
Logo pink
Are you a
new drug developer?
Contact us to learn more about our customized products and solutions.
Accession Number
DB00440  (APRD00103)
Small Molecule
Approved, Vet approved

Trimethoprim is a pyrimidine inhibitor of dihydrofolate reductase, it is an antibacterial related to pyrimethamine. The interference with folic acid metabolism may cause a depression of hematopoiesis. It is potentiated by sulfonamides and the trimethoprim-sulfamethoxazole combination is the form most often used. It is sometimes used alone as an antimalarial. Trimethoprim resistance has been reported.

  • 2,4-diamino-5-(3,4,5-trimethoxybenzyl)pyrimidine
  • 5-[(3,4,5-trimethoxyphenyl)methyl]-2,4-pyrimidinediamine
  • Trimethoprim
  • Triméthoprime
  • Trimethoprimum
  • Trimetoprima
External IDs
BW 56-72 / BW-56-72 / NIH-204 / NSC-106568 / Ro 6-2153-12 F
Product Ingredients
IngredientUNIICASInChI Key
Trimethoprim hydrochloride9XE000OU9B60834-30-2YLCCEQZHUHUYPA-UHFFFAOYSA-N
Trimethoprim sulfateE377MF8EQ856585-33-2UILMMYFRNCCPLK-UHFFFAOYSA-N
Product Images
Prescription Products
NameDosageStrengthRouteLabellerMarketing StartMarketing End
PrimsolSolution50 mg/5mLOralAytu BioScience, Inc.2015-09-152018-01-01Us
PrimsolSolution50 mg/5mLOralFsc Laboratories, Inc.2000-01-24Not applicableUs
PrimSolSolution50 mg/5mLOralAllegis Holdings, Llc2017-05-04Not applicableUs
ProloprimTablet200 mg/1OralMonarch Pharmaceuticals, Inc.1982-07-142007-01-31Us
ProloprimTablet100 mg/1OralMonarch Pharmaceuticals, Inc.1982-07-142007-01-31Us
Proloprim 200 Tab 200mgTablet200 mgOralGlaxosmithkline Inc1985-12-312004-08-05Canada
Proloprim Tab 100mgTablet100 mgOralGlaxosmithkline Inc1986-12-312003-10-28Canada
TrimethoprimTablet100 mg/1OralMayne Pharma2016-07-18Not applicableUs
TrimethoprimTablet100 mg/1OralTeva1990-09-302017-12-31Us00093 2158 01 nlmimage10 5a2b2d69
TrimethoprimTablet200 mg/1OralTEVA PHARMACEUTICALS USA2006-11-062006-11-06Us
Additional Data Available
  • Application Number
    Application Number

    A unique ID assigned by the FDA when a product is submitted for approval by the labeller.

    Learn more
  • Product Code
    Product Code

    A governmentally-recognized ID which uniquely identifies the product within its regulatory market.

    Learn more
Generic Prescription Products
NameDosageStrengthRouteLabellerMarketing StartMarketing End
TrimethoprimTablet100 mg/1OralActavis Pharma, Inc.2010-04-042019-03-31Us0591 557120180907 15195 15kxnko
TrimethoprimTablet100 mg/1OralCarilion Materials Management2010-04-04Not applicableUs68151 201020180913 8702 1rmesn8
TrimethoprimTablet100 mg/1OralLupin Pharmaceuticals,Inc.2011-06-24Not applicableUs
TrimethoprimTablet100 mg/1OralNovel Laboratories, Inc.2014-03-04Not applicableUs
TrimethoprimTablet100 mg/1OralPD-Rx Pharmaceuticals, Inc.2010-04-04Not applicableUs
TrimethoprimTablet100 mg/1OralRemedy Repack2013-09-242014-09-24Us
TrimethoprimTablet100 mg/1Oralbryant ranch prepack2011-06-24Not applicableUs
TrimethoprimTablet100 mg/1OralPhysicians Total Care, Inc.2012-05-02Not applicableUs00591 5571 01 nlmimage10 e0127053
TrimethoprimTablet100 mg/1OralAvPAK2013-07-312019-03-31Us
TrimethoprimTablet100 mg/1OralAv Kare, Inc.2013-05-06Not applicableUs
Additional Data Available
  • Application Number
    Application Number

    A unique ID assigned by the FDA when a product is submitted for approval by the labeller.

    Learn more
  • Product Code
    Product Code

    A governmentally-recognized ID which uniquely identifies the product within its regulatory market.

    Learn more
Mixture Products
NameIngredientsDosageRouteLabellerMarketing StartMarketing End
Apo Sulfatrim DS TabTrimethoprim (160 mg) + Sulfamethoxazole (800 mg)TabletOralApotex Corporation1979-12-31Not applicableCanada
Apo Sulfatrim PediatricTrimethoprim (20 mg) + Sulfamethoxazole (100 mg)TabletOralApotex Corporation1979-12-31Not applicableCanada
Apo Sulfatrim TabTrimethoprim (80 mg) + Sulfamethoxazole (400 mg)TabletOralApotex Corporation1979-12-31Not applicableCanada
Apo-sulfatrim Oral SuspensionTrimethoprim (8 mg) + Sulfamethoxazole (40 mg)SuspensionOralApotex Corporation1989-12-31Not applicableCanada
BactrimTrimethoprim (80 mg/1) + Sulfamethoxazole (400 mg/1)TabletOralAR Scientific, Inc.2004-11-012018-12-28Us
BactrimTrimethoprim (80 mg/1) + Sulfamethoxazole (400 mg/1)TabletOralSun Pharmaceutical Industries Limited2004-11-01Not applicableUs
Bactrim DSTrimethoprim (160 mg/1) + Sulfamethoxazole (800 mg/1)TabletOralSun Pharmaceutical Industries Limited2004-11-01Not applicableUs
Bactrim DSTrimethoprim (160 mg/1) + Sulfamethoxazole (800 mg/1)TabletOralPhysicians Total Care, Inc.1997-08-26Not applicableUs
Bactrim DSTrimethoprim (160 mg/1) + Sulfamethoxazole (800 mg/1)TabletOralAR Scientific, Inc.2004-11-012018-12-28Us
Bactrim DS Roche TabTrimethoprim (160 mg) + Sulfamethoxazole (800 mg)TabletOralHoffmann La Roche1976-12-312001-07-19Canada
International/Other Brands
Alprim (Alphapharm) / Catin (Kojar) / Eumi (Hwang's) / Inflamnil (Swiss Pharm) / Lannacher (Root) / Lariago (Ipca Laboratories) / Meprim (Johnson) / Metipine (Kojar) / Monotrim (GlaxoSmithKline) / Motrim (Lannacher) / Trimpex / Triprim (GlaxoSmithKline)
CAS number
Average: 290.3177
Monoisotopic: 290.137890462
Chemical Formula
InChI Key



For the treatment of urinary tract infections, uncomplicated pyelonephritis (with sulfamethoxazole) and mild acute prostatitis. May be used as pericoital (with sulfamethoxazole) or continuous prophylaxis in females with recurrent cystitis. May be used as an alternative to treat asymptomatic bacteriuria during pregnancy (only before the last 6 weeks of pregnancy). Other uses include: alternative agent in respiratory tract infections (otitis, sinusitus, bronchitis and pneumonia), treatment of Pneumocystis jirovecii pneumonia (acute or prophylaxis), Nocardia infections, and traveller's diarrhea.

Associated Conditions

Trimethoprim is a pyrimidine analogue that disrupts folate synthesis, an essential part of the thymidine synthesis pathway. Inhibition of the enzyme starves the bacteria of nucleotides necessary for DNA replication.The drug, therefore, exhibits bactericidal activity.

Mechanism of action

Trimethoprim inhibits dihydrofolate reductase. This inhibition prevents the conversion of dihydrofolic acid (DHF) to tetrahydrofolic acid (THF) in the thymidine synthesis pathway. Trimethoprim acts on bacterial dihydrofolate reductase with thousands of times the affinity of human dihydrofolate reductase.

Sulfamethoxazole inhibits dihydrofolate synthetase (aka dihydropteroate synthetase), an enzyme involved further upstream in the same pathway. Trimethoprim and sulfamethoxazole are commonly used in combination due to their synergistic effects. This drug combination also reduces the development of resistance that is seen when either drug is used alone.

AThymidylate synthase
NDihydrofolate reductase
Additional Data Available
Adverse Effects

Comprehensive structured data on known drug adverse effects with statistical prevalence. MedDRA and ICD10 ids are provided for adverse effect conditions and symptoms.

Learn more
Additional Data Available

Structured data covering drug contraindications. Each contraindication describes a scenario in which the drug is not to be used. Includes restrictions on co-administration, contraindicated populations, and more.

Learn more
Additional Data Available
Blackbox Warnings

Structured data representing warnings from the black box section of drug labels. These warnings cover important and dangerous risks, contraindications, or adverse effects.

