Accession NumberDB01015  (APRD00076)
TypeSmall Molecule

A bacteriostatic antibacterial agent that interferes with folic acid synthesis in susceptible bacteria. Its broad spectrum of activity has been limited by the development of resistance. (From Martindale, The Extra Pharmacopoeia, 30th ed, p208)

Gantanol (tn)
External IDs NSC-147832 / RO 4-2130 / STX-608
Product Ingredients Not Available
Product Images
Approved Prescription Products
NameDosageStrengthRouteLabellerMarketing StartMarketing End
Sulfamethoxazole Tab 500mgTablet500 mgOralPro Doc Limitee1978-12-311999-08-12Canada
Approved Generic Prescription Products
NameDosageStrengthRouteLabellerMarketing StartMarketing End
Apo Sulfamethoxazole Tab 500mgTablet500 mgOralApotex Corporation1978-12-31Not applicableCanada
Approved Over the Counter ProductsNot Available
Unapproved/Other Products Not Available
International Brands
GantanolNot Available
SinominNot Available
UrobakNot Available
Brand mixtures
Apo Sulfatrim DS TabApotex Corporation
Apo Sulfatrim PediatricApotex Corporation
Apo Sulfatrim TabApotex Corporation
Apo-sulfatrim Oral SuspensionApotex Corporation
BactrimAR Scientific, Inc.
Bactrim DSAR Scientific, Inc.
Bactrim DS Roche TabHoffmann La Roche
Bactrim Roche InjHoffmann La Roche
Bactrim Roche Suspension PaediatricHoffmann La Roche
Bactrim Roche TabHoffmann La Roche
Nu-cotrimox Sus 40/8mg/mlNu Pharm Inc
Nu-cotrimox Tab 400/80mgNu Pharm Inc
Nu-cotrimox-DS Tab 800/160mgNu Pharm Inc
Protrin Df TabPro Doc Limitee
Protrin TabPro Doc Limitee
Riva-sep DSLaboratoire Riva Inc
Roubac Tab 160/800Rougier Pharma Division Of Ratiopharm Inc
Roubac Tab 80/400Rougier Pharma Division Of Ratiopharm Inc
SeptraGlaxosmithkline Inc
Septra DS TabletsGlaxosmithkline Inc
Septra InjectionAspen Pharmacare Canada Inc.
Septra Pediatric SuspensionGlaxosmithkline Inc
Sulfamethoxazole and TrimethoprimTeva
Sulfamethoxazole and Trimethoprim (double Strength)Teva
Sulfamethoxazole and Trimethoprim Double StrengthLake Erie Medical Dba Quality L Care Products Lc
Sulfamethoxazole and Trimethoprim DSApotheca, Inc.
Sulfamethoxazole and Trimethoprim TabletsD.C. Labs Limited
SulfatrimSTI Pharma
Teva-trimel DSTeva
Trisulfa DS TabJaapharm Canada Inc.
Trisulfa S SuspensionJaapharm Canada Inc.
Trisulfa TabJaapharm Canada Inc.
CAS number723-46-6
WeightAverage: 253.278
Monoisotopic: 253.052111923
Chemical FormulaC10H11N3O3S

For the treatment bacterial infections causing bronchitis, prostatitis and urinary tract infections.

Structured Indications

Sulfamethoxazole is a sulfonamide drug that inhibits bacterial synthesis of dihydrofolic acid by competing with para-aminobenzoic acid (PABA) for binding to dihydropteroate synthetase (dihydrofolate synthetase). Sulfamethoxazole is bacteriostatic in nature. Inhibition of dihydrofolic acid synthesis decreases the synthesis of bacterial nucleotides and DNA. Sulfamethoxazole is normally given in combination with Trimethoprim, a dihydrofolate reductase inhibitor, which inhibits the reduction of dihydrofolic acid to tetrahydrofolic acid. Studies have shown that bacterial resistance develops more slowly with the combination of the two drugs than with either Trimethoprim or Sulfamethoxazole alone.

Mechanism of action

Sulfonamides inhibit the enzymatic conversion of pteridine and p-aminobenzoic acid (PABA) to dihydropteroic acid by competing with PABA for binding to dihydrofolate synthetase, an intermediate of tetrahydrofolic acid (THF) synthesis. THF is required for the synthesis of purines and dTMP and inhibition of its synthesis inhibits bacterial growth. Pyrimethamine and trimethoprim inhibit dihydrofolate reductase, another step in THF synthesis, and therefore act synergistically with the sulfonamides.

TargetKindPharmacological actionActionsOrganismUniProt ID
Dihydropteroate synthaseProteinyes
Escherichia coli (strain K12)P0AC13 details
Bifunctional protein FolCProteinyes
Escherichia coli (strain K12)P08192 details
Glutathione S-transferase PProteinunknownNot AvailableHumanP09211 details
Related Articles

Rapidly absorbed following oral administration. Also well-absorbed topically.

Volume of distributionNot Available
Protein binding



Hepatic. The metabolism of sulfamethoxazole occurs predominately by N4-acetylation, although the glucuronide conjugate has been identified.

Not Available
Sulfamethoxazole N1-glucuronideDetails
Sulfamethoxazole N4-hydroxylamineDetails
Not Available
Sulfamethoxazole N4-hydroxylamine
Not Available
Not Available
Sulfamethoxazole GSH conjugateDetails
Route of eliminationNot Available
Half life

10 hours

ClearanceNot Available

Sulfamethoxazole may cause nausea, vomiting, diarrhea and hypersensitivity reactions. Hematologic effects such as anemia, agranulocytosis, thrombocytopenia and hemolytic anemia in patients with glucose-6-phosphate dehydrogenase deficiency may also occur. Sulfamethoxazole may displace bilirubin from albumin binding sites causing jaundice or kernicterus in newborns.

