms limiting distribution of the threonine-protein kinase B-RaF(V600E) inhibitor dabrafenib to the brain: implications for the treatment of melanoma brain metastases. J Pharmacol Exp Ther. 2013 Mar;344(3):655-64. doi: 10.1124/jpet.112.201475. Epub 2012 Dec 17. [PubMed:23249624]
Pharmacological action
General Function
Sodium-independent organic anion transmembrane transporter activity
Specific Function
Mediates the Na(+)-independent uptake of organic anions such as pravastatin, taurocholate, methotrexate, dehydroepiandrosterone sulfate, 17-beta-glucuronosyl estradiol, estrone sulfate, prostagland...
Gene Name
Uniprot ID
Uniprot Name
Solute carrier organic anion transporter family member 1B1
Molecular Weight
76447.99 Da
Pharmacological action
General Function
Sodium-independent organic anion transmembrane transporter activity
Specific Function
Mediates the Na(+)-independent uptake of organic anions such as 17-beta-glucuronosyl estradiol, taurocholate, triiodothyronine (T3), leukotriene C4, dehydroepiandrosterone sulfate (DHEAS), methotre...
Gene Name
Uniprot ID
Uniprot Name
Solute carrier organic anion transporter family member 1B3
Molecular Weight
77402.175 Da
Pharmacological action
General Function
Sodium-independent organic anion transmembrane transporter activity
Specific Function
Involved in the renal elimination of endogenous and exogenous organic anions. Functions as organic anion exchanger when the uptake of one molecule of organic anion is coupled with an efflux of one ...
Gene Name
Uniprot ID
Uniprot Name
Solute carrier family 22 member 6
Molecular Weight
61815.78 Da
Pharmacological action
General Function
Sodium-independent organic anion transmembrane transporter activity
Specific Function
Plays an important role in the excretion/detoxification of endogenous and exogenous organic anions, especially from the brain and kidney. Involved in the transport basolateral of steviol, fexofenad...
Gene Name
Uniprot ID
Uniprot Name
Solute carrier family 22 member 8
Molecular Weight
59855.585 Da

Drug created on June 24, 2013 15:54 / Updated on November 15, 2019 02:02