
Accession Number
DB01015  (APRD00076)
Small Molecule

A bacteriostatic antibacterial agent that interferes with folic acid synthesis in susceptible bacteria. Its broad spectrum of activity has been limited by the development of resistance. (From Martindale, The Extra Pharmacopoeia, 30th ed, p208)

  • 3-(p-Aminophenylsulfonamido)-5-methylisoxazole
  • 3-Sulfanilamido-5-methylisoxazole
  • 4-Amino-N-(5-methyl-3-isoxazolyl)benzenesulfonamide
  • Gantanol (tn)
  • SMX
  • Sulfamethoxazole
External IDs
NSC-147832 / RO 4-2130 / STX-608
Product Images
Prescription Products
NameDosageStrengthRouteLabellerMarketing StartMarketing End
Apo Sulfamethoxazole Tab 500mgTablet500 mgOralApotex Corporation1978-12-31Not applicableCanada
Sulfamethoxazole Tab 500mgTablet500 mgOralPro Doc Limitee1978-12-311999-08-12Canada
Generic Prescription Products
NameDosageStrengthRouteLabellerMarketing StartMarketing End
Sulfamethoxazole and TrimethoprimTablet800 mg/1OralRemedy Repack2012-07-162012-11-09Us
Mixture Products
NameIngredientsDosageRouteLabellerMarketing StartMarketing End
Apo Sulfatrim DS TabSulfamethoxazole (800 mg) + Trimethoprim (160 mg)TabletOralApotex Corporation1979-12-31Not applicableCanada
Apo Sulfatrim PediatricSulfamethoxazole (100 mg) + Trimethoprim (20 mg)TabletOralApotex Corporation1979-12-31Not applicableCanada
Apo Sulfatrim TabSulfamethoxazole (400 mg) + Trimethoprim (80 mg)TabletOralApotex Corporation1979-12-31Not applicableCanada
Apo-sulfatrim Oral SuspensionSulfamethoxazole (40 mg) + Trimethoprim (8 mg)SuspensionOralApotex Corporation1989-12-31Not applicableCanada
BactrimSulfamethoxazole (400 mg/1) + Trimethoprim (80 mg/1)TabletOralSun Pharmaceutical Industries Limited2004-11-01Not applicableUs
BactrimSulfamethoxazole (400 mg/1) + Trimethoprim (80 mg/1)TabletOralAR Scientific, Inc.2004-11-012018-12-28Us
Bactrim DSSulfamethoxazole (800 mg/1) + Trimethoprim (160 mg/1)TabletOralSun Pharmaceutical Industries Limited2004-11-01Not applicableUs
Bactrim DSSulfamethoxazole (800 mg/1) + Trimethoprim (160 mg/1)TabletOralPhysicians Total Care, Inc.1997-08-26Not applicableUs
Bactrim DSSulfamethoxazole (800 mg/1) + Trimethoprim (160 mg/1)TabletOralAR Scientific, Inc.2004-11-012018-12-28Us
Bactrim DS Roche TabSulfamethoxazole (800 mg) + Trimethoprim (160 mg)TabletOralHoffmann La Roche1976-12-312001-07-19Canada
Unapproved/Other Products
NameIngredientsDosageRouteLabellerMarketing StartMarketing End
SeptraSulfamethoxazole (200 mg/5mL) + Trimethoprim (40 mg/5mL)SuspensionOralMonarch Pharmaceuticals, Inc.2007-03-282007-03-28Us
Septra GrapeSulfamethoxazole (200 mg/5mL) + Trimethoprim (40 mg/5mL)SuspensionOralMonarch Pharmaceuticals, Inc.2007-03-282007-03-28Us
Sulfamethoxazole and TrimethoprimSulfamethoxazole (800 mg/1) + Trimethoprim (160 mg/1)TabletOralVintage Pharmaceuticals, LLC2007-11-272007-11-27Us
Sulfamethoxazole and TrimethoprimSulfamethoxazole (200 mg/5) + Trimethoprim (40 mg/5)SuspensionOralVintage Pharmaceuticals, LLC2008-03-242008-03-24Us
Sulfamethoxazole and TrimethoprimSulfamethoxazole (200 mg/5) + Trimethoprim (40 mg/5)SuspensionOralVintage Pharmaceuticals, LLC2008-03-242008-03-24Us
Sulfamethoxazole and TrimethoprimSulfamethoxazole (400 mg/1) + Trimethoprim (80 mg/1)TabletOralVintage Pharmaceuticals, LLC2007-11-272007-11-27Us
International/Other Brands
Gantanol / Sinomin / Urobak
CAS number
Average: 253.278
Monoisotopic: 253.052111923
Chemical Formula
InChI Key



For the treatment bacterial infections causing bronchitis, prostatitis and urinary tract infections.

Associated Conditions

Sulfamethoxazole is a sulfonamide drug that inhibits bacterial synthesis of dihydrofolic acid by competing with para-aminobenzoic acid (PABA) for binding to dihydropteroate synthetase (dihydrofolate synthetase). Sulfamethoxazole is bacteriostatic in nature. Inhibition of dihydrofolic acid synthesis decreases the synthesis of bacterial nucleotides and DNA. Sulfamethoxazole is normally given in combination with Trimethoprim, a dihydrofolate reductase inhibitor, which inhibits the reduction of dihydrofolic acid to tetrahydrofolic acid. Studies have shown that bacterial resistance develops more slowly with the combination of the two drugs than with either Trimethoprim or Sulfamethoxazole alone.

Mechanism of action

Sulfonamides inhibit the enzymatic conversion of pteridine and p-aminobenzoic acid (PABA) to dihydropteroic acid by competing with PABA for binding to dihydrofolate synthetase, an intermediate of tetrahydrofolic acid (THF) synthesis. THF is required for the synthesis of purines and dTMP and inhibition of its synthesis inhibits bacterial growth. Pyrimethamine and trimethoprim inhibit dihydrofolate reductase, another step in THF synthesis, and therefore act synergistically with the sulfonamides.

ADihydropteroate synthase
Escherichia coli (strain K12)
ABifunctional protein FolC
Escherichia coli (strain K12)
UGlutathione S-transferase PNot AvailableHuman

Rapidly absorbed following oral administration. Also well-absorbed topically.

Volume of distribution
Not Available
Protein binding



Hepatic. The metabolism of sulfamethoxazole occurs predominately by N4-acetylation, although the glucuronide conjugate has been identified.

Route of elimination
Not Available
Half life

10 hours

Not Available

Sulfamethoxazole may cause nausea, vomiting, diarrhea and hypersensitivity reactions. Hematologic effects such as anemia, agranulocytosis, thrombocytopenia and hemolytic anemia in patients with glucose-6-phosphate dehydrogenase deficiency may also occur. Sulfamethoxazole may displace bilirubin from albumin binding sites causing jaundice or kernicterus in newborns.

Affected organisms
  • Gram negative and gram positive bacteria
  • Listeria monocytogenes
  • Escherichia coli
Not Available
Pharmacogenomic Effects/ADRs
Interacting Gene/EnzymeAllele nameGenotype(s)Defining Change(s)Type(s)DescriptionDetails
Glucose-6-phosphate 1-dehydrogenaseVilleurbanneNot Available1000_1002delACCADR InferredIncreased risk of dose-related hemolysis.Details
Glucose-6-phosphate 1-dehydrogenaseTorunNot Available1006A->GADR InferredIncreased risk of dose-related hemolysis.Details
Glucose-6-phosphate 1-dehydrogenaseSunderlandNot Available105_107delCATADR InferredIncreased risk of dose-related hemolysis.Details
Glucose-6-phosphate 1-dehydrogenaseIwatsukiNot Available1081G->AADR InferredIncreased risk of dose-related hemolysis.Details
Glucose-6-phosphate 1-dehydrogenaseSerresNot Available1082C->TADR InferredIncreased risk of dose-related hemolysis.Details
Glucose-6-phosphate 1-dehydrogenaseTondelaNot Available1084_1101delCTGAACGAGCGCAAGGCCADR InferredIncreased risk of dose-related hemolysis.Details
Glucose-6-phosphate 1-dehydrogenaseLoma LindaNot Available1089C->AADR InferredIncreased risk of dose-related hemolysis.Details
Glucose-6-phosphate 1-dehydrogenaseAachenNot Available1089C->GADR InferredIncreased risk of dose-related hemolysis.Details
Glucose-6-phosphate 1-dehydrogenaseTenriNot Available1096A->GADR InferredIncreased risk of dose-related hemolysis.Details
Glucose-6-phosphate 1-dehydrogenaseMontpellierNot Available1132G>AADR InferredIncreased risk of dose-related hemolysis.Details
Glucose-6-phosphate 1-dehydrogenaseCalvo MackennaNot Available1138A->GADR InferredIncreased risk of dose-related hemolysis.Details
Glucose-6-phosphate 1-dehydrogenaseRileyNot Available1139T->CADR InferredIncreased risk of dose-related hemolysis.Details
Glucose-6-phosphate 1-dehydrogenaseOlomoucNot Available1141T->CADR InferredIncreased risk of dose-related hemolysis.Details
Glucose-6-phosphate 1-dehydrogenaseTomahNot Available1153T->CADR InferredIncreased risk of dose-related hemolysis.Details
Glucose-6-phosphate 1-dehydrogenaseLynwoodNot Available1154G->TADR InferredIncreased risk of dose-related hemolysis.Details
Glucose-6-phosphate 1-dehydrogenaseMadridNot Available1155C->GADR InferredIncreased risk of dose-related hemolysis.Details
Glucose-6-phosphate 1-dehydrogenaseIowa, Walter Reed, SpringfieldNot Available1156A->GADR InferredIncreased risk of dose-related hemolysis.Details
Glucose-6-phosphate 1-dehydrogenaseBeverly Hills, Genova, Iwate, Niigata, YamaguchiNot Available1160G->AADR InferredIncreased risk of dose-related hemolysis.Details
Glucose-6-phosphate 1-dehydrogenaseHartfordNot Available1162A->GADR InferredIncreased risk of dose-related hemolysis.Details
Glucose-6-phosphate 1-dehydrogenasePrahaNot Available1166A->GADR InferredIncreased risk of dose-related hemolysis.Details
Glucose-6-phosphate 1-dehydrogenaseKrakowNot Available1175T>CADR InferredIncreased risk of dose-related hemolysis.Details
Glucose-6-phosphate 1-dehydrogenaseWisconsinNot Available1177C->GADR InferredIncreased risk of dose-related hemolysis.Details
Glucose-6-phosphate 1-dehydrogenaseNashville, Anaheim, PorticiNot Available1178G->AADR InferredIncreased risk of dose-related hemolysis.Details
Glucose-6-phosphate 1-dehydrogenaseAlhambraNot Available1180G->CADR InferredIncreased risk of dose-related hemolysis.Details
Glucose-6-phosphate 1-dehydrogenaseBariNot Available1187C->TADR InferredIncreased risk of dose-related hemolysis.Details
Glucose-6-phosphate 1-dehydrogenasePuerto LimonNot Available1192G->AADR InferredIncreased risk of dose-related hemolysis.Details
Glucose-6-phosphate 1-dehydrogenaseCovao do LoboNot Available1205C>AADR InferredIncreased risk of dose-related hemolysis.Details
Glucose-6-phosphate 1-dehydrogenaseClinicNot Available1215G->AADR InferredIncreased risk of dose-related hemolysis.Details
Glucose-6-phosphate 1-dehydrogenaseUtrechtNot Available1225C->TADR InferredIncreased risk of dose-related hemolysis.Details
Glucose-6-phosphate 1-dehydrogenaseSuwalkiNot Available1226C->GADR InferredIncreased risk of dose-related hemolysis.Details
Glucose-6-phosphate 1-dehydrogenaseRiversideNot Available1228G->TADR InferredIncreased risk of dose-related hemolysis.Details
Glucose-6-phosphate 1-dehydrogenaseJapan, ShinagawaNot Available1229G->AADR InferredIncreased risk of dose-related hemolysis.Details
Glucose-6-phosphate 1-dehydrogenaseKawasakiNot Available1229G->CADR InferredIncreased risk of dose-related hemolysis.Details
Glucose-6-phosphate 1-dehydrogenaseMunichNot Available1231A->GADR InferredIncreased risk of dose-related hemolysis.Details
Glucose-6-phosphate 1-dehydrogenaseGeorgiaNot Available1284C->AADR InferredIncreased risk of dose-related hemolysis.Details
Glucose-6-phosphate 1-dehydrogenaseSumareNot Available1292T->GADR InferredIncreased risk of dose-related hemolysis.Details
Glucose-6-phosphate 1-dehydrogenaseTelti/KobeNot Available1318C->TADR InferredIncreased risk of dose-related hemolysis.Details
Glucose-6-phosphate 1-dehydrogenaseSantiago de Cuba, MoriokaNot Available1339G->AADR InferredIncreased risk of dose-related hemolysis.Details
Glucose-6-phosphate 1-dehydrogenaseHarimaNot Available1358T->AADR InferredIncreased risk of dose-related hemolysis.Details
Glucose-6-phosphate 1-dehydrogenaseFiguera da FozNot Available1366G->CADR InferredIncreased risk of dose-related hemolysis.Details
Glucose-6-phosphate 1-dehydrogenaseAmiensNot Available1367A>TADR InferredIncreased risk of dose-related hemolysis.Details
Glucose-6-phosphate 1-dehydrogenaseBangkok NoiNot Available1376G->T, 1502T->GADR InferredIncreased risk of dose-related hemolysis.Details
Glucose-6-phosphate 1-dehydrogenaseFukayaNot Available1462G->AADR InferredIncreased risk of dose-related hemolysis.Details
Glucose-6-phosphate 1-dehydrogenaseCampinasNot Available1463G->TADR InferredIncreased risk of dose-related hemolysis.Details
Glucose-6-phosphate 1-dehydrogenaseBuenos AiresNot Available1465C>TADR InferredIncreased risk of dose-related hemolysis.Details
Glucose-6-phosphate 1-dehydrogenaseArakawaNot Available1466C->TADR InferredIncreased risk of dose-related hemolysis.Details
Glucose-6-phosphate 1-dehydrogenaseBrightonNot Available1488_1490delGAAADR InferredIncreased risk of dose-related hemolysis.Details
Glucose-6-phosphate 1-dehydrogenaseKozukataNot Available159G->CADR InferredIncreased risk of dose-related hemolysis.Details
Glucose-6-phosphate 1-dehydrogenaseAmsterdamNot Available180_182delTCTADR InferredIncreased risk of dose-related hemolysis.Details
Glucose-6-phosphate 1-dehydrogenaseNo nameNot Available202G->A, 376A->G, 1264C>GADR InferredIncreased risk of dose-related hemolysis.Details
Glucose-6-phosphate 1-dehydrogenaseSwanseaNot Available224T->CADR InferredIncreased risk of dose-related hemolysis.Details
Glucose-6-phosphate 1-dehydrogenaseUrayasuNot Available281_283delAGAADR InferredIncreased risk of dose-related hemolysis.Details
Glucose-6-phosphate 1-dehydrogenaseVancouverNot Available317C->G544C->T592C->TADR InferredIncreased risk of dose-related hemolysis.Details
Glucose-6-phosphate 1-dehydrogenaseMt SinaiNot Available376A->G, 1159C->TADR InferredIncreased risk of dose-related hemolysis.Details
Glucose-6-phosphate 1-dehydrogenasePlymouthNot Available488G->AADR InferredIncreased risk of dose-related hemolysis.Details
Glucose-6-phosphate 1-dehydrogenaseVolendamNot Available514C->TADR InferredIncreased risk of dose-related hemolysis.Details
Glucose-6-phosphate 1-dehydrogenaseShinshuNot Available527A->GADR InferredIncreased risk of dose-related hemolysis.Details
Glucose-6-phosphate 1-dehydrogenaseChikugoNot Available535A->TADR InferredIncreased risk of dose-related hemolysis.Details
Glucose-6-phosphate 1-dehydrogenaseTsukuiNot Available561_563delCTCADR InferredIncreased risk of dose-related hemolysis.Details
Glucose-6-phosphate 1-dehydrogenasePedoplis-CkaroNot Available573C>GADR InferredIncreased risk of dose-related hemolysis.Details
Glucose-6-phosphate 1-dehydrogenaseSantiagoNot Available593G->CADR InferredIncreased risk of dose-related hemolysis.Details
Glucose-6-phosphate 1-dehydrogenaseMinnesota, Marion, Gastonia, LeJeuneNot Available637G->TADR InferredIncreased risk of dose-related hemolysis.Details
Glucose-6-phosphate 1-dehydrogenaseCincinnatiNot Available637G->T, 1037A->TADR InferredIncreased risk of dose-related hemolysis.Details
Glucose-6-phosphate 1-dehydrogenaseHarilaouNot Available648T->GADR InferredIncreased risk of dose-related hemolysis.Details
Glucose-6-phosphate 1-dehydrogenaseNorth DallasNot Available683_685delACAADR InferredIncreased risk of dose-related hemolysis.Details
Glucose-6-phosphate 1-dehydrogenaseAsahikawaNot Available695G->AADR InferredIncreased risk of dose-related hemolysis.Details
Glucose-6-phosphate 1-dehydrogenaseDurhamNot Available713A->GADR InferredIncreased risk of dose-related hemolysis.Details
Glucose-6-phosphate 1-dehydrogenaseStonybrookNot Available724_729delGGCACTADR InferredIncreased risk of dose-related hemolysis.Details
Glucose-6-phosphate 1-dehydrogenaseWayneNot Available769C->GADR InferredIncreased risk of dose-related hemolysis.Details
Glucose-6-phosphate 1-dehydrogenaseAveiroNot Available806G->AADR InferredIncreased risk of dose-related hemolysis.Details
Glucose-6-phosphate 1-dehydrogenaseCleveland CorumNot Available820G->AADR InferredIncreased risk of dose-related hemolysis.Details
Glucose-6-phosphate 1-dehydrogenaseLilleNot Available821A>TADR InferredIncreased risk of dose-related hemolysis.Details
Glucose-6-phosphate 1-dehydrogenaseBangkokNot Available825G>CADR InferredIncreased risk of dose-related hemolysis.Details
Glucose-6-phosphate 1-dehydrogenaseSugaoNot Available826C->TADR InferredIncreased risk of dose-related hemolysis.Details
Glucose-6-phosphate 1-dehydrogenaseLa JollaNot Available832T->CADR InferredIncreased risk of dose-related hemolysis.Details
Glucose-6-phosphate 1-dehydrogenaseWexhamNot Available833C->TADR InferredIncreased risk of dose-related hemolysis.Details
Glucose-6-phosphate 1-dehydrogenasePiotrkowNot Available851T>CADR InferredIncreased risk of dose-related hemolysis.Details
Glucose-6-phosphate 1-dehydrogenaseWest VirginiaNot Available910G->TADR InferredIncreased risk of dose-related hemolysis.Details
Glucose-6-phosphate 1-dehydrogenaseOmiyaNot Available921G->CADR InferredIncreased risk of dose-related hemolysis.Details
Glucose-6-phosphate 1-dehydrogenaseNaraNot Available953_976delCCACCAAAGGGTACCTGGAC GACCADR InferredIncreased risk of dose-related hemolysis.Details
Glucose-6-phosphate 1-dehydrogenaseManhattanNot Available962G->AADR InferredIncreased risk of dose-related hemolysis.Details
Glucose-6-phosphate 1-dehydrogenaseRehevotNot Available964T->CADR InferredIncreased risk of dose-related hemolysis.Details
Glucose-6-phosphate 1-dehydrogenaseHoniaraNot Available99A->G / 1360C->TADR InferredIncreased risk of dose-related hemolysis.Details
Glucose-6-phosphate 1-dehydrogenaseTokyo, FukushimaNot Available1246G->AADR InferredIncreased risk of dose-related hemolysis.Details
Glucose-6-phosphate 1-dehydrogenaseChathamNot Available1003G->AADR InferredIncreased risk of dose-related hemolysis.Details
Glucose-6-phosphate 1-dehydrogenaseFushanNot Available1004C->AADR InferredIncreased risk of dose-related hemolysis.Details
Glucose-6-phosphate 1-dehydrogenasePartenopeNot Available1052G->TADR InferredIncreased risk of dose-related hemolysis.Details
Glucose-6-phosphate 1-dehydrogenaseIerapetraNot Available1057C->TADR InferredIncreased risk of dose-related hemolysis.Details
Glucose-6-phosphate 1-dehydrogenaseAnadiaNot Available1193A->GADR InferredIncreased risk of dose-related hemolysis.Details
Glucose-6-phosphate 1-dehydrogenaseAbenoNot Available1220A->CADR InferredIncreased risk of dose-related hemolysis.Details
Glucose-6-phosphate 1-dehydrogenaseSurabayaNot Available1291G->AADR InferredIncreased risk of dose-related hemolysis.Details
Glucose-6-phosphate 1-dehydrogenasePawneeNot Available1316G->CADR InferredIncreased risk of dose-related hemolysis.Details
Glucose-6-phosphate 1-dehydrogenaseS. AntiocoNot Available1342A->GADR InferredIncreased risk of dose-related hemolysis.Details
Glucose-6-phosphate 1-dehydrogenaseCassanoNot Available1347G->CADR InferredIncreased risk of dose-related hemolysis.Details
Glucose-6-phosphate 1-dehydrogenaseHermoupolisNot Available1347G->C / 1360C->TADR InferredIncreased risk of dose-related hemolysis.Details
Glucose-6-phosphate 1-dehydrogenaseUnion,Maewo, Chinese-2, KaloNot Available1360C->TADR InferredIncreased risk of dose-related hemolysis.Details
Glucose-6-phosphate 1-dehydrogenaseAndalusNot Available1361G->AADR InferredIncreased risk of dose-related hemolysis.Details
Glucose-6-phosphate 1-dehydrogenaseCosenzaNot Available1376G->CADR InferredIncreased risk of dose-related hemolysis.Details
Glucose-6-phosphate 1-dehydrogenaseCanton, Taiwan- Hakka, Gifu-like, Agrigento-likeNot Available1376G->TADR InferredIncreased risk of dose-related hemolysis.Details
Glucose-6-phosphate 1-dehydrogenaseFloresNot Available1387C->AADR InferredIncreased risk of dose-related hemolysis.Details
Glucose-6-phosphate 1-dehydrogenaseKaiping, Anant, Dhon, Sapporo-like, WoseraNot Available1388G->AADR InferredIncreased risk of dose-related hemolysis.Details
Glucose-6-phosphate 1-dehydrogenaseKamogawaNot Available169C->TADR InferredIncreased risk of dose-related hemolysis.Details
Glucose-6-phosphate 1-dehydrogenaseCostanzoNot Available179T>CADR InferredIncreased risk of dose-related hemolysis.Details
Glucose-6-phosphate 1-dehydrogenaseAmazoniaNot Available185C->AADR InferredIncreased risk of dose-related hemolysis.Details
Glucose-6-phosphate 1-dehydrogenaseSongklanagarindNot Available196T->AADR InferredIncreased risk of dose-related hemolysis.Details
Glucose-6-phosphate 1-dehydrogenaseHechiNot Available202G->A / 871G->AADR InferredIncreased risk of dose-related hemolysis.Details
Glucose-6-phosphate 1-dehydrogenaseNamouruNot Available208T->CADR InferredIncreased risk of dose-related hemolysis.Details
Glucose-6-phosphate 1-dehydrogenaseBao LocNot Available352T>CADR InferredIncreased risk of dose-related hemolysis.Details
Glucose-6-phosphate 1-dehydrogenaseCrispimNot Available375G->T, 379G->T383T->C384C>TADR InferredIncreased risk of dose-related hemolysis.Details
Glucose-6-phosphate 1-dehydrogenaseAcrokorinthosNot Available376A->G / 463C->GADR InferredIncreased risk of dose-related hemolysis.Details
Glucose-6-phosphate 1-dehydrogenaseSanta MariaNot Available376A->G / 542A->TADR InferredIncreased risk of dose-related hemolysis.Details
Glucose-6-phosphate 1-dehydrogenaseAnanindeuaNot Available376A->G / 871G->AADR InferredIncreased risk of dose-related hemolysis.Details
Glucose-6-phosphate 1-dehydrogenaseVanua LavaNot Available383T->CADR InferredIncreased risk of dose-related hemolysis.Details
Glucose-6-phosphate 1-dehydrogenaseValladolidNot Available406C->TADR InferredIncreased risk of dose-related hemolysis.Details
Glucose-6-phosphate 1-dehydrogenaseBelemNot Available409C->TADR InferredIncreased risk of dose-related hemolysis.Details
Glucose-6-phosphate 1-dehydrogenaseLiuzhouNot Available442G->AADR InferredIncreased risk of dose-related hemolysis.Details
Glucose-6-phosphate 1-dehydrogenaseShenzenNot Available473G>AADR InferredIncreased risk of dose-related hemolysis.Details
Glucose-6-phosphate 1-dehydrogenaseTaipei “Chinese- 3”Not Available493A->GADR InferredIncreased risk of dose-related hemolysis.Details
Glucose-6-phosphate 1-dehydrogenaseToledoNot Available496C>TADR InferredIncreased risk of dose-related hemolysis.Details
Glucose-6-phosphate 1-dehydrogenaseNaoneNot Available497G->AADR InferredIncreased risk of dose-related hemolysis.Details
Glucose-6-phosphate 1-dehydrogenaseNankangNot Available517T->CADR InferredIncreased risk of dose-related hemolysis.Details
Glucose-6-phosphate 1-dehydrogenaseMiaoliNot Available519C->GADR InferredIncreased risk of dose-related hemolysis.Details
Glucose-6-phosphate 1-dehydrogenaseMediterranean, Dallas, Panama‚ Sassari, Cagliari, BirminghamNot Available563C->TADR InferredIncreased risk of dose-related hemolysis.Details
Glucose-6-phosphate 1-dehydrogenaseCoimbra ShundeNot Available592C->TADR InferredIncreased risk of dose-related hemolysis.Details
Glucose-6-phosphate 1-dehydrogenaseNilgiriNot Available593G>AADR InferredIncreased risk of dose-related hemolysis.Details
Glucose-6-phosphate 1-dehydrogenaseRadlowoNot Available679C->TADR InferredIncreased risk of dose-related hemolysis.Details
Glucose-6-phosphate 1-dehydrogenaseRoubaixNot Available811G>CADR InferredIncreased risk of dose-related hemolysis.Details
Glucose-6-phosphate 1-dehydrogenaseHaikouNot Available835A->GADR InferredIncreased risk of dose-related hemolysis.Details
Glucose-6-phosphate 1-dehydrogenaseChinese-1Not Available835A->TADR InferredIncreased risk of dose-related hemolysis.Details
Glucose-6-phosphate 1-dehydrogenaseMizushimaNot Available848A>GADR InferredIncreased risk of dose-related hemolysis.Details
Glucose-6-phosphate 1-dehydrogenaseOsakaNot Available853C->TADR InferredIncreased risk of dose-related hemolysis.Details
Glucose-6-phosphate 1-dehydrogenaseViangchan, JammuNot Available871G->AADR InferredIncreased risk of dose-related hemolysis.Details
Glucose-6-phosphate 1-dehydrogenaseSeoulNot Available916G->AADR InferredIncreased risk of dose-related hemolysis.Details
Glucose-6-phosphate 1-dehydrogenaseLudhianaNot Available929G->AADR InferredIncreased risk of dose-related hemolysis.Details
Glucose-6-phosphate 1-dehydrogenaseFarroupilhaNot Available977C->AADR InferredIncreased risk of dose-related hemolysis.Details
Glucose-6-phosphate 1-dehydrogenaseChinese-5Not Available1024C->TADR InferredIncreased risk of dose-related hemolysis.Details
Glucose-6-phosphate 1-dehydrogenaseRignanoNot Available130G>AADR InferredIncreased risk of dose-related hemolysis.Details
Glucose-6-phosphate 1-dehydrogenaseOrissaNot Available131C->GADR InferredIncreased risk of dose-related hemolysis.Details
Glucose-6-phosphate 1-dehydrogenaseG6PDNiceNot Available1380G>CADR InferredIncreased risk of dose-related hemolysis.Details
Glucose-6-phosphate 1-dehydrogenaseKamiube, KeelungNot Available1387C->TADR InferredIncreased risk of dose-related hemolysis.Details
Glucose-6-phosphate 1-dehydrogenaseNeapolisNot Available1400C->GADR InferredIncreased risk of dose-related hemolysis.Details
Glucose-6-phosphate 1-dehydrogenaseAuresNot Available143T->CADR InferredIncreased risk of dose-related hemolysis.Details
Glucose-6-phosphate 1-dehydrogenaseSplitNot Available1442C->GADR InferredIncreased risk of dose-related hemolysis.Details
Glucose-6-phosphate 1-dehydrogenaseKambosNot Available148C->TADR InferredIncreased risk of dose-related hemolysis.Details
Glucose-6-phosphate 1-dehydrogenasePalestrinaNot Available170G>AADR InferredIncreased risk of dose-related hemolysis.Details
Glucose-6-phosphate 1-dehydrogenaseMetapontoNot Available172G->AADR InferredIncreased risk of dose-related hemolysis.Details
Glucose-6-phosphate 1-dehydrogenaseMusashinoNot Available185C->TADR InferredIncreased risk of dose-related hemolysis.Details
Glucose-6-phosphate 1-dehydrogenaseAsahiNot Available202G->AADR InferredIncreased risk of dose-related hemolysis.Details
Glucose-6-phosphate 1-dehydrogenaseA- (202), Ferrara INot Available202G->A / 376A->GADR InferredIncreased risk of dose-related hemolysis.Details
Glucose-6-phosphate 1-dehydrogenaseMurcia OristanoNot Available209A->GADR InferredIncreased risk of dose-related hemolysis.Details
Glucose-6-phosphate 1-dehydrogenaseUbe KonanNot Available241C->TADR InferredIncreased risk of dose-related hemolysis.Details
Glucose-6-phosphate 1-dehydrogenaseLagosantoNot Available242G->AADR InferredIncreased risk of dose-related hemolysis.Details
Glucose-6-phosphate 1-dehydrogenaseGuangzhouNot Available274C->TADR InferredIncreased risk of dose-related hemolysis.Details
Glucose-6-phosphate 1-dehydrogenaseHammersmithNot Available323T->AADR InferredIncreased risk of dose-related hemolysis.Details
Glucose-6-phosphate 1-dehydrogenaseSinnaiNot Available34G->TADR InferredIncreased risk of dose-related hemolysis.Details
Glucose-6-phosphate 1-dehydrogenaseA- (680)Not Available376A->G / 680G->TADR InferredIncreased risk of dose-related hemolysis.Details
Glucose-6-phosphate 1-dehydrogenaseA- (968), Betica,Selma, GuantanamoNot Available376A->G / 968T->CADR InferredIncreased risk of dose-related hemolysis.Details
Glucose-6-phosphate 1-dehydrogenaseSalerno PyrgosNot Available383T>GADR InferredIncreased risk of dose-related hemolysis.Details
Glucose-6-phosphate 1-dehydrogenaseQuing YanNot Available392G->TADR InferredIncreased risk of dose-related hemolysis.Details
Glucose-6-phosphate 1-dehydrogenaseLagesNot Available40G->AADR InferredIncreased risk of dose-related hemolysis.Details
Glucose-6-phosphate 1-dehydrogenaseIleshaNot Available466G->AADR InferredIncreased risk of dose-related hemolysis.Details
Glucose-6-phosphate 1-dehydrogenaseMahidolNot Available487G->AADR InferredIncreased risk of dose-related hemolysis.Details
Glucose-6-phosphate 1-dehydrogenaseMalagaNot Available542A->TADR InferredIncreased risk of dose-related hemolysis.Details
Glucose-6-phosphate 1-dehydrogenaseSibariNot Available634A->GADR InferredIncreased risk of dose-related hemolysis.Details
Glucose-6-phosphate 1-dehydrogenaseMexico CityNot Available680G->AADR InferredIncreased risk of dose-related hemolysis.Details
Glucose-6-phosphate 1-dehydrogenaseNanningNot Available703C->TADR InferredIncreased risk of dose-related hemolysis.Details
Glucose-6-phosphate 1-dehydrogenaseSeattle, Lodi, Modena, Ferrara II, Athens-likeNot Available844G->CADR InferredIncreased risk of dose-related hemolysis.Details
Glucose-6-phosphate 1-dehydrogenaseBajo MaumereNot Available844G->TADR InferredIncreased risk of dose-related hemolysis.Details
Glucose-6-phosphate 1-dehydrogenaseMontalbanoNot Available854G->AADR InferredIncreased risk of dose-related hemolysis.Details
Glucose-6-phosphate 1-dehydrogenaseKalyan-Kerala, Jamnaga, RohiniNot Available949G->AADR InferredIncreased risk of dose-related hemolysis.Details
Glucose-6-phosphate 1-dehydrogenaseGaoheNot Available95A->GADR InferredIncreased risk of dose-related hemolysis.Details


Drug Interactions
(1S,6R)-3-{[3-(TRIFLUOROMETHYL)-5,6-DIHYDRO[1,2,4]TRIAZOLO[4,3-A]PYRAZIN-7(8H)-YL]CARBONYL}-6-(2,4,5-TRIFLUOROPHENYL)CYCLOHEX-3-EN-1-AMINE(1S,6R)-3-{[3-(TRIFLUOROMETHYL)-5,6-DIHYDRO[1,2,4]TRIAZOLO[4,3-A]PYRAZIN-7(8H)-YL]CARBONYL}-6-(2,4,5-TRIFLUOROPHENYL)CYCLOHEX-3-EN-1-AMINE may increase the hypoglycemic activities of Sulfamethoxazole.
2,4-thiazolidinedione2,4-thiazolidinedione may increase the hypoglycemic activities of Sulfamethoxazole.
7,8-Dichloro-1,2,3,4-tetrahydroisoquinoline7,8-Dichloro-1,2,3,4-tetrahydroisoquinoline may increase the hypoglycemic activities of Sulfamethoxazole.
AbirateroneThe metabolism of Sulfamethoxazole can be decreased when combined with Abiraterone.
AcarboseThe therapeutic efficacy of Acarbose can be increased when used in combination with Sulfamethoxazole.
AceclofenacThe metabolism of Aceclofenac can be decreased when combined with Sulfamethoxazole.
AcenocoumarolThe therapeutic efficacy of Acenocoumarol can be increased when used in combination with Sulfamethoxazole.
AcetohexamideAcetohexamide may increase the hypoglycemic activities of Sulfamethoxazole.
Acetyl sulfisoxazoleThe metabolism of Sulfamethoxazole can be decreased when combined with Acetyl sulfisoxazole.
Acetylsalicylic acidAcetylsalicylic acid may increase the hypoglycemic activities of Sulfamethoxazole.
Food Interactions
  • Do not take calcium, aluminium, magnesium or iron supplements within 2 hours of taking this medication.
  • Take on empty stomach: 1 hour before or 2 hours after meals.
  • Take with a full glass of water.


Synthesis Reference

Yasushi Takagishi, Kiichiro Ohsuga, Sadao Ohama, "Suppository containing sulfamethoxazole/trimethoprim complex and process for preparing the same." U.S. Patent US4461765, issued December, 1975.

General References
Not Available
External Links
Human Metabolome Database
KEGG Compound
PubChem Compound
PubChem Substance
Therapeutic Targets Database
RxList Drug Page
ATC Codes
J01EE01 — Sulfamethoxazole and trimethoprimG01AE10 — Combinations of sulfonamidesJ01EC01 — Sulfamethoxazole
AHFS Codes
  • 08:12.20 — Sulfonamides
PDB Entries
Download (35 KB)

Clinical Trials

Clinical Trials
1Active Not RecruitingOtherBacterial Infections1
1CompletedTreatmentAnaplastic Astrocytoma (AA) / Astrocytic Tumors / Glioblastoma Multiforme (GBM) / Neoplasms, Brain1
1CompletedTreatmentHuman Immunodeficiency Virus (HIV) Infections / Pneumonia, Pneumocystis Carinii1
1, 2CompletedTreatmentInfection, Human Immunodeficiency Virus I / Pf Subclinical Parasitemia1
1, 2CompletedTreatmentKidney Diseases / Transplant, Kidney / Transplantation, Kidney / Transplantation, Renal1
1, 2WithdrawnSupportive CareChronic Myeloproliferative Disorders / Infection NOS / Leukemias / Lymphoproliferative Disorders / Malignant Lymphomas / Multiple Myeloma and Plasma Cell Neoplasm / Myelodysplastic Syndromes / Myelodysplastic/Myeloproliferative Neoplasms / Unspecified Adult Solid Tumor, Protocol Specific1
2CompletedNot AvailableTuberculosis1
2CompletedTreatmentCystic Fibrosis (CF)1
2CompletedTreatmentCystic Fibrosis (CF) / Methicillin-Resistant Staphylococcus Aureus (MRSA)1
2CompletedTreatmentDiabetes Mellitus, Insulin-Dependent1
2CompletedTreatmentMalignant Lymphomas2
2CompletedTreatmentUrinary Tract Infections (UTIs)1
2Enrolling by InvitationTreatmentHypotonia Cystinuria Syndrome / Isolated PREPL Deficiency1
2Not Yet RecruitingTreatmentMethicillin-Resistant Staphylococcus Aureus (MRSA) / Skin-structure infections1
2RecruitingPreventionProstate Infections1
2RecruitingTreatmentAtopic Dermatitis (AD)1
2RecruitingTreatmentCommunity-acquired Methicillin-resistant Staphylococcus Aureus Infection / Community-Acquired MRSA Infections1
2RecruitingTreatmentCystic Fibrosis (CF)1
2RecruitingTreatmentInfection NOS / Multiple Myeloma (MM)1
2RecruitingTreatmentUrinary Tract Infections (UTIs)1
2TerminatedTreatmentEnd-Stage Renal Disease (ESRD)1
2Unknown StatusTreatmentHip Prosthetic Joint Infection1
2WithdrawnTreatmentUrinary Tract Infections, Recurrent1
2, 3TerminatedPreventionHuman Immunodeficiency Virus (HIV) Infections / Pneumonia, Interstitial Plasma Cell / Tuberculosis1
2, 3Unknown StatusTreatmentPneumonia, Pneumocystis / Prevention & Control1
3CompletedPreventionLife-threatening Infection / Nutrition Disorders1
3CompletedPreventionPlasmodium Infections1
3CompletedPreventionUrinary Tract Infections (UTIs) / Vesicoureteral Reflux1
3CompletedSupportive CareInfection NOS / Multiple Myeloma (MM)1
3CompletedTreatmentAntibiotics / Chronic Obstructive Pulmonary Disease (COPD) / Sepsis1
3CompletedTreatmentHuman Immunodeficiency Virus (HIV) Infections / Pneumonia, Pneumocystis Carinii1
3CompletedTreatmentUrinary Tract Infections, Recurrent1
3Not Yet RecruitingTreatmentChronic Rhinosinusitis (Diagnosis)1
3RecruitingPreventionChronic Kidney Disease (CKD) / Renal Hypodysplasia, Nonsyndromic, 1 / Vesicoureteral Reflux1
3RecruitingTreatmentEnterobacteriaceae Infections1
3TerminatedPreventionMalaria in Pregnancy1
3TerminatedTreatmentHuman Immunodeficiency Virus (HIV) Infections / Pneumonia, Interstitial Plasma Cell / Pneumonia, Pneumocystis Carinii1
4CompletedPreventionAcquired Immune Deficiency Syndrome (AIDS) / Anemias / Human Immunodeficiency Virus (HIV) Infections / Neutropenias / Newborn Infants1
4CompletedPreventionAsymptomatic Bacteriuria / Urinary Tract Infections (UTIs)1
4CompletedPreventionPyelonephritis / Renal Scars1
4CompletedTreatmentBMI >30 kg/m2 / MRSA / PCP / Pharmacokinetics / Tuberculosis1
4CompletedTreatmentHuman Immunodeficiency Virus (HIV)1
4CompletedTreatmentSkin Diseases, Infectious1
4RecruitingPreventionUrinary Bladder, Overactive / Urinary Tract Infections (UTIs)1
4TerminatedTreatmentDiabetes Mellitus (DM) / High Blood Pressure (Hypertension) / Stage 2 Hypertension1
4WithdrawnPreventionComplications; Breast Prosthesis, Infection or Inflammation1
4WithdrawnTreatmentPneumonia, Pneumocystis Carinii1
Not AvailableActive Not RecruitingPreventionHuman Immunodeficiency Virus (HIV)1
Not AvailableActive Not RecruitingTreatmentUrinary Tract Infections (UTIs)1
Not AvailableCompletedNot AvailableBronchitis2
Not AvailableCompletedTreatmentAbscesses1
Not AvailableCompletedTreatmentAbscesses / Infections caused by penicillinase-producing staphylococci1
Not AvailableCompletedTreatmentAbscesses / Skin Diseases, Bacterial1
Not AvailableCompletedTreatmentCellulitis1
Not AvailableCompletedTreatmentEnd-Stage Renal Disease (ESRD)1
Not AvailableCompletedTreatmentHuman Immunodeficiency Virus (HIV) Infections / Pneumonia, Pneumocystis Carinii2
Not AvailableCompletedTreatmentHypospadias1
Not AvailableNo Longer AvailableNot AvailableDiabetes, Diabetes Mellitus Type 11
Not AvailableRecruitingPreventionMotility Disorders / Staphylococcus Aureus1
Not AvailableRecruitingPreventionUrolithiasis / UTI1
Not AvailableRecruitingTreatmentLiver Abscess, Pyogenic1
Not AvailableTerminatedNot AvailablePrescribers' Drug Orders1
Not AvailableTerminatedPreventionCatheter-Associated Urinary Tract Infection1
Not AvailableUnknown StatusNot AvailableAsymptomatic Infections / Bacteriuria / Transplantation Infection / Urinary Tract Infections (UTIs)1
Not AvailableUnknown StatusPreventionUreteric Stent After Stone Surgery1
Not AvailableUnknown StatusTreatmentAbscesses1
Not AvailableWithdrawnTreatmentAbscesses1


  • Hoffmann la roche inc
  • Ascot hosp pharmaceuticals inc div travenol laboratories inc
  • Barr laboratories inc
  • Heather drug co inc
  • Sandoz inc
  • Watson laboratories inc
  • Shionogi usa inc
  • Medisca Inc.
Dosage forms
Injection, solution, concentrateIntravenous
TabletOral800 mg/1
TabletOral500 mg
Unit descriptionCostUnit
Sulfamethoxazole-TMP DS 800-160 mg tablet0.94USD tablet
Sulfamethoxazole powder0.41USD g
DrugBank does not sell nor buy drugs. Pricing information is supplied for informational purposes only.
Not Available


Experimental Properties
melting point (°C)167 °CPhysProp
water solubility610 mg/L (at 37 °C)YALKOWSKY,SH & DANNENFELSER,RM (1992)
logP0.89HANSCH,C ET AL. (1995)
logS-2.62ADME Research, USCD
Predicted Properties
Water Solubility0.459 mg/mLALOGPS
pKa (Strongest Acidic)6.16ChemAxon
pKa (Strongest Basic)1.97ChemAxon
Physiological Charge-1ChemAxon
Hydrogen Acceptor Count4ChemAxon
Hydrogen Donor Count2ChemAxon
Polar Surface Area98.22 Å2ChemAxon
Rotatable Bond Count2ChemAxon
Refractivity64.5 m3·mol-1ChemAxon
Polarizability24.99 Å3ChemAxon
Number of Rings2ChemAxon
Rule of FiveYesChemAxon
Ghose FilterYesChemAxon
Veber's RuleNoChemAxon
MDDR-like RuleNoChemAxon
Predicted ADMET features
Human Intestinal Absorption+1.0
Blood Brain Barrier+0.9382
Caco-2 permeable-0.5346
P-glycoprotein substrateNon-substrate0.8884
P-glycoprotein inhibitor INon-inhibitor0.9362
P-glycoprotein inhibitor IINon-inhibitor0.8754
Renal organic cation transporterNon-inhibitor0.9195
CYP450 2C9 substrateNon-substrate0.7652
CYP450 2D6 substrateNon-substrate0.9115
CYP450 3A4 substrateNon-substrate0.7632
CYP450 1A2 substrateNon-inhibitor0.9045
CYP450 2C9 inhibitorNon-inhibitor0.9071
CYP450 2D6 inhibitorNon-inhibitor0.9231
CYP450 2C19 inhibitorNon-inhibitor0.9025
CYP450 3A4 inhibitorNon-inhibitor0.9744
CYP450 inhibitory promiscuityLow CYP Inhibitory Promiscuity0.7151
Ames testNon AMES toxic0.9132
BiodegradationNot ready biodegradable0.9882
Rat acute toxicity1.6422 LD50, mol/kg Not applicable
hERG inhibition (predictor I)Weak inhibitor0.9143
hERG inhibition (predictor II)Non-inhibitor0.8956
ADMET data is predicted using admetSAR, a free tool for evaluating chemical ADMET properties. (23092397)


Mass Spec (NIST)
Download (9.61 KB)
SpectrumSpectrum TypeSplash Key
Predicted GC-MS Spectrum - GC-MSPredicted GC-MSNot Available
GC-MS Spectrum - EI-BGC-MSsplash10-05mo-8900000000-8a6ba1e89f89f5cb1e3c
Predicted MS/MS Spectrum - 10V, Positive (Annotated)Predicted LC-MS/MSNot Available
Predicted MS/MS Spectrum - 20V, Positive (Annotated)Predicted LC-MS/MSNot Available
Predicted MS/MS Spectrum - 40V, Positive (Annotated)Predicted LC-MS/MSNot Available
Predicted MS/MS Spectrum - 10V, Negative (Annotated)Predicted LC-MS/MSNot Available
Predicted MS/MS Spectrum - 20V, Negative (Annotated)Predicted LC-MS/MSNot Available
Predicted MS/MS Spectrum - 40V, Negative (Annotated)Predicted LC-MS/MSNot Available
LC-MS/MS Spectrum - LC-ESI-qTof , PositiveLC-MS/MSNot Available
LC-MS/MS Spectrum - LC-ESI-qTof , PositiveLC-MS/MSNot Available
LC-MS/MS Spectrum - LC-ESI-QTOF , negativeLC-MS/MSsplash10-0a4i-0940000000-88c5b1ef2f503737ca9a
LC-MS/MS Spectrum - LC-ESI-QTOF , negativeLC-MS/MSsplash10-0a4i-0900000000-b1b1b8e70ec8043bb89b
LC-MS/MS Spectrum - LC-ESI-QTOF , negativeLC-MS/MSsplash10-0a4i-0900000000-f9d7f50685c7e96eefcd
LC-MS/MS Spectrum - LC-ESI-ITFT , negativeLC-MS/MSsplash10-0a4i-0900000000-465bcb56920d86311f93
LC-MS/MS Spectrum - LC-ESI-ITFT , negativeLC-MS/MSsplash10-0udi-0390000000-5dac2c73d05262cd10c0
LC-MS/MS Spectrum - LC-ESI-ITFT , negativeLC-MS/MSsplash10-0a4i-0900000000-754d521e9fa8d49057e7
LC-MS/MS Spectrum - LC-ESI-ITFT , negativeLC-MS/MSsplash10-0a4i-0900000000-5dea192ddf68e39f5c6c
LC-MS/MS Spectrum - LC-ESI-ITFT , negativeLC-MS/MSsplash10-0a4i-5900000000-f376319dc72913e8db61
LC-MS/MS Spectrum - LC-ESI-ITFT , negativeLC-MS/MSsplash10-08fu-9300000000-275ed92901e4719e8eb0
LC-MS/MS Spectrum - LC-ESI-ITFT , negativeLC-MS/MSsplash10-0udi-0290000000-b02c397c2d2954785c81
LC-MS/MS Spectrum - LC-ESI-ITFT , negativeLC-MS/MSsplash10-0a4i-0900000000-c61eade368561111e908
LC-MS/MS Spectrum - LC-ESI-ITFT , negativeLC-MS/MSsplash10-0a4i-0900000000-c85d502fd299d3c8942c
LC-MS/MS Spectrum - LC-ESI-ITFT , negativeLC-MS/MSsplash10-0a4i-4900000000-c8c24b18f27b59f6e693
LC-MS/MS Spectrum - LC-ESI-ITFT , negativeLC-MS/MSsplash10-0a4i-0900000000-c61eade368561111e908
LC-MS/MS Spectrum - LC-ESI-QTOF , negativeLC-MS/MSsplash10-0a4i-0910000000-64449078c4fdd8bf4614
LC-MS/MS Spectrum - LC-ESI-QTOF , negativeLC-MS/MSsplash10-0a4i-3900000000-58869a5ce23e7feeeedf
LC-MS/MS Spectrum - LC-ESI-QTOF , negativeLC-MS/MSsplash10-03di-9000000000-c388b00730b45caa4648
LC-MS/MS Spectrum - LC-ESI-QTOF , positiveLC-MS/MSsplash10-0a4i-3910000000-a82697559a690c6121ea
LC-MS/MS Spectrum - LC-ESI-QTOF , positiveLC-MS/MSsplash10-0a4i-0910000000-44dbcbdfb3ce5df0ba57
LC-MS/MS Spectrum - LC-ESI-QTOF , positiveLC-MS/MSsplash10-0a4i-0900000000-181bb6cd1b54b2b6495c
LC-MS/MS Spectrum - LC-ESI-QTOF , positiveLC-MS/MSsplash10-052b-0900000000-ef143045595a430e870d
LC-MS/MS Spectrum - LC-ESI-QTOF , positiveLC-MS/MSsplash10-0002-0900000000-c3682226c90f2e2715a0
LC-MS/MS Spectrum - LC-ESI-QTOF , positiveLC-MS/MSsplash10-0udi-0190000000-24d764d31dded89ff00f
LC-MS/MS Spectrum - LC-ESI-ITFT , positiveLC-MS/MSsplash10-052v-0900000000-2bfa4615b96e29115a6b
LC-MS/MS Spectrum - LC-ESI-ITFT , positiveLC-MS/MSsplash10-0udi-0090000000-64a7ff77c37052fd7340
LC-MS/MS Spectrum - LC-ESI-ITFT , positiveLC-MS/MSsplash10-0pb9-2940000000-0ca0de185b8cef9d025b
LC-MS/MS Spectrum - LC-ESI-ITFT , positiveLC-MS/MSsplash10-0a4i-4900000000-7fa1e7f1e8a16439e36b
LC-MS/MS Spectrum - LC-ESI-ITFT , positiveLC-MS/MSsplash10-0a4l-7900000000-8584244d965e9da53c66
LC-MS/MS Spectrum - LC-ESI-ITFT , positiveLC-MS/MSsplash10-052f-9500000000-00c6bdb3c2f34a8492b6
LC-MS/MS Spectrum - LC-ESI-ITFT , positiveLC-MS/MSsplash10-05mo-9400000000-914135419173af598f05
LC-MS/MS Spectrum - LC-ESI-ITFT , positiveLC-MS/MSsplash10-0udi-0090000000-cf49e6fbc7d210f2db82
LC-MS/MS Spectrum - LC-ESI-ITFT , positiveLC-MS/MSsplash10-0pb9-2940000000-cf1c49b6edd74e0db359
LC-MS/MS Spectrum - LC-ESI-ITFT , positiveLC-MS/MSsplash10-0a4i-4900000000-be7ef446a6f0292a0c15
LC-MS/MS Spectrum - LC-ESI-ITFT , positiveLC-MS/MSsplash10-0a4l-7900000000-96c9b596ad5235d5e8fd
LC-MS/MS Spectrum - LC-ESI-ITFT , positiveLC-MS/MSsplash10-052f-9600000000-c5bd253f35dc1f56f173
LC-MS/MS Spectrum - LC-ESI-ITFT , positiveLC-MS/MSsplash10-05mo-9400000000-68dc3bc1422a652b6c43
LC-MS/MS Spectrum - LC-ESI-ITFT , positiveLC-MS/MSsplash10-0a4v-0900000000-e147c7f66af9a39125b4
LC-MS/MS Spectrum - LC-ESI-QTOF , positiveLC-MS/MSsplash10-0zfr-2970000000-6fea429d8717a3a0e019
LC-MS/MS Spectrum - LC-ESI-QTOF , positiveLC-MS/MSsplash10-0a4l-6900000000-b134f68352446228a2de
LC-MS/MS Spectrum - LC-ESI-QTOF , positiveLC-MS/MSsplash10-00kf-9200000000-f766fcb18caedb6dc7b8
LC-MS/MS Spectrum - LC-ESI-ITFT , positiveLC-MS/MSsplash10-0a4l-6900000000-55bf55718dd534098430
LC-MS/MS Spectrum - LC-ESI-ITFT , positiveLC-MS/MSsplash10-052f-9500000000-6adbdcc86fd0c4aac92a
LC-MS/MS Spectrum - LC-ESI-ITFT , positiveLC-MS/MSsplash10-0a4r-0900000000-e69bb2beedb2b53adcda
LC-MS/MS Spectrum - LC-ESI-ITFT , positiveLC-MS/MSsplash10-0a4r-0900000000-c7d050466aea7503baaf
MS/MS Spectrum - , positiveLC-MS/MSsplash10-0zfr-1970000000-cbfc43ff8e81c2553da0
MS/MS Spectrum - , positiveLC-MS/MSsplash10-0zfr-2960000000-9e8c6c452dea7906eac4
MS/MS Spectrum - , positiveLC-MS/MSsplash10-0a4i-4901000000-b25f2b64f82210ccef6f
LC-MS/MS Spectrum - LC-ESI-QFT , positiveLC-MS/MSsplash10-0pb9-4930000000-0673f294c7ef0fcc9fc5


This compound belongs to the class of organic compounds known as aminobenzenesulfonamides. These are organic compounds containing a benzenesulfonamide moiety with an amine group attached to the benzene ring.
Organic compounds
Super Class
Benzene and substituted derivatives
Sub Class
Direct Parent
Alternative Parents
Benzenesulfonyl compounds / Aniline and substituted anilines / Organosulfonamides / Imidolactams / Isoxazoles / Heteroaromatic compounds / Aminosulfonyl compounds / Oxacyclic compounds / Azacyclic compounds / Primary amines
show 4 more
Aminobenzenesulfonamide / Benzenesulfonyl group / Aniline or substituted anilines / Organosulfonic acid amide / Imidolactam / Azole / Isoxazole / Organic sulfonic acid or derivatives / Organosulfonic acid or derivatives / Sulfonyl
show 16 more
Molecular Framework
Aromatic heteromonocyclic compounds
External Descriptors
substituted aniline, sulfonamide, isoxazoles, sulfonamide antibiotic (CHEBI:9332)


Escherichia coli (strain K12)
Pharmacological action
General Function
Metal ion binding
Specific Function
Catalyzes the condensation of para-aminobenzoate (pABA) with 6-hydroxymethyl-7,8-dihydropterin diphosphate (DHPt-PP) to form 7,8-dihydropteroate (H2Pte), the immediate precursor of folate derivatives.
Gene Name
Uniprot ID
Uniprot Name
Dihydropteroate synthase
Molecular Weight
30614.855 Da
  1. Hong YL, Hossler PA, Calhoun DH, Meshnick SR: Inhibition of recombinant Pneumocystis carinii dihydropteroate synthetase by sulfa drugs. Antimicrob Agents Chemother. 1995 Aug;39(8):1756-63. [PubMed:7486915]
Escherichia coli (strain K12)
Pharmacological action
General Function
Tetrahydrofolylpolyglutamate synthase activity
Specific Function
Conversion of folates to polyglutamate derivatives.
Gene Name
Uniprot ID
Uniprot Name
Bifunctional protein FolC
Molecular Weight
45405.225 Da
  1. Overington JP, Al-Lazikani B, Hopkins AL: How many drug targets are there? Nat Rev Drug Discov. 2006 Dec;5(12):993-6. [PubMed:17139284]
  2. Imming P, Sinning C, Meyer A: Drugs, their targets and the nature and number of drug targets. Nat Rev Drug Discov. 2006 Oct;5(10):821-34. [PubMed:17016423]
  3. Winstanley PA, Mberu EK, Szwandt IS, Breckenridge AM, Watkins WM: In vitro activities of novel antifolate drug combinations against Plasmodium falciparum and human granulocyte CFUs. Antimicrob Agents Chemother. 1995 Apr;39(4):948-52. [PubMed:7786001]
Pharmacological action
General Function
S-nitrosoglutathione binding
Specific Function
Conjugation of reduced glutathione to a wide number of exogenous and endogenous hydrophobic electrophiles. Regulates negatively CDK5 activity via p25/p35 translocation to prevent neurodegeneration.
Gene Name
Uniprot ID
Uniprot Name
Glutathione S-transferase P
Molecular Weight
23355.625 Da
  1. Callan HE, Jenkins RE, Maggs JL, Lavergne SN, Clarke SE, Naisbitt DJ, Park BK: Multiple adduction reactions of nitroso sulfamethoxazole with cysteinyl residues of peptides and proteins: implications for hapten formation. Chem Res Toxicol. 2009 May;22(5):937-48. doi: 10.1021/tx900034r. [PubMed:19358516]


Pharmacological action
General Function
Arylamine n-acetyltransferase activity
Specific Function
Participates in the detoxification of a plethora of hydrazine and arylamine drugs. Catalyzes the N- or O-acetylation of various arylamine and heterocyclic amine substrates and is able to bioactivat...
Gene Name
Uniprot ID
Uniprot Name
Arylamine N-acetyltransferase 1
Molecular Weight
33898.445 Da
  1. Zhou SF, Zhou ZW, Yang LP, Cai JP: Substrates, inducers, inhibitors and structure-activity relationships of human Cytochrome P450 2C9 and implications in drug development. Curr Med Chem. 2009;16(27):3480-675. Epub 2009 Sep 1. [PubMed:19515014]
Pharmacological action
General Function
Arylamine n-acetyltransferase activity
Specific Function
Participates in the detoxification of a plethora of hydrazine and arylamine drugs. Catalyzes the N- or O-acetylation of various arylamine and heterocyclic amine substrates and is able to bioactivat...
Gene Name
Uniprot ID
Uniprot Name
Arylamine N-acetyltransferase 2
Molecular Weight
33542.235 Da
  1. Zhou SF, Zhou ZW, Yang LP, Cai JP: Substrates, inducers, inhibitors and structure-activity relationships of human Cytochrome P450 2C9 and implications in drug development. Curr Med Chem. 2009;16(27):3480-675. Epub 2009 Sep 1. [PubMed:19515014]
Pharmacological action
General Function
Steroid hydroxylase activity
Specific Function
Cytochromes P450 are a group of heme-thiolate monooxygenases. In liver microsomes, this enzyme is involved in an NADPH-dependent electron transport pathway. It oxidizes a variety of structurally un...
Gene Name
Uniprot ID
Uniprot Name
Cytochrome P450 2C9
Molecular Weight
55627.365 Da
  1. Zhou SF, Zhou ZW, Yang LP, Cai JP: Substrates, inducers, inhibitors and structure-activity relationships of human Cytochrome P450 2C9 and implications in drug development. Curr Med Chem. 2009;16(27):3480-675. Epub 2009 Sep 1. [PubMed:19515014]
  2. Cribb AE, Spielberg SP, Griffin GP: N4-hydroxylation of sulfamethoxazole by cytochrome P450 of the cytochrome P4502C subfamily and reduction of sulfamethoxazole hydroxylamine in human and rat hepatic microsomes. Drug Metab Dispos. 1995 Mar;23(3):406-14. [PubMed:7628308]
  3. Preissner S, Kroll K, Dunkel M, Senger C, Goldsobel G, Kuzman D, Guenther S, Winnenburg R, Schroeder M, Preissner R: SuperCYP: a comprehensive database on Cytochrome P450 enzymes including a tool for analysis of CYP-drug interactions. Nucleic Acids Res. 2010 Jan;38(Database issue):D237-43. doi: 10.1093/nar/gkp970. Epub 2009 Nov 24. [PubMed:19934256]
  4. Wen X, Wang JS, Backman JT, Laitila J, Neuvonen PJ: Trimethoprim and sulfamethoxazole are selective inhibitors of CYP2C8 and CYP2C9, respectively. Drug Metab Dispos. 2002 Jun;30(6):631-5. [PubMed:12019187]
  5. Miners JO, Birkett DJ: Cytochrome P4502C9: an enzyme of major importance in human drug metabolism. Br J Clin Pharmacol. 1998 Jun;45(6):525-38. [PubMed:9663807]
  6. Drug Interactions: Cytochrome P450 Drug Interaction Table [Link]
Pharmacological action
General Function
Prostaglandin-endoperoxide synthase activity
Specific Function
Converts arachidonate to prostaglandin H2 (PGH2), a committed step in prostanoid synthesis. Involved in the constitutive production of prostanoids in particular in the stomach and platelets. In gas...
Gene Name
Uniprot ID
Uniprot Name
Prostaglandin G/H synthase 1
Molecular Weight
68685.82 Da
  1. Zhou SF, Zhou ZW, Yang LP, Cai JP: Substrates, inducers, inhibitors and structure-activity relationships of human Cytochrome P450 2C9 and implications in drug development. Curr Med Chem. 2009;16(27):3480-675. Epub 2009 Sep 1. [PubMed:19515014]
Pharmacological action
General Function
Retinoic acid binding
Specific Function
UDPGT is of major importance in the conjugation and subsequent elimination of potentially toxic xenobiotics and endogenous compounds. This isoform has specificity for phenols. Isoform 2 lacks trans...
Gene Name
Uniprot ID
Uniprot Name
UDP-glucuronosyltransferase 1-9
Molecular Weight
59940.495 Da
  1. Zhou SF, Zhou ZW, Yang LP, Cai JP: Substrates, inducers, inhibitors and structure-activity relationships of human Cytochrome P450 2C9 and implications in drug development. Curr Med Chem. 2009;16(27):3480-675. Epub 2009 Sep 1. [PubMed:19515014]
Pharmacological action
General Function
Steroid hydroxylase activity
Specific Function
Cytochromes P450 are a group of heme-thiolate monooxygenases. In liver microsomes, this enzyme is involved in an NADPH-dependent electron transport pathway. It oxidizes a variety of structurally un...
Gene Name
Uniprot ID
Uniprot Name
Cytochrome P450 2C8
Molecular Weight
55824.275 Da
  1. Preissner S, Kroll K, Dunkel M, Senger C, Goldsobel G, Kuzman D, Guenther S, Winnenburg R, Schroeder M, Preissner R: SuperCYP: a comprehensive database on Cytochrome P450 enzymes including a tool for analysis of CYP-drug interactions. Nucleic Acids Res. 2010 Jan;38(Database issue):D237-43. doi: 10.1093/nar/gkp970. Epub 2009 Nov 24. [PubMed:19934256]
Pharmacological action
General Function
Vitamin d3 25-hydroxylase activity
Specific Function
Cytochromes P450 are a group of heme-thiolate monooxygenases. In liver microsomes, this enzyme is involved in an NADPH-dependent electron transport pathway. It performs a variety of oxidation react...
Gene Name
Uniprot ID
Uniprot Name
Cytochrome P450 3A4
Molecular Weight
57342.67 Da
  1. Preissner S, Kroll K, Dunkel M, Senger C, Goldsobel G, Kuzman D, Guenther S, Winnenburg R, Schroeder M, Preissner R: SuperCYP: a comprehensive database on Cytochrome P450 enzymes including a tool for analysis of CYP-drug interactions. Nucleic Acids Res. 2010 Jan;38(Database issue):D237-43. doi: 10.1093/nar/gkp970. Epub 2009 Nov 24. [PubMed:19934256]
  2. Lehmann DF, Newman N, Morse PD: The effect of cimetidine on the formation of sulfamethoxazole hydroxylamine in patients with human immunodeficiency virus. J Clin Pharmacol. 1998 May;38(5):463-6. [PubMed:9602961]


Pharmacological action
General Function
Toxic substance binding
Specific Function
Serum albumin, the main protein of plasma, has a good binding capacity for water, Ca(2+), Na(+), K(+), fatty acids, hormones, bilirubin and drugs. Its main function is the regulation of the colloid...
Gene Name
Uniprot ID
Uniprot Name
Serum albumin
Molecular Weight
69365.94 Da
  1. Bratlid D, Bergan T: Displacement of albumin-bound antimicrobial agents by bilirubin. Pharmacology. 1976;14(5):464-72. [PubMed:1031216]
  2. Angelakou A, Valsami G, Koupparis M, Macheras P: Use of 1-anilino-8-napthalenesulphonate as an ion probe for the potentiometric study of the binding of sulphonamides to bovine serum albumin and plasma. J Pharm Pharmacol. 1993 May;45(5):434-8. [PubMed:8099962]


Pharmacological action
General Function
Transporter activity
Specific Function
Involved in the ATP-dependent secretion of bile salts into the canaliculus of hepatocytes.
Gene Name
Uniprot ID
Uniprot Name
Bile salt export pump
Molecular Weight
146405.83 Da
  1. Pedersen JM, Matsson P, Bergstrom CA, Hoogstraate J, Noren A, LeCluyse EL, Artursson P: Early identification of clinically relevant drug interactions with the human bile salt export pump (BSEP/ABCB11). Toxicol Sci. 2013 Dec;136(2):328-43. doi: 10.1093/toxsci/kft197. Epub 2013 Sep 6. [PubMed:24014644]

Drug created on June 13, 2005 07:24 / Updated on September 23, 2018 19:37