Affected organisms
  • Gram negative and gram positive bacteria
  • Listeria monocytogenes
  • Escherichia coli
PathwaysNot Available
Pharmacogenomic Effects/ADRs
Interacting Gene/EnzymeAllele nameGenotype(s)Defining Change(s)Type(s)DescriptionDetails
Glucose-6-phosphate 1-dehydrogenaseVilleurbanneNot Available1000_1002delACCADR InferredIncreased risk of dose-related hemolysis. Details
Glucose-6-phosphate 1-dehydrogenaseTorunNot Available1006A->GADR InferredIncreased risk of dose-related hemolysis. Details
Glucose-6-phosphate 1-dehydrogenaseSunderlandNot Available105_107delCATADR InferredIncreased risk of dose-related hemolysis. Details
Glucose-6-phosphate 1-dehydrogenaseIwatsukiNot Available1081G->AADR InferredIncreased risk of dose-related hemolysis. Details
Glucose-6-phosphate 1-dehydrogenaseSerresNot Available1082C->TADR InferredIncreased risk of dose-related hemolysis. Details
Glucose-6-phosphate 1-dehydrogenaseTondelaNot Available1084_1101delCTGAACGAGCGCAAGGCCADR InferredIncreased risk of dose-related hemolysis. Details
Glucose-6-phosphate 1-dehydrogenaseLoma LindaNot Available1089C->AADR InferredIncreased risk of dose-related hemolysis. Details
Glucose-6-phosphate 1-dehydrogenaseAachenNot Available1089C->GADR InferredIncreased risk of dose-related hemolysis. Details
Glucose-6-phosphate 1-dehydrogenaseTenriNot Available1096A->GADR InferredIncreased risk of dose-related hemolysis. Details
Glucose-6-phosphate 1-dehydrogenaseMontpellierNot Available1132G>AADR InferredIncreased risk of dose-related hemolysis. Details
Glucose-6-phosphate 1-dehydrogenaseCalvo MackennaNot Available1138A->GADR InferredIncreased risk of dose-related hemolysis. Details
Glucose-6-phosphate 1-dehydrogenaseRileyNot Available1139T->CADR InferredIncreased risk of dose-related hemolysis. Details
Glucose-6-phosphate 1-dehydrogenaseOlomoucNot Available1141T->CADR InferredIncreased risk of dose-related hemolysis. Details
Glucose-6-phosphate 1-dehydrogenaseTomahNot Available1153T->CADR InferredIncreased risk of dose-related hemolysis. Details
Glucose-6-phosphate 1-dehydrogenaseLynwoodNot Available1154G->TADR InferredIncreased risk of dose-related hemolysis. Details
Glucose-6-phosphate 1-dehydrogenaseMadridNot Available1155C->GADR InferredIncreased risk of dose-related hemolysis. Details
Glucose-6-phosphate 1-dehydrogenaseIowa, Walter Reed, SpringfieldNot Available1156A->GADR InferredIncreased risk of dose-related hemolysis. Details
Glucose-6-phosphate 1-dehydrogenaseBeverly Hills, Genova, Iwate, Niigata, YamaguchiNot Available1160G->AADR InferredIncreased risk of dose-related hemolysis. Details
Glucose-6-phosphate 1-dehydrogenaseHartfordNot Available1162A->GADR InferredIncreased risk of dose-related hemolysis. Details
Glucose-6-phosphate 1-dehydrogenasePrahaNot Available1166A->GADR InferredIncreased risk of dose-related hemolysis. Details
Glucose-6-phosphate 1-dehydrogenaseKrakowNot Available1175T>CADR InferredIncreased risk of dose-related hemolysis. Details
Glucose-6-phosphate 1-dehydrogenaseWisconsinNot Available1177C->GADR InferredIncreased risk of dose-related hemolysis. Details
Glucose-6-phosphate 1-dehydrogenaseNashville, Anaheim, PorticiNot Available1178G->AADR InferredIncreased risk of dose-related hemolysis. Details
Glucose-6-phosphate 1-dehydrogenaseAlhambraNot Available1180G->CADR InferredIncreased risk of dose-related hemolysis. Details
Glucose-6-phosphate 1-dehydrogenaseBariNot Available1187C->TADR InferredIncreased risk of dose-related hemolysis. Details
Glucose-6-phosphate 1-dehydrogenasePuerto LimonNot Available1192G->AADR InferredIncreased risk of dose-related hemolysis. Details
Glucose-6-phosphate 1-dehydrogenaseCovao do LoboNot Available1205C>AADR InferredIncreased risk of dose-related hemolysis. Details
Glucose-6-phosphate 1-dehydrogenaseClinicNot Available1215G->AADR InferredIncreased risk of dose-related hemolysis. Details
Glucose-6-phosphate 1-dehydrogenaseUtrechtNot Available1225C->TADR InferredIncreased risk of dose-related hemolysis. Details
Glucose-6-phosphate 1-dehydrogenaseSuwalkiNot Available1226C->GADR InferredIncreased risk of dose-related hemolysis. Details
Glucose-6-phosphate 1-dehydrogenaseRiversideNot Available1228G->TADR InferredIncreased risk of dose-related hemolysis. Details
Glucose-6-phosphate 1-dehydrogenaseJapan, ShinagawaNot Available1229G->AADR InferredIncreased risk of dose-related hemolysis. Details
Glucose-6-phosphate 1-dehydrogenaseKawasakiNot Available1229G->CADR InferredIncreased risk of dose-related hemolysis. Details
Glucose-6-phosphate 1-dehydrogenaseMunichNot Available1231A->GADR InferredIncreased risk of dose-related hemolysis. Details
Glucose-6-phosphate 1-dehydrogenaseGeorgiaNot Available1284C->AADR InferredIncreased risk of dose-related hemolysis. Details
Glucose-6-phosphate 1-dehydrogenaseSumareNot Available1292T->GADR InferredIncreased risk of dose-related hemolysis. Details
Glucose-6-phosphate 1-dehydrogenaseTelti/KobeNot Available1318C->TADR InferredIncreased risk of dose-related hemolysis. Details
Glucose-6-phosphate 1-dehydrogenaseSantiago de Cuba, MoriokaNot Available1339G->AADR InferredIncreased risk of dose-related hemolysis. Details
Glucose-6-phosphate 1-dehydrogenaseHarimaNot Available1358T->AADR InferredIncreased risk of dose-related hemolysis. Details
Glucose-6-phosphate 1-dehydrogenaseFiguera da FozNot Available1366G->CADR InferredIncreased risk of dose-related hemolysis. Details
Glucose-6-phosphate 1-dehydrogenaseAmiensNot Available1367A>TADR InferredIncreased risk of dose-related hemolysis. Details
Glucose-6-phosphate 1-dehydrogenaseBangkok NoiNot Available1376G->T, 1502T->GADR InferredIncreased risk of dose-related hemolysis. Details
Glucose-6-phosphate 1-dehydrogenaseFukayaNot Available1462G->AADR InferredIncreased risk of dose-related hemolysis. Details
Glucose-6-phosphate 1-dehydrogenaseCampinasNot Available1463G->TADR InferredIncreased risk of dose-related hemolysis. Details
Glucose-6-phosphate 1-dehydrogenaseBuenos AiresNot Available1465C>TADR InferredIncreased risk of dose-related hemolysis. Details
Glucose-6-phosphate 1-dehydrogenaseArakawaNot Available1466C->TADR InferredIncreased risk of dose-related hemolysis. Details
Glucose-6-phosphate 1-dehydrogenaseBrightonNot Available1488_1490delGAAADR InferredIncreased risk of dose-related hemolysis. Details
Glucose-6-phosphate 1-dehydrogenaseKozukataNot Available159G->CADR InferredIncreased risk of dose-related hemolysis. Details
Glucose-6-phosphate 1-dehydrogenaseAmsterdamNot Available180_182delTCTADR InferredIncreased risk of dose-related hemolysis. Details
Glucose-6-phosphate 1-dehydrogenaseNo nameNot Available202G->A, 376A->G, 1264C>GADR InferredIncreased risk of dose-related hemolysis. Details
Glucose-6-phosphate 1-dehydrogenaseSwanseaNot Available224T->CADR InferredIncreased risk of dose-related hemolysis. Details
Glucose-6-phosphate 1-dehydrogenaseUrayasuNot Available281_283delAGAADR InferredIncreased risk of dose-related hemolysis. Details
Glucose-6-phosphate 1-dehydrogenaseVancouverNot Available317C->G544C->T592C->TADR InferredIncreased risk of dose-related hemolysis. Details
Glucose-6-phosphate 1-dehydrogenaseMt SinaiNot Available376A->G, 1159C->TADR InferredIncreased risk of dose-related hemolysis. Details
Glucose-6-phosphate 1-dehydrogenasePlymouthNot Available488G->AADR InferredIncreased risk of dose-related hemolysis. Details
Glucose-6-phosphate 1-dehydrogenaseVolendamNot Available514C->TADR InferredIncreased risk of dose-related hemolysis. Details
Glucose-6-phosphate 1-dehydrogenaseShinshuNot Available527A->GADR InferredIncreased risk of dose-related hemolysis. Details
Glucose-6-phosphate 1-dehydrogenaseChikugoNot Available535A->TADR InferredIncreased risk of dose-related hemolysis. Details
Glucose-6-phosphate 1-dehydrogenaseTsukuiNot Available561_563delCTCADR InferredIncreased risk of dose-related hemolysis. Details
Glucose-6-phosphate 1-dehydrogenasePedoplis-CkaroNot Available573C>GADR InferredIncreased risk of dose-related hemolysis. Details
Glucose-6-phosphate 1-dehydrogenaseSantiagoNot Available593G->CADR InferredIncreased risk of dose-related hemolysis. Details
Glucose-6-phosphate 1-dehydrogenaseMinnesota, Marion, Gastonia, LeJeuneNot Available637G->TADR InferredIncreased risk of dose-related hemolysis. Details
Glucose-6-phosphate 1-dehydrogenaseCincinnatiNot Available637G->T, 1037A->TADR InferredIncreased risk of dose-related hemolysis. Details
Glucose-6-phosphate 1-dehydrogenaseHarilaouNot Available648T->GADR InferredIncreased risk of dose-related hemolysis. Details
Glucose-6-phosphate 1-dehydrogenaseNorth DallasNot Available683_685delACAADR InferredIncreased risk of dose-related hemolysis. Details
Glucose-6-phosphate 1-dehydrogenaseAsahikawaNot Available695G->AADR InferredIncreased risk of dose-related hemolysis. Details
Glucose-6-phosphate 1-dehydrogenaseDurhamNot Available713A->GADR InferredIncreased risk of dose-related hemolysis. Details
Glucose-6-phosphate 1-dehydrogenaseStonybrookNot Available724_729delGGCACTADR InferredIncreased risk of dose-related hemolysis. Details
Glucose-6-phosphate 1-dehydrogenaseWayneNot Available769C->GADR InferredIncreased risk of dose-related hemolysis. Details
Glucose-6-phosphate 1-dehydrogenaseAveiroNot Available806G->AADR InferredIncreased risk of dose-related hemolysis. Details
Glucose-6-phosphate 1-dehydrogenaseCleveland CorumNot Available820G->AADR InferredIncreased risk of dose-related hemolysis. Details
Glucose-6-phosphate 1-dehydrogenaseLilleNot Available821A>TADR InferredIncreased risk of dose-related hemolysis. Details
Glucose-6-phosphate 1-dehydrogenaseBangkokNot Available825G>CADR InferredIncreased risk of dose-related hemolysis. Details
Glucose-6-phosphate 1-dehydrogenaseSugaoNot Available826C->TADR InferredIncreased risk of dose-related hemolysis. Details
Glucose-6-phosphate 1-dehydrogenaseLa JollaNot Available832T->CADR InferredIncreased risk of dose-related hemolysis. Details
Glucose-6-phosphate 1-dehydrogenaseWexhamNot Available833C->TADR InferredIncreased risk of dose-related hemolysis. Details
Glucose-6-phosphate 1-dehydrogenasePiotrkowNot Available851T>CADR InferredIncreased risk of dose-related hemolysis. Details
Glucose-6-phosphate 1-dehydrogenaseWest VirginiaNot Available910G->TADR InferredIncreased risk of dose-related hemolysis. Details
Glucose-6-phosphate 1-dehydrogenaseOmiyaNot Available921G->CADR InferredIncreased risk of dose-related hemolysis. Details
Glucose-6-phosphate 1-dehydrogenaseNaraNot Available953_976delCCACCAAAGGGTACCTGGAC GACCADR InferredIncreased risk of dose-related hemolysis. Details
Glucose-6-phosphate 1-dehydrogenaseManhattanNot Available962G->AADR InferredIncreased risk of dose-related hemolysis. Details
Glucose-6-phosphate 1-dehydrogenaseRehevotNot Available964T->CADR InferredIncreased risk of dose-related hemolysis. Details
Glucose-6-phosphate 1-dehydrogenaseHoniaraNot Available99A->G / 1360C->TADR InferredIncreased risk of dose-related hemolysis. Details
Glucose-6-phosphate 1-dehydrogenaseTokyo, FukushimaNot Available1246G->AADR InferredIncreased risk of dose-related hemolysis. Details
Glucose-6-phosphate 1-dehydrogenaseChathamNot Available1003G->AADR InferredIncreased risk of dose-related hemolysis. Details
Glucose-6-phosphate 1-dehydrogenaseFushanNot Available1004C->AADR InferredIncreased risk of dose-related hemolysis. Details
Glucose-6-phosphate 1-dehydrogenasePartenopeNot Available1052G->TADR InferredIncreased risk of dose-related hemolysis. Details
Glucose-6-phosphate 1-dehydrogenaseIerapetraNot Available1057C->TADR InferredIncreased risk of dose-related hemolysis. Details
Glucose-6-phosphate 1-dehydrogenaseAnadiaNot Available1193A->GADR InferredIncreased risk of dose-related hemolysis. Details
Glucose-6-phosphate 1-dehydrogenaseAbenoNot Available1220A->CADR InferredIncreased risk of dose-related hemolysis. Details
Glucose-6-phosphate 1-dehydrogenaseSurabayaNot Available1291G->AADR InferredIncreased risk of dose-related hemolysis. Details
Glucose-6-phosphate 1-dehydrogenasePawneeNot Available1316G->CADR InferredIncreased risk of dose-related hemolysis. Details
Glucose-6-phosphate 1-dehydrogenaseS. AntiocoNot Available1342A->GADR InferredIncreased risk of dose-related hemolysis. Details
Glucose-6-phosphate 1-dehydrogenaseCassanoNot Available1347G->CADR InferredIncreased risk of dose-related hemolysis. Details
Glucose-6-phosphate 1-dehydrogenaseHermoupolisNot Available1347G->C / 1360C->TADR InferredIncreased risk of dose-related hemolysis. Details
Glucose-6-phosphate 1-dehydrogenaseUnion,Maewo, Chinese-2, KaloNot Available1360C->TADR InferredIncreased risk of dose-related hemolysis. Details
Glucose-6-phosphate 1-dehydrogenaseAndalusNot Available1361G->AADR InferredIncreased risk of dose-related hemolysis. Details
Glucose-6-phosphate 1-dehydrogenaseCosenzaNot Available1376G->CADR InferredIncreased risk of dose-related hemolysis. Details
Glucose-6-phosphate 1-dehydrogenaseCanton, Taiwan- Hakka, Gifu-like, Agrigento-likeNot Available1376G->TADR InferredIncreased risk of dose-related hemolysis. Details
Glucose-6-phosphate 1-dehydrogenaseFloresNot Available1387C->AADR InferredIncreased risk of dose-related hemolysis. Details
Glucose-6-phosphate 1-dehydrogenaseKaiping, Anant, Dhon, Sapporo-like, WoseraNot Available1388G->AADR InferredIncreased risk of dose-related hemolysis. Details
Glucose-6-phosphate 1-dehydrogenaseKamogawaNot Available169C->TADR InferredIncreased risk of dose-related hemolysis. Details
Glucose-6-phosphate 1-dehydrogenaseCostanzoNot Available179T>CADR InferredIncreased risk of dose-related hemolysis. Details
Glucose-6-phosphate 1-dehydrogenaseAmazoniaNot Available185C->AADR InferredIncreased risk of dose-related hemolysis. Details
Glucose-6-phosphate 1-dehydrogenaseSongklanagarindNot Available196T->AADR InferredIncreased risk of dose-related hemolysis. Details
Glucose-6-phosphate 1-dehydrogenaseHechiNot Available202G->A / 871G->AADR InferredIncreased risk of dose-related hemolysis. Details
Glucose-6-phosphate 1-dehydrogenaseNamouruNot Available208T->CADR InferredIncreased risk of dose-related hemolysis. Details
Glucose-6-phosphate 1-dehydrogenaseBao LocNot Available352T>CADR InferredIncreased risk of dose-related hemolysis. Details
Glucose-6-phosphate 1-dehydrogenaseCrispimNot Available375G->T, 379G->T383T->C384C>TADR InferredIncreased risk of dose-related hemolysis. Details
Glucose-6-phosphate 1-dehydrogenaseAcrokorinthosNot Available376A->G / 463C->GADR InferredIncreased risk of dose-related hemolysis. Details
Glucose-6-phosphate 1-dehydrogenaseSanta MariaNot Available376A->G / 542A->TADR InferredIncreased risk of dose-related hemolysis. Details
Glucose-6-phosphate 1-dehydrogenaseAnanindeuaNot Available376A->G / 871G->AADR InferredIncreased risk of dose-related hemolysis. Details
Glucose-6-phosphate 1-dehydrogenaseVanua LavaNot Available383T->CADR InferredIncreased risk of dose-related hemolysis. Details
Glucose-6-phosphate 1-dehydrogenaseValladolidNot Available406C->TADR InferredIncreased risk of dose-related hemolysis. Details
Glucose-6-phosphate 1-dehydrogenaseBelemNot Available409C->TADR InferredIncreased risk of dose-related hemolysis. Details
Glucose-6-phosphate 1-dehydrogenaseLiuzhouNot Available442G->AADR InferredIncreased risk of dose-related hemolysis. Details
Glucose-6-phosphate 1-dehydrogenaseShenzenNot Available473G>AADR InferredIncreased risk of dose-related hemolysis. Details
Glucose-6-phosphate 1-dehydrogenaseTaipei “Chinese- 3”Not Available493A->GADR InferredIncreased risk of dose-related hemolysis. Details
Glucose-6-phosphate 1-dehydrogenaseToledoNot Available496C>TADR InferredIncreased risk of dose-related hemolysis. Details
Glucose-6-phosphate 1-dehydrogenaseNaoneNot Available497G->AADR InferredIncreased risk of dose-related hemolysis. Details
Glucose-6-phosphate 1-dehydrogenaseNankangNot Available517T->CADR InferredIncreased risk of dose-related hemolysis. Details
Glucose-6-phosphate 1-dehydrogenaseMiaoliNot Available519C->GADR InferredIncreased risk of dose-related hemolysis. Details
Glucose-6-phosphate 1-dehydrogenaseMediterranean, Dallas, Panama‚ Sassari, Cagliari, BirminghamNot Available563C->TADR InferredIncreased risk of dose-related hemolysis. Details
Glucose-6-phosphate 1-dehydrogenaseCoimbra ShundeNot Available592C->TADR InferredIncreased risk of dose-related hemolysis. Details
Glucose-6-phosphate 1-dehydrogenaseNilgiriNot Available593G>AADR InferredIncreased risk of dose-related hemolysis. Details
Glucose-6-phosphate 1-dehydrogenaseRadlowoNot Available679C->TADR InferredIncreased risk of dose-related hemolysis. Details
Glucose-6-phosphate 1-dehydrogenaseRoubaixNot Available811G>CADR InferredIncreased risk of dose-related hemolysis. Details
Glucose-6-phosphate 1-dehydrogenaseHaikouNot Available835A->GADR InferredIncreased risk of dose-related hemolysis. Details
Glucose-6-phosphate 1-dehydrogenaseChinese-1Not Available835A->TADR InferredIncreased risk of dose-related hemolysis. Details
Glucose-6-phosphate 1-dehydrogenaseMizushimaNot Available848A>GADR InferredIncreased risk of dose-related hemolysis. Details
Glucose-6-phosphate 1-dehydrogenaseOsakaNot Available853C->TADR InferredIncreased risk of dose-related hemolysis. Details
Glucose-6-phosphate 1-dehydrogenaseViangchan, JammuNot Available871G->AADR InferredIncreased risk of dose-related hemolysis. Details
Glucose-6-phosphate 1-dehydrogenaseSeoulNot Available916G->AADR InferredIncreased risk of dose-related hemolysis. Details
Glucose-6-phosphate 1-dehydrogenaseLudhianaNot Available929G->AADR InferredIncreased risk of dose-related hemolysis. Details
Glucose-6-phosphate 1-dehydrogenaseFarroupilhaNot Available977C->AADR InferredIncreased risk of dose-related hemolysis. Details
Glucose-6-phosphate 1-dehydrogenaseChinese-5Not Available1024C->TADR InferredIncreased risk of dose-related hemolysis. Details
Glucose-6-phosphate 1-dehydrogenaseRignanoNot Available130G>AADR InferredIncreased risk of dose-related hemolysis. Details
Glucose-6-phosphate 1-dehydrogenaseOrissaNot Available131C->GADR InferredIncreased risk of dose-related hemolysis. Details
Glucose-6-phosphate 1-dehydrogenaseG6PDNiceNot Available1380G>CADR InferredIncreased risk of dose-related hemolysis. Details
Glucose-6-phosphate 1-dehydrogenaseKamiube, KeelungNot Available1387C->TADR InferredIncreased risk of dose-related hemolysis. Details
Glucose-6-phosphate 1-dehydrogenaseNeapolisNot Available1400C->GADR InferredIncreased risk of dose-related hemolysis. Details
Glucose-6-phosphate 1-dehydrogenaseAuresNot Available143T->CADR InferredIncreased risk of dose-related hemolysis. Details
Glucose-6-phosphate 1-dehydrogenaseSplitNot Available1442C->GADR InferredIncreased risk of dose-related hemolysis. Details
Glucose-6-phosphate 1-dehydrogenaseKambosNot Available148C->TADR InferredIncreased risk of dose-related hemolysis. Details
Glucose-6-phosphate 1-dehydrogenasePalestrinaNot Available170G>AADR InferredIncreased risk of dose-related hemolysis. Details
Glucose-6-phosphate 1-dehydrogenaseMetapontoNot Available172G->AADR InferredIncreased risk of dose-related hemolysis. Details
Glucose-6-phosphate 1-dehydrogenaseMusashinoNot Available185C->TADR InferredIncreased risk of dose-related hemolysis. Details
Glucose-6-phosphate 1-dehydrogenaseAsahiNot Available202G->AADR InferredIncreased risk of dose-related hemolysis. Details
Glucose-6-phosphate 1-dehydrogenaseA- (202), Ferrara INot Available202G->A / 376A->GADR InferredIncreased risk of dose-related hemolysis. Details
Glucose-6-phosphate 1-dehydrogenaseMurcia OristanoNot Available209A->GADR InferredIncreased risk of dose-related hemolysis. Details
Glucose-6-phosphate 1-dehydrogenaseUbe KonanNot Available241C->TADR InferredIncreased risk of dose-related hemolysis. Details
Glucose-6-phosphate 1-dehydrogenaseLagosantoNot Available242G->AADR InferredIncreased risk of dose-related hemolysis. Details
Glucose-6-phosphate 1-dehydrogenaseGuangzhouNot Available274C->TADR InferredIncreased risk of dose-related hemolysis. Details
Glucose-6-phosphate 1-dehydrogenaseHammersmithNot Available323T->AADR InferredIncreased risk of dose-related hemolysis. Details
Glucose-6-phosphate 1-dehydrogenaseSinnaiNot Available34G->TADR InferredIncreased risk of dose-related hemolysis. Details
Glucose-6-phosphate 1-dehydrogenaseA- (680)Not Available376A->G / 680G->TADR InferredIncreased risk of dose-related hemolysis. Details
Glucose-6-phosphate 1-dehydrogenaseA- (968), Betica,Selma, GuantanamoNot Available376A->G / 968T->CADR InferredIncreased risk of dose-related hemolysis. Details
Glucose-6-phosphate 1-dehydrogenaseSalerno PyrgosNot Available383T>GADR InferredIncreased risk of dose-related hemolysis. Details
Glucose-6-phosphate 1-dehydrogenaseQuing YanNot Available392G->TADR InferredIncreased risk of dose-related hemolysis. Details
Glucose-6-phosphate 1-dehydrogenaseLagesNot Available40G->AADR InferredIncreased risk of dose-related hemolysis. Details
Glucose-6-phosphate 1-dehydrogenaseIleshaNot Available466G->AADR InferredIncreased risk of dose-related hemolysis. Details
Glucose-6-phosphate 1-dehydrogenaseMahidolNot Available487G->AADR InferredIncreased risk of dose-related hemolysis. Details
Glucose-6-phosphate 1-dehydrogenaseMalagaNot Available542A->TADR InferredIncreased risk of dose-related hemolysis. Details
Glucose-6-phosphate 1-dehydrogenaseSibariNot Available634A->GADR InferredIncreased risk of dose-related hemolysis. Details
Glucose-6-phosphate 1-dehydrogenaseMexico CityNot Available680G->AADR InferredIncreased risk of dose-related hemolysis. Details
Glucose-6-phosphate 1-dehydrogenaseNanningNot Available703C->TADR InferredIncreased risk of dose-related hemolysis. Details
Glucose-6-phosphate 1-dehydrogenaseSeattle, Lodi, Modena, Ferrara II, Athens-likeNot Available844G->CADR InferredIncreased risk of dose-related hemolysis. Details
Glucose-6-phosphate 1-dehydrogenaseBajo MaumereNot Available844G->TADR InferredIncreased risk of dose-related hemolysis. Details
Glucose-6-phosphate 1-dehydrogenaseMontalbanoNot Available854G->AADR InferredIncreased risk of dose-related hemolysis. Details
Glucose-6-phosphate 1-dehydrogenaseKalyan-Kerala, Jamnaga, RohiniNot Available949G->AADR InferredIncreased risk of dose-related hemolysis. Details
Glucose-6-phosphate 1-dehydrogenaseGaoheNot Available95A->GADR InferredIncreased risk of dose-related hemolysis. Details
Drug Interactions
DrugInteractionDrug group
2,4-thiazolidinedioneThiazolidinedione may increase the hypoglycemic activities of Sulfamethoxazole.Investigational
7,8-Dichloro-1,2,3,4-tetrahydroisoquinoline7,8-DICHLORO-1,2,3,4-TETRAHYDROISOQUINOLINE may increase the hypoglycemic activities of Sulfamethoxazole.Experimental
AbirateroneThe metabolism of Sulfamethoxazole can be decreased when combined with Abiraterone.Approved
AcarboseAcarbose may increase the hypoglycemic activities of Sulfamethoxazole.Approved, Investigational
AceclofenacThe metabolism of Aceclofenac can be decreased when combined with Sulfamethoxazole.Approved
AcenocoumarolSulfamethoxazole may increase the anticoagulant activities of Acenocoumarol.Approved
AcetaminophenThe metabolism of Acetaminophen can be decreased when combined with Sulfamethoxazole.Approved
AcetohexamideAcetohexamide may increase the hypoglycemic activities of Sulfamethoxazole.Withdrawn
Acetylsalicylic acidThe metabolism of Acetylsalicylic acid can be decreased when combined with Sulfamethoxazole.Approved, Vet Approved
AICA ribonucleotideAicar may increase the hypoglycemic activities of Sulfamethoxazole.Experimental
AlmotriptanThe metabolism of Almotriptan can be decreased when combined with Sulfamethoxazole.Approved, Investigational
AlogliptinAlogliptin may increase the hypoglycemic activities of Sulfamethoxazole.Approved
AlosetronThe metabolism of Alosetron can be decreased when combined with Sulfamethoxazole.Approved, Withdrawn
AlprazolamThe metabolism of Alprazolam can be decreased when combined with Sulfamethoxazole.Approved, Illicit, Investigational
AminophenazoneThe metabolism of Aminophenazone can be decreased when combined with Sulfamethoxazole.Approved, Withdrawn
Aminosalicylic AcidAminosalicylic Acid may increase the hypoglycemic activities of Sulfamethoxazole.Approved
AmiodaroneThe metabolism of Sulfamethoxazole can be decreased when combined with Amiodarone.Approved, Investigational
AmitriptylineThe metabolism of Amitriptyline can be decreased when combined with Sulfamethoxazole.Approved
AmodiaquineThe serum concentration of Amodiaquine can be increased when it is combined with Sulfamethoxazole.Approved
AmprenavirThe metabolism of Amprenavir can be decreased when combined with Sulfamethoxazole.Approved
AnagrelideSulfamethoxazole may increase the QTc-prolonging activities of Anagrelide.Approved
AntipyrineThe metabolism of Antipyrine can be decreased when combined with Sulfamethoxazole.Approved
ApixabanThe metabolism of Apixaban can be decreased when combined with Sulfamethoxazole.Approved
AprepitantThe serum concentration of Sulfamethoxazole can be increased when it is combined with Aprepitant.Approved, Investigational
Arachidonic AcidThe metabolism of Arachidonic Acid can be decreased when combined with Sulfamethoxazole.Experimental
ArformoterolThe metabolism of Arformoterol can be decreased when combined with Sulfamethoxazole.Approved, Investigational
Arsenic trioxideSulfamethoxazole may increase the QTc-prolonging activities of Arsenic trioxide.Approved, Investigational
ArtemetherSulfamethoxazole may increase the QTc-prolonging activities of Artemether.Approved
AsenapineSulfamethoxazole may increase the QTc-prolonging activities of Asenapine.Approved
AtazanavirThe metabolism of Sulfamethoxazole can be decreased when combined with Atazanavir.Approved, Investigational
AtomoxetineThe metabolism of Sulfamethoxazole can be decreased when combined with Atomoxetine.Approved
AtorvastatinThe metabolism of Atorvastatin can be decreased when combined with Sulfamethoxazole.Approved
AzathioprineSulfamethoxazole may increase the myelosuppressive activities of Azathioprine.Approved
AzelastineThe metabolism of Azelastine can be decreased when combined with Sulfamethoxazole.Approved
AzithromycinSulfamethoxazole may increase the QTc-prolonging activities of Azithromycin.Approved
BalaglitazoneBalaglitazone may increase the hypoglycemic activities of Sulfamethoxazole.Investigational
BalsalazideBalsalazide may increase the hypoglycemic activities of Sulfamethoxazole.Approved, Investigational
BedaquilineSulfamethoxazole may increase the QTc-prolonging activities of Bedaquiline.Approved
BenmoxinBenmoxin may increase the hypoglycemic activities of Sulfamethoxazole.Withdrawn
Benzyl alcoholThe metabolism of Benzyl alcohol can be decreased when combined with Sulfamethoxazole.Approved
BeraprostThe metabolism of Beraprost can be decreased when combined with Sulfamethoxazole.Investigational
BexaroteneThe serum concentration of Sulfamethoxazole can be decreased when it is combined with Bexarotene.Approved, Investigational
BoceprevirThe metabolism of Sulfamethoxazole can be decreased when combined with Boceprevir.Approved, Investigational
BortezomibThe metabolism of Sulfamethoxazole can be decreased when combined with Bortezomib.Approved, Investigational
BosentanThe serum concentration of Bosentan can be increased when it is combined with Sulfamethoxazole.Approved, Investigational
BrompheniramineThe metabolism of Brompheniramine can be decreased when combined with Sulfamethoxazole.Approved
BuforminBuformin may increase the hypoglycemic activities of Sulfamethoxazole.Withdrawn
BuprenorphineThe metabolism of Buprenorphine can be decreased when combined with Sulfamethoxazole.Approved, Illicit, Investigational, Vet Approved
BupropionThe metabolism of Bupropion can be decreased when combined with Sulfamethoxazole.Approved
CabazitaxelThe metabolism of Cabazitaxel can be decreased when combined with Sulfamethoxazole.Approved
CabozantinibThe metabolism of Cabozantinib can be decreased when combined with Sulfamethoxazole.Approved
CaffeineThe metabolism of Caffeine can be decreased when combined with Sulfamethoxazole.Approved
CanagliflozinCanagliflozin may increase the hypoglycemic activities of Sulfamethoxazole.Approved
CandesartanThe metabolism of Candesartan can be decreased when combined with Sulfamethoxazole.Approved
CapecitabineThe metabolism of Sulfamethoxazole can be decreased when combined with Capecitabine.Approved, Investigational
CarbamazepineThe metabolism of Sulfamethoxazole can be increased when combined with Carbamazepine.Approved, Investigational
CarbinoxamineThe metabolism of Carbinoxamine can be decreased when combined with Sulfamethoxazole.Approved
CaroxazoneCaroxazone may increase the hypoglycemic activities of Sulfamethoxazole.Withdrawn
CarvedilolThe serum concentration of Carvedilol can be increased when it is combined with Sulfamethoxazole.Approved, Investigational
CastanospermineCastanospermine may increase the hypoglycemic activities of Sulfamethoxazole.Experimental
CelecoxibThe metabolism of Celecoxib can be decreased when combined with Sulfamethoxazole.Approved, Investigational
CeritinibThe serum concentration of Sulfamethoxazole can be increased when it is combined with Ceritinib.Approved
CerivastatinThe metabolism of Cerivastatin can be decreased when combined with Sulfamethoxazole.Withdrawn
ChloroquineSulfamethoxazole may increase the QTc-prolonging activities of Chloroquine.Approved, Vet Approved
ChlorpromazineSulfamethoxazole may increase the QTc-prolonging activities of Chlorpromazine.Approved, Vet Approved
ChlorpropamideChlorpropamide may increase the hypoglycemic activities of Sulfamethoxazole.Approved
CholecalciferolThe metabolism of Sulfamethoxazole can be decreased when combined with Cholecalciferol.Approved, Nutraceutical
CiglitazoneCiglitazone may increase the hypoglycemic activities of Sulfamethoxazole.Experimental
CinnarizineThe metabolism of Cinnarizine can be decreased when combined with Sulfamethoxazole.Approved
CinoxacinCinoxacin may increase the hypoglycemic activities of Sulfamethoxazole.Approved, Withdrawn
CiprofloxacinSulfamethoxazole may increase the QTc-prolonging activities of Ciprofloxacin.Approved, Investigational
CisaprideSulfamethoxazole may increase the QTc-prolonging activities of Cisapride.Approved, Investigational, Withdrawn
CitalopramSulfamethoxazole may increase the QTc-prolonging activities of Citalopram.Approved
ClarithromycinThe metabolism of Sulfamethoxazole can be decreased when combined with Clarithromycin.Approved
ClemastineThe metabolism of Sulfamethoxazole can be decreased when combined with Clemastine.Approved
ClopidogrelThe metabolism of Clopidogrel can be decreased when combined with Sulfamethoxazole.Approved, Nutraceutical
ClotrimazoleThe metabolism of Sulfamethoxazole can be decreased when combined with Clotrimazole.Approved, Vet Approved
ClozapineSulfamethoxazole may increase the QTc-prolonging activities of Clozapine.Approved
CobicistatThe metabolism of Sulfamethoxazole can be decreased when combined with Cobicistat.Approved
ConivaptanThe serum concentration of Sulfamethoxazole can be increased when it is combined with Conivaptan.Approved, Investigational
CrizotinibSulfamethoxazole may increase the QTc-prolonging activities of Crizotinib.Approved
CyclophosphamideThe metabolism of Cyclophosphamide can be decreased when combined with Sulfamethoxazole.Approved, Investigational
CyclosporineThe metabolism of Sulfamethoxazole can be decreased when combined with Cyclosporine.Approved, Investigational, Vet Approved
CyclosporineSulfamethoxazole may increase the nephrotoxic activities of Cyclosporine.Approved, Investigational, Vet Approved
DabrafenibThe serum concentration of Sulfamethoxazole can be decreased when it is combined with Dabrafenib.Approved
DapagliflozinThe metabolism of Dapagliflozin can be decreased when combined with Sulfamethoxazole.Approved
DapoxetineDapoxetine may increase the hypoglycemic activities of Sulfamethoxazole.Investigational
DapsoneThe risk or severity of adverse effects can be increased when Dapsone is combined with Sulfamethoxazole.Approved, Investigational
DapsoneThe metabolism of Dapsone can be decreased when combined with Sulfamethoxazole.Approved, Investigational
DarunavirThe metabolism of Sulfamethoxazole can be decreased when combined with Darunavir.Approved
DasabuvirThe metabolism of Dasabuvir can be decreased when combined with Sulfamethoxazole.Approved
DasatinibThe serum concentration of Sulfamethoxazole can be increased when it is combined with Dasatinib.Approved, Investigational
DeferasiroxThe serum concentration of Sulfamethoxazole can be decreased when it is combined with Deferasirox.Approved, Investigational
DelavirdineThe metabolism of Sulfamethoxazole can be decreased when combined with Delavirdine.Approved
DeoxyspergualinDeoxyspergualin may increase the hypoglycemic activities of Sulfamethoxazole.Investigational
DesvenlafaxineDesvenlafaxine may increase the hypoglycemic activities of Sulfamethoxazole.Approved
DexamethasoneThe serum concentration of Sulfamethoxazole can be decreased when it is combined with Dexamethasone.Approved, Investigational, Vet Approved
DexketoprofenThe risk or severity of adverse effects can be increased when Dexketoprofen is combined with Sulfamethoxazole.Approved
DextromethorphanThe metabolism of Dextromethorphan can be decreased when combined with Sulfamethoxazole.Approved
DiazepamThe metabolism of Diazepam can be decreased when combined with Sulfamethoxazole.Approved, Illicit, Vet Approved
DiclofenacThe metabolism of Diclofenac can be decreased when combined with Sulfamethoxazole.Approved, Vet Approved
DicoumarolSulfamethoxazole may increase the anticoagulant activities of Dicoumarol.Approved
DiflunisalDiflunisal may increase the hypoglycemic activities of Sulfamethoxazole.Approved
DihydroergotamineThe metabolism of Sulfamethoxazole can be decreased when combined with Dihydroergotamine.Approved
DihydrotestosteroneDihydrotestosterone may increase the hypoglycemic activities of Sulfamethoxazole.Illicit
DiltiazemThe metabolism of Sulfamethoxazole can be decreased when combined with Diltiazem.Approved
DiphenhydramineThe metabolism of Diphenhydramine can be decreased when combined with Sulfamethoxazole.Approved
DisopyramideSulfamethoxazole may increase the QTc-prolonging activities of Disopyramide.Approved
DofetilideSulfamethoxazole may increase the QTc-prolonging activities of Dofetilide.Approved
DolasetronSulfamethoxazole may increase the QTc-prolonging activities of Dolasetron.Approved
DomperidoneSulfamethoxazole may increase the QTc-prolonging activities of Domperidone.Approved, Investigational, Vet Approved
DonepezilThe metabolism of Donepezil can be decreased when combined with Sulfamethoxazole.Approved
DopamineThe metabolism of Dopamine can be decreased when combined with Sulfamethoxazole.Approved
DorzolamideThe metabolism of Dorzolamide can be decreased when combined with Sulfamethoxazole.Approved
DoxepinThe metabolism of Doxepin can be decreased when combined with Sulfamethoxazole.Approved
DoxycyclineThe metabolism of Sulfamethoxazole can be decreased when combined with Doxycycline.Approved, Investigational, Vet Approved
DronabinolThe serum concentration of Dronabinol can be increased when it is combined with Sulfamethoxazole.Approved, Illicit
DronedaroneSulfamethoxazole may increase the QTc-prolonging activities of Dronedarone.Approved
DroperidolSulfamethoxazole may increase the QTc-prolonging activities of Droperidol.Approved, Vet Approved
DulaglutideDulaglutide may increase the hypoglycemic activities of Sulfamethoxazole.Approved
DuloxetineDuloxetine may increase the hypoglycemic activities of Sulfamethoxazole.Approved
EfavirenzThe serum concentration of Sulfamethoxazole can be decreased when it is combined with Efavirenz.Approved, Investigational
EletriptanThe metabolism of Eletriptan can be decreased when combined with Sulfamethoxazole.Approved, Investigational
EliglustatSulfamethoxazole may increase the QTc-prolonging activities of Eliglustat.Approved
EltrombopagThe metabolism of Eltrombopag can be decreased when combined with Sulfamethoxazole.Approved
EmpagliflozinEmpagliflozin may increase the hypoglycemic activities of Sulfamethoxazole.Approved
EnoxacinEnoxacin may increase the hypoglycemic activities of Sulfamethoxazole.Approved
EnzalutamideThe serum concentration of Sulfamethoxazole can be decreased when it is combined with Enzalutamide.Approved
EpoprostenolThe metabolism of Epoprostenol can be decreased when combined with Sulfamethoxazole.Approved
ErlotinibThe metabolism of Erlotinib can be decreased when combined with Sulfamethoxazole.Approved, Investigational
ErythromycinSulfamethoxazole may increase the QTc-prolonging activities of Erythromycin.Approved, Vet Approved
EscitalopramSulfamethoxazole may increase the QTc-prolonging activities of Escitalopram.Approved, Investigational
Eslicarbazepine acetateThe serum concentration of Sulfamethoxazole can be decreased when it is combined with Eslicarbazepine acetate.Approved
EstradiolThe metabolism of Estradiol can be decreased when combined with Sulfamethoxazole.Approved, Investigational, Vet Approved
EstroneThe metabolism of Estrone can be decreased when combined with Sulfamethoxazole.Approved
EszopicloneThe metabolism of Eszopiclone can be decreased when combined with Sulfamethoxazole.Approved
Ethyl biscoumacetateSulfamethoxazole may increase the anticoagulant activities of Ethyl biscoumacetate.Withdrawn
EtodolacThe metabolism of Etodolac can be decreased when combined with Sulfamethoxazole.Approved, Investigational, Vet Approved
EtoperidoneEtoperidone may increase the hypoglycemic activities of Sulfamethoxazole.Approved
EtoricoxibThe metabolism of Etoricoxib can be decreased when combined with Sulfamethoxazole.Approved, Investigational
EtravirineThe serum concentration of Sulfamethoxazole can be decreased when it is combined with Etravirine.Approved
ExenatideExenatide may increase the hypoglycemic activities of Sulfamethoxazole.Approved, Investigational
FlecainideSulfamethoxazole may increase the QTc-prolonging activities of Flecainide.Approved, Withdrawn
FleroxacinFleroxacin may increase the hypoglycemic activities of Sulfamethoxazole.Approved
FloxuridineThe metabolism of Sulfamethoxazole can be decreased when combined with Floxuridine.Approved
FluconazoleThe metabolism of Sulfamethoxazole can be decreased when combined with Fluconazole.Approved
FluindioneSulfamethoxazole may increase the anticoagulant activities of Fluindione.Investigational
FlumequineFlumequine may increase the hypoglycemic activities of Sulfamethoxazole.Withdrawn
FlunarizineThe metabolism of Flunarizine can be decreased when combined with Sulfamethoxazole.Approved
FlunitrazepamThe metabolism of Flunitrazepam can be decreased when combined with Sulfamethoxazole.Approved, Illicit
FluorouracilThe metabolism of Sulfamethoxazole can be decreased when combined with Fluorouracil.Approved
FluoxetineSulfamethoxazole may increase the QTc-prolonging activities of Fluoxetine.Approved, Vet Approved
FluoxymesteroneFluoxymesterone may increase the hypoglycemic activities of Sulfamethoxazole.Approved, Illicit
FlupentixolSulfamethoxazole may increase the QTc-prolonging activities of Flupentixol.Approved, Withdrawn
FlurbiprofenThe metabolism of Flurbiprofen can be decreased when combined with Sulfamethoxazole.Approved, Investigational
FluvastatinThe metabolism of Fluvastatin can be decreased when combined with Sulfamethoxazole.Approved
FluvoxamineThe metabolism of Sulfamethoxazole can be decreased when combined with Fluvoxamine.Approved, Investigational
FormoterolThe metabolism of Formoterol can be decreased when combined with Sulfamethoxazole.Approved, Investigational
FosamprenavirThe metabolism of Sulfamethoxazole can be decreased when combined with Fosamprenavir.Approved
FosaprepitantThe serum concentration of Sulfamethoxazole can be increased when it is combined with Fosaprepitant.Approved
FosphenytoinThe metabolism of Sulfamethoxazole can be increased when combined with Fosphenytoin.Approved
FurazolidoneFurazolidone may increase the hypoglycemic activities of Sulfamethoxazole.Approved, Vet Approved
Fusidic AcidThe serum concentration of Sulfamethoxazole can be increased when it is combined with Fusidic Acid.Approved
Gadobenic acidSulfamethoxazole may increase the QTc-prolonging activities of Gadobenic acid.Approved
GatifloxacinGatifloxacin may increase the hypoglycemic activities of Sulfamethoxazole.Approved, Investigational
GavestinelThe metabolism of Gavestinel can be decreased when combined with Sulfamethoxazole.Investigational
GemfibrozilThe metabolism of Sulfamethoxazole can be decreased when combined with Gemfibrozil.Approved
GemifloxacinSulfamethoxazole may increase the QTc-prolonging activities of Gemifloxacin.Approved, Investigational
GlibornurideGlibornuride may increase the hypoglycemic activities of Sulfamethoxazole.Withdrawn
GliclazideSulfamethoxazole may increase the hypoglycemic activities of Gliclazide.Approved
GlimepirideGlimepiride may increase the hypoglycemic activities of Sulfamethoxazole.Approved
GlipizideSulfamethoxazole may increase the hypoglycemic activities of Glipizide.Approved
GliquidoneGliquidone may increase the hypoglycemic activities of Sulfamethoxazole.Approved
GlisoxepideSulfamethoxazole may increase the hypoglycemic activities of Glisoxepide.Approved
GlyburideSulfamethoxazole may increase the hypoglycemic activities of Glyburide.Approved
GoserelinSulfamethoxazole may increase the QTc-prolonging activities of Goserelin.Approved
GranisetronSulfamethoxazole may increase the QTc-prolonging activities of Granisetron.Approved, Investigational
GrepafloxacinGrepafloxacin may increase the hypoglycemic activities of Sulfamethoxazole.Withdrawn
GuanfacineThe metabolism of Guanfacine can be decreased when combined with Sulfamethoxazole.Approved, Investigational
GusperimusGusperimus may increase the hypoglycemic activities of Sulfamethoxazole.Investigational
HalofantrineThe metabolism of Halofantrine can be decreased when combined with Sulfamethoxazole.Approved
HaloperidolSulfamethoxazole may increase the QTc-prolonging activities of Haloperidol.Approved
HalothaneThe metabolism of Halothane can be decreased when combined with Sulfamethoxazole.Approved, Vet Approved
HexobarbitalThe metabolism of Hexobarbital can be decreased when combined with Sulfamethoxazole.Approved
HistamineThe metabolism of Histamine Phosphate can be decreased when combined with Sulfamethoxazole.Approved, Investigational
HydracarbazineHydracarbazine may increase the hypoglycemic activities of Sulfamethoxazole.Experimental
HydromorphoneThe metabolism of Hydromorphone can be decreased when combined with Sulfamethoxazole.Approved, Illicit
IbuprofenThe metabolism of Ibuprofen can be decreased when combined with Sulfamethoxazole.Approved
IbutilideSulfamethoxazole may increase the QTc-prolonging activities of Ibutilide.Approved
IdarubicinThe metabolism of Idarubicin can be decreased when combined with Sulfamethoxazole.Approved
IdelalisibThe serum concentration of Sulfamethoxazole can be increased when it is combined with Idelalisib.Approved
IfosfamideThe metabolism of Ifosfamide can be decreased when combined with Sulfamethoxazole.Approved
IloperidoneSulfamethoxazole may increase the QTc-prolonging activities of Iloperidone.Approved
ImatinibThe metabolism of Sulfamethoxazole can be decreased when combined with Imatinib.Approved
IndalpineIndalpine may increase the hypoglycemic activities of Sulfamethoxazole.Investigational, Withdrawn
IndinavirThe metabolism of Sulfamethoxazole can be decreased when combined with Indinavir.Approved
IndomethacinThe metabolism of Indomethacin can be decreased when combined with Sulfamethoxazole.Approved, Investigational
Insulin AspartSulfamethoxazole may increase the hypoglycemic activities of Insulin Aspart.Approved
Insulin DetemirSulfamethoxazole may increase the hypoglycemic activities of Insulin Detemir.Approved
Insulin GlargineInsulin Glargine may increase the hypoglycemic activities of Sulfamethoxazole.Approved
Insulin GlulisineSulfamethoxazole may increase the hypoglycemic activities of Insulin Glulisine.Approved
Insulin HumanInsulin Human may increase the hypoglycemic activities of Sulfamethoxazole.Approved, Investigational
Insulin LisproInsulin Lispro may increase the hypoglycemic activities of Sulfamethoxazole.Approved
Insulin PorkInsulin Pork may increase the hypoglycemic activities of Sulfamethoxazole.Approved
IproclozideIproclozide may increase the hypoglycemic activities of Sulfamethoxazole.Withdrawn
IproniazidIproniazid may increase the hypoglycemic activities of Sulfamethoxazole.Withdrawn
IrbesartanThe metabolism of Irbesartan can be decreased when combined with Sulfamethoxazole.Approved, Investigational
IsavuconazoniumThe metabolism of Sulfamethoxazole can be decreased when combined with Isavuconazonium.Approved, Investigational
IsocarboxazidIsocarboxazid may increase the hypoglycemic activities of Sulfamethoxazole.Approved
IsradipineThe metabolism of Sulfamethoxazole can be decreased when combined with Isradipine.Approved
ItraconazoleThe metabolism of Sulfamethoxazole can be decreased when combined with Itraconazole.Approved, Investigational
IvacaftorThe serum concentration of Sulfamethoxazole can be increased when it is combined with Ivacaftor.Approved
IxazomibThe metabolism of Ixazomib can be decreased when combined with Sulfamethoxazole.Approved
KetamineThe metabolism of Ketamine can be decreased when combined with Sulfamethoxazole.Approved, Vet Approved
KetobemidoneThe metabolism of Ketobemidone can be decreased when combined with Sulfamethoxazole.Approved
KetoconazoleThe metabolism of Sulfamethoxazole can be decreased when combined with Ketoconazole.Approved, Investigational
KetoprofenThe metabolism of Ketoprofen can be decreased when combined with Sulfamethoxazole.Approved, Vet Approved
LanreotideSulfamethoxazole may increase the hypoglycemic activities of Lanreotide.Approved
LansoprazoleThe metabolism of Lansoprazole can be decreased when combined with Sulfamethoxazole.Approved, Investigational
LapatinibThe metabolism of Lapatinib can be decreased when combined with Sulfamethoxazole.Approved, Investigational
LeflunomideThe metabolism of Leflunomide can be decreased when combined with Sulfamethoxazole.Approved, Investigational
LenvatinibSulfamethoxazole may increase the QTc-prolonging activities of Lenvatinib.Approved
LesinuradThe metabolism of Lesinurad can be decreased when combined with Sulfamethoxazole.Approved
LeuprolideSulfamethoxazole may increase the QTc-prolonging activities of Leuprolide.Approved, Investigational
LevofloxacinSulfamethoxazole may increase the QTc-prolonging activities of Levofloxacin.Approved, Investigational
LevomilnacipranLevomilnacipran may increase the hypoglycemic activities of Sulfamethoxazole.Approved
LicofeloneThe metabolism of Licofelone can be decreased when combined with Sulfamethoxazole.Investigational
LidocaineThe metabolism of Lidocaine can be decreased when combined with Sulfamethoxazole.Approved, Vet Approved
LinagliptinLinagliptin may increase the hypoglycemic activities of Sulfamethoxazole.Approved
LiraglutideLiraglutide may increase the hypoglycemic activities of Sulfamethoxazole.Approved
LomefloxacinLomefloxacin may increase the hypoglycemic activities of Sulfamethoxazole.Approved
LoperamideThe metabolism of Loperamide can be decreased when combined with Sulfamethoxazole.Approved
LopinavirThe metabolism of Sulfamethoxazole can be decreased when combined with Lopinavir.Approved
LoratadineThe metabolism of Loratadine can be decreased when combined with Sulfamethoxazole.Approved
LornoxicamThe metabolism of Lornoxicam can be decreased when combined with Sulfamethoxazole.Approved
LosartanThe metabolism of Sulfamethoxazole can be decreased when combined with Losartan.Approved
LovastatinThe metabolism of Sulfamethoxazole can be decreased when combined with Lovastatin.Approved, Investigational
LuliconazoleThe serum concentration of Sulfamethoxazole can be increased when it is combined with Luliconazole.Approved
LumacaftorThe serum concentration of Sulfamethoxazole can be decreased when it is combined with Lumacaftor.Approved
LumefantrineSulfamethoxazole may increase the QTc-prolonging activities of Lumefantrine.Approved
LumiracoxibThe metabolism of Lumiracoxib can be decreased when combined with Sulfamethoxazole.Approved, Investigational
MebanazineMebanazine may increase the hypoglycemic activities of Sulfamethoxazole.Withdrawn
MecamylamineThe risk or severity of adverse effects can be increased when Sulfamethoxazole is combined with Mecamylamine.Approved
MecaserminSulfamethoxazole may increase the hypoglycemic activities of Mecasermin.Approved, Investigational
Mefenamic acidThe metabolism of Mefenamic acid can be decreased when combined with Sulfamethoxazole.Approved
MelatoninThe metabolism of Melatonin can be decreased when combined with Sulfamethoxazole.Approved, Nutraceutical, Vet Approved
MeloxicamThe metabolism of Meloxicam can be decreased when combined with Sulfamethoxazole.Approved, Vet Approved
MephenytoinThe metabolism of Mephenytoin can be decreased when combined with Sulfamethoxazole.Investigational, Withdrawn
MercaptopurineSulfamethoxazole may increase the myelosuppressive activities of Mercaptopurine.Approved
MesalazineMesalazine may increase the hypoglycemic activities of Sulfamethoxazole.Approved
MestranolThe metabolism of Mestranol can be decreased when combined with Sulfamethoxazole.Approved
MetforminMetformin may increase the hypoglycemic activities of Sulfamethoxazole.Approved
MethadoneSulfamethoxazole may increase the QTc-prolonging activities of Methadone.Approved
MethenamineThe risk or severity of adverse effects can be increased when Hexamethylenetetramine is combined with Sulfamethoxazole.Approved, Vet Approved
MethotrexateThe risk or severity of adverse effects can be increased when Sulfamethoxazole is combined with Methotrexate.Approved
MethoxyfluraneThe metabolism of Methoxyflurane can be decreased when combined with Sulfamethoxazole.Approved, Vet Approved
Methylene blueMethylene blue may increase the hypoglycemic activities of Sulfamethoxazole.Investigational
MethyltestosteroneMethyltestosterone may increase the hypoglycemic activities of Sulfamethoxazole.Approved
MetronidazoleThe metabolism of Metronidazole can be decreased when combined with Sulfamethoxazole.Approved
MifepristoneThe serum concentration of Sulfamethoxazole can be increased when it is combined with Mifepristone.Approved, Investigational
MiglitolMiglitol may increase the hypoglycemic activities of Sulfamethoxazole.Approved
MiglustatMiglustat may increase the hypoglycemic activities of Sulfamethoxazole.Approved
MilnacipranMilnacipran may increase the hypoglycemic activities of Sulfamethoxazole.Approved
MinaprineMinaprine may increase the hypoglycemic activities of Sulfamethoxazole.Approved
MirtazapineThe metabolism of Mirtazapine can be decreased when combined with Sulfamethoxazole.Approved
MitiglinideMitiglinide may increase the hypoglycemic activities of Sulfamethoxazole.Approved, Investigational
MitotaneThe serum concentration of Sulfamethoxazole can be decreased when it is combined with Mitotane.Approved
MoclobemideMoclobemide may increase the hypoglycemic activities of Sulfamethoxazole.Approved
ModafinilThe serum concentration of Sulfamethoxazole can be decreased when it is combined with Modafinil.Approved, Investigational
MontelukastThe metabolism of Montelukast can be decreased when combined with Sulfamethoxazole.Approved
MorphineThe metabolism of Morphine can be decreased when combined with Sulfamethoxazole.Approved, Investigational
MoxifloxacinSulfamethoxazole may increase the QTc-prolonging activities of Moxifloxacin.Approved, Investigational
Mycophenolate mofetilThe metabolism of Mycophenolate mofetil can be decreased when combined with Sulfamethoxazole.Approved, Investigational
NafcillinThe serum concentration of Sulfamethoxazole can be decreased when it is combined with Nafcillin.Approved
Nalidixic AcidNalidixic Acid may increase the hypoglycemic activities of Sulfamethoxazole.Approved
NaloxoneThe metabolism of Naloxone can be decreased when combined with Sulfamethoxazole.Approved, Vet Approved
NaproxenThe metabolism of Naproxen can be decreased when combined with Sulfamethoxazole.Approved, Vet Approved
NateglinideNateglinide may increase the hypoglycemic activities of Sulfamethoxazole.Approved, Investigational
NCX 4016NCX 4016 may increase the hypoglycemic activities of Sulfamethoxazole.Investigational
NefazodoneThe metabolism of Sulfamethoxazole can be decreased when combined with Nefazodone.Approved, Withdrawn
NelfinavirThe metabolism of Sulfamethoxazole can be decreased when combined with Nelfinavir.Approved
NetupitantThe serum concentration of Sulfamethoxazole can be increased when it is combined with Netupitant.Approved
NevirapineThe metabolism of Sulfamethoxazole can be increased when combined with Nevirapine.Approved
NialamideNialamide may increase the hypoglycemic activities of Sulfamethoxazole.Withdrawn
NicardipineThe metabolism of Sulfamethoxazole can be decreased when combined with Nicardipine.Approved
NiclosamideThe metabolism of Niclosamide can be decreased when combined with Sulfamethoxazole.Approved, Vet Approved
NicotineThe metabolism of Nicotine can be decreased when combined with Sulfamethoxazole.Approved
NilotinibSulfamethoxazole may increase the QTc-prolonging activities of Nilotinib.Approved, Investigational
Nitric OxideThe risk or severity of adverse effects can be increased when Nitric Oxide is combined with Sulfamethoxazole.Approved
NitroaspirinNitroaspirin may increase the hypoglycemic activities of Sulfamethoxazole.Investigational
NorfloxacinNorfloxacin may increase the hypoglycemic activities of Sulfamethoxazole.Approved
NortriptylineThe metabolism of Nortriptyline can be decreased when combined with Sulfamethoxazole.Approved
OctamoxinOctamoxin may increase the hypoglycemic activities of Sulfamethoxazole.Withdrawn
OctreotideOctreotide may increase the hypoglycemic activities of Sulfamethoxazole.Approved, Investigational
OfloxacinSulfamethoxazole may increase the QTc-prolonging activities of Ofloxacin.Approved
OlaparibThe metabolism of Sulfamethoxazole can be decreased when combined with Olaparib.Approved
OlodaterolThe metabolism of Olodaterol can be decreased when combined with Sulfamethoxazole.Approved
OlsalazineOlsalazine may increase the hypoglycemic activities of Sulfamethoxazole.Approved
OmbitasvirThe metