
Accession Number
DB00440  (APRD00103)
Small Molecule
Approved, Vet approved

A pyrimidine inhibitor of dihydrofolate reductase, it is an antibacterial related to pyrimethamine. The interference with folic acid metabolism may cause a depression of hematopoiesis. It is potentiated by sulfonamides and the trimethoprim-sulfamethoxazole combination is the form most often used. It is sometimes used alone as an antimalarial. Trimethoprim resistance has been reported. [PubChem]

  • 2,4-Diamino-5-(3,4,5-trimethoxybenzyl)pyrimidine
  • 5-[(3,4,5-Trimethoxyphenyl)methyl]-2,4-pyrimidinediamine
  • Trimethoprim
  • Triméthoprime
  • Trimethoprimum
  • Trimetoprima
External IDs
BW 56-72 / BW-56-72 / NIH-204 / NSC-106568 / Ro 6-2153-12 F / UNII-9XE000OU9B
Product Ingredients
IngredientUNIICASInChI Key
Trimethoprim hydrochloride9XE000OU9B60834-30-2YLCCEQZHUHUYPA-UHFFFAOYSA-N
Trimethoprim sulfateE377MF8EQ856585-33-2UILMMYFRNCCPLK-UHFFFAOYSA-N
Product Images
Prescription Products
NameDosageStrengthRouteLabellerMarketing StartMarketing End
PrimsolSolution50 mg/5mLOralFsc Laboratories, Inc.2000-01-24Not applicableUs
PrimsolSolution50 mg/5mLOralAytu Bio Science, Inc.2015-09-152018-01-01Us
PrimSolSolution50 mg/5mLOralAllegis Holdings, Llc2017-05-04Not applicableUs
Proloprim 200 Tab 200mgTablet200 mgOralGlaxosmithkline Inc1985-12-312004-08-05Canada
Proloprim Tab 100mgTablet100 mgOralGlaxosmithkline Inc1986-12-312003-10-28Canada
TrimethoprimTablet100 mg/1OralTeva1990-09-302017-12-31Us00093 2158 01 nlmimage10 5a2b2d69
TrimethoprimTablet100 mg/1OralMayne Pharma2016-07-18Not applicableUs
Trimethoprim TabletsTablet100 mgOralAa Pharma Inc2001-01-01Not applicableCanada
Trimethoprim TabletsTablet200 mgOralAa Pharma Inc2001-07-30Not applicableCanada
TRIMPEX trimethoprim hydrochlorideSolution50 mg/5mLOralKey Therapeutics, Llc2017-10-02Not applicableUs
Generic Prescription Products
NameDosageStrengthRouteLabellerMarketing StartMarketing End
TrimethoprimTablet100 mg/1OralPd Rx Pharmaceuticals, Inc.2010-04-04Not applicableUs
TrimethoprimTablet100 mg/1OralNovel Laboratories, Inc.2011-06-24Not applicableUs
TrimethoprimTablet100 mg/1OralCarilion Materials Management2010-04-04Not applicableUs
TrimethoprimTablet100 mg/1OralAv Pak2013-07-31Not applicableUs
TrimethoprimTablet100 mg/1OralLupin Pharmaceuticals2011-06-24Not applicableUs
TrimethoprimTablet100 mg/1OralPhysicians Total Care, Inc.2012-05-02Not applicableUs00591 5571 01 nlmimage10 e0127053
TrimethoprimTablet100 mg/1OralAv Kare, Inc.2013-05-06Not applicableUs
TrimethoprimTablet100 mg/1OralActavis Pharma Company2010-04-04Not applicableUs
TrimethoprimTablet100 mg/1OralRemedy Repack2013-09-242016-12-30Us
Mixture Products
NameIngredientsDosageRouteLabellerMarketing StartMarketing End
Apo Sulfatrim DS TabTrimethoprim (160 mg) + Sulfamethoxazole (800 mg)TabletOralApotex Corporation1979-12-31Not applicableCanada
Apo Sulfatrim PediatricTrimethoprim (20 mg) + Sulfamethoxazole (100 mg)TabletOralApotex Corporation1979-12-31Not applicableCanada
Apo Sulfatrim TabTrimethoprim (80 mg) + Sulfamethoxazole (400 mg)TabletOralApotex Corporation1979-12-31Not applicableCanada
Apo-sulfatrim Oral SuspensionTrimethoprim (8 mg) + Sulfamethoxazole (40 mg)SuspensionOralApotex Corporation1989-12-31Not applicableCanada
BactrimTrimethoprim (80 mg/1) + Sulfamethoxazole (400 mg/1)TabletOralAR Scientific, Inc.2004-11-01Not applicableUs
BactrimTrimethoprim (80 mg/1) + Sulfamethoxazole (400 mg/1)TabletOralSun Pharmaceutical Industries Limited2004-11-01Not applicableUs
Bactrim DSTrimethoprim (160 mg/1) + Sulfamethoxazole (800 mg/1)TabletOralPhysicians Total Care, Inc.1997-08-26Not applicableUs
Bactrim DSTrimethoprim (160 mg/1) + Sulfamethoxazole (800 mg/1)TabletOralAR Scientific, Inc.2004-11-01Not applicableUs
Bactrim DSTrimethoprim (160 mg/1) + Sulfamethoxazole (800 mg/1)TabletOralSun Pharmaceutical Industries Limited2004-11-01Not applicableUs
Bactrim DS Roche TabTrimethoprim (160 mg) + Sulfamethoxazole (800 mg)TabletOralHoffmann La Roche1976-12-312001-07-19Canada
International/Other Brands
Alprim (Alphapharm) / Catin (Kojar) / Eumi (Hwang's) / Inflamnil (Swiss Pharm) / Lannacher (Root) / Lariago (Ipca Laboratories) / Meprim (Johnson) / Metipine (Kojar) / Monotrim (GlaxoSmithKline) / Motrim (Lannacher) / Proloprim (GlaxoSmithKline) / Trimpex / Triprim (GlaxoSmithKline)
CAS number
Average: 290.3177
Monoisotopic: 290.137890462
Chemical Formula
InChI Key



For the treatment of urinary tract infections, uncomplicated pyelonephritis (with sulfamethoxazole) and mild acute prostatitis. May be used as pericoital (with sulfamethoxazole) or continuous prophylaxis in females with recurrent cystitis. May be used as an alternative to treat asymptomatic bacteriuria during pregnancy (only before the last 6 weeks of pregnancy). Other uses include: alternative agent in respiratory tract infections (otitis, sinusitus, bronchitis and pneumonia), treatment of Pneumocystis jirovecii pneumonia (acute or prophylaxis), Nocardia infections, and traveller's diarrhea.

Associated Conditions

Trimethoprim is a pyrimidine analogue that disrupts folate synthesis, an essential part of the thymidine synthesis pathway. Inhibition of the enzyme starves the bacteria of nucleotides necessary for DNA replication.The drug, therefore, exhibits bactericidal activity.

Mechanism of action

Trimethoprim binds to dihydrofolate reductase and inhibits the reduction of dihydrofolic acid (DHF) to tetrahydrofolic acid (THF). THF is an essential precursor in the thymidine synthesis pathway and interference with this pathway inhibits bacterial DNA synthesis. Trimethoprim's affinity for bacterial dihydrofolate reductase is several thousand times greater than its affinity for human dihydrofolate reductase. Sulfamethoxazole inhibits dihydrofolate synthetase (aka dihydropteroate synthetase), an enzyme involved further upstream in the same pathway. Trimethoprim and sulfamethoxazole are commonly used in combination due to their synergistic effects. This drug combination also reduces the development of resistance that is seen when either drug is used alone.

AThymidylate synthase
NDihydrofolate reductase

Readily and almost completely absorbed in the GI tract with peak serum concentrations attained 1-4 hours after oral administration. Widely distributed to tissues and fluids including kidney, lung, seminal fluid, aqueous humour, middle ear fluid, sputum, vaginal secretions, bile, bone and CSF.

Volume of distribution
Not Available
Protein binding

42-46% bound to plasma proteins


Hepatic metabolism to oxide and hydroxylated metabolites.

Route of elimination

Ten to twenty percent of trimethoprim is metabolized, primarily in the liver; the remainder is excreted unchanged in the urine. After oral administration, 50% to 60% of trimethoprim is excreted in the urine within 24 hours, approximately 80% of this being unmetabolized trimethoprim. Trimethoprim also passes the placental barrier and is excreted in human milk.

Half life

8-11 hours in adults with normal renal function

Not Available

LD50=4850 (orally in mice)

Affected organisms
  • Gram negative and gram positive bacteria
  • Listeria monocytogenes
  • Escherichia coli
Not Available
Pharmacogenomic Effects/ADRs
Interacting Gene/EnzymeAllele nameGenotype(s)Defining Change(s)Type(s)DescriptionDetails
Glucose-6-phosphate 1-dehydrogenaseVilleurbanneNot Available1000_1002delACCADR InferredIncreased risk of dose-related hemolysis.Details
Glucose-6-phosphate 1-dehydrogenaseTorunNot Available1006A->GADR InferredIncreased risk of dose-related hemolysis.Details
Glucose-6-phosphate 1-dehydrogenaseSunderlandNot Available105_107delCATADR InferredIncreased risk of dose-related hemolysis.Details
Glucose-6-phosphate 1-dehydrogenaseIwatsukiNot Available1081G->AADR InferredIncreased risk of dose-related hemolysis.Details
Glucose-6-phosphate 1-dehydrogenaseSerresNot Available1082C->TADR InferredIncreased risk of dose-related hemolysis.Details
Glucose-6-phosphate 1-dehydrogenaseTondelaNot Available1084_1101delCTGAACGAGCGCAAGGCCADR InferredIncreased risk of dose-related hemolysis.Details
Glucose-6-phosphate 1-dehydrogenaseLoma LindaNot Available1089C->AADR InferredIncreased risk of dose-related hemolysis.Details
Glucose-6-phosphate 1-dehydrogenaseAachenNot Available1089C->GADR InferredIncreased risk of dose-related hemolysis.Details
Glucose-6-phosphate 1-dehydrogenaseTenriNot Available1096A->GADR InferredIncreased risk of dose-related hemolysis.Details
Glucose-6-phosphate 1-dehydrogenaseMontpellierNot Available1132G>AADR InferredIncreased risk of dose-related hemolysis.Details
Glucose-6-phosphate 1-dehydrogenaseCalvo MackennaNot Available1138A->GADR InferredIncreased risk of dose-related hemolysis.Details
Glucose-6-phosphate 1-dehydrogenaseRileyNot Available1139T->CADR InferredIncreased risk of dose-related hemolysis.Details
Glucose-6-phosphate 1-dehydrogenaseOlomoucNot Available1141T->CADR InferredIncreased risk of dose-related hemolysis.Details
Glucose-6-phosphate 1-dehydrogenaseTomahNot Available1153T->CADR InferredIncreased risk of dose-related hemolysis.Details
Glucose-6-phosphate 1-dehydrogenaseLynwoodNot Available1154G->TADR InferredIncreased risk of dose-related hemolysis.Details
Glucose-6-phosphate 1-dehydrogenaseMadridNot Available1155C->GADR InferredIncreased risk of dose-related hemolysis.Details
Glucose-6-phosphate 1-dehydrogenaseIowa, Walter Reed, SpringfieldNot Available1156A->GADR InferredIncreased risk of dose-related hemolysis.Details
Glucose-6-phosphate 1-dehydrogenaseBeverly Hills, Genova, Iwate, Niigata, YamaguchiNot Available1160G->AADR InferredIncreased risk of dose-related hemolysis.Details
Glucose-6-phosphate 1-dehydrogenaseHartfordNot Available1162A->GADR InferredIncreased risk of dose-related hemolysis.Details
Glucose-6-phosphate 1-dehydrogenasePrahaNot Available1166A->GADR InferredIncreased risk of dose-related hemolysis.Details
Glucose-6-phosphate 1-dehydrogenaseKrakowNot Available1175T>CADR InferredIncreased risk of dose-related hemolysis.Details
Glucose-6-phosphate 1-dehydrogenaseWisconsinNot Available1177C->GADR InferredIncreased risk of dose-related hemolysis.Details
Glucose-6-phosphate 1-dehydrogenaseNashville, Anaheim, PorticiNot Available1178G->AADR InferredIncreased risk of dose-related hemolysis.Details
Glucose-6-phosphate 1-dehydrogenaseAlhambraNot Available1180G->CADR InferredIncreased risk of dose-related hemolysis.Details
Glucose-6-phosphate 1-dehydrogenaseBariNot Available1187C->TADR InferredIncreased risk of dose-related hemolysis.Details
Glucose-6-phosphate 1-dehydrogenasePuerto LimonNot Available1192G->AADR InferredIncreased risk of dose-related hemolysis.Details
Glucose-6-phosphate 1-dehydrogenaseCovao do LoboNot Available1205C>AADR InferredIncreased risk of dose-related hemolysis.Details
Glucose-6-phosphate 1-dehydrogenaseClinicNot Available1215G->AADR InferredIncreased risk of dose-related hemolysis.Details
Glucose-6-phosphate 1-dehydrogenaseUtrechtNot Available1225C->TADR InferredIncreased risk of dose-related hemolysis.Details
Glucose-6-phosphate 1-dehydrogenaseSuwalkiNot Available1226C->GADR InferredIncreased risk of dose-related hemolysis.Details
Glucose-6-phosphate 1-dehydrogenaseRiversideNot Available1228G->TADR InferredIncreased risk of dose-related hemolysis.Details
Glucose-6-phosphate 1-dehydrogenaseJapan, ShinagawaNot Available1229G->AADR InferredIncreased risk of dose-related hemolysis.Details
Glucose-6-phosphate 1-dehydrogenaseKawasakiNot Available1229G->CADR InferredIncreased risk of dose-related hemolysis.Details
Glucose-6-phosphate 1-dehydrogenaseMunichNot Available1231A->GADR InferredIncreased risk of dose-related hemolysis.Details
Glucose-6-phosphate 1-dehydrogenaseGeorgiaNot Available1284C->AADR InferredIncreased risk of dose-related hemolysis.Details
Glucose-6-phosphate 1-dehydrogenaseSumareNot Available1292T->GADR InferredIncreased risk of dose-related hemolysis.Details
Glucose-6-phosphate 1-dehydrogenaseTelti/KobeNot Available1318C->TADR InferredIncreased risk of dose-related hemolysis.Details
Glucose-6-phosphate 1-dehydrogenaseSantiago de Cuba, MoriokaNot Available1339G->AADR InferredIncreased risk of dose-related hemolysis.Details
Glucose-6-phosphate 1-dehydrogenaseHarimaNot Available1358T->AADR InferredIncreased risk of dose-related hemolysis.Details
Glucose-6-phosphate 1-dehydrogenaseFiguera da FozNot Available1366G->CADR InferredIncreased risk of dose-related hemolysis.Details
Glucose-6-phosphate 1-dehydrogenaseAmiensNot Available1367A>TADR InferredIncreased risk of dose-related hemolysis.Details
Glucose-6-phosphate 1-dehydrogenaseBangkok NoiNot Available1376G->T, 1502T->GADR InferredIncreased risk of dose-related hemolysis.Details
Glucose-6-phosphate 1-dehydrogenaseFukayaNot Available1462G->AADR InferredIncreased risk of dose-related hemolysis.Details
Glucose-6-phosphate 1-dehydrogenaseCampinasNot Available1463G->TADR InferredIncreased risk of dose-related hemolysis.Details
Glucose-6-phosphate 1-dehydrogenaseBuenos AiresNot Available1465C>TADR InferredIncreased risk of dose-related hemolysis.Details
Glucose-6-phosphate 1-dehydrogenaseArakawaNot Available1466C->TADR InferredIncreased risk of dose-related hemolysis.Details
Glucose-6-phosphate 1-dehydrogenaseBrightonNot Available1488_1490delGAAADR InferredIncreased risk of dose-related hemolysis.Details
Glucose-6-phosphate 1-dehydrogenaseKozukataNot Available159G->CADR InferredIncreased risk of dose-related hemolysis.Details
Glucose-6-phosphate 1-dehydrogenaseAmsterdamNot Available180_182delTCTADR InferredIncreased risk of dose-related hemolysis.Details
Glucose-6-phosphate 1-dehydrogenaseNo nameNot Available202G->A, 376A->G, 1264C>GADR InferredIncreased risk of dose-related hemolysis.Details
Glucose-6-phosphate 1-dehydrogenaseSwanseaNot Available224T->CADR InferredIncreased risk of dose-related hemolysis.Details
Glucose-6-phosphate 1-dehydrogenaseUrayasuNot Available281_283delAGAADR InferredIncreased risk of dose-related hemolysis.Details
Glucose-6-phosphate 1-dehydrogenaseVancouverNot Available317C->G544C->T592C->TADR InferredIncreased risk of dose-related hemolysis.Details
Glucose-6-phosphate 1-dehydrogenaseMt SinaiNot Available376A->G, 1159C->TADR InferredIncreased risk of dose-related hemolysis.Details
Glucose-6-phosphate 1-dehydrogenasePlymouthNot Available488G->AADR InferredIncreased risk of dose-related hemolysis.Details
Glucose-6-phosphate 1-dehydrogenaseVolendamNot Available514C->TADR InferredIncreased risk of dose-related hemolysis.Details
Glucose-6-phosphate 1-dehydrogenaseShinshuNot Available527A->GADR InferredIncreased risk of dose-related hemolysis.Details
Glucose-6-phosphate 1-dehydrogenaseChikugoNot Available535A->TADR InferredIncreased risk of dose-related hemolysis.Details
Glucose-6-phosphate 1-dehydrogenaseTsukuiNot Available561_563delCTCADR InferredIncreased risk of dose-related hemolysis.Details
Glucose-6-phosphate 1-dehydrogenasePedoplis-CkaroNot Available573C>GADR InferredIncreased risk of dose-related hemolysis.Details
Glucose-6-phosphate 1-dehydrogenaseSantiagoNot Available593G->CADR InferredIncreased risk of dose-related hemolysis.Details
Glucose-6-phosphate 1-dehydrogenaseMinnesota, Marion, Gastonia, LeJeuneNot Available637G->TADR InferredIncreased risk of dose-related hemolysis.Details
Glucose-6-phosphate 1-dehydrogenaseCincinnatiNot Available637G->T, 1037A->TADR InferredIncreased risk of dose-related hemolysis.Details
Glucose-6-phosphate 1-dehydrogenaseHarilaouNot Available648T->GADR InferredIncreased risk of dose-related hemolysis.Details
Glucose-6-phosphate 1-dehydrogenaseNorth DallasNot Available683_685delACAADR InferredIncreased risk of dose-related hemolysis.Details
Glucose-6-phosphate 1-dehydrogenaseAsahikawaNot Available695G->AADR InferredIncreased risk of dose-related hemolysis.Details
Glucose-6-phosphate 1-dehydrogenaseDurhamNot Available713A->GADR InferredIncreased risk of dose-related hemolysis.Details
Glucose-6-phosphate 1-dehydrogenaseStonybrookNot Available724_729delGGCACTADR InferredIncreased risk of dose-related hemolysis.Details
Glucose-6-phosphate 1-dehydrogenaseWayneNot Available769C->GADR InferredIncreased risk of dose-related hemolysis.Details
Glucose-6-phosphate 1-dehydrogenaseAveiroNot Available806G->AADR InferredIncreased risk of dose-related hemolysis.Details
Glucose-6-phosphate 1-dehydrogenaseCleveland CorumNot Available820G->AADR InferredIncreased risk of dose-related hemolysis.Details
Glucose-6-phosphate 1-dehydrogenaseLilleNot Available821A>TADR InferredIncreased risk of dose-related hemolysis.Details
Glucose-6-phosphate 1-dehydrogenaseBangkokNot Available825G>CADR InferredIncreased risk of dose-related hemolysis.Details
Glucose-6-phosphate 1-dehydrogenaseSugaoNot Available826C->TADR InferredIncreased risk of dose-related hemolysis.Details
Glucose-6-phosphate 1-dehydrogenaseLa JollaNot Available832T->CADR InferredIncreased risk of dose-related hemolysis.Details
Glucose-6-phosphate 1-dehydrogenaseWexhamNot Available833C->TADR InferredIncreased risk of dose-related hemolysis.Details
Glucose-6-phosphate 1-dehydrogenasePiotrkowNot Available851T>CADR InferredIncreased risk of dose-related hemolysis.Details
Glucose-6-phosphate 1-dehydrogenaseWest VirginiaNot Available910G->TADR InferredIncreased risk of dose-related hemolysis.Details
Glucose-6-phosphate 1-dehydrogenaseOmiyaNot Available921G->CADR InferredIncreased risk of dose-related hemolysis.Details
Glucose-6-phosphate 1-dehydrogenaseNaraNot Available953_976delCCACCAAAGGGTACCTGGAC GACCADR InferredIncreased risk of dose-related hemolysis.Details
Glucose-6-phosphate 1-dehydrogenaseManhattanNot Available962G->AADR InferredIncreased risk of dose-related hemolysis.Details
Glucose-6-phosphate 1-dehydrogenaseRehevotNot Available964T->CADR InferredIncreased risk of dose-related hemolysis.Details
Glucose-6-phosphate 1-dehydrogenaseHoniaraNot Available99A->G / 1360C->TADR InferredIncreased risk of dose-related hemolysis.Details
Glucose-6-phosphate 1-dehydrogenaseTokyo, FukushimaNot Available1246G->AADR InferredIncreased risk of dose-related hemolysis.Details
Glucose-6-phosphate 1-dehydrogenaseChathamNot Available1003G->AADR InferredIncreased risk of dose-related hemolysis.Details
Glucose-6-phosphate 1-dehydrogenaseFushanNot Available1004C->AADR InferredIncreased risk of dose-related hemolysis.Details
Glucose-6-phosphate 1-dehydrogenasePartenopeNot Available1052G->TADR InferredIncreased risk of dose-related hemolysis.Details
Glucose-6-phosphate 1-dehydrogenaseIerapetraNot Available1057C->TADR InferredIncreased risk of dose-related hemolysis.Details
Glucose-6-phosphate 1-dehydrogenaseAnadiaNot Available1193A->GADR InferredIncreased risk of dose-related hemolysis.Details
Glucose-6-phosphate 1-dehydrogenaseAbenoNot Available1220A->CADR InferredIncreased risk of dose-related hemolysis.Details
Glucose-6-phosphate 1-dehydrogenaseSurabayaNot Available1291G->AADR InferredIncreased risk of dose-related hemolysis.Details
Glucose-6-phosphate 1-dehydrogenasePawneeNot Available1316G->CADR InferredIncreased risk of dose-related hemolysis.Details
Glucose-6-phosphate 1-dehydrogenaseS. AntiocoNot Available1342A->GADR InferredIncreased risk of dose-related hemolysis.Details
Glucose-6-phosphate 1-dehydrogenaseCassanoNot Available1347G->CADR InferredIncreased risk of dose-related hemolysis.Details
Glucose-6-phosphate 1-dehydrogenaseHermoupolisNot Available1347G->C / 1360C->TADR InferredIncreased risk of dose-related hemolysis.Details
Glucose-6-phosphate 1-dehydrogenaseUnion,Maewo, Chinese-2, KaloNot Available1360C->TADR InferredIncreased risk of dose-related hemolysis.Details
Glucose-6-phosphate 1-dehydrogenaseAndalusNot Available1361G->AADR InferredIncreased risk of dose-related hemolysis.Details
Glucose-6-phosphate 1-dehydrogenaseCosenzaNot Available1376G->CADR InferredIncreased risk of dose-related hemolysis.Details
Glucose-6-phosphate 1-dehydrogenaseCanton, Taiwan- Hakka, Gifu-like, Agrigento-likeNot Available1376G->TADR InferredIncreased risk of dose-related hemolysis.Details
Glucose-6-phosphate 1-dehydrogenaseFloresNot Available1387C->AADR InferredIncreased risk of dose-related hemolysis.Details
Glucose-6-phosphate 1-dehydrogenaseKaiping, Anant, Dhon, Sapporo-like, WoseraNot Available1388G->AADR InferredIncreased risk of dose-related hemolysis.Details
Glucose-6-phosphate 1-dehydrogenaseKamogawaNot Available169C->TADR InferredIncreased risk of dose-related hemolysis.Details
Glucose-6-phosphate 1-dehydrogenaseCostanzoNot Available179T>CADR InferredIncreased risk of dose-related hemolysis.Details
Glucose-6-phosphate 1-dehydrogenaseAmazoniaNot Available185C->AADR InferredIncreased risk of dose-related hemolysis.Details
Glucose-6-phosphate 1-dehydrogenaseSongklanagarindNot Available196T->AADR InferredIncreased risk of dose-related hemolysis.Details
Glucose-6-phosphate 1-dehydrogenaseHechiNot Available202G->A / 871G->AADR InferredIncreased risk of dose-related hemolysis.Details
Glucose-6-phosphate 1-dehydrogenaseNamouruNot Available208T->CADR InferredIncreased risk of dose-related hemolysis.Details
Glucose-6-phosphate 1-dehydrogenaseBao LocNot Available352T>CADR InferredIncreased risk of dose-related hemolysis.Details
Glucose-6-phosphate 1-dehydrogenaseCrispimNot Available375G->T, 379G->T383T->C384C>TADR InferredIncreased risk of dose-related hemolysis.Details
Glucose-6-phosphate 1-dehydrogenaseAcrokorinthosNot Available376A->G / 463C->GADR InferredIncreased risk of dose-related hemolysis.Details
Glucose-6-phosphate 1-dehydrogenaseSanta MariaNot Available376A->G / 542A->TADR InferredIncreased risk of dose-related hemolysis.Details
Glucose-6-phosphate 1-dehydrogenaseAnanindeuaNot Available376A->G / 871G->AADR InferredIncreased risk of dose-related hemolysis.Details
Glucose-6-phosphate 1-dehydrogenaseVanua LavaNot Available383T->CADR InferredIncreased risk of dose-related hemolysis.Details
Glucose-6-phosphate 1-dehydrogenaseValladolidNot Available406C->TADR InferredIncreased risk of dose-related hemolysis.Details
Glucose-6-phosphate 1-dehydrogenaseBelemNot Available409C->TADR InferredIncreased risk of dose-related hemolysis.Details
Glucose-6-phosphate 1-dehydrogenaseLiuzhouNot Available442G->AADR InferredIncreased risk of dose-related hemolysis.Details
Glucose-6-phosphate 1-dehydrogenaseShenzenNot Available473G>AADR InferredIncreased risk of dose-related hemolysis.Details
Glucose-6-phosphate 1-dehydrogenaseTaipei “Chinese- 3”Not Available493A->GADR InferredIncreased risk of dose-related hemolysis.Details
Glucose-6-phosphate 1-dehydrogenaseToledoNot Available496C>TADR InferredIncreased risk of dose-related hemolysis.Details
Glucose-6-phosphate 1-dehydrogenaseNaoneNot Available497G->AADR InferredIncreased risk of dose-related hemolysis.Details
Glucose-6-phosphate 1-dehydrogenaseNankangNot Available517T->CADR InferredIncreased risk of dose-related hemolysis.Details
Glucose-6-phosphate 1-dehydrogenaseMiaoliNot Available519C->GADR InferredIncreased risk of dose-related hemolysis.Details
Glucose-6-phosphate 1-dehydrogenaseMediterranean, Dallas, Panama‚ Sassari, Cagliari, BirminghamNot Available563C->TADR InferredIncreased risk of dose-related hemolysis.Details
Glucose-6-phosphate 1-dehydrogenaseCoimbra ShundeNot Available592C->TADR InferredIncreased risk of dose-related hemolysis.Details
Glucose-6-phosphate 1-dehydrogenaseNilgiriNot Available593G>AADR InferredIncreased risk of dose-related hemolysis.Details
Glucose-6-phosphate 1-dehydrogenaseRadlowoNot Available679C->TADR InferredIncreased risk of dose-related hemolysis.Details
Glucose-6-phosphate 1-dehydrogenaseRoubaixNot Available811G>CADR InferredIncreased risk of dose-related hemolysis.Details
Glucose-6-phosphate 1-dehydrogenaseHaikouNot Available835A->GADR InferredIncreased risk of dose-related hemolysis.Details
Glucose-6-phosphate 1-dehydrogenaseChinese-1Not Available835A->TADR InferredIncreased risk of dose-related hemolysis.Details
Glucose-6-phosphate 1-dehydrogenaseMizushimaNot Available848A>GADR InferredIncreased risk of dose-related hemolysis.Details
Glucose-6-phosphate 1-dehydrogenaseOsakaNot Available853C->TADR InferredIncreased risk of dose-related hemolysis.Details
Glucose-6-phosphate 1-dehydrogenaseViangchan, JammuNot Available871G->AADR InferredIncreased risk of dose-related hemolysis.Details
Glucose-6-phosphate 1-dehydrogenaseSeoulNot Available916G->AADR InferredIncreased risk of dose-related hemolysis.Details
Glucose-6-phosphate 1-dehydrogenaseLudhianaNot Available929G->AADR InferredIncreased risk of dose-related hemolysis.Details
Glucose-6-phosphate 1-dehydrogenaseFarroupilhaNot Available977C->AADR InferredIncreased risk of dose-related hemolysis.Details
Glucose-6-phosphate 1-dehydrogenaseChinese-5Not Available1024C->TADR InferredIncreased risk of dose-related hemolysis.Details
Glucose-6-phosphate 1-dehydrogenaseRignanoNot Available130G>AADR InferredIncreased risk of dose-related hemolysis.Details
Glucose-6-phosphate 1-dehydrogenaseOrissaNot Available131C->GADR InferredIncreased risk of dose-related hemolysis.Details
Glucose-6-phosphate 1-dehydrogenaseG6PDNiceNot Available1380G>CADR InferredIncreased risk of dose-related hemolysis.Details
Glucose-6-phosphate 1-dehydrogenaseKamiube, KeelungNot Available1387C->TADR InferredIncreased risk of dose-related hemolysis.Details
Glucose-6-phosphate 1-dehydrogenaseNeapolisNot Available1400C->GADR InferredIncreased risk of dose-related hemolysis.Details
Glucose-6-phosphate 1-dehydrogenaseAuresNot Available143T->CADR InferredIncreased risk of dose-related hemolysis.Details
Glucose-6-phosphate 1-dehydrogenaseSplitNot Available1442C->GADR InferredIncreased risk of dose-related hemolysis.Details
Glucose-6-phosphate 1-dehydrogenaseKambosNot Available148C->TADR InferredIncreased risk of dose-related hemolysis.Details
Glucose-6-phosphate 1-dehydrogenasePalestrinaNot Available170G>AADR InferredIncreased risk of dose-related hemolysis.Details
Glucose-6-phosphate 1-dehydrogenaseMetapontoNot Available172G->AADR InferredIncreased risk of dose-related hemolysis.Details
Glucose-6-phosphate 1-dehydrogenaseMusashinoNot Available185C->TADR InferredIncreased risk of dose-related hemolysis.Details
Glucose-6-phosphate 1-dehydrogenaseAsahiNot Available202G->AADR InferredIncreased risk of dose-related hemolysis.Details
Glucose-6-phosphate 1-dehydrogenaseA- (202), Ferrara INot Available202G->A / 376A->GADR InferredIncreased risk of dose-related hemolysis.Details
Glucose-6-phosphate 1-dehydrogenaseMurcia OristanoNot Available209A->GADR InferredIncreased risk of dose-related hemolysis.Details
Glucose-6-phosphate 1-dehydrogenaseUbe KonanNot Available241C->TADR InferredIncreased risk of dose-related hemolysis.Details
Glucose-6-phosphate 1-dehydrogenaseLagosantoNot Available242G->AADR InferredIncreased risk of dose-related hemolysis.Details
Glucose-6-phosphate 1-dehydrogenaseGuangzhouNot Available274C->TADR InferredIncreased risk of dose-related hemolysis.Details
Glucose-6-phosphate 1-dehydrogenaseHammersmithNot Available323T->AADR InferredIncreased risk of dose-related hemolysis.Details
Glucose-6-phosphate 1-dehydrogenaseSinnaiNot Available34G->TADR InferredIncreased risk of dose-related hemolysis.Details
Glucose-6-phosphate 1-dehydrogenaseA- (680)Not Available376A->G / 680G->TADR InferredIncreased risk of dose-related hemolysis.Details
Glucose-6-phosphate 1-dehydrogenaseA- (968), Betica,Selma, GuantanamoNot Available376A->G / 968T->CADR InferredIncreased risk of dose-related hemolysis.Details
Glucose-6-phosphate 1-dehydrogenaseSalerno PyrgosNot Available383T>GADR InferredIncreased risk of dose-related hemolysis.Details
Glucose-6-phosphate 1-dehydrogenaseQuing YanNot Available392G->TADR InferredIncreased risk of dose-related hemolysis.Details
Glucose-6-phosphate 1-dehydrogenaseLagesNot Available40G->AADR InferredIncreased risk of dose-related hemolysis.Details
Glucose-6-phosphate 1-dehydrogenaseIleshaNot Available466G->AADR InferredIncreased risk of dose-related hemolysis.Details
Glucose-6-phosphate 1-dehydrogenaseMahidolNot Available487G->AADR InferredIncreased risk of dose-related hemolysis.Details
Glucose-6-phosphate 1-dehydrogenaseMalagaNot Available542A->TADR InferredIncreased risk of dose-related hemolysis.Details
Glucose-6-phosphate 1-dehydrogenaseSibariNot Available634A->GADR InferredIncreased risk of dose-related hemolysis.Details
Glucose-6-phosphate 1-dehydrogenaseMexico CityNot Available680G->AADR InferredIncreased risk of dose-related hemolysis.Details
Glucose-6-phosphate 1-dehydrogenaseNanningNot Available703C->TADR InferredIncreased risk of dose-related hemolysis.Details
Glucose-6-phosphate 1-dehydrogenaseSeattle, Lodi, Modena, Ferrara II, Athens-likeNot Available844G->CADR InferredIncreased risk of dose-related hemolysis.Details
Glucose-6-phosphate 1-dehydrogenaseBajo MaumereNot Available844G->TADR InferredIncreased risk of dose-related hemolysis.Details
Glucose-6-phosphate 1-dehydrogenaseMontalbanoNot Available854G->AADR InferredIncreased risk of dose-related hemolysis.Details
Glucose-6-phosphate 1-dehydrogenaseKalyan-Kerala, Jamnaga, RohiniNot Available949G->AADR InferredIncreased risk of dose-related hemolysis.Details
Glucose-6-phosphate 1-dehydrogenaseGaoheNot Available95A->GADR InferredIncreased risk of dose-related hemolysis.Details


Drug Interactions
DrugInteractionDrug group
AbirateroneThe serum concentration of Trimethoprim can be increased when it is combined with Abiraterone.Approved
AceclofenacThe metabolism of Aceclofenac can be decreased when combined with Trimethoprim.Approved, Investigational
AcenocoumarolThe metabolism of Acenocoumarol can be decreased when combined with Trimethoprim.Approved, Investigational
AcepromazineThe serum concentration of Acepromazine can be increased when it is combined with Trimethoprim.Approved, Vet Approved
AceprometazineThe serum concentration of Aceprometazine can be increased when it is combined with Trimethoprim.Approved
AcetaminophenThe metabolism of Acetaminophen can be decreased when combined with Trimethoprim.Approved
Acetyl sulfisoxazoleThe metabolism of Trimethoprim can be decreased when combined with Acetyl sulfisoxazole.Approved, Vet Approved
Acetylsalicylic acidThe metabolism of Acetylsalicylic acid can be decreased when combined with Trimethoprim.Approved, Vet Approved
AfatinibThe serum concentration of Afatinib can be decreased when it is combined with Trimethoprim.Approved
AlimemazineThe serum concentration of Alimemazine can be increased when it is combined with Trimethoprim.Approved, Vet Approved
AlmotriptanThe metabolism of Almotriptan can be decreased when combined with Trimethoprim.Approved, Investigational
AlosetronThe metabolism of Alosetron can be decreased when combined with Trimethoprim.Approved, Withdrawn
AlprazolamThe metabolism of Alprazolam can be decreased when combined with Trimethoprim.Approved, Illicit, Investigational
AmantadineThe risk or severity of adverse effects can be increased when Trimethoprim is combined with Amantadine.Approved
AminophenazoneThe metabolism of Aminophenazone can be decreased when combined with Trimethoprim.Approved, Withdrawn
AmiodaroneThe metabolism of Trimethoprim can be decreased when combined with Amiodarone.Approved, Investigational
AmitriptylineThe metabolism of Amitriptyline can be decreased when combined with Trimethoprim.Approved
AmodiaquineThe serum concentration of Amodiaquine can be increased when it is combined with Trimethoprim.Approved, Investigational
AmodiaquineTrimethoprim may increase the neutropenic activities of Amodiaquine.Approved, Investigational
AmprenavirThe metabolism of Amprenavir can be decreased when combined with Trimethoprim.Approved, Investigational
AnagrelideTrimethoprim may increase the QTc-prolonging activities of Anagrelide.Approved
AntipyrineThe metabolism of Antipyrine can be decreased when combined with Trimethoprim.Approved, Investigational
ApalutamideThe serum concentration of Trimethoprim can be decreased when it is combined with Apalutamide.Approved, Investigational
ApixabanThe metabolism of Apixaban can be decreased when combined with Trimethoprim.Approved
AprepitantThe serum concentration of Trimethoprim can be increased when it is combined with Aprepitant.Approved, Investigational
Arachidonic AcidThe metabolism of Arachidonic Acid can be decreased when combined with Trimethoprim.Experimental
ArformoterolThe metabolism of Arformoterol can be decreased when combined with Trimethoprim.Approved, Investigational
Arsenic trioxideTrimethoprim may increase the QTc-prolonging activities of Arsenic trioxide.Approved, Investigational
ArtemetherThe risk or severity of QTc prolongation can be increased when Trimethoprim is combined with Artemether.Approved
AsenapineTrimethoprim may increase the QTc-prolonging activities of Asenapine.Approved
AsunaprevirThe metabolism of Asunaprevir can be decreased when combined with Trimethoprim.Approved, Investigational, Withdrawn
AtazanavirThe metabolism of Trimethoprim can be decreased when combined with Atazanavir.Approved, Investigational
AtomoxetineThe metabolism of Trimethoprim can be decreased when combined with Atomoxetine.Approved
AtorvastatinThe metabolism of Atorvastatin can be decreased when combined with Trimethoprim.Approved
AvatrombopagThe metabolism of Avatrombopag can be decreased when combined with Trimethoprim.Approved, Investigational
AzathioprineTrimethoprim may increase the myelosuppressive activities of Azathioprine.Approved
AzelastineThe metabolism of Azelastine can be decreased when combined with Trimethoprim.Approved
Azilsartan medoxomilTrimethoprim may increase the hyperkalemic activities of Azilsartan medoxomil.Approved, Investigational
AzithromycinTrimethoprim may increase the QTc-prolonging activities of Azithromycin.Approved
BalaglitazoneThe metabolism of Balaglitazone can be decreased when combined with Trimethoprim.Investigational
BedaquilineTrimethoprim may increase the QTc-prolonging activities of Bedaquiline.Approved
BenazeprilTrimethoprim may increase the hyperkalemic activities of Benazepril.Approved, Investigational
Benzyl alcoholThe metabolism of Benzyl alcohol can be decreased when combined with Trimethoprim.Approved
BeraprostThe metabolism of Beraprost can be decreased when combined with Trimethoprim.Investigational
BexaroteneThe metabolism of Bexarotene can be decreased when combined with Trimethoprim.Approved, Investigational
BioallethrinThe metabolism of Bioallethrin can be decreased when combined with Trimethoprim.Approved, Experimental
BL-1020The serum concentration of BL-1020 can be increased when it is combined with Trimethoprim.Investigational
BoceprevirThe metabolism of Trimethoprim can be decreased when combined with Boceprevir.Approved, Withdrawn
BortezomibThe metabolism of Trimethoprim can be decreased when combined with Bortezomib.Approved, Investigational
BosentanThe serum concentration of Bosentan can be increased when it is combined with Trimethoprim.Approved, Investigational
BosutinibThe serum concentration of Bosutinib can be increased when it is combined with Trimethoprim.Approved
Brentuximab vedotinThe serum concentration of Brentuximab vedotin can be decreased when it is combined with Trimethoprim.Approved, Investigational
BrigatinibThe metabolism of Brigatinib can be decreased when combined with Trimethoprim.Approved, Investigational
BrivaracetamThe metabolism of Brivaracetam can be decreased when combined with Trimethoprim.Approved, Investigational
BrompheniramineThe metabolism of Brompheniramine can be decreased when combined with Trimethoprim.Approved
BuprenorphineThe metabolism of Buprenorphine can be decreased when combined with Trimethoprim.Approved, Illicit, Investigational, Vet Approved
BupropionThe metabolism of Bupropion can be decreased when combined with Trimethoprim.Approved
CabazitaxelThe metabolism of Cabazitaxel can be decreased when combined with Trimethoprim.Approved
CabozantinibThe metabolism of Cabozantinib can be decreased when combined with Trimethoprim.Approved, Investigational
CaffeineThe metabolism of Caffeine can be decreased when combined with Trimethoprim.Approved
CandesartanTrimethoprim may increase the hyperkalemic activities of Candesartan.Experimental
Candesartan cilexetilTrimethoprim may increase the hyperkalemic activities of Candesartan cilexetil.Approved
CandoxatrilTrimethoprim may increase the hyperkalemic activities of Candoxatril.Experimental
CannabidiolThe metabolism of Cannabidiol can be decreased when combined with Trimethoprim.Approved, Investigational
CapecitabineThe metabolism of Trimethoprim can be decreased when combined with Capecitabine.Approved, Investigational
CaptoprilTrimethoprim may increase the hyperkalemic activities of Captopril.Approved
CarbamazepineThe metabolism of Trimethoprim can be increased when combined with Carbamazepine.Approved, Investigational
CarbinoxamineThe metabolism of Carbinoxamine can be decreased when combined with Trimethoprim.Approved
CarvedilolThe serum concentration of Carvedilol can be increased when it is combined with Trimethoprim.Approved, Investigational
CelecoxibThe metabolism of Celecoxib can be decreased when combined with Trimethoprim.Approved, Investigational
CeritinibThe serum concentration of Trimethoprim can be increased when it is combined with Ceritinib.Approved
CerivastatinThe metabolism of Cerivastatin can be decreased when combined with Trimethoprim.Approved, Withdrawn
ChloroquineThe metabolism of Chloroquine can be decreased when combined with Trimethoprim.Approved, Investigational, Vet Approved
ChlorproethazineThe serum concentration of Chlorproethazine can be increased when it is combined with Trimethoprim.Experimental
ChlorpromazineThe serum concentration of Chlorpromazine can be increased when it is combined with Trimethoprim.Approved, Investigational, Vet Approved
ChlorpropamideThe metabolism of Chlorpropamide can be decreased when combined with Trimethoprim.Approved, Investigational
CholecalciferolThe metabolism of Trimethoprim can be decreased when combined with Cholecalciferol.Approved, Nutraceutical
CiglitazoneThe metabolism of Ciglitazone can be decreased when combined with Trimethoprim.Experimental
CilazaprilTrimethoprim may increase the hyperkalemic activities of Cilazapril.Approved
CinnarizineThe metabolism of Cinnarizine can be decreased when combined with Trimethoprim.Approved, Investigational
CiprofloxacinTrimethoprim may increase the QTc-prolonging activities of Ciprofloxacin.Approved, Investigational
CisaprideTrimethoprim may increase the QTc-prolonging activities of Cisapride.Approved, Investigational, Withdrawn
CitalopramTrimethoprim may increase the QTc-prolonging activities of Citalopram.Approved
ClarithromycinThe metabolism of Trimethoprim can be decreased when combined with Clarithromycin.Approved
ClemastineThe metabolism of Trimethoprim can be decreased when combined with Clemastine.Approved, Investigational
ClopidogrelThe metabolism of Clopidogrel can be decreased when combined with Trimethoprim.Approved
ClotrimazoleThe metabolism of Trimethoprim can be decreased when combined with Clotrimazole.Approved, Vet Approved
ClozapineThe metabolism of Clozapine can be decreased when combined with Trimethoprim.Approved
CobicistatThe metabolism of Trimethoprim can be decreased when combined with Cobicistat.Approved
ColchicineThe serum concentration of Colchicine can be increased when it is combined with Trimethoprim.Approved
ConivaptanThe serum concentration of Conivaptan can be increased when it is combined with Trimethoprim.Approved, Investigational
CrisaboroleThe metabolism of Trimethoprim can be decreased when combined with Crisaborole.Approved, Investigational
CrizotinibThe metabolism of Trimethoprim can be decreased when combined with Crizotinib.Approved
CurcuminThe metabolism of Trimethoprim can be decreased when combined with Curcumin.Approved, Investigational
CyclophosphamideThe metabolism of Cyclophosphamide can be decreased when combined with Trimethoprim.Approved, Investigational
CyclosporineThe metabolism of Trimethoprim can be decreased when combined with Cyclosporine.Approved, Investigational, Vet Approved
Dabigatran etexilateThe serum concentration of Dabigatran etexilate can be decreased when it is combined with Trimethoprim.Approved
DabrafenibThe serum concentration of Trimethoprim can be decreased when it is combined with Dabrafenib.Approved, Investigational
DapagliflozinThe metabolism of Dapagliflozin can be decreased when combined with Trimethoprim.Approved
DapsoneThe risk or severity of adverse effects can be increased when Trimethoprim is combined with Dapsone.Approved, Investigational
DarunavirThe metabolism of Trimethoprim can be decreased when combined with Darunavir.Approved
DasabuvirThe metabolism of Dasabuvir can be decreased when combined with Trimethoprim.Approved
DasatinibThe serum concentration of Trimethoprim can be increased when it is combined with Dasatinib.Approved, Investigational
DeferasiroxThe serum concentration of Trimethoprim can be decreased when it is combined with Deferasirox.Approved, Investigational
DelaprilTrimethoprim may increase the hyperkalemic activities of Delapril.Experimental
DelavirdineThe metabolism of Trimethoprim can be decreased when combined with Delavirdine.Approved
DextromethorphanThe metabolism of Dextromethorphan can be decreased when combined with Trimethoprim.Approved
DiazepamThe metabolism of Diazepam can be decreased when combined with Trimethoprim.Approved, Illicit, Investigational, Vet Approved
DiclofenacThe metabolism of Diclofenac can be decreased when combined with Trimethoprim.Approved, Vet Approved
DicoumarolThe metabolism of Dicoumarol can be decreased when combined with Trimethoprim.Approved
DigoxinThe serum concentration of Digoxin can be increased when it is combined with Trimethoprim.Approved
DihydroergotamineThe metabolism of Trimethoprim can be decreased when combined with Dihydroergotamine.Approved, Investigational
DiltiazemThe metabolism of Trimethoprim can be decreased when combined with Diltiazem.Approved, Investigational
DiphenhydramineThe metabolism of Diphenhydramine can be decreased when combined with Trimethoprim.Approved, Investigational
DisopyramideTrimethoprim may increase the QTc-prolonging activities of Disopyramide.Approved
DoconexentThe metabolism of Doconexent can be decreased when combined with Trimethoprim.Approved, Investigational
DofetilideTrimethoprim may decrease the excretion rate of Dofetilide which could result in a higher serum level.Approved, Investigational
DolasetronThe metabolism of Dolasetron can be decreased when combined with Trimethoprim.Approved, Investigational
DomperidoneTrimethoprim may increase the QTc-prolonging activities of Domperidone.Approved, Investigational, Vet Approved
DonepezilThe metabolism of Donepezil can be decreased when combined with Trimethoprim.Approved
DopamineThe metabolism of Dopamine can be decreased when combined with Trimethoprim.Approved
DorzolamideThe metabolism of Dorzolamide can be decreased when combined with Trimethoprim.Approved
DosulepinThe metabolism of Trimethoprim can be decreased when combined with Dosulepin.Approved
DoxepinThe metabolism of Doxepin can be decreased when combined with Trimethoprim.Approved, Investigational
DoxorubicinThe serum concentration of Doxorubicin can be increased when it is combined with Trimethoprim.Approved, Investigational
DoxycyclineThe metabolism of Trimethoprim can be decreased when combined with Doxycycline.Approved, Investigational, Vet Approved
DronabinolThe serum concentration of Dronabinol can be increased when it is combined with Trimethoprim.Approved, Illicit
DronedaroneTrimethoprim may increase the QTc-prolonging activities of Dronedarone.Approved
DroperidolTrimethoprim may increase the QTc-prolonging activities of Droperidol.Approved, Vet Approved
EdoxabanThe serum concentration of Edoxaban can be increased when it is combined with Trimethoprim.Approved
EfavirenzThe metabolism of Trimethoprim can be decreased when combined with Efavirenz.Approved, Investigational
EletriptanThe metabolism of Eletriptan can be decreased when combined with Trimethoprim.Approved, Investigational
EliglustatTrimethoprim may increase the QTc-prolonging activities of Eliglustat.Approved
EltrombopagThe metabolism of Eltrombopag can be decreased when combined with Trimethoprim.Approved
EnalaprilTrimethoprim may increase the hyperkalemic activities of Enalapril.Approved, Vet Approved
EnalaprilatTrimethoprim may increase the hyperkalemic activities of Enalaprilat.Approved
EnasidenibThe metabolism of Enasidenib can be decreased when combined with Trimethoprim.Approved, Investigational
EnzalutamideThe serum concentration of Trimethoprim can be decreased when it is combined with Enzalutamide.Approved
EplerenoneTrimethoprim may increase the hyperkalemic activities of Eplerenone.Approved
EpoprostenolThe metabolism of Epoprostenol can be decreased when combined with Trimethoprim.Approved
EprosartanTrimethoprim may increase the hyperkalemic activities of Eprosartan.Approved
ErlotinibThe metabolism of Erlotinib can be decreased when combined with Trimethoprim.Approved, Investigational
ErythromycinThe metabolism of Trimethoprim can be decreased when combined with Erythromycin.Approved, Investigational, Vet Approved
EscitalopramTrimethoprim may increase the QTc-prolonging activities of Escitalopram.Approved, Investigational
EstradiolThe metabolism of Estradiol can be decreased when combined with Trimethoprim.Approved, Investigational, Vet Approved
Estradiol acetateThe metabolism of Estradiol acetate can be decreased when combined with Trimethoprim.Approved, Investigational, Vet Approved
Estradiol benzoateThe metabolism of Estradiol benzoate can be decreased when combined with Trimethoprim.Approved, Investigational, Vet Approved
Estradiol cypionateThe metabolism of Estradiol cypionate can be decreased when combined with Trimethoprim.Approved, Investigational, Vet Approved
Estradiol dienanthateThe metabolism of Estradiol dienanthate can be decreased when combined with Trimethoprim.Approved, Investigational, Vet Approved
Estradiol valerateThe metabolism of Estradiol valerate can be decreased when combined with Trimethoprim.Approved, Investigational, Vet Approved
EstroneThe metabolism of Estrone can be decreased when combined with Trimethoprim.Approved
EszopicloneThe metabolism of Eszopiclone can be decreased when combined with Trimethoprim.Approved, Investigational
EtodolacThe metabolism of Etodolac can be decreased when combined with Trimethoprim.Approved, Investigational, Vet Approved
EtoricoxibThe metabolism of Etoricoxib can be decreased when combined with Trimethoprim.Approved, Investigational
EtravirineThe metabolism of Trimethoprim can be decreased when combined with Etravirine.Approved
EverolimusThe serum concentration of Everolimus can be increased when it is combined with Trimethoprim.Approved
FelodipineThe metabolism of Trimethoprim can be decreased when combined with Felodipine.Approved, Investigational
FimasartanTrimethoprim may increase the hyperkalemic activities of Fimasartan.Approved, Investigational
FlecainideTrimethoprim may increase the QTc-prolonging activities of Flecainide.Approved, Withdrawn
FloxuridineThe metabolism of Trimethoprim can be decreased when combined with Floxuridine.Approved
FluconazoleThe metabolism of Trimethoprim can be decreased when combined with Fluconazole.Approved, Investigational
FlunarizineThe metabolism of Flunarizine can be decreased when combined with Trimethoprim.Approved
FlunitrazepamThe metabolism of Flunitrazepam can be decreased when combined with Trimethoprim.Approved, Illicit
FluorouracilThe metabolism of Trimethoprim can be decreased when combined with Fluorouracil.Approved
FluoxetineTrimethoprim may increase the QTc-prolonging activities of Fluoxetine.Approved, Vet Approved
FlupentixolTrimethoprim may increase the QTc-prolonging activities of Flupentixol.Approved, Investigational, Withdrawn
FluphenazineThe serum concentration of Fluphenazine can be increased when it is combined with Trimethoprim.Approved
FlurbiprofenThe metabolism of Flurbiprofen can be decreased when combined with Trimethoprim.Approved, Investigational
FluvastatinThe metabolism of Trimethoprim can be decreased when combined with Fluvastatin.Approved
FluvoxamineThe metabolism of Trimethoprim can be decreased when combined with Fluvoxamine.Approved, Investigational
ForasartanTrimethoprim may increase the hyperkalemic activities of Forasartan.Experimental
FormoterolThe metabolism of Formoterol can be decreased when combined with Trimethoprim.Approved, Investigational
FosamprenavirThe metabolism of Trimethoprim can be decreased when combined with Fosamprenavir.Approved
FosaprepitantThe serum concentration of Trimethoprim can be increased when it is combined with Fosaprepitant.Approved
FosinoprilTrimethoprim may increase the hyperkalemic activities of Fosinopril.Approved
FosphenytoinThe serum concentration of Trimethoprim can be decreased when it is combined with Fosphenytoin.Approved, Investigational
Fusidic AcidThe serum concentration of Trimethoprim can be increased when it is combined with Fusidic Acid.Approved, Investigational
Gadobenic acidTrimethoprim may increase the QTc-prolonging activities of Gadobenic acid.Approved, Investigational
GavestinelThe metabolism of Gavestinel can be decreased when combined with Trimethoprim.Investigational
GemfibrozilThe metabolism of Trimethoprim can be decreased when combined with Gemfibrozil.Approved
GemifloxacinTrimethoprim may increase the QTc-prolonging activities of Gemifloxacin.Approved, Investigational
GliclazideThe metabolism of Gliclazide can be decreased when combined with Trimethoprim.Approved
GlimepirideThe metabolism of Glimepiride can be decreased when combined with Trimethoprim.Approved
GlipizideThe metabolism of Glipizide can be decreased when combined with Trimethoprim.Approved, Investigational
GlyburideThe metabolism of Glyburide can be decreased when combined with Trimethoprim.Approved
GoserelinTrimethoprim may increase the QTc-prolonging activities of Goserelin.Approved
GranisetronTrimethoprim may increase the QTc-prolonging activities of Granisetron.Approved, Investigational
GuanfacineThe metabolism of Guanfacine can be decreased when combined with Trimethoprim.Approved, Investigational
HalofantrineThe metabolism of Halofantrine can be decreased when combined with Trimethoprim.Approved
HaloperidolThe metabolism of Haloperidol can be decreased when combined with Trimethoprim.Approved
HalothaneThe metabolism of Halothane can be decreased when combined with Trimethoprim.Approved, Vet Approved
HexobarbitalThe metabolism of Hexobarbital can be decreased when combined with Trimethoprim.Approved
HistamineThe metabolism of Histamine can be decreased when combined with Trimethoprim.Approved, Investigational
HydromorphoneThe metabolism of Hydromorphone can be decreased when combined with Trimethoprim.Approved, Illicit
IbuprofenThe metabolism of Ibuprofen can be decreased when combined with Trimethoprim.Approved
IbutilideTrimethoprim may increase the QTc-prolonging activities of Ibutilide.Approved
IdarubicinThe metabolism of Idarubicin can be decreased when combined with Trimethoprim.Approved
IdelalisibThe metabolism of Trimethoprim can be decreased when combined with Idelalisib.Approved
IfosfamideThe metabolism of Ifosfamide can be decreased when combined with Trimethoprim.Approved
IloperidoneTrimethoprim may increase the QTc-prolonging activities of Iloperidone.Approved
ImatinibThe metabolism of Trimethoprim can be decreased when combined with Imatinib.Approved
ImidaprilTrimethoprim may increase the hyperkalemic activities of Imidapril.Investigational
IndinavirThe metabolism of Trimethoprim can be decreased when combined with Indinavir.Approved
IndisulamThe metabolism of Indisulam can be decreased when combined with Trimethoprim.Investigational
IndomethacinThe metabolism of Indomethacin can be decreased when combined with Trimethoprim.Approved, Investigational
IrbesartanTrimethoprim may increase the hyperkalemic activities of Irbesartan.Approved, Investigational
IsavuconazoleThe serum concentration of Trimethoprim can be increased when it is combined with Isavuconazole.Approved, Investigational
IsavuconazoniumThe metabolism of Trimethoprim can be decreased when combined with Isavuconazonium.Approved, Investigational
IsradipineThe metabolism of Trimethoprim can be decreased when combined with Isradipine.Approved, Investigational
ItraconazoleThe metabolism of Trimethoprim can be decreased when combined with Itraconazole.Approved, Investigational
IvacaftorThe serum concentration of Trimethoprim can be increased when it is combined with Ivacaftor.Approved
IxazomibThe metabolism of Ixazomib can be decreased when combined with Trimethoprim.Approved, Investigational
KetamineThe metabolism of Ketamine can be decreased when combined with Trimethoprim.Approved, Vet Approved
KetobemidoneThe metabolism of Ketobemidone can be decreased when combined with Trimethoprim.Approved, Investigational
KetoconazoleThe metabolism of Trimethoprim can be decreased when combined with Ketoconazole.Approved, Investigational
KetoprofenThe metabolism of Ketoprofen can be decreased when combined with Trimethoprim.Approved, Vet Approved
LamivudineTrimethoprim may decrease the excretion rate of Lamivudine which could result in a higher serum level.Approved, Investigational
LansoprazoleThe metabolism of Lansoprazole can be decreased when combined with Trimethoprim.Approved, Investigational
LapatinibThe metabolism of Trimethoprim can be decreased when combined with Lapatinib.Approved, Investigational
LedipasvirThe serum concentration of Ledipasvir can be decreased when it is combined with Trimethoprim.Approved
LedipasvirThe serum concentration of Ledipasvir can be increased when it is combined with Trimethoprim.Approved
LeflunomideThe metabolism of Leflunomide can be decreased when combined with Trimethoprim.Approved, Investigational
LenvatinibTrimethoprim may increase the QTc-prolonging activities of Lenvatinib.Approved, Investigational
LesinuradThe metabolism of Lesinurad can be decreased when combined with Trimethoprim.Approved, Investigational
LeuprolideTrimethoprim may increase the QTc-prolonging activities of Leuprolide.Approved, Investigational
LevofloxacinTrimethoprim may increase the QTc-prolonging activities of Levofloxacin.Approved, Investigational
LevomilnacipranThe metabolism of Levomilnacipran can be decreased when combined with Trimethoprim.Approved, Investigational
LicofeloneThe metabolism of Licofelone can be decreased when combined with Trimethoprim.Investigational
LidocaineThe metabolism of Lidocaine can be decreased when combined with Trimethoprim.Approved, Vet Approved
LinagliptinThe serum concentration of Linagliptin can be decreased when it is combined with Trimethoprim.Approved
LisinoprilTrimethoprim may increase the hyperkalemic activities of Lisinopril.Approved, Investigational
LobeglitazoneThe metabolism of Lobeglitazone can be decreased when combined with Trimethoprim.Approved, Investigational
LoperamideThe metabolism of Loperamide can be decreased when combined with Trimethoprim.Approved
LopinavirThe metabolism of Trimethoprim can be decreased when combined with Lopinavir.Approved
LoratadineThe metabolism of Loratadine can be decreased when combined with Trimethoprim.Approved, Investigational
LornoxicamThe metabolism of Lornoxicam can be decreased when combined with Trimethoprim.Approved, Investigational
LorpiprazoleThe serum concentration of Trimethoprim can be increased when it is combined with Lorpiprazole.Approved
LosartanTrimethoprim may increase the hyperkalemic activities of Losartan.Approved
LovastatinThe metabolism of Trimethoprim can be decreased when combined with Lovastatin.Approved, Investigational
LuliconazoleThe serum concentration of Trimethoprim can be increased when it is combined with Luliconazole.Approved
LumacaftorThe serum concentration of Trimethoprim can be increased when it is combined with Lumacaftor.Approved
LumefantrineThe risk or severity of QTc prolongation can be increased when Trimethoprim is combined with Lumefantrine.Approved
LumiracoxibThe metabolism of Lumiracoxib can be decreased when combined with Trimethoprim.Approved, Investigational
ManidipineThe metabolism of Trimethoprim can be decreased when combined with Manidipine.Approved, Investigational
Medical CannabisThe metabolism of Medical Cannabis can be decreased when combined with Trimethoprim.Experimental, Investigational
Mefenamic acidThe metabolism of Mefenamic acid can be decreased when combined with Trimethoprim.Approved
MelatoninThe metabolism of Melatonin can be decreased when combined with Trimethoprim.Approved, Nutraceutical, Vet Approved
MeloxicamThe metabolism of Meloxicam can be decreased when combined with Trimethoprim.Approved, Vet Approved
MemantineThe risk or severity of adverse effects can be increased when Trimethoprim is combined with Memantine.Approved, Investigational
MephenytoinThe metabolism of Mephenytoin can be decreased when combined with Trimethoprim.Investigational, Withdrawn
MercaptopurineTrimethoprim may increase the myelosuppressive activities of Mercaptopurine.Approved
MesoridazineThe serum concentration of Mesoridazine can be increased when it is combined with Trimethoprim.Approved, Investigational
MestranolThe metabolism of Mestranol can be decreased when combined with Trimethoprim.Approved
MetforminThe serum concentration of Metformin can be increased when it is combined with Trimethoprim.Approved
MethadoneThe metabolism of Methadone can be decreased when combined with Trimethoprim.Approved
MethotrexateThe risk or severity of adverse effects can be increased when Trimethoprim is combined with Methotrexate.Approved
MethotrimeprazineThe serum concentration of Methotrimeprazine can be increased when it is combined with Trimethoprim.Approved, Investigational
MethoxyfluraneThe metabolism of Methoxyflurane can be decreased when combined with Trimethoprim.Approved, Investigational, Vet Approved
Methylene blueThe serum concentration of Methylene blue can be increased when it is combined with Trimethoprim.Approved, Investigational
MetronidazoleThe metabolism of Metronidazole can be decreased when combined with Trimethoprim.Approved
MidostaurinThe metabolism of Trimethoprim can be decreased when combined with Midostaurin.Approved, Investigational
MifepristoneThe serum concentration of Trimethoprim can be increased when it is combined with Mifepristone.Approved, Investigational
MirtazapineThe metabolism of Mirtazapine can be decreased when combined with Trimethoprim.Approved
MitotaneThe serum concentration of Trimethoprim can be decreased when it is combined with Mitotane.Approved
MoclobemideThe metabolism of Moclobemide can be decreased when combined with Trimethoprim.Approved, Investigational
MoexiprilTrimethoprim may increase the hyperkalemic activities of Moexipril.Approved
MontelukastThe metabolism of Montelukast can be decreased when combined with Trimethoprim.Approved
MoricizineThe serum concentration of Moricizine can be increased when it is combined with Trimethoprim.Approved, Investigational, Withdrawn
MorphineThe metabolism of Morphine can be decreased when combined with Trimethoprim.Approved, Investigational
MoxifloxacinTrimethoprim may increase the QTc-prolonging activities of Moxifloxacin.Approved, Investigational
MuraglitazarThe metabolism of Muraglitazar can be decreased when combined with Trimethoprim.Investigational
Mycophenolate mofetilThe metabolism of Mycophenolate mofetil can be decreased when combined with Trimethoprim.Approved, Investigational
NabiloneThe metabolism of Trimethoprim can be decreased when combined with Nabilone.Approved, Investigational
NabiximolsThe metabolism of Nabiximols can be decreased when combined with Trimethoprim.Approved, Investigational
NaloxegolThe serum concentration of Naloxegol can be increased when it is combined with Trimethoprim.Approved
NaloxoneThe metabolism of Naloxone can be decreased when combined with Trimethoprim.Approved, Vet Approved
NaproxenThe metabolism of Naproxen can be decreased when combined with Trimethoprim.Approved, Vet Approved
NateglinideThe metabolism of Nateglinide can be decreased when combined with Trimethoprim.Approved, Investigational
NefazodoneThe metabolism of Trimethoprim can be decreased when combined with Nefazodone.Approved, Withdrawn
NelfinavirThe metabolism of Trimethoprim can be decreased when combined with Nelfinavir.Approved
NetoglitazoneThe metabolism of Netoglitazone can be decreased when combined with Trimethoprim.Experimental
NetupitantThe serum concentration of Trimethoprim can be increased when it is combined with Netupitant.Approved, Investigational
NevirapineThe metabolism of Trimethoprim can be increased when combined with Nevirapine.Approved
NicardipineThe metabolism of Trimethoprim can be decreased when combined with Nicardipine.Approved, Investigational
NiclosamideThe metabolism of Niclosamide can be decreased when combined with Trimethoprim.Approved, Investigational, Vet Approved
NicotineThe metabolism of Nicotine can be decreased when combined with Trimethoprim.Approved
NilotinibTrimethoprim may increase the QTc-prolonging activities of Nilotinib.Approved, Investigational
NortriptylineThe metabolism of Nortriptyline can be decreased when combined with Trimethoprim.Approved
OdanacatibThe metabolism of Odanacatib can be decreased when combined with Trimethoprim.Investigational
OfloxacinTrimethoprim may increase the QTc-prolonging activities of Ofloxacin.Approved
OlaparibThe metabolism of Trimethoprim can be decreased when combined with Olaparib.Approved
OlmesartanTrimethoprim may increase the hyperkalemic activities of Olmesartan.Approved, Investigational
OlodaterolThe metabolism of Olodaterol can be decreased when combined with Trimethoprim.Approved
OmapatrilatTrimethoprim may increase the hyperkalemic activities of Omapatrilat.Investigational
OmbitasvirThe metabolism of Ombitasvir can be decreased when combined with Trimethoprim.Approved, Investigational
OmeprazoleThe metabolism of Trimethoprim can be decreased when combined with Omeprazole.Approved, Investigational, Vet Approved
OndansetronThe metabolism of Ondansetron can be decreased when combined with Trimethoprim.Approved
OsimertinibThe serum concentration of Trimethoprim can be increased when it is combined with Osimertinib.Approved
OspemifeneThe metabolism of Ospemifene can be decreased when combined with Trimethoprim.Approved, Investigational
OxaprozinThe metabolism of Oxaprozin can be decreased when combined with Trimethoprim.Approved
PaclitaxelThe metabolism of Paclitaxel can be decreased when combined with Trimethoprim.Approved, Vet Approved
PalbociclibThe serum concentration of Trimethoprim can be increased when it is combined with Palbociclib.Approved, Investigational
PaliperidoneTrimethoprim may increase the QTc-prolonging activities of Paliperidone.Approved
PanobinostatTrimethoprim may increase the QTc-prolonging activities of Panobinostat.Approved, Investigational
ParamethadioneThe metabolism of Paramethadione can be decreased when combined with Trimethoprim.Approved
ParecoxibThe metabolism of Parecoxib can be decreased when combined with Trimethoprim.Approved
PazopanibThe serum concentration of Pazopanib can be increased when it is combined with Trimethoprim.Approved
PentamidineThe metabolism of Pentamidine can be decreased when combined with Trimethoprim.Approved, Investigational
PentobarbitalThe metabolism of Trimethoprim can be increased when combined with Pentobarbital.Approved, Investigational, Vet Approved
PerazineThe serum concentration of Perazine can be increased when it is combined with Trimethoprim.Approved, Investigational
PerflutrenTrimethoprim may increase the QTc-prolonging activities of Perflutren.Approved
PerindoprilTrimethoprim may increase the hyperkalemic activities of Perindopril.Approved
PerospironeThe metabolism of Perospirone can be decreased when combined with Trimethoprim.Approved
PerphenazineThe serum concentration of Perphenazine can be increased when it is combined with Trimethoprim.Approved
PhenacetinThe metabolism of Phenacetin can be decreased when combined with Trimethoprim.Withdrawn
PhenobarbitalThe metabolism of Trimethoprim can be increased when combined with Phenobarbital.Approved, Investigational
PhenprocoumonThe metabolism of Phenprocoumon can be decreased when combined with Trimethoprim.Approved, Investigational
PhenylbutazoneThe metabolism of Phenylbutazone can be decreased when combined with Trimethoprim.Approved, Vet Approved
PhenytoinThe serum concentration of Phenytoin can be increased when it is combined with Trimethoprim.Approved, Vet Approved
PimozideTrimethoprim may increase the QTc-prolonging activities of Pimozide.Approved
PioglitazoneThe metabolism of Pioglitazone can be decreased when combined with Trimethoprim.Approved, Investigational
PiperaquineThe metabolism of Piperaquine can be decreased when combined with Trimethoprim.Approved, Investigational
PiroxicamThe metabolism of Piroxicam can be decreased when combined with Trimethoprim.Approved, Investigational
PitavastatinThe metabolism of Pitavastatin can be decreased when combined with Trimethoprim.Approved
PitolisantThe serum concentration of Trimethoprim can be decreased when it is combined with Pitolisant.Approved, Investigational
PonatinibThe metabolism of Ponatinib can be decreased when combined with Trimethoprim.Approved, Investigational
PosaconazoleThe metabolism of Trimethoprim can be decreased when combined with Posaconazole.Approved, Investigational, Vet Approved
PralatrexateThe serum concentration of Pralatrexate can be increased when it is combined with Trimethoprim.Approved, Investigational
PrasugrelThe metabolism of Prasugrel can be decreased when combined with Trimethoprim.Approved
PravastatinThe metabolism of Pravastatin can be decreased when combined with Trimethoprim.Approved
PrimaquineTrimethoprim may increase the QTc-prolonging activities of Primaquine.Approved
PrimidoneThe metabolism of Trimethoprim can be increased when combined with Primidone.Approved, Vet Approved
ProcainamideThe serum concentration of the active metabolites of Procainamide can be increased when Procainamide is used in combination with Trimethoprim.Approved
ProchlorperazineThe serum concentration of Prochlorperazine can be increased when it is combined with Trimethoprim.Approved, Vet Approved
ProgesteroneThe metabolism of Progesterone can be decreased when combined with Trimethoprim.Approved, Vet Approved
ProguanilThe metabolism of Proguanil can be decreased when combined with Trimethoprim.Approved
PromazineThe serum concentration of Promazine can be increased when it is combined with Trimethoprim.Approved, Vet Approved
PromethazineThe serum concentration of Promethazine can be increased when it is combined with Trimethoprim.Approved, Investigational
PropafenoneTrimethoprim may increase the QTc-prolonging activities of Propafenone.Approved
PropericiazineThe serum concentration of Propericiazine can be increased when it is combined with Trimethoprim.Approved, Investigational
PropiopromazineThe serum concentration of Propiopromazine can be increased when it is combined with Trimethoprim.Vet Approved
PropofolThe metabolism of Propofol can be decreased when combined with Trimethoprim.Approved, Investigational, Vet Approved
PrucaloprideThe serum concentration of Prucalopride can be increased when it is combined with Trimethoprim.Approved
PyrimethamineThe metabolism of Trimethoprim can be decreased when combined with Pyrimethamine.Approved, Investigational, Vet Approved
QuazepamThe metabolism of Quazepam can be decreased when combined with Trimethoprim.Approved, Illicit
QuetiapineTrimethoprim may increase the QTc-prolonging activities of Quetiapine.Approved
QuinaprilTrimethoprim may increase the hyperkalemic activities of Quinapril.Approved, Investigational
QuinidineTrimethoprim may increase the QTc-prolonging activities of Quinidine.Approved, Investigational
QuinineTrimethoprim may increase the QTc-prolonging activities of Quinine.Approved
RabeprazoleThe metabolism of Trimethoprim can be decreased when combined with Rabeprazole.Approved, Investigational
RamiprilTrimethoprim may increase the hyperkalemic activities of Ramipril.Approved
RanolazineThe serum concentration of Ranolazine can be increased when it is combined with Trimethoprim.Approved, Investigational
RepaglinideThe metabolism of Repaglinide can be decreased when combined with Trimethoprim.Approved, Investigational
RescinnamineTrimethoprim may increase the hyperkalemic activities of Rescinnamine.Approved
RifabutinThe metabolism of Trimethoprim can be increased when combined with Rifabutin.Approved, Investigational
RifampicinThe metabolism of Trimethoprim can be increased when combined with Rifampicin.Approved
RifapentineThe metabolism of Trimethoprim can be increased when combined with Rifapentine.Approved, Investigational
RifaximinThe serum concentration of Rifaximin can be increased when it is combined with Trimethoprim.Approved, Investigational
RiociguatThe metabolism of Riociguat can be decreased when combined with Trimethoprim.Approved
RivoglitazoneThe metabolism of Rivoglitazone can be decreased when combined with Trimethoprim.Experimental, Investigational
RofecoxibThe metabolism of Rofecoxib can be decreased when combined with Trimethoprim.Approved, Investigational, Withdrawn
RosiglitazoneThe metabolism of Rosiglitazone can be decreased when combined with Trimethoprim.Approved, Investigational
RosuvastatinThe metabolism of Rosuvastatin can be decreased when combined with Trimethoprim.Approved
RucaparibThe metabolism of Trimethoprim can be decreased when combined with Rucaparib.Approved, Investigational
RupatadineThe metabolism of Rupatadine can be decreased when combined with Trimethoprim.Approved
SacubitrilTrimethoprim may increase the hyperkalemic activities of Sacubitril.Approved
Salicylic acidThe metabolism of Salicylic acid can be decreased when combined with Trimethoprim.Approved, Investigational, Vet Approved
SaprisartanTrimethoprim may increase the hyperkalemic activities of Saprisartan.Experimental
SaquinavirThe metabolism of Trimethoprim can be decreased when combined with Saquinavir.Approved, Investigational
SaralasinTrimethoprim may increase the hyperkalemic activities of Saralasin.Investigational
SarilumabThe therapeutic efficacy of Trimethoprim can be decreased when used in combination with Sarilumab.Approved, Investigational
SecobarbitalThe metabolism of Trimethoprim can be increased when combined with Secobarbital.Approved, Vet Approved
SelegilineThe metabolism of Selegiline can be decreased when combined with Trimethoprim.Approved, Investigational, Vet Approved
SelexipagThe metabolism of Selexipag can be decreased when combined with Trimethoprim.Approved
SeratrodastThe metabolism of Seratrodast can be decreased when combined with Trimethoprim.Approved
SertralineThe metabolism of Sertraline can be decreased when combined with Trimethoprim.Approved
SildenafilThe metabolism of Trimethoprim can be decreased when combined with Sildenafil.Approved, Investigational
SilodosinThe serum concentration of Silodosin can be increased when it is combined with Trimethoprim.Approved
SiltuximabThe serum concentration of Trimethoprim can be decreased when it is combined with Siltuximab.Approved, Investigational
SimeprevirThe serum concentration of Trimethoprim can be increased when it is combined with Simeprevir.Approved
SimvastatinThe metabolism of Simvastatin can be decreased when combined with Trimethoprim.Approved
SitagliptinThe metabolism of Sitagliptin can be decreased when combined with Trimethoprim.Approved, Investigational
SitaxentanThe metabolism of Sitaxentan can be decreased when combined with Trimethoprim.Approved, Investigational, Withdrawn
SofosbuvirThe serum concentration of Sofosbuvir can be decreased when it is combined with Trimethoprim.Approved
SorafenibThe metabolism of Trimethoprim can be decreased when combined with Sorafenib.Approved, Investigational
SotalolTrimethoprim may increase the QTc-prolonging activities of Sotalol.Approved
SpiraprilTrimethoprim may increase the hyperkalemic activities of Spirapril.Approved
SpironolactoneTrimethoprim may increase the hyperkalemic activities of Spironolactone.Approved
St. John's WortThe serum concentration of Trimethoprim can be decreased when it is combined with St. John's Wort.Approved, Investigational, Nutraceutical
StiripentolThe serum concentration of Trimethoprim can be increased when it is combined with Stiripentol.Approved
SulfadiazineThe metabolism of Trimethoprim can be decreased when combined with Sulfadiazine.Approved, Investigational, Vet Approved
SulfamethoxazoleThe metabolism of Trimethoprim can be decreased when combined with Sulfamethoxazole.Approved
SulfamoxoleThe metabolism of Sulfamoxole can be decreased when combined with Trimethoprim.Approved
SulfinpyrazoneThe metabolism of Sulfinpyrazone can be decreased when combined with Trimethoprim.Approved
SulfisoxazoleThe metabolism of Trimethoprim can be decreased when combined with Sulfisoxazole.Approved, Vet Approved
SuprofenThe metabolism of Suprofen can be decreased when combined with Trimethoprim.Approved, Withdrawn
TamoxifenThe metabolism of Tamoxifen can be decreased when combined with Trimethoprim.Approved
TapentadolThe metabolism of Tapentadol can be decreased when combined with Trimethoprim.Approved
TasosartanTrimethoprim may increase the hyperkalemic activities of Tasosartan.Approved
TazaroteneThe metabolism of Tazarotene can be decreased when combined with Trimethoprim.Approved, Investigational
TelaprevirThe metabolism of Trimethoprim can be decreased when combined with Telaprevir.Approved, Withdrawn
TelavancinTrimethoprim may increase the QTc-prolonging activities of Telavancin.Approved
TelithromycinThe metabolism of Trimethoprim can be decreased when combined with Telithromycin.Approved
TelmisartanTrimethoprim may increase the hyperkalemic activities of Telmisartan.Approved, Investigational
TemazepamThe metabolism of Temazepam can be decreased when combined with Trimethoprim.Approved, Investigational
TemocaprilTrimethoprim may increase the hyperkalemic activities of Temocapril.Experimental, Investigational
TenoxicamThe metabolism of Tenoxicam can be decreased when combined with Trimethoprim.Approved
TerbinafineThe metabolism of Terbinafine can be decreased when combined with Trimethoprim.Approved, Investigational, Vet Approved
TerfenadineThe metabolism of Terfenadine can be decreased when combined with Trimethoprim.Approved, Withdrawn
TeriflunomideThe metabolism of Trimethoprim can be decreased when combined with Teriflunomide.Approved
TestosteroneThe metabolism of Testosterone can be decreased when combined with Trimethoprim.Approved, Investigational
Testosterone cypionateThe metabolism of Testosterone cypionate can be decreased when combined with Trimethoprim.Approved
Testosterone enanthateThe metabolism of Testosterone enanthate can be decreased when combined with Trimethoprim.Approved
Testosterone undecanoateThe metabolism of Testosterone undecanoate can be decreased when combined with Trimethoprim.Approved, Investigational
TetrabenazineTrimethoprim may increase the QTc-prolonging activities of Tetrabenazine.Approved, Investigational
ThalidomideThe metabolism of Thalidomide can be decreased when combined with Trimethoprim.Approved, Investigational, Withdrawn
TheophyllineThe metabolism of Theophylline can be decreased when combined with Trimethoprim.Approved
ThiamylalThe metabolism of Thiamylal can be decreased when combined with Trimethoprim.Approved, Vet Approved
ThiazinamThe serum concentration of Thiazinam can be increased when it is combined with Trimethoprim.Experimental
ThiethylperazineThe serum concentration of Thiethylperazine can be increased when it is combined with Trimethoprim.Withdrawn
ThioproperazineThe serum concentration of Thioproperazine can be increased when it is combined with Trimethoprim.Approved
ThioridazineTrimethoprim may increase the QTc-prolonging activities of Thioridazine.Approved, Withdrawn
TicagrelorThe metabolism of Trimethoprim can be decreased when combined with Ticagrelor.Approved
TiclopidineThe metabolism of Trimethoprim can be decreased when combined with Ticlopidine.Approved
TocilizumabThe serum concentration of Trimethoprim can be decreased when it is combined with Tocilizumab.Approved
TolbutamideThe metabolism of Trimethoprim can be decreased when combined with Tolbutamide.Approved, Investigational
TolterodineThe metabolism of Tolterodine can be decreased when combined with Trimethoprim.Approved, Investigational
TopiroxostatThe metabolism of Trimethoprim can be decreased when combined with Topiroxostat.Approved, Investigational
TopotecanThe serum concentration of Topotecan can be increased when it is combined with Trimethoprim.Approved, Investigational
TorasemideThe metabolism of Torasemide can be decreased when combined with Trimethoprim.Approved
ToremifeneTrimethoprim may increase the QTc-prolonging activities of Toremifene.Approved, Investigational
TrabectedinThe metabolism of Trabectedin can be decreased when combined with Trimethoprim.Approved, Investigational
TrandolaprilTrimethoprim may increase the hyperkalemic activities of Trandolapril.Approved
TreprostinilThe metabolism of Treprostinil can be decreased when combined with Trimethoprim.Approved, Investigational
TretinoinThe metabolism of Tretinoin can be decreased when combined with Trimethoprim.Approved, Investigational, Nutraceutical
TrifluoperazineThe serum concentration of Trifluoperazine can be increased when it is combined with Trimethoprim.Approved, Investigational
TriflupromazineThe serum concentration of Triflupromazine can be increased when it is combined with Trimethoprim.Approved, Vet Approved
TrimethadioneThe metabolism of Trimethadione can be decreased when combined with Trimethoprim.Approved
TrimipramineThe metabolism of Trimipramine can be decreased when combined with Trimethoprim.Approved
TroglitazoneThe metabolism of Troglitazone can be decreased when combined with Trimethoprim.Investigational, Withdrawn
ValdecoxibThe metabolism of Valdecoxib can be decreased when combined with Trimethoprim.Approved, Investigational, Withdrawn
Valproic AcidThe metabolism of Trimethoprim can be decreased when combined with Valproic Acid.Approved, Investigational
ValsartanTrimethoprim may increase the hyperkalemic activities of Valsartan.Approved, Investigational
VandetanibTrimethoprim may increase the QTc-prolonging activities of Vandetanib.Approved
VareniclineThe serum concentration of Varenicline can be increased when it is combined with Trimethoprim.Approved, Investigational
VelpatasvirThe metabolism of Velpatasvir can be decreased when combined with Trimethoprim.Approved, Investigational
VemurafenibThe risk or severity of QTc prolongation can be increased when Vemurafenib is combined with Trimethoprim.Approved
VenlafaxineThe metabolism of Trimethoprim can be decreased when combined with Venlafaxine.Approved
VerapamilThe metabolism of Trimethoprim can be decreased when combined with Verapamil.Approved
VicrivirocThe metabolism of Vicriviroc can be decreased when combined with Trimethoprim.Investigational
VincristineThe serum concentration of Vincristine can be decreased when it is combined with Trimethoprim.Approved, Investigational
VismodegibThe metabolism of Vismodegib can be decreased when combined with Trimethoprim.Approved, Investigational
VoriconazoleThe metabolism of Trimethoprim can be decreased when combined with Voriconazole.Approved, Investigational
VortioxetineThe metabolism of Vortioxetine can be decreased when combined with Trimethoprim.Approved, Investigational
VoxilaprevirThe metabolism of Voxilaprevir can be decreased when combined with Trimethoprim.Approved, Investigational
WarfarinThe metabolism of Warfarin can be decreased when combined with Trimethoprim.Approved
XimelagatranThe metabolism of Ximelagatran can be decreased when combined with Trimethoprim.Approved, Investigational, Withdrawn
ZafirlukastThe metabolism of Trimethoprim can be decreased when combined with Zafirlukast.Approved, Investigational
ZalcitabineThe metabolism of Zalcitabine can be decreased when combined with Trimethoprim.Approved, Investigational
ZaltoprofenThe metabolism of Zaltoprofen can be decreased when combined with Trimethoprim.Approved, Investigational
ZidovudineThe metabolism of Zidovudine can be decreased when combined with Trimethoprim.Approved
ZileutonThe metabolism of Zileuton can be decreased when combined with Trimethoprim.Approved, Investigational, Withdrawn
ZiprasidoneTrimethoprim may increase the QTc-prolonging activities of Ziprasidone.Approved
ZofenoprilTrimethoprim may increase the hyperkalemic activities of Zofenopril.Experimental
ZolpidemThe metabolism of Zolpidem can be decreased when combined with Trimethoprim.Approved
ZopicloneThe metabolism of Zopiclone can be decreased when combined with Trimethoprim.Approved
ZuclopenthixolTrimethoprim may increase the QTc-prolonging activities of Zuclopenthixol.Approved, Investigational
Food Interactions
  • Do not take calcium, aluminium, magnesium or iron supplements within 2 hours of taking this medication.
  • Take on empty stomach: 1 hour before or 2 hours after meals.
  • Take with a full glass of water.


Synthesis Reference

Yasushi Takagishi, Kiichiro Ohsuga, Sadao Ohama, "Suppository containing sulfamethoxazole/trimethoprim complex and process for preparing the same." U.S. Patent US4461765, issued December, 1975.

General References
  1. Brumfitt W, Hamilton-Miller JM: Reassessment of the rationale for the combinations of sulphonamides with diaminopyrimidines. J Chemother. 1993 Dec;5(6):465-9. [PubMed:8195839]
  2. Brumfitt W, Hamilton-Miller JM: Limitations of and indications for the use of co-trimoxazole. J Chemother. 1994 Feb;6(1):3-11. [PubMed:8071675]
  3. Bean DC, Livermore DM, Papa I, Hall LM: Resistance among Escherichia coli to sulphonamides and other antimicrobials now little used in man. J Antimicrob Chemother. 2005 Nov;56(5):962-4. Epub 2005 Sep 8. [PubMed:16150859]
  4. Felmingham D, Reinert RR, Hirakata Y, Rodloff A: Increasing prevalence of antimicrobial resistance among isolates of Streptococcus pneumoniae from the PROTEKT surveillance study, and compatative in vitro activity of the ketolide, telithromycin. J Antimicrob Chemother. 2002 Sep;50 Suppl S1:25-37. [PubMed:12239226]
  5. Johnson JR, Manges AR, O'Bryan TT, Riley LW: A disseminated multidrug-resistant clonal group of uropathogenic Escherichia coli in pyelonephritis. Lancet. 2002 Jun 29;359(9325):2249-51. [PubMed:12103291]
External Links
Human Metabolome Database
KEGG Compound
PubChem Compound
PubChem Substance
Therapeutic Targets Database
RxList Drug Page Drug Page
ATC Codes
J01EE05 — Sulfadimidine and trimethoprimJ01EA01 — TrimethoprimJ01EE01 — Sulfamethoxazole and trimethoprimJ01EE07 — Sulfamerazine and trimethoprimJ01EE03 — Sulfametrole and trimethoprimJ01EE02 — Sulfadiazine and trimethoprimJ01EE04 — Sulfamoxole and trimethoprim
AHFS Codes
  • 08:36.00 — Urinary Anti-infectives
PDB Entries
1dg5 / 1dyr / 2bfm / 2w3a / 2w3v / 2w9g / 2w9h / 2w9s / 3fl9 / 3frb
show 9 more
FDA label
Download (98.5 KB)
Download (74.3 KB)

Clinical Trials

Clinical Trials
1Active Not RecruitingOtherBacterial Infections1
1Active Not RecruitingTreatmentAnaplastic Astrocytoma (AA) / Astrocytic Tumors / Glioblastoma Multiforme (GBM) / Neoplasms, Brain1
1CompletedBasic ScienceOxidative Stress1
1CompletedTreatmentHuman Immunodeficiency Virus (HIV) Infections / Pneumonia, Pneumocystis Carinii1
1, 2CompletedTreatmentInfection, Human Immunodeficiency Virus I / Pf Subclinical Parasitemia1
1, 2CompletedTreatmentKidney Diseases / Transplant, Kidney / Transplantation, Kidney / Transplantation, Renal1
1, 2WithdrawnSupportive CareChronic Myeloproliferative Disorders / Infection NOS / Leukemias / Lymphoproliferative Disorders / Malignant Lymphomas / Multiple Myeloma and Plasma Cell Neoplasm / Myelodysplastic Syndromes / Myelodysplastic/Myeloproliferative Neoplasms / Unspecified Adult Solid Tumor, Protocol Specific1
2CompletedNot AvailableTuberculosis1
2CompletedTreatmentCystic Fibrosis (CF)1
2CompletedTreatmentCystic Fibrosis (CF) / Methicillin-Resistant Staphylococcus Aureus (MRSA)1
2CompletedTreatmentDiabetes Mellitus, Insulin-Dependent1
2CompletedTreatmentEpidermolysis Bullosa1
2CompletedTreatmentMalignant Lymphomas1
2CompletedTreatmentUrinary Tract Infections (UTIs)1
2RecruitingPreventionProstate Infections1
2RecruitingTreatmentAtopic Dermatitis (AD)1
2RecruitingTreatmentCommunity-acquired Methicillin-resistant Staphylococcus Aureus Infection / Community-Acquired MRSA Infections1
2RecruitingTreatmentCystic Fibrosis (CF)1
2RecruitingTreatmentInfection NOS / Multiple Myeloma (MM)1
2RecruitingTreatmentUrinary Tract Infections (UTIs)1
2TerminatedTreatmentEnd-Stage Renal Disease (ESRD)1
2Unknown StatusTreatmentHip Prosthetic Joint Infection1
2WithdrawnTreatmentRecurrent Urinary Tract Infections1
2, 3TerminatedPreventionHuman Immunodeficiency Virus (HIV) Infections / Pneumonia, Interstitial Plasma Cell / Tuberculosis1
2, 3Unknown StatusTreatmentPneumonia, Pneumocystis / Prevention & Control1
3CompletedPreventionLife-threatening Infection / Nutrition Disorders1
3CompletedPreventionUrinary Tract Infections (UTIs) / Vesicoureteral Reflux1
3CompletedSupportive CareInfection NOS / Multiple Myeloma (MM)1
3CompletedTreatmentAntibiotics / Chronic Obstructive Pulmonary Disease (COPD) / Sepsis1
3CompletedTreatmentHuman Immunodeficiency Virus (HIV) Infections / Pneumonia, Pneumocystis Carinii1
3CompletedTreatmentRecurrent Urinary Tract Infections1
3Not Yet RecruitingTreatmentChronic Rhinosinusitis (Diagnosis)1
3RecruitingPreventionChronic Kidney Disease (CKD) / Renal Hypodysplasia, Nonsyndromic, 1 / Vesicoureteral Reflux1
3RecruitingTreatmentEnterobacteriaceae Infections1
3TerminatedPreventionMalaria in Pregnancy1
3TerminatedTreatmentHuman Immunodeficiency Virus (HIV) Infections / Pneumonia, Interstitial Plasma Cell / Pneumonia, Pneumocystis Carinii1
4CompletedPreventionAcquired Immune Deficiency Syndrome (AIDS) / Anemias / Human Immunodeficiency Virus (HIV) Infections / Neutropenias / Newborn Infants1
4CompletedPreventionAsymptomatic Bacteriuria / Urinary Tract Infections (UTIs)1
4CompletedPreventionPyelonephritis / Renal Scars1
4CompletedTreatmentBMI >30 kg/m2 / MRSA / PCP / Pharmacokinetics / Tuberculosis1
4CompletedTreatmentHuman Immunodeficiency Virus (HIV)1
4CompletedTreatmentSkin Diseases, Infectious1
4Not Yet RecruitingPreventionOveractive Bladder / Urinary Tract Infections (UTIs)1
4RecruitingPreventionUrinary Tract Infections, Recurrent1
4WithdrawnPreventionComplications; Breast Prosthesis, Infection or Inflammation1
4WithdrawnTreatmentPneumonia, Pneumocystis Carinii1
Not AvailableActive Not RecruitingPreventionHuman Immunodeficiency Virus (HIV)1
Not AvailableActive Not RecruitingTreatmentHydronephrosis / Urinary Tract Infections (UTIs)1
Not AvailableActive Not RecruitingTreatmentHypospadias1
Not AvailableActive Not RecruitingTreatmentUrinary Tract Infections (UTIs)1
Not AvailableCompletedNot AvailableBronchitis2
Not AvailableCompletedTreatmentAbscesses1
Not AvailableCompletedTreatmentAbscesses / Infections caused by penicillinase-producing staphylococci1
Not AvailableCompletedTreatmentAbscesses / Skin Diseases, Bacterial1
Not AvailableCompletedTreatmentCellulitis1
Not AvailableCompletedTreatmentEnd-Stage Renal Disease (ESRD)1
Not AvailableCompletedTreatmentHuman Immunodeficiency Virus (HIV) Infections / Pneumonia, Pneumocystis Carinii2
Not AvailableCompletedTreatmentScleral Buckling1
Not AvailableNo Longer AvailableNot AvailableDiabetes, Diabetes Mellitus Type 11
Not AvailableRecruitingPreventionMotility Disorders / Staphylococcus Aureus1
Not AvailableRecruitingPreventionUrolithiasis / UTI1
Not AvailableRecruitingTreatmentLiver Abscess, Pyogenic1
Not AvailableTerminatedNot AvailablePrescribers' Drug Orders1
Not AvailableTerminatedPreventionCatheter-Associated Urinary Tract Infection1
Not AvailableUnknown StatusNot AvailableAsymptomatic Infections / Bacteriuria / Transplantation Infection / Urinary Tract Infections (UTIs)1
Not AvailableUnknown StatusPreventionUreteric Stent After Stone Surgery1
Not AvailableUnknown StatusTreatmentAbscesses1
Not AvailableWithdrawnTreatmentAbscesses1


  • Monarch pharmaceuticals inc
  • Mutual pharmaceutical co inc
  • Teva pharmaceuticals usa inc
  • Watson laboratories inc
  • Hoffmann la roche inc
  • Fsc laboratories inc
  • Actavis Group
  • Advanced Pharmaceutical Services Inc.
  • Aidarex Pharmacuticals LLC
  • Akorn Inc.
  • Alcon Laboratories
  • Allergan Inc.
  • Amerisource Health Services Corp.
  • Amneal Pharmaceuticals
  • Apotheca Inc.
  • Apothecon
  • A-S Medication Solutions LLC
  • Ascent Pediatrics Inc.
  • Atlantic Biologicals Corporation
  • Aurobindo Pharma Ltd.
  • Avkare Incorporated
  • Bausch & Lomb Inc.
  • Baxter International Inc.
  • Bryant Ranch Prepack
  • Cardinal Health
  • Carlisle Laboratories Inc.
  • Casa De Amigos Pharmacy
  • Central Texas Community Health Centers
  • Comprehensive Consultant Services Inc.
  • Coupler Enterprises Inc.
  • Darby Dental Supply Co. Inc.
  • Dept Health Central Pharmacy
  • Direct Dispensing Inc.
  • Dispensing Solutions
  • Diversified Healthcare Services Inc.
  • Eon Labs
  • Falcon Pharmaceuticals Ltd.
  • FSC Laboratories
  • Golden State Medical Supply Inc.
  • Greenstone LLC
  • Group Health Cooperative
  • H.J. Harkins Co. Inc.
  • Heartland Repack Services LLC
  • Hi Tech Pharmacal Co. Inc.
  • Innovative Manufacturing and Distribution Services Inc.
  • Innoviant Pharmacy Inc.
  • Kaiser Foundation Hospital
  • Keltman Pharmaceuticals Inc.
  • King Pharmaceuticals Inc.
  • Laboratoires Docteur Pierre Ricaud
  • Lake Erie Medical and Surgical Supply
  • Lark Pharmaceuticals Inc.
  • Liberty Pharmaceuticals
  • Long Island Pharmacal
  • Lyne Laboratories Inc.
  • Major Pharmaceuticals
  • Mckesson Corp.
  • Medisca Inc.
  • Medvantx Inc.
  • Midland Healthcare LLC
  • Midland Pharmaceutical LLC
  • Monarch Pharmacy
  • Murfreesboro Pharmaceutical Nursing Supply
  • Mutual Pharmaceutical Co.
  • Novopharm Ltd.
  • Nucare Pharmaceuticals Inc.
  • Pacific Pharma Lp
  • Palmetto Pharmaceuticals Inc.
  • Patient First Corp.
  • PD-Rx Pharmaceuticals Inc.
  • Pfizer Animal Health
  • Pfizer Inc.
  • Pharmaceutical Association
  • Pharmaceutical Utilization Management Program VA Inc.
  • Pharmacia Inc.
  • Pharmedix
  • Physicians Total Care Inc.
  • Pliva Inc.
  • Preferred Pharmaceuticals Inc.
  • Prepackage Specialists
  • Prepak Systems Inc.
  • Prescript Pharmaceuticals
  • Qualitest
  • Rebel Distributors Corp.
  • Redpharm Drug
  • Remedy Repack
  • Resource Optimization and Innovation LLC
  • Sandhills Packaging Inc.
  • Sandoz
  • Sicor Pharmaceuticals
  • Southwood Pharmaceuticals
  • St Mary's Medical Park Pharmacy
  • Stat Scripts LLC
  • Talbert Medical Management Corp.
  • Taro Pharmaceuticals USA
  • Taylor Pharmaceuticals
  • Teva Pharmaceutical Industries Ltd.
  • Tya Pharmaceuticals
  • UDL Laboratories
  • United Research Laboratories Inc.
  • Va Cmop Dallas
  • Vangard Labs Inc.
  • Vintage Pharmaceuticals Inc.
  • Vista Pharmaceuticals Inc.
  • Watson Pharmaceuticals
  • Women First Healthcare Inc.
  • Xactdose Inc.
Dosage forms
Solution / dropsOphthalmic
SolutionOral50 mg/5mL
Injection, solution, concentrateIntravenous
TabletOral100 mg/1
TabletOral100 mg
TabletOral200 mg
Unit descriptionCostUnit
Bactrim ds tablet5.53USD tablet
Bactrim DS 800-160 mg tablet3.0USD tablet
Septra DS 800-160 mg tablet2.43USD tablet
Septra ds tablet2.33USD tablet
Trimethoprim powder1.79USD g
Bactrim 400-80 mg tablet1.63USD tablet
Septra 80-400 tablet1.49USD tablet
Sulfamethoxazole-tmp ds tablet1.44USD tablet
Sulfamethoxazole-tmp vial0.84USD ml
Trimethoprim 100 mg tablet0.7USD tablet
Sulfamethoxazole-Trimethoprim 400-80 mg tablet0.69USD tablet
Apo-Trimethoprim 200 mg Tablet0.55USD tablet
Primsol 50 mg/5 ml oral soln0.39USD ml
Apo-Trimethoprim 100 mg Tablet0.27USD tablet
Sulfamethoxazole-tmp ss tablet0.17USD tablet
Sulfamethoxazole-Trimethoprim 200-40 mg/5ml Suspension0.13USD ml
Sulfatrim 200-40 mg/5ml Suspension0.13USD ml
DrugBank does not sell nor buy drugs. Pricing information is supplied for informational purposes only.
Patent NumberPediatric ExtensionApprovedExpires (estimated)


Experimental Properties
melting point (°C)199-203 °CPhysProp
water solubility400 mg/L (at 25 °C)YALKOWSKY,SH & DANNENFELSER,RM (1992)
logP0.91HANSCH,C ET AL. (1995)
logS-2.86ADME Research, USCD
pKa7.12 (at 20 °C)PERRIN,DD (1972)
Predicted Properties
Water Solubility0.615 mg/mLALOGPS
pKa (Strongest Acidic)17.33ChemAxon
pKa (Strongest Basic)7.16ChemAxon
Physiological Charge1ChemAxon
Hydrogen Acceptor Count7ChemAxon
Hydrogen Donor Count2ChemAxon
Polar Surface Area105.51 Å2ChemAxon
Rotatable Bond Count5ChemAxon
Refractivity81.51 m3·mol-1ChemAxon
Polarizability29.71 Å3ChemAxon
Number of Rings2ChemAxon
Rule of FiveYesChemAxon
Ghose FilterYesChemAxon
Veber's RuleNoChemAxon
MDDR-like RuleNoChemAxon
Predicted ADMET features
Human Intestinal Absorption+0.994
Blood Brain Barrier+0.9381
Caco-2 permeable+0.8867
P-glycoprotein substrateNon-substrate0.5845
P-glycoprotein inhibitor INon-inhibitor0.8631
P-glycoprotein inhibitor IINon-inhibitor0.8382
Renal organic cation transporterNon-inhibitor0.8531
CYP450 2C9 substrateNon-substrate0.8799
CYP450 2D6 substrateNon-substrate0.9116
CYP450 3A4 substrateNon-substrate0.5732
CYP450 1A2 substrateNon-inhibitor0.9046
CYP450 2C9 inhibitorNon-inhibitor0.9071
CYP450 2D6 inhibitorNon-inhibitor0.9231
CYP450 2C19 inhibitorNon-inhibitor0.9025
CYP450 3A4 inhibitorNon-inhibitor0.8467
CYP450 inhibitory promiscuityHigh CYP Inhibitory Promiscuity0.5
Ames testNon AMES toxic0.8227
BiodegradationNot ready biodegradable0.9949
Rat acute toxicity1.7701 LD50, mol/kg Not applicable
hERG inhibition (predictor I)Weak inhibitor0.9394
hERG inhibition (predictor II)Non-inhibitor0.8734
ADMET data is predicted using admetSAR, a free tool for evaluating chemical ADMET properties. (23092397)


Mass Spec (NIST)
Not Available
SpectrumSpectrum TypeSplash Key
Predicted GC-MS Spectrum - GC-MSPredicted GC-MSNot Available
GC-MS Spectrum - EI-BGC-MSsplash10-0006-5390000000-e68103f64cbb997e5776
Predicted MS/MS Spectrum - 10V, Positive (Annotated)Predicted LC-MS/MSNot Available
Predicted MS/MS Spectrum - 20V, Positive (Annotated)Predicted LC-MS/MSNot Available
Predicted MS/MS Spectrum - 40V, Positive (Annotated)Predicted LC-MS/MSNot Available
Predicted MS/MS Spectrum - 10V, Negative (Annotated)Predicted LC-MS/MSNot Available
Predicted MS/MS Spectrum - 20V, Negative (Annotated)Predicted LC-MS/MSNot Available
Predicted MS/MS Spectrum - 40V, Negative (Annotated)Predicted LC-MS/MSNot Available
LC-MS/MS Spectrum - LC-ESI-qTof , PositiveLC-MS/MSNot Available
LC-MS/MS Spectrum - LC-ESI-ITFT , positiveLC-MS/MSsplash10-0089-0290000000-32000410829186ca112c
LC-MS/MS Spectrum - LC-ESI-ITFT , positiveLC-MS/MSsplash10-0006-0090000000-44ccaa9725303a7db8a4
LC-MS/MS Spectrum - LC-ESI-ITFT , positiveLC-MS/MSsplash10-0006-0090000000-af77a44791c8867aad66
LC-MS/MS Spectrum - LC-ESI-ITFT , positiveLC-MS/MSsplash10-0006-0190000000-8eb1449e3f800368c863
LC-MS/MS Spectrum - LC-ESI-ITFT , positiveLC-MS/MSsplash10-03n9-0190000000-deb1664d211c2227b048
LC-MS/MS Spectrum - LC-ESI-ITFT , positiveLC-MS/MSsplash10-077i-0590000000-ae48b54f4879c1551670
LC-MS/MS Spectrum - LC-ESI-ITFT , positiveLC-MS/MSsplash10-0089-1950000000-5084ea4b328a585b675d
LC-MS/MS Spectrum - LC-ESI-ITFT , positiveLC-MS/MSsplash10-0006-0090000000-fb9fa4e4130917b6e6ff
LC-MS/MS Spectrum - LC-ESI-ITFT , positiveLC-MS/MSsplash10-0006-0090000000-15d83f92b30f466cd587
LC-MS/MS Spectrum - LC-ESI-ITFT , positiveLC-MS/MSsplash10-0006-0190000000-f95e0c038a6aa70dc02e
LC-MS/MS Spectrum - LC-ESI-ITFT , positiveLC-MS/MSsplash10-03na-0190000000-72c88d8f9739c7d29714
LC-MS/MS Spectrum - LC-ESI-ITFT , positiveLC-MS/MSsplash10-077i-0590000000-9c0f5662b9713adab9cb
LC-MS/MS Spectrum - LC-ESI-ITFT , positiveLC-MS/MSsplash10-0089-1950000000-8b16041ba3b127d299ba
LC-MS/MS Spectrum - LC-ESI-ITFT , positiveLC-MS/MSsplash10-0089-0290000000-6a16da6c03a03fd87f34
LC-MS/MS Spectrum - LC-ESI-QQ , positiveLC-MS/MSsplash10-0006-0090000000-145bf44afce31ab82f64
LC-MS/MS Spectrum - LC-ESI-QQ , positiveLC-MS/MSsplash10-0006-0090000000-68ca013641f0c338b3a2
LC-MS/MS Spectrum - LC-ESI-QQ , positiveLC-MS/MSsplash10-008c-0290000000-d56028ecf88d373b83bd
LC-MS/MS Spectrum - LC-ESI-QQ , positiveLC-MS/MSsplash10-03n9-0590000000-15246e14a33089adf87d
LC-MS/MS Spectrum - LC-ESI-QQ , positiveLC-MS/MSsplash10-0230-1950000000-83b1288780d0f8f7b8a4
LC-MS/MS Spectrum - LC-ESI-IT , positiveLC-MS/MSsplash10-00e9-0690000000-693e14cc9adc7eb2f25a
LC-MS/MS Spectrum - LC-ESI-ITFT , positiveLC-MS/MSsplash10-01si-0190000000-1cf9183ddf2bfed27ff3
LC-MS/MS Spectrum - LC-ESI-ITFT , positiveLC-MS/MSsplash10-0259-0590000000-114c45037d358307bf34
LC-MS/MS Spectrum - LC-ESI-ITFT , positiveLC-MS/MSsplash10-0006-0190000000-ef1516809b4a9fc2cb85
LC-MS/MS Spectrum - LC-ESI-ITFT , positiveLC-MS/MSsplash10-0089-0290000000-a1cc2a930cf072c3aa11
MS/MS Spectrum - , positiveLC-MS/MSsplash10-0006-0190000000-0fa04011b512afabef25
MS/MS Spectrum - , positiveLC-MS/MSsplash10-0006-0090000000-2e8d981761670d12c381
MS/MS Spectrum - , positiveLC-MS/MSsplash10-03na-2690000000-39babdc7b45a0aa0adf7


This compound belongs to the class of organic compounds known as anisoles. These are organic compounds containing a methoxybenzene or a derivative thereof.
Organic compounds
Super Class
Phenol ethers
Sub Class
Direct Parent
Alternative Parents
Phenoxy compounds / Methoxybenzenes / Aminopyrimidines and derivatives / Alkyl aryl ethers / Imidolactams / Heteroaromatic compounds / Azacyclic compounds / Primary amines / Organopnictogen compounds / Hydrocarbon derivatives
Phenoxy compound / Anisole / Methoxybenzene / Alkyl aryl ether / Aminopyrimidine / Monocyclic benzene moiety / Pyrimidine / Imidolactam / Heteroaromatic compound / Organoheterocyclic compound
Molecular Framework
Aromatic heteromonocyclic compounds
External Descriptors
aminopyrimidine, methoxybenzene (CHEBI:45924) / a small molecule (CPD0-1581)


Pharmacological action
General Function
Thymidylate synthase activity
Specific Function
Contributes to the de novo mitochondrial thymidylate biosynthesis pathway.
Gene Name
Uniprot ID
Uniprot Name
Thymidylate synthase
Molecular Weight
35715.65 Da
  1. Overington JP, Al-Lazikani B, Hopkins AL: How many drug targets are there? Nat Rev Drug Discov. 2006 Dec;5(12):993-6. [PubMed:17139284]
  2. Imming P, Sinning C, Meyer A: Drugs, their targets and the nature and number of drug targets. Nat Rev Drug Discov. 2006 Oct;5(10):821-34. [PubMed:17016423]
  3. Gamarro F, Yu PL, Zhao J, Edman U, Greene PJ, Santi D: Trypanosoma brucei dihydrofolate reductase-thymidylate synthase: gene isolation and expression and characterization of the enzyme. Mol Biochem Parasitol. 1995 Jun;72(1-2):11-22. [PubMed:8538681]
  4. Rosowsky A, Papoulis AT, Forsch RA, Queener SF: Synthesis and antiparasitic and antitumor activity of 2, 4-diamino-6-(arylmethyl)-5,6,7,8-tetrahydroquinazoline analogues of piritrexim. J Med Chem. 1999 Mar 25;42(6):1007-17. [PubMed:10090784]
  5. Reche P, Arrebola R, Santi DV, Gonzalez-Pacanowska D, Ruiz-Perez LM: Expression and characterization of the Trypanosoma cruzi dihydrofolate reductase domain. Mol Biochem Parasitol. 1996 Feb-Mar;76(1-2):175-85. [PubMed:8920005]
  6. Oefner C, Parisi S, Schulz H, Lociuro S, Dale GE: Inhibitory properties and X-ray crystallographic study of the binding of AR-101, AR-102 and iclaprim in ternary complexes with NADPH and dihydrofolate reductase from Staphylococcus aureus. Acta Crystallogr D Biol Crystallogr. 2009 Aug;65(Pt 8):751-7. doi: 10.1107/S0907444909013936. Epub 2009 Jul 10. [PubMed:19622858]
  7. Berman HM, Westbrook J, Feng Z, Gilliland G, Bhat TN, Weissig H, Shindyalov IN, Bourne PE: The Protein Data Bank. Nucleic Acids Res. 2000 Jan 1;28(1):235-42. [PubMed:10592235]
2. Dihydrofolate reductase
Pharmacological action
General Function
Nadph binding
Specific Function
Key enzyme in folate metabolism. Contributes to the de novo mitochondrial thymidylate biosynthesis pathway. Catalyzes an essential reaction for de novo glycine and purine synthesis, and for DNA pre...
Gene Name
Uniprot ID
Uniprot Name
Dihydrofolate reductase
Molecular Weight
21452.61 Da
  1. Laskowska E, Kuczynska-Wisnik D, Bak M, Lipinska B: Trimethoprim induces heat shock proteins and protein aggregation in E. coli cells. Curr Microbiol. 2003 Oct;47(4):286-9. [PubMed:14629008]
  2. Floris-Moore MA, Amodio-Groton MI, Catalano MT: Adverse reactions to trimethoprim/sulfamethoxazole in AIDS. Ann Pharmacother. 2003 Dec;37(12):1810-3. [PubMed:14632594]
  3. Rosowsky A, Fu H, Chan DC, Queener SF: Synthesis of 2,4-diamino-6-[2'-O-(omega-carboxyalkyl)oxydibenz[b,f]azepin-5-yl]methylpteridine s as potent and selective inhibitors of Pneumocystis carinii, Toxoplasma gondii, and Mycobacterium avium dihydrofolate reductase. J Med Chem. 2004 May 6;47(10):2475-85. [PubMed:15115391]
  4. Nahimana A, Rabodonirina M, Bille J, Francioli P, Hauser PM: Mutations of Pneumocystis jirovecii dihydrofolate reductase associated with failure of prophylaxis. Antimicrob Agents Chemother. 2004 Nov;48(11):4301-5. [PubMed:15504856]
  5. Barrow EW, Bourne PC, Barrow WW: Functional cloning of Bacillus anthracis dihydrofolate reductase and confirmation of natural resistance to trimethoprim. Antimicrob Agents Chemother. 2004 Dec;48(12):4643-9. [PubMed:15561838]
  6. Chen X, Ji ZL, Chen YZ: TTD: Therapeutic Target Database. Nucleic Acids Res. 2002 Jan 1;30(1):412-5. [PubMed:11752352]


Pharmacological action
General Function
Steroid hydroxylase activity
Specific Function
Cytochromes P450 are a group of heme-thiolate monooxygenases. In liver microsomes, this enzyme is involved in an NADPH-dependent electron transport pathway. It oxidizes a variety of structurally un...
Gene Name
Uniprot ID
Uniprot Name
Cytochrome P450 2C9
Molecular Weight
55627.365 Da
  1. Preissner S, Kroll K, Dunkel M, Senger C, Goldsobel G, Kuzman D, Guenther S, Winnenburg R, Schroeder M, Preissner R: SuperCYP: a comprehensive database on Cytochrome P450 enzymes including a tool for analysis of CYP-drug interactions. Nucleic Acids Res. 2010 Jan;38(Database issue):D237-43. doi: 10.1093/nar/gkp970. Epub 2009 Nov 24. [PubMed:19934256]
Pharmacological action
General Function
Vitamin d3 25-hydroxylase activity
Specific Function
Cytochromes P450 are a group of heme-thiolate monooxygenases. In liver microsomes, this enzyme is involved in an NADPH-dependent electron transport pathway. It performs a variety of oxidation react...
Gene Name
Uniprot ID
Uniprot Name
Cytochrome P450 3A4
Molecular Weight
57342.67 Da
  1. Preissner S, Kroll K, Dunkel M, Senger C, Goldsobel G, Kuzman D, Guenther S, Winnenburg R, Schroeder M, Preissner R: SuperCYP: a comprehensive database on Cytochrome P450 enzymes including a tool for analysis of CYP-drug interactions. Nucleic Acids Res. 2010 Jan;38(Database issue):D237-43. doi: 10.1093/nar/gkp970. Epub 2009 Nov 24. [PubMed:19934256]
Pharmacological action
General Function
Steroid hydroxylase activity
Specific Function
Cytochromes P450 are a group of heme-thiolate monooxygenases. In liver microsomes, this enzyme is involved in an NADPH-dependent electron transport pathway. It oxidizes a variety of structurally un...
Gene Name
Uniprot ID
Uniprot Name
Cytochrome P450 2C8
Molecular Weight
55824.275 Da
  1. Preissner S, Kroll K, Dunkel M, Senger C, Goldsobel G, Kuzman D, Guenther S, Winnenburg R, Schroeder M, Preissner R: SuperCYP: a comprehensive database on Cytochrome P450 enzymes including a tool for analysis of CYP-drug interactions. Nucleic Acids Res. 2010 Jan;38(Database issue):D237-43. doi: 10.1093/nar/gkp970. Epub 2009 Nov 24. [PubMed:19934256]
  2. Drug Interactions: Cytochrome P450 Drug Interaction Table [Link]


Pharmacological action
General Function
Xenobiotic-transporting atpase activity
Specific Function
Energy-dependent efflux pump responsible for decreased drug accumulation in multidrug-resistant cells.
Gene Name
Uniprot ID
Uniprot Name
Multidrug resistance protein 1
Molecular Weight
141477.255 Da
  1. Romiti N, Tramonti G, Chieli E: Influence of different chemicals on MDR-1 P-glycoprotein expression and activity in the HK-2 proximal tubular cell line. Toxicol Appl Pharmacol. 2002 Sep 1;183(2):83-91. [PubMed:12387747]
  2. Polli JW, Wring SA, Humphreys JE, Huang L, Morgan JB, Webster LO, Serabjit-Singh CS: Rational use of in vitro P-glycoprotein assays in drug discovery. J Pharmacol Exp Ther. 2001 Nov;299(2):620-8. [PubMed:11602674]

Drug created on June 13, 2005 07:24 / Updated on June 24, 2018 20:22