Learn more

Readily and almost completely absorbed in the GI tract with peak serum concentrations attained 1-4 hours after oral administration. Widely distributed to tissues and fluids including kidney, lung, seminal fluid, aqueous humour, middle ear fluid, sputum, vaginal secretions, bile, bone and CSF.

Volume of distribution
Not Available
Protein binding

42-46% bound to plasma proteins


Hepatic metabolism to oxide and hydroxylated metabolites.

Route of elimination

Ten to twenty percent of trimethoprim is metabolized, primarily in the liver; the remainder is excreted unchanged in the urine. After oral administration, 50% to 60% of trimethoprim is excreted in the urine within 24 hours, approximately 80% of this being unmetabolized trimethoprim. Trimethoprim also passes the placental barrier and is excreted in human milk.

Half life

8-11 hours in adults with normal renal function

Not Available

LD50=4850 (orally in mice)

Affected organisms
  • Gram negative and gram positive bacteria
  • Listeria monocytogenes
  • Escherichia coli
Not Available
Pharmacogenomic Effects/ADRs
Interacting Gene/EnzymeAllele nameGenotype(s)Defining Change(s)Type(s)DescriptionDetails
Glucose-6-phosphate 1-dehydrogenaseVilleurbanneNot Available1000_1002delACCADR InferredIncreased risk of dose-related hemolysis.Details
Glucose-6-phosphate 1-dehydrogenaseTorunNot Available1006A->GADR InferredIncreased risk of dose-related hemolysis.Details
Glucose-6-phosphate 1-dehydrogenaseSunderlandNot Available105_107delCATADR InferredIncreased risk of dose-related hemolysis.Details
Glucose-6-phosphate 1-dehydrogenaseIwatsukiNot Available1081G->AADR InferredIncreased risk of dose-related hemolysis.Details
Glucose-6-phosphate 1-dehydrogenaseSerresNot Available1082C->TADR InferredIncreased risk of dose-related hemolysis.Details
Glucose-6-phosphate 1-dehydrogenaseTondelaNot Available1084_1101delCTGAACGAGCGCAAGGCCADR InferredIncreased risk of dose-related hemolysis.Details
Glucose-6-phosphate 1-dehydrogenaseLoma LindaNot Available1089C->AADR InferredIncreased risk of dose-related hemolysis.Details
Glucose-6-phosphate 1-dehydrogenaseAachenNot Available1089C->GADR InferredIncreased risk of dose-related hemolysis.Details
Glucose-6-phosphate 1-dehydrogenaseTenriNot Available1096A->GADR InferredIncreased risk of dose-related hemolysis.Details
Glucose-6-phosphate 1-dehydrogenaseMontpellierNot Available1132G>AADR InferredIncreased risk of dose-related hemolysis.Details
Glucose-6-phosphate 1-dehydrogenaseCalvo MackennaNot Available1138A->GADR InferredIncreased risk of dose-related hemolysis.Details
Glucose-6-phosphate 1-dehydrogenaseRileyNot Available1139T->CADR InferredIncreased risk of dose-related hemolysis.Details
Glucose-6-phosphate 1-dehydrogenaseOlomoucNot Available1141T->CADR InferredIncreased risk of dose-related hemolysis.Details
Glucose-6-phosphate 1-dehydrogenaseTomahNot Available1153T->CADR InferredIncreased risk of dose-related hemolysis.Details
Glucose-6-phosphate 1-dehydrogenaseLynwoodNot Available1154G->TADR InferredIncreased risk of dose-related hemolysis.Details
Glucose-6-phosphate 1-dehydrogenaseMadridNot Available1155C->GADR InferredIncreased risk of dose-related hemolysis.Details
Glucose-6-phosphate 1-dehydrogenaseIowa, Walter Reed, SpringfieldNot Available1156A->GADR InferredIncreased risk of dose-related hemolysis.Details
Glucose-6-phosphate 1-dehydrogenaseBeverly Hills, Genova, Iwate, Niigata, YamaguchiNot Available1160G->AADR InferredIncreased risk of dose-related hemolysis.Details
Glucose-6-phosphate 1-dehydrogenaseHartfordNot Available1162A->GADR InferredIncreased risk of dose-related hemolysis.Details
Glucose-6-phosphate 1-dehydrogenasePrahaNot Available1166A->GADR InferredIncreased risk of dose-related hemolysis.Details
Glucose-6-phosphate 1-dehydrogenaseKrakowNot Available1175T>CADR InferredIncreased risk of dose-related hemolysis.Details
Glucose-6-phosphate 1-dehydrogenaseWisconsinNot Available1177C->GADR InferredIncreased risk of dose-related hemolysis.Details
Glucose-6-phosphate 1-dehydrogenaseNashville, Anaheim, PorticiNot Available1178G->AADR InferredIncreased risk of dose-related hemolysis.Details
Glucose-6-phosphate 1-dehydrogenaseAlhambraNot Available1180G->CADR InferredIncreased risk of dose-related hemolysis.Details
Glucose-6-phosphate 1-dehydrogenaseBariNot Available1187C->TADR InferredIncreased risk of dose-related hemolysis.Details
Glucose-6-phosphate 1-dehydrogenasePuerto LimonNot Available1192G->AADR InferredIncreased risk of dose-related hemolysis.Details
Glucose-6-phosphate 1-dehydrogenaseCovao do LoboNot Available1205C>AADR InferredIncreased risk of dose-related hemolysis.Details
Glucose-6-phosphate 1-dehydrogenaseClinicNot Available1215G->AADR InferredIncreased risk of dose-related hemolysis.Details
Glucose-6-phosphate 1-dehydrogenaseUtrechtNot Available1225C->TADR InferredIncreased risk of dose-related hemolysis.Details
Glucose-6-phosphate 1-dehydrogenaseSuwalkiNot Available1226C->GADR InferredIncreased risk of dose-related hemolysis.Details
Glucose-6-phosphate 1-dehydrogenaseRiversideNot Available1228G->TADR InferredIncreased risk of dose-related hemolysis.Details
Glucose-6-phosphate 1-dehydrogenaseJapan, ShinagawaNot Available1229G->AADR InferredIncreased risk of dose-related hemolysis.Details
Glucose-6-phosphate 1-dehydrogenaseKawasakiNot Available1229G->CADR InferredIncreased risk of dose-related hemolysis.Details
Glucose-6-phosphate 1-dehydrogenaseMunichNot Available1231A->GADR InferredIncreased risk of dose-related hemolysis.Details
Glucose-6-phosphate 1-dehydrogenaseGeorgiaNot Available1284C->AADR InferredIncreased risk of dose-related hemolysis.Details
Glucose-6-phosphate 1-dehydrogenaseSumareNot Available1292T->GADR InferredIncreased risk of dose-related hemolysis.Details
Glucose-6-phosphate 1-dehydrogenaseTelti/KobeNot Available1318C->TADR InferredIncreased risk of dose-related hemolysis.Details
Glucose-6-phosphate 1-dehydrogenaseSantiago de Cuba, MoriokaNot Available1339G->AADR InferredIncreased risk of dose-related hemolysis.Details
Glucose-6-phosphate 1-dehydrogenaseHarimaNot Available1358T->AADR InferredIncreased risk of dose-related hemolysis.Details
Glucose-6-phosphate 1-dehydrogenaseFiguera da FozNot Available1366G->CADR InferredIncreased risk of dose-related hemolysis.Details
Glucose-6-phosphate 1-dehydrogenaseAmiensNot Available1367A>TADR InferredIncreased risk of dose-related hemolysis.Details
Glucose-6-phosphate 1-dehydrogenaseBangkok NoiNot Available1376G->T, 1502T->GADR InferredIncreased risk of dose-related hemolysis.Details
Glucose-6-phosphate 1-dehydrogenaseFukayaNot Available1462G->AADR InferredIncreased risk of dose-related hemolysis.Details
Glucose-6-phosphate 1-dehydrogenaseCampinasNot Available1463G->TADR InferredIncreased risk of dose-related hemolysis.Details
Glucose-6-phosphate 1-dehydrogenaseBuenos AiresNot Available1465C>TADR InferredIncreased risk of dose-related hemolysis.Details
Glucose-6-phosphate 1-dehydrogenaseArakawaNot Available1466C->TADR InferredIncreased risk of dose-related hemolysis.Details
Glucose-6-phosphate 1-dehydrogenaseBrightonNot Available1488_1490delGAAADR InferredIncreased risk of dose-related hemolysis.Details
Glucose-6-phosphate 1-dehydrogenaseKozukataNot Available159G->CADR InferredIncreased risk of dose-related hemolysis.Details
Glucose-6-phosphate 1-dehydrogenaseAmsterdamNot Available180_182delTCTADR InferredIncreased risk of dose-related hemolysis.Details
Glucose-6-phosphate 1-dehydrogenaseNo nameNot Available202G->A, 376A->G, 1264C>GADR InferredIncreased risk of dose-related hemolysis.Details
Glucose-6-phosphate 1-dehydrogenaseSwanseaNot Available224T->CADR InferredIncreased risk of dose-related hemolysis.Details
Glucose-6-phosphate 1-dehydrogenaseUrayasuNot Available281_283delAGAADR InferredIncreased risk of dose-related hemolysis.Details
Glucose-6-phosphate 1-dehydrogenaseVancouverNot Available317C->G544C->T592C->TADR InferredIncreased risk of dose-related hemolysis.Details
Glucose-6-phosphate 1-dehydrogenaseMt SinaiNot Available376A->G, 1159C->TADR InferredIncreased risk of dose-related hemolysis.Details
Glucose-6-phosphate 1-dehydrogenasePlymouthNot Available488G->AADR InferredIncreased risk of dose-related hemolysis.Details
Glucose-6-phosphate 1-dehydrogenaseVolendamNot Available514C->TADR InferredIncreased risk of dose-related hemolysis.Details
Glucose-6-phosphate 1-dehydrogenaseShinshuNot Available527A->GADR InferredIncreased risk of dose-related hemolysis.Details
Glucose-6-phosphate 1-dehydrogenaseChikugoNot Available535A->TADR InferredIncreased risk of dose-related hemolysis.Details
Glucose-6-phosphate 1-dehydrogenaseTsukuiNot Available561_563delCTCADR InferredIncreased risk of dose-related hemolysis.Details
Glucose-6-phosphate 1-dehydrogenasePedoplis-CkaroNot Available573C>GADR InferredIncreased risk of dose-related hemolysis.Details
Glucose-6-phosphate 1-dehydrogenaseSantiagoNot Available593G->CADR InferredIncreased risk of dose-related hemolysis.Details
Glucose-6-phosphate 1-dehydrogenaseMinnesota, Marion, Gastonia, LeJeuneNot Available637G->TADR InferredIncreased risk of dose-related hemolysis.Details
Glucose-6-phosphate 1-dehydrogenaseCincinnatiNot Available637G->T, 1037A->TADR InferredIncreased risk of dose-related hemolysis.Details
Glucose-6-phosphate 1-dehydrogenaseHarilaouNot Available648T->GADR InferredIncreased risk of dose-related hemolysis.Details
Glucose-6-phosphate 1-dehydrogenaseNorth DallasNot Available683_685delACAADR InferredIncreased risk of dose-related hemolysis.Details
Glucose-6-phosphate 1-dehydrogenaseAsahikawaNot Available695G->AADR InferredIncreased risk of dose-related hemolysis.Details
Glucose-6-phosphate 1-dehydrogenaseDurhamNot Available713A->GADR InferredIncreased risk of dose-related hemolysis.Details
Glucose-6-phosphate 1-dehydrogenaseStonybrookNot Available724_729delGGCACTADR InferredIncreased risk of dose-related hemolysis.Details
Glucose-6-phosphate 1-dehydrogenaseWayneNot Available769C->GADR InferredIncreased risk of dose-related hemolysis.Details
Glucose-6-phosphate 1-dehydrogenaseAveiroNot Available806G->AADR InferredIncreased risk of dose-related hemolysis.Details
Glucose-6-phosphate 1-dehydrogenaseCleveland CorumNot Available820G->AADR InferredIncreased risk of dose-related hemolysis.Details
Glucose-6-phosphate 1-dehydrogenaseLilleNot Available821A>TADR InferredIncreased risk of dose-related hemolysis.Details
Glucose-6-phosphate 1-dehydrogenaseBangkokNot Available825G>CADR InferredIncreased risk of dose-related hemolysis.Details
Glucose-6-phosphate 1-dehydrogenaseSugaoNot Available826C->TADR InferredIncreased risk of dose-related hemolysis.Details
Glucose-6-phosphate 1-dehydrogenaseLa JollaNot Available832T->CADR InferredIncreased risk of dose-related hemolysis.Details
Glucose-6-phosphate 1-dehydrogenaseWexhamNot Available833C->TADR InferredIncreased risk of dose-related hemolysis.Details
Glucose-6-phosphate 1-dehydrogenasePiotrkowNot Available851T>CADR InferredIncreased risk of dose-related hemolysis.Details
Glucose-6-phosphate 1-dehydrogenaseWest VirginiaNot Available910G->TADR InferredIncreased risk of dose-related hemolysis.Details
Glucose-6-phosphate 1-dehydrogenaseOmiyaNot Available921G->CADR InferredIncreased risk of dose-related hemolysis.Details
Glucose-6-phosphate 1-dehydrogenaseNaraNot Available953_976delCCACCAAAGGGTACCTGGAC GACCADR InferredIncreased risk of dose-related hemolysis.Details
Glucose-6-phosphate 1-dehydrogenaseManhattanNot Available962G->AADR InferredIncreased risk of dose-related hemolysis.Details
Glucose-6-phosphate 1-dehydrogenaseRehevotNot Available964T->CADR InferredIncreased risk of dose-related hemolysis.Details
Glucose-6-phosphate 1-dehydrogenaseHoniaraNot Available99A->G / 1360C->TADR InferredIncreased risk of dose-related hemolysis.Details
Glucose-6-phosphate 1-dehydrogenaseTokyo, FukushimaNot Available1246G->AADR InferredIncreased risk of dose-related hemolysis.Details
Glucose-6-phosphate 1-dehydrogenaseChathamNot Available1003G->AADR InferredIncreased risk of dose-related hemolysis.Details
Glucose-6-phosphate 1-dehydrogenaseFushanNot Available1004C->AADR InferredIncreased risk of dose-related hemolysis.Details
Glucose-6-phosphate 1-dehydrogenasePartenopeNot Available1052G->TADR InferredIncreased risk of dose-related hemolysis.Details
Glucose-6-phosphate 1-dehydrogenaseIerapetraNot Available1057C->TADR InferredIncreased risk of dose-related hemolysis.Details
Glucose-6-phosphate 1-dehydrogenaseAnadiaNot Available1193A->GADR InferredIncreased risk of dose-related hemolysis.Details
Glucose-6-phosphate 1-dehydrogenaseAbenoNot Available1220A->CADR InferredIncreased risk of dose-related hemolysis.Details
Glucose-6-phosphate 1-dehydrogenaseSurabayaNot Available1291G->AADR InferredIncreased risk of dose-related hemolysis.Details
Glucose-6-phosphate 1-dehydrogenasePawneeNot Available1316G->CADR InferredIncreased risk of dose-related hemolysis.Details
Glucose-6-phosphate 1-dehydrogenaseS. AntiocoNot Available1342A->GADR InferredIncreased risk of dose-related hemolysis.Details
Glucose-6-phosphate 1-dehydrogenaseCassanoNot Available1347G->CADR InferredIncreased risk of dose-related hemolysis.Details
Glucose-6-phosphate 1-dehydrogenaseHermoupolisNot Available1347G->C / 1360C->TADR InferredIncreased risk of dose-related hemolysis.Details
Glucose-6-phosphate 1-dehydrogenaseUnion,Maewo, Chinese-2, KaloNot Available1360C->TADR InferredIncreased risk of dose-related hemolysis.Details
Glucose-6-phosphate 1-dehydrogenaseAndalusNot Available1361G->AADR InferredIncreased risk of dose-related hemolysis.Details
Glucose-6-phosphate 1-dehydrogenaseCosenzaNot Available1376G->CADR InferredIncreased risk of dose-related hemolysis.Details
Glucose-6-phosphate 1-dehydrogenaseCanton, Taiwan- Hakka, Gifu-like, Agrigento-likeNot Available1376G->TADR InferredIncreased risk of dose-related hemolysis.Details
Glucose-6-phosphate 1-dehydrogenaseFloresNot Available1387C->AADR InferredIncreased risk of dose-related hemolysis.Details
Glucose-6-phosphate 1-dehydrogenaseKaiping, Anant, Dhon, Sapporo-like, WoseraNot Available1388G->AADR InferredIncreased risk of dose-related hemolysis.Details
Glucose-6-phosphate 1-dehydrogenaseKamogawaNot Available169C->TADR InferredIncreased risk of dose-related hemolysis.Details
Glucose-6-phosphate 1-dehydrogenaseCostanzoNot Available179T>CADR InferredIncreased risk of dose-related hemolysis.Details
Glucose-6-phosphate 1-dehydrogenaseAmazoniaNot Available185C->AADR InferredIncreased risk of dose-related hemolysis.Details
Glucose-6-phosphate 1-dehydrogenaseSongklanagarindNot Available196T->AADR InferredIncreased risk of dose-related hemolysis.Details
Glucose-6-phosphate 1-dehydrogenaseHechiNot Available202G->A / 871G->AADR InferredIncreased risk of dose-related hemolysis.Details
Glucose-6-phosphate 1-dehydrogenaseNamouruNot Available208T->CADR InferredIncreased risk of dose-related hemolysis.Details
Glucose-6-phosphate 1-dehydrogenaseBao LocNot Available352T>CADR InferredIncreased risk of dose-related hemolysis.Details
Glucose-6-phosphate 1-dehydrogenaseCrispimNot Available375G->T, 379G->T383T->C384C>TADR InferredIncreased risk of dose-related hemolysis.Details
Glucose-6-phosphate 1-dehydrogenaseAcrokorinthosNot Available376A->G / 463C->GADR InferredIncreased risk of dose-related hemolysis.Details
Glucose-6-phosphate 1-dehydrogenaseSanta MariaNot Available376A->G / 542A->TADR InferredIncreased risk of dose-related hemolysis.Details
Glucose-6-phosphate 1-dehydrogenaseAnanindeuaNot Available376A->G / 871G->AADR InferredIncreased risk of dose-related hemolysis.Details
Glucose-6-phosphate 1-dehydrogenaseVanua LavaNot Available383T->CADR InferredIncreased risk of dose-related hemolysis.Details
Glucose-6-phosphate 1-dehydrogenaseValladolidNot Available406C->TADR InferredIncreased risk of dose-related hemolysis.Details
Glucose-6-phosphate 1-dehydrogenaseBelemNot Available409C->TADR InferredIncreased risk of dose-related hemolysis.Details
Glucose-6-phosphate 1-dehydrogenaseLiuzhouNot Available442G->AADR InferredIncreased risk of dose-related hemolysis.Details
Glucose-6-phosphate 1-dehydrogenaseShenzenNot Available473G>AADR InferredIncreased risk of dose-related hemolysis.Details
Glucose-6-phosphate 1-dehydrogenaseTaipei “Chinese- 3”Not Available493A->GADR InferredIncreased risk of dose-related hemolysis.Details
Glucose-6-phosphate 1-dehydrogenaseToledoNot Available496C>TADR InferredIncreased risk of dose-related hemolysis.Details
Glucose-6-phosphate 1-dehydrogenaseNaoneNot Available497G->AADR InferredIncreased risk of dose-related hemolysis.Details
Glucose-6-phosphate 1-dehydrogenaseNankangNot Available517T->CADR InferredIncreased risk of dose-related hemolysis.Details
Glucose-6-phosphate 1-dehydrogenaseMiaoliNot Available519C->GADR InferredIncreased risk of dose-related hemolysis.Details
Glucose-6-phosphate 1-dehydrogenaseMediterranean, Dallas, Panama‚ Sassari, Cagliari, BirminghamNot Available563C->TADR InferredIncreased risk of dose-related hemolysis.Details
Glucose-6-phosphate 1-dehydrogenaseCoimbra ShundeNot Available592C->TADR InferredIncreased risk of dose-related hemolysis.Details
Glucose-6-phosphate 1-dehydrogenaseNilgiriNot Available593G>AADR InferredIncreased risk of dose-related hemolysis.Details
Glucose-6-phosphate 1-dehydrogenaseRadlowoNot Available679C->TADR InferredIncreased risk of dose-related hemolysis.Details
Glucose-6-phosphate 1-dehydrogenaseRoubaixNot Available811G>CADR InferredIncreased risk of dose-related hemolysis.Details
Glucose-6-phosphate 1-dehydrogenaseHaikouNot Available835A->GADR InferredIncreased risk of dose-related hemolysis.Details
Glucose-6-phosphate 1-dehydrogenaseChinese-1Not Available835A->TADR InferredIncreased risk of dose-related hemolysis.Details
Glucose-6-phosphate 1-dehydrogenaseMizushimaNot Available848A>GADR InferredIncreased risk of dose-related hemolysis.Details
Glucose-6-phosphate 1-dehydrogenaseOsakaNot Available853C->TADR InferredIncreased risk of dose-related hemolysis.Details
Glucose-6-phosphate 1-dehydrogenaseViangchan, JammuNot Available871G->AADR InferredIncreased risk of dose-related hemolysis.Details
Glucose-6-phosphate 1-dehydrogenaseSeoulNot Available916G->AADR InferredIncreased risk of dose-related hemolysis.Details
Glucose-6-phosphate 1-dehydrogenaseLudhianaNot Available929G->AADR InferredIncreased risk of dose-related hemolysis.Details
Glucose-6-phosphate 1-dehydrogenaseFarroupilhaNot Available977C->AADR InferredIncreased risk of dose-related hemolysis.Details
Glucose-6-phosphate 1-dehydrogenaseChinese-5Not Available1024C->TADR InferredIncreased risk of dose-related hemolysis.Details
Glucose-6-phosphate 1-dehydrogenaseRignanoNot Available130G>AADR InferredIncreased risk of dose-related hemolysis.Details
Glucose-6-phosphate 1-dehydrogenaseOrissaNot Available131C->GADR InferredIncreased risk of dose-related hemolysis.Details
Glucose-6-phosphate 1-dehydrogenaseG6PDNiceNot Available1380G>CADR InferredIncreased risk of dose-related hemolysis.Details
Glucose-6-phosphate 1-dehydrogenaseKamiube, KeelungNot Available1387C->TADR InferredIncreased risk of dose-related hemolysis.Details
Glucose-6-phosphate 1-dehydrogenaseNeapolisNot Available1400C->GADR InferredIncreased risk of dose-related hemolysis.Details
Glucose-6-phosphate 1-dehydrogenaseAuresNot Available143T->CADR InferredIncreased risk of dose-related hemolysis.Details
Glucose-6-phosphate 1-dehydrogenaseSplitNot Available1442C->GADR InferredIncreased risk of dose-related hemolysis.Details
Glucose-6-phosphate 1-dehydrogenaseKambosNot Available148C->TADR InferredIncreased risk of dose-related hemolysis.Details
Glucose-6-phosphate 1-dehydrogenasePalestrinaNot Available170G>AADR InferredIncreased risk of dose-related hemolysis.Details
Glucose-6-phosphate 1-dehydrogenaseMetapontoNot Available172G->AADR InferredIncreased risk of dose-related hemolysis.Details
Glucose-6-phosphate 1-dehydrogenaseMusashinoNot Available185C->TADR InferredIncreased risk of dose-related hemolysis.Details
Glucose-6-phosphate 1-dehydrogenaseAsahiNot Available202G->AADR InferredIncreased risk of dose-related hemolysis.Details
Glucose-6-phosphate 1-dehydrogenaseA- (202), Ferrara INot Available202G->A / 376A->GADR InferredIncreased risk of dose-related hemolysis.Details
Glucose-6-phosphate 1-dehydrogenaseMurcia OristanoNot Available209A->GADR InferredIncreased risk of dose-related hemolysis.Details
Glucose-6-phosphate 1-dehydrogenaseUbe KonanNot Available241C->TADR InferredIncreased risk of dose-related hemolysis.Details
Glucose-6-phosphate 1-dehydrogenaseLagosantoNot Available242G->AADR InferredIncreased risk of dose-related hemolysis.Details
Glucose-6-phosphate 1-dehydrogenaseGuangzhouNot Available274C->TADR InferredIncreased risk of dose-related hemolysis.Details
Glucose-6-phosphate 1-dehydrogenaseHammersmithNot Available323T->AADR InferredIncreased risk of dose-related hemolysis.Details
Glucose-6-phosphate 1-dehydrogenaseSinnaiNot Available34G->TADR InferredIncreased risk of dose-related hemolysis.Details
Glucose-6-phosphate 1-dehydrogenaseA- (680)Not Available376A->G / 680G->TADR InferredIncreased risk of dose-related hemolysis.Details
Glucose-6-phosphate 1-dehydrogenaseA- (968), Betica,Selma, GuantanamoNot Available376A->G / 968T->CADR InferredIncreased risk of dose-related hemolysis.Details
Glucose-6-phosphate 1-dehydrogenaseSalerno PyrgosNot Available383T>GADR InferredIncreased risk of dose-related hemolysis.Details
Glucose-6-phosphate 1-dehydrogenaseQuing YanNot Available392G->TADR InferredIncreased risk of dose-related hemolysis.Details
Glucose-6-phosphate 1-dehydrogenaseLagesNot Available40G->AADR InferredIncreased risk of dose-related hemolysis.Details
Glucose-6-phosphate 1-dehydrogenaseIleshaNot Available466G->AADR InferredIncreased risk of dose-related hemolysis.Details
Glucose-6-phosphate 1-dehydrogenaseMahidolNot Available487G->AADR InferredIncreased risk of dose-related hemolysis.Details
Glucose-6-phosphate 1-dehydrogenaseMalagaNot Available542A->TADR InferredIncreased risk of dose-related hemolysis.Details
Glucose-6-phosphate 1-dehydrogenaseSibariNot Available634A->GADR InferredIncreased risk of dose-related hemolysis.Details
Glucose-6-phosphate 1-dehydrogenaseMexico CityNot Available680G->AADR InferredIncreased risk of dose-related hemolysis.Details
Glucose-6-phosphate 1-dehydrogenaseNanningNot Available703C->TADR InferredIncreased risk of dose-related hemolysis.Details
Glucose-6-phosphate 1-dehydrogenaseSeattle, Lodi, Modena, Ferrara II, Athens-likeNot Available844G->CADR InferredIncreased risk of dose-related hemolysis.Details
Glucose-6-phosphate 1-dehydrogenaseBajo MaumereNot Available844G->TADR InferredIncreased risk of dose-related hemolysis.Details
Glucose-6-phosphate 1-dehydrogenaseMontalbanoNot Available854G->AADR InferredIncreased risk of dose-related hemolysis.Details
Glucose-6-phosphate 1-dehydrogenaseKalyan-Kerala, Jamnaga, RohiniNot Available949G->AADR InferredIncreased risk of dose-related hemolysis.Details
Glucose-6-phosphate 1-dehydrogenaseGaoheNot Available95A->GADR InferredIncreased risk of dose-related hemolysis.Details


Drug Interactions
(6R)-Folinic acidThe therapeutic efficacy of Trimethoprim can be decreased when used in combination with (6R)-Folinic acid.
(6S)-5,6,7,8-tetrahydrofolateThe therapeutic efficacy of Trimethoprim can be decreased when used in combination with (6S)-5,6,7,8-tetrahydrofolate.
(R)-warfarinThe metabolism of (R)-warfarin can be decreased when combined with Trimethoprim.
(S)-WarfarinThe metabolism of (S)-Warfarin can be decreased when combined with Trimethoprim.
3,5-diiodothyropropionic acidThe metabolism of 3,5-diiodothyropropionic acid can be decreased when combined with Trimethoprim.
4-hydroxycoumarinThe metabolism of 4-hydroxycoumarin can be decreased when combined with Trimethoprim.
5-androstenedioneThe metabolism of 5-androstenedione can be decreased when combined with Trimethoprim.
6-Deoxyerythronolide BThe metabolism of Trimethoprim can be decreased when combined with 6-Deoxyerythronolide B.
6-O-benzylguanineThe metabolism of 6-O-benzylguanine can be decreased when combined with Trimethoprim.
7-ethyl-10-hydroxycamptothecinThe metabolism of Trimethoprim can be decreased when combined with 7-ethyl-10-hydroxycamptothecin.
Additional Data Available
  • Extended Description
    Extended Description

    Extended description of the mechanism of action and particular properties of each drug interaction.

    Learn more
  • Severity

    A severity rating for each drug interaction, from minor to major.

    Learn more
  • Evidence Level
    Evidence Level

    A rating for the strength of the evidence supporting each drug interaction.

    Learn more
  • Action

    An effect category for each drug interaction. Know how this interaction affects the subject drug.

    Learn more
Food Interactions
  • Do not take calcium, aluminium, magnesium or iron supplements within 2 hours of taking this medication.
  • Take on empty stomach: 1 hour before or 2 hours after meals.
  • Take with a full glass of water.


Synthesis Reference

Yasushi Takagishi, Kiichiro Ohsuga, Sadao Ohama, "Suppository containing sulfamethoxazole/trimethoprim complex and process for preparing the same." U.S. Patent US4461765, issued December, 1975.

General References
  1. Brumfitt W, Hamilton-Miller JM: Reassessment of the rationale for the combinations of sulphonamides with diaminopyrimidines. J Chemother. 1993 Dec;5(6):465-9. [PubMed:8195839]
  2. Brumfitt W, Hamilton-Miller JM: Limitations of and indications for the use of co-trimoxazole. J Chemother. 1994 Feb;6(1):3-11. [PubMed:8071675]
  3. Bean DC, Livermore DM, Papa I, Hall LM: Resistance among Escherichia coli to sulphonamides and other antimicrobials now little used in man. J Antimicrob Chemother. 2005 Nov;56(5):962-4. Epub 2005 Sep 8. [PubMed:16150859]
  4. Felmingham D, Reinert RR, Hirakata Y, Rodloff A: Increasing prevalence of antimicrobial resistance among isolates of Streptococcus pneumoniae from the PROTEKT surveillance study, and compatative in vitro activity of the ketolide, telithromycin. J Antimicrob Chemother. 2002 Sep;50 Suppl S1:25-37. [PubMed:12239226]
  5. Johnson JR, Manges AR, O'Bryan TT, Riley LW: A disseminated multidrug-resistant clonal group of uropathogenic Escherichia coli in pyelonephritis. Lancet. 2002 Jun 29;359(9325):2249-51. [PubMed:12103291]
External Links
Human Metabolome Database
KEGG Compound
PubChem Compound
PubChem Substance
Therapeutic Targets Database
RxList Drug Page Drug Page
ATC Codes
J04AM08 — Isoniazid, sulfamethoxazole, trimethoprim and pyridoxineJ01EA01 — TrimethoprimJ01EE03 — Sulfametrole and trimethoprimJ01EE01 — Sulfamethoxazole and trimethoprimJ01EE04 — Sulfamoxole and trimethoprimJ01EE02 — Sulfadiazine and trimethoprimJ01EE07 — Sulfamerazine and trimethoprimJ01EE05 — Sulfadimidine and trimethoprim
AHFS Codes
  • 08:36.00 — Urinary Anti-infectives
PDB Entries
1dg5 / 1dyr / 2bfm / 2w3a / 2w3v / 2w9g / 2w9h / 2w9s / 3fl9 / 3frb
show 9 more
FDA label
Download (98.5 KB)
Download (74.3 KB)

Clinical Trials

Clinical Trials
1Active Not RecruitingOtherBacterial Infections1
1CompletedBasic ScienceOxidative Stress1
1CompletedTreatmentAnaplastic Astrocytoma (AA) / Astrocytic Tumors / Glioblastoma Multiforme (GBM) / Neoplasms, Brain1
1CompletedTreatmentHuman Immunodeficiency Virus (HIV) Infections / Pneumonia, Pneumocystis Carinii1
1, 2CompletedTreatmentHuman Immunodeficiency Virus Type 1 (HIV-1) Infection / Pf Subclinical Parasitemia1
1, 2CompletedTreatmentKidney Diseases / Transplant, Kidney / Transplantation, Kidney / Transplantation, Renal1
1, 2WithdrawnSupportive CareChronic Myeloproliferative Disorders / Infection NOS / Leukemias / Lymphoproliferative Disorders / Malignant Lymphomas / Multiple Myeloma and Plasma Cell Neoplasm / Myelodysplastic Syndromes / Myelodysplastic/Myeloproliferative Neoplasms / Unspecified Adult Solid Tumor, Protocol Specific1
2Active Not RecruitingTreatmentUrinary Tract Infections (UTIs)1
2CompletedNot AvailableTuberculosis Infection1
2CompletedTreatmentCystic Fibrosis (CF)1
2CompletedTreatmentCystic Fibrosis (CF) / Methicillin-Resistant Staphylococcus Aureus (MRSA)1
2CompletedTreatmentDiabetes Mellitus, Insulin-Dependent1
2CompletedTreatmentEpidermolysis Bullosa1
2CompletedTreatmentMalignant Lymphomas1
2CompletedTreatmentUrinary Tract Infections (UTIs)1
2Not Yet RecruitingTreatmentMethicillin-Resistant Staphylococcus Aureus (MRSA) / Skin-structure infections1
2RecruitingPreventionProstate Infections1
2RecruitingTreatmentAtopic Dermatitis (AD) / Dermatitis, Eczematous / Skin Diseases / Skin Diseases, Genetic / Skin Inflammation1
2RecruitingTreatmentCommunity-acquired Methicillin-resistant Staphylococcus Aureus Infection / Community-Acquired MRSA Infections1
2RecruitingTreatmentCystic Fibrosis (CF)1
2RecruitingTreatmentInfection NOS / Multiple Myeloma (MM)1
2TerminatedTreatmentEnd-Stage Renal Disease (ESRD)1
2Unknown StatusTreatmentHip Prosthetic Joint Infection1
2WithdrawnTreatmentUrinary Tract Infections, Recurrent1
2, 3TerminatedPreventionHuman Immunodeficiency Virus (HIV) Infections / Pneumonia, Interstitial Plasma Cell / Tuberculosis Infection1
2, 3Unknown StatusTreatmentPneumonia, Pneumocystis / Prevention & Control1
3CompletedPreventionLife-threatening Infection / Nutrition Disorders1
3CompletedPreventionUrinary Tract Infections (UTIs) / Vesicoureteral Reflux1
3CompletedSupportive CareInfection NOS / Multiple Myeloma (MM)1
3CompletedTreatmentAntibiotics / Chronic Obstructive Pulmonary Disease (COPD) / Sepsis1
3CompletedTreatmentHuman Immunodeficiency Virus (HIV) Infections / Pneumonia, Pneumocystis Carinii1
3CompletedTreatmentUrinary Tract Infections, Recurrent1
3Not Yet RecruitingTreatmentChronic Rhinosinusitis (Diagnosis)1
3RecruitingPreventionChronic Kidney Disease (CKD) / Renal Hypodysplasia, Nonsyndromic, 1 / Vesicoureteral Reflux1
3RecruitingTreatmentEnterobacteriaceae Infections1
3TerminatedPreventionMalaria in Pregnancy1
3TerminatedTreatmentHuman Immunodeficiency Virus (HIV) Infections / Pneumonia, Interstitial Plasma Cell / Pneumonia, Pneumocystis Carinii1
4Active Not RecruitingPreventionUrinary Tract Infections, Recurrent1
4CompletedPreventionAcquired Immune Deficiency Syndrome (AIDS) / Anemias / Human Immunodeficiency Virus (HIV) Infections / Neutropenias / Newborn Infants1
4CompletedPreventionAsymptomatic Bacteriuria / Urinary Tract Infections (UTIs)1
4CompletedPreventionPyelonephritis / Renal Scars1
4CompletedTreatmentBMI >30 kg/m2 / MRSA / PCP / Pharmacokinetics / Tuberculosis Infection1
4CompletedTreatmentHuman Immunodeficiency Virus (HIV)1
4CompletedTreatmentLiver Abscess, Pyogenic1
4CompletedTreatmentSkin Diseases, Infectious1
4Not Yet RecruitingTreatmentPneumonia, Pneumocystis1
4RecruitingBasic ScienceThiamine Deficiency / Vitamin B1 deficiency1
4RecruitingPreventionUrinary Bladder, Overactive / Urinary Tract Infections (UTIs)1
4TerminatedTreatmentDiabetes Mellitus (DM) / High Blood Pressure (Hypertension) / Stage 2 Hypertension1
4WithdrawnPreventionComplications; Breast Prosthesis, Infection or Inflammation1
4WithdrawnTreatmentPneumonia, Pneumocystis Carinii1
Not AvailableActive Not RecruitingTreatmentHydronephrosis / Urinary Tract Infections (UTIs)1
Not AvailableActive Not RecruitingTreatmentUrinary Tract Infections (UTIs)1
Not AvailableCompletedNot AvailableBronchitis2
Not AvailableCompletedPreventionHuman Immunodeficiency Virus (HIV)1
Not AvailableCompletedTreatmentAbscesses1
Not AvailableCompletedTreatmentAbscesses / Infections caused by penicillinase-producing staphylococci1
Not AvailableCompletedTreatmentAbscesses / Skin Diseases, Bacterial1
Not AvailableCompletedTreatmentCellulitis1
Not AvailableCompletedTreatmentEnd-Stage Renal Disease (ESRD)1
Not AvailableCompletedTreatmentHuman Immunodeficiency Virus (HIV) Infections / Pneumonia, Pneumocystis Carinii2
Not AvailableCompletedTreatmentHypospadias1
Not AvailableCompletedTreatmentScleral Buckling1
Not AvailableNo Longer AvailableNot AvailableType 1 Insulin-Dependent Diabetes Mellitus1
Not AvailableRecruitingPreventionMotility Disorders / Staphylococcus Aureus1
Not AvailableRecruitingPreventionUrolithiasis / UTI1
Not AvailableTerminatedNot AvailablePrescribers' Drug Orders1
Not AvailableTerminatedPreventionCatheter-Associated Urinary Tract Infection1
Not AvailableUnknown StatusNot AvailableAsymptomatic Infections / Bacteriuria / Transplantation Infection / Urinary Tract Infections (UTIs)1
Not AvailableUnknown StatusPreventionUreteric Stent After Stone Surgery1
Not AvailableUnknown StatusTreatmentAbscesses1
Not AvailableWithdrawnTreatmentAbscesses1


  • Monarch pharmaceuticals inc
  • Mutual pharmaceutical co inc
  • Teva pharmaceuticals usa inc
  • Watson laboratories inc
  • Hoffmann la roche inc
  • Fsc laboratories inc
  • Actavis Group
  • Advanced Pharmaceutical Services Inc.
  • Aidarex Pharmacuticals LLC
  • Akorn Inc.
  • Alcon Laboratories
  • Allergan Inc.
  • Amerisource Health Services Corp.
  • Amneal Pharmaceuticals
  • Apotheca Inc.
  • Apothecon
  • A-S Medication Solutions LLC
  • Ascent Pediatrics Inc.
  • Atlantic Biologicals Corporation
  • Aurobindo Pharma Ltd.
  • Avkare Incorporated
  • Bausch & Lomb Inc.
  • Baxter International Inc.
  • Bryant Ranch Prepack
  • Cardinal Health
  • Carlisle Laboratories Inc.
  • Casa De Amigos Pharmacy
  • Central Texas Community Health Centers
  • Comprehensive Consultant Services Inc.
  • Coupler Enterprises Inc.
  • Darby Dental Supply Co. Inc.
  • Dept Health Central Pharmacy
  • Direct Dispensing Inc.
  • Dispensing Solutions
  • Diversified Healthcare Services Inc.
  • Eon Labs
  • Falcon Pharmaceuticals Ltd.
  • FSC Laboratories
  • Golden State Medical Supply Inc.
  • Greenstone LLC
  • Group Health Cooperative
  • H.J. Harkins Co. Inc.
  • Heartland Repack Services LLC
  • Hi Tech Pharmacal Co. Inc.
  • Innovative Manufacturing and Distribution Services Inc.
  • Innoviant Pharmacy Inc.
  • Kaiser Foundation Hospital
  • Keltman Pharmaceuticals Inc.
  • King Pharmaceuticals Inc.
  • Laboratoires Docteur Pierre Ricaud
  • Lake Erie Medical and Surgical Supply
  • Lark Pharmaceuticals Inc.
  • Liberty Pharmaceuticals
  • Long Island Pharmacal
  • Lyne Laboratories Inc.
  • Major Pharmaceuticals
  • Mckesson Corp.
  • Medisca Inc.
  • Medvantx Inc.
  • Midland Healthcare LLC
  • Midland Pharmaceutical LLC
  • Monarch Pharmacy
  • Murfreesboro Pharmaceutical Nursing Supply
  • Mutual Pharmaceutical Co.
  • Novopharm Ltd.
  • Nucare Pharmaceuticals Inc.
  • Pacific Pharma Lp
  • Palmetto Pharmaceuticals Inc.
  • Patient First Corp.
  • PD-Rx Pharmaceuticals Inc.
  • Pfizer Animal Health
  • Pfizer Inc.
  • Pharmaceutical Association
  • Pharmaceutical Utilization Management Program VA Inc.
  • Pharmacia Inc.
  • Pharmedix
  • Physicians Total Care Inc.
  • Pliva Inc.
  • Preferred Pharmaceuticals Inc.
  • Prepackage Specialists
  • Prepak Systems Inc.
  • Prescript Pharmaceuticals
  • Qualitest
  • Rebel Distributors Corp.
  • Redpharm Drug
  • Remedy Repack
  • Resource Optimization and Innovation LLC
  • Sandhills Packaging Inc.
  • Sandoz
  • Sicor Pharmaceuticals
  • Southwood Pharmaceuticals
  • St Mary's Medical Park Pharmacy
  • Stat Scripts LLC
  • Talbert Medical Management Corp.
  • Taro Pharmaceuticals USA
  • Taylor Pharmaceuticals
  • Teva Pharmaceutical Industries Ltd.
  • Tya Pharmaceuticals
  • UDL Laboratories
  • United Research Laboratories Inc.
  • Va Cmop Dallas
  • Vangard Labs Inc.
  • Vintage Pharmaceuticals Inc.
  • Vista Pharmaceuticals Inc.
  • Watson Pharmaceuticals
  • Women First Healthcare Inc.
  • Xactdose Inc.
Dosage forms
Solution / dropsOphthalmic
SolutionOral50 mg/5mL
TabletOral100 mg/1
TabletOral200 mg/1
Injection, solution, concentrateIntravenous
PowderNot applicable1 g/1g
TabletOral100 mg
TabletOral200 mg
Unit descriptionCostUnit
Bactrim ds tablet5.53USD tablet
Bactrim DS 800-160 mg tablet3.0USD tablet
Septra DS 800-160 mg tablet2.43USD tablet
Septra ds tablet2.33USD tablet
Trimethoprim powder1.79USD g
Bactrim 400-80 mg tablet1.63USD tablet
Septra 80-400 tablet1.49USD tablet
Sulfamethoxazole-tmp ds tablet1.44USD tablet
Sulfamethoxazole-tmp vial0.84USD ml
Trimethoprim 100 mg tablet0.7USD tablet
Sulfamethoxazole-Trimethoprim 400-80 mg tablet0.69USD tablet
Apo-Trimethoprim 200 mg Tablet0.55USD tablet
Primsol 50 mg/5 ml oral soln0.39USD ml
Apo-Trimethoprim 100 mg Tablet0.27USD tablet
Sulfamethoxazole-tmp ss tablet0.17USD tablet
Sulfamethoxazole-Trimethoprim 200-40 mg/5ml Suspension0.13USD ml
Sulfatrim 200-40 mg/5ml Suspension0.13USD ml
DrugBank does not sell nor buy drugs. Pricing information is supplied for informational purposes only.
Patent NumberPediatric ExtensionApprovedExpires (estimated)
Additional Data Available
  • Filed On
    Filed On

    The date on which a patent was filed with the relevant government.

    Learn more


Experimental Properties
melting point (°C)199-203 °CPhysProp
water solubility400 mg/L (at 25 °C)YALKOWSKY,SH & DANNENFELSER,RM (1992)
logP0.91HANSCH,C ET AL. (1995)
logS-2.86ADME Research, USCD
pKa7.12 (at 20 °C)PERRIN,DD (1972)
Predicted Properties
Water Solubility0.615 mg/mLALOGPS
pKa (Strongest Acidic)17.33ChemAxon
pKa (Strongest Basic)7.16ChemAxon
Physiological Charge1ChemAxon
Hydrogen Acceptor Count7ChemAxon
Hydrogen Donor Count2ChemAxon
Polar Surface Area105.51 Å2ChemAxon
Rotatable Bond Count5ChemAxon
Refractivity81.51 m3·mol-1ChemAxon
Polarizability29.71 Å3ChemAxon
Number of Rings2ChemAxon
Rule of FiveYesChemAxon
Ghose FilterYesChemAxon
Veber's RuleNoChemAxon
MDDR-like RuleNoChemAxon
Predicted ADMET features
Human Intestinal Absorption+0.994
Blood Brain Barrier+0.9381
Caco-2 permeable+0.8867
P-glycoprotein substrateNon-substrate0.5845
P-glycoprotein inhibitor INon-inhibitor0.8631
P-glycoprotein inhibitor IINon-inhibitor0.8382
Renal organic cation transporterNon-inhibitor0.8531
CYP450 2C9 substrateNon-substrate0.8799
CYP450 2D6 substrateNon-substrate0.9116
CYP450 3A4 substrateNon-substrate0.5732
CYP450 1A2 substrateNon-inhibitor0.9046
CYP450 2C9 inhibitorNon-inhibitor0.9071
CYP450 2D6 inhibitorNon-inhibitor0.9231
CYP450 2C19 inhibitorNon-inhibitor0.9025
CYP450 3A4 inhibitorNon-inhibitor0.8467
CYP450 inhibitory promiscuityHigh CYP Inhibitory Promiscuity0.5
Ames testNon AMES toxic0.8227
BiodegradationNot ready biodegradable0.9949
Rat acute toxicity1.7701 LD50, mol/kg Not applicable
hERG inhibition (predictor I)Weak inhibitor0.9394
hERG inhibition (predictor II)Non-inhibitor0.8734
ADMET data is predicted using admetSAR, a free tool for evaluating chemical ADMET properties. (23092397)


Mass Spec (NIST)
Not Available
SpectrumSpectrum TypeSplash Key
Predicted GC-MS Spectrum - GC-MSPredicted GC-MSNot Available
GC-MS Spectrum - EI-BGC-MSsplash10-0006-5390000000-e68103f64cbb997e5776
Predicted MS/MS Spectrum - 10V, Positive (Annotated)Predicted LC-MS/MSNot Available
Predicted MS/MS Spectrum - 20V, Positive (Annotated)Predicted LC-MS/MSNot Available
Predicted MS/MS Spectrum - 40V, Positive (Annotated)Predicted LC-MS/MSNot Available
Predicted MS/MS Spectrum - 10V, Negative (Annotated)Predicted LC-MS/MSNot Available
Predicted MS/MS Spectrum - 20V, Negative (Annotated)Predicted LC-MS/MSNot Available
Predicted MS/MS Spectrum - 40V, Negative (Annotated)Predicted LC-MS/MSNot Available
LC-MS/MS Spectrum - LC-ESI-qTof , PositiveLC-MS/MSNot Available
LC-MS/MS Spectrum - LC-ESI-ITFT , positiveLC-MS/MSsplash10-0089-0290000000-32000410829186ca112c
LC-MS/MS Spectrum - LC-ESI-ITFT , positiveLC-MS/MSsplash10-0006-0090000000-44ccaa9725303a7db8a4
LC-MS/MS Spectrum - LC-ESI-ITFT , positiveLC-MS/MSsplash10-0006-0090000000-af77a44791c8867aad66
LC-MS/MS Spectrum - LC-ESI-ITFT , positiveLC-MS/MSsplash10-0006-0190000000-8eb1449e3f800368c863
LC-MS/MS Spectrum - LC-ESI-ITFT , positiveLC-MS/MSsplash10-03n9-0190000000-deb1664d211c2227b048
LC-MS/MS Spectrum - LC-ESI-ITFT , positiveLC-MS/MSsplash10-077i-0590000000-ae48b54f4879c1551670
LC-MS/MS Spectrum - LC-ESI-ITFT , positiveLC-MS/MSsplash10-0089-1950000000-5084ea4b328a585b675d
LC-MS/MS Spectrum - LC-ESI-ITFT , positiveLC-MS/MSsplash10-0006-0090000000-fb9fa4e4130917b6e6ff
LC-MS/MS Spectrum - LC-ESI-ITFT , positiveLC-MS/MSsplash10-0006-0090000000-15d83f92b30f466cd587
LC-MS/MS Spectrum - LC-ESI-ITFT , positiveLC-MS/MSsplash10-0006-0190000000-f95e0c038a6aa70dc02e
LC-MS/MS Spectrum - LC-ESI-ITFT , positiveLC-MS/MSsplash10-03na-0190000000-72c88d8f9739c7d29714
LC-MS/MS Spectrum - LC-ESI-ITFT , positiveLC-MS/MSsplash10-077i-0590000000-9c0f5662b9713adab9cb
LC-MS/MS Spectrum - LC-ESI-ITFT , positiveLC-MS/MSsplash10-0089-1950000000-8b16041ba3b127d299ba
LC-MS/MS Spectrum - LC-ESI-ITFT , positiveLC-MS/MSsplash10-0089-0290000000-6a16da6c03a03fd87f34
LC-MS/MS Spectrum - LC-ESI-QQ , positiveLC-MS/MSsplash10-0006-0090000000-145bf44afce31ab82f64
LC-MS/MS Spectrum - LC-ESI-QQ , positiveLC-MS/MSsplash10-0006-0090000000-68ca013641f0c338b3a2
LC-MS/MS Spectrum - LC-ESI-QQ , positiveLC-MS/MSsplash10-008c-0290000000-d56028ecf88d373b83bd
LC-MS/MS Spectrum - LC-ESI-QQ , positiveLC-MS/MSsplash10-03n9-0590000000-15246e14a33089adf87d
LC-MS/MS Spectrum - LC-ESI-QQ , positiveLC-MS/MSsplash10-0230-1950000000-83b1288780d0f8f7b8a4
LC-MS/MS Spectrum - LC-ESI-IT , positiveLC-MS/MSsplash10-00e9-0690000000-693e14cc9adc7eb2f25a
LC-MS/MS Spectrum - LC-ESI-ITFT , positiveLC-MS/MSsplash10-01si-0190000000-1cf9183ddf2bfed27ff3
LC-MS/MS Spectrum - LC-ESI-ITFT , positiveLC-MS/MSsplash10-0259-0590000000-114c45037d358307bf34
LC-MS/MS Spectrum - LC-ESI-ITFT , positiveLC-MS/MSsplash10-0006-0190000000-ef1516809b4a9fc2cb85
LC-MS/MS Spectrum - LC-ESI-ITFT , positiveLC-MS/MSsplash10-0089-0290000000-a1cc2a930cf072c3aa11
MS/MS Spectrum - , positiveLC-MS/MSsplash10-0006-0190000000-0fa04011b512afabef25
MS/MS Spectrum - , positiveLC-MS/MSsplash10-0006-0090000000-2e8d981761670d12c381
MS/MS Spectrum - , positiveLC-MS/MSsplash10-03na-2690000000-39babdc7b45a0aa0adf7


This compound belongs to the class of organic compounds known as anisoles. These are organic compounds containing a methoxybenzene or a derivative thereof.
Organic compounds
Super Class
Phenol ethers
Sub Class
Direct Parent
Alternative Parents
Phenoxy compounds / Methoxybenzenes / Aminopyrimidines and derivatives / Alkyl aryl ethers / Imidolactams / Heteroaromatic compounds / Azacyclic compounds / Primary amines / Organopnictogen compounds / Hydrocarbon derivatives
Phenoxy compound / Anisole / Methoxybenzene / Alkyl aryl ether / Aminopyrimidine / Monocyclic benzene moiety / Pyrimidine / Imidolactam / Heteroaromatic compound / Organoheterocyclic compound
Molecular Framework
Aromatic heteromonocyclic compounds
External Descriptors
aminopyrimidine, methoxybenzene (CHEBI:45924) / a small molecule (CPD0-1581)


Pharmacological action
General Function
Thymidylate synthase activity
Specific Function
Contributes to the de novo mitochondrial thymidylate biosynthesis pathway.
Gene Name
Uniprot ID
Uniprot Name
Thymidylate synthase
Molecular Weight
35715.65 Da
  1. Overington JP, Al-Lazikani B, Hopkins AL: How many drug targets are there? Nat Rev Drug Discov. 2006 Dec;5(12):993-6. [PubMed:17139284]
  2. Imming P, Sinning C, Meyer A: Drugs, their targets and the nature and number of drug targets. Nat Rev Drug Discov. 2006 Oct;5(10):821-34. [PubMed:17016423]
  3. Gamarro F, Yu PL, Zhao J, Edman U, Greene PJ, Santi D: Trypanosoma brucei dihydrofolate reductase-thymidylate synthase: gene isolation and expression and characterization of the enzyme. Mol Biochem Parasitol. 1995 Jun;72(1-2):11-22. [PubMed:8538681]
  4. Rosowsky A, Papoulis AT, Forsch RA, Queener SF: Synthesis and antiparasitic and antitumor activity of 2, 4-diamino-6-(arylmethyl)-5,6,7,8-tetrahydroquinazoline analogues of piritrexim. J Med Chem. 1999 Mar 25;42(6):1007-17. [PubMed:10090784]
  5. Reche P, Arrebola R, Santi DV, Gonzalez-Pacanowska D, Ruiz-Perez LM: Expression and characterization of the Trypanosoma cruzi dihydrofolate reductase domain. Mol Biochem Parasitol. 1996 Feb-Mar;76(1-2):175-85. [PubMed:8920005]
  6. Oefner C, Parisi S, Schulz H, Lociuro S, Dale GE: Inhibitory properties and X-ray crystallographic study of the binding of AR-101, AR-102 and iclaprim in ternary complexes with NADPH and dihydrofolate reductase from Staphylococcus aureus. Acta Crystallogr D Biol Crystallogr. 2009 Aug;65(Pt 8):751-7. doi: 10.1107/S0907444909013936. Epub 2009 Jul 10. [PubMed:19622858]
  7. Berman HM, Westbrook J, Feng Z, Gilliland G, Bhat TN, Weissig H, Shindyalov IN, Bourne PE: The Protein Data Bank. Nucleic Acids Res. 2000 Jan 1;28(1):235-42. [PubMed:10592235]
2. Dihydrofolate reductase
Pharmacological action
General Function
Nadph binding
Specific Function
Key enzyme in folate metabolism. Contributes to the de novo mitochondrial thymidylate biosynthesis pathway. Catalyzes an essential reaction for de novo glycine and purine synthesis, and for DNA pre...
Gene Name
Uniprot ID
Uniprot Name
Dihydrofolate reductase
Molecular Weight
21452.61 Da
  1. Laskowska E, Kuczynska-Wisnik D, Bak M, Lipinska B: Trimethoprim induces heat shock proteins and protein aggregation in E. coli cells. Curr Microbiol. 2003 Oct;47(4):286-9. [PubMed:14629008]
  2. Floris-Moore MA, Amodio-Groton MI, Catalano MT: Adverse reactions to trimethoprim/sulfamethoxazole in AIDS. Ann Pharmacother. 2003 Dec;37(12):1810-3. [PubMed:14632594]
  3. Rosowsky A, Fu H, Chan DC, Queener SF: Synthesis of 2,4-diamino-6-[2'-O-(omega-carboxyalkyl)oxydibenz[b,f]azepin-5-yl]methylpteridine s as potent and selective inhibitors of Pneumocystis carinii, Toxoplasma gondii, and Mycobacterium avium dihydrofolate reductase. J Med Chem. 2004 May 6;47(10):2475-85. [PubMed:15115391]
  4. Nahimana A, Rabodonirina M, Bille J, Francioli P, Hauser PM: Mutations of Pneumocystis jirovecii dihydrofolate reductase associated with failure of prophylaxis. Antimicrob Agents Chemother. 2004 Nov;48(11):4301-5. [PubMed:15504856]
  5. Barrow EW, Bourne PC, Barrow WW: Functional cloning of Bacillus anthracis dihydrofolate reductase and confirmation of natural resistance to trimethoprim. Antimicrob Agents Chemother. 2004 Dec;48(12):4643-9. [PubMed:15561838]
  6. Chen X, Ji ZL, Chen YZ: TTD: Therapeutic Target Database. Nucleic Acids Res. 2002 Jan 1;30(1):412-5. [PubMed:11752352]


Pharmacological action
General Function
Vitamin d3 25-hydroxylase activity
Specific Function
Cytochromes P450 are a group of heme-thiolate monooxygenases. In liver microsomes, this enzyme is involved in an NADPH-dependent electron transport pathway. It performs a variety of oxidation react...
Gene Name
Uniprot ID
Uniprot Name
Cytochrome P450 3A4
Molecular Weight
57342.67 Da
  1. Preissner S, Kroll K, Dunkel M, Senger C, Goldsobel G, Kuzman D, Guenther S, Winnenburg R, Schroeder M, Preissner R: SuperCYP: a comprehensive database on Cytochrome P450 enzymes including a tool for analysis of CYP-drug interactions. Nucleic Acids Res. 2010 Jan;38(Database issue):D237-43. doi: 10.1093/nar/gkp970. Epub 2009 Nov 24. [PubMed:19934256]
  2. Rendic S: Summary of information on human CYP enzymes: human P450 metabolism data. Drug Metab Rev. 2002 Feb-May;34(1-2):83-448. [PubMed:11996015]
Pharmacological action
General Function
Steroid hydroxylase activity
Specific Function
Cytochromes P450 are a group of heme-thiolate monooxygenases. In liver microsomes, this enzyme is involved in an NADPH-dependent electron transport pathway. It oxidizes a variety of structurally un...
Gene Name
Uniprot ID
Uniprot Name
Cytochrome P450 2C8
Molecular Weight
55824.275 Da
  1. Trimethoprim FDA label [File]
Pharmacological action
General Function
Steroid hydroxylase activity
Specific Function
Cytochromes P450 are a group of heme-thiolate monooxygenases. In liver microsomes, this enzyme is involved in an NADPH-dependent electron transport pathway. It oxidizes a variety of structurally un...
Gene Name
Uniprot ID
Uniprot Name
Cytochrome P450 2C9
Molecular Weight
55627.365 Da
  1. Rendic S: Summary of information on human CYP enzymes: human P450 metabolism data. Drug Metab Rev. 2002 Feb-May;34(1-2):83-448. [PubMed:11996015]


Pharmacological action
General Function
Xenobiotic-transporting atpase activity
Specific Function
Energy-dependent efflux pump responsible for decreased drug accumulation in multidrug-resistant cells.
Gene Name
Uniprot ID
Uniprot Name
Multidrug resistance protein 1
Molecular Weight
141477.255 Da
  1. Romiti N, Tramonti G, Chieli E: Influence of different chemicals on MDR-1 P-glycoprotein expression and activity in the HK-2 proximal tubular cell line. Toxicol Appl Pharmacol. 2002 Sep 1;183(2):83-91. [PubMed:12387747]
  2. Polli JW, Wring SA, Humphreys JE, Huang L, Morgan JB, Webster LO, Serabjit-Singh CS: Rational use of in vitro P-glycoprotein assays in drug discovery. J Pharmacol Exp Ther. 2001 Nov;299(2):620-8. [PubMed:11602674]
Pharmacological action
General Function
Quaternary ammonium group transmembrane transporter activity
Specific Function
Mediates tubular uptake of organic compounds from circulation. Mediates the influx of agmatine, dopamine, noradrenaline (norepinephrine), serotonin, choline, famotidine, ranitidine, histamin, creat...
Gene Name
Uniprot ID
Uniprot Name
Solute carrier family 22 member 2
Molecular Weight
62579.99 Da
  1. Muller F, Konig J, Hoier E, Mandery K, Fromm MF: Role of organic cation transporter OCT2 and multidrug and toxin extrusion proteins MATE1 and MATE2-K for transport and drug interactions of the antiviral lamivudine. Biochem Pharmacol. 2013 Sep 15;86(6):808-15. doi: 10.1016/j.bcp.2013.07.008. Epub 2013 Jul 20. [PubMed:23876341]
  2. BACTRIM (sulfamethoxazole and trimethoprim) FDA Label [Link]

Drug created on June 13, 2005 07:24 / Updated on August 21, 2019 23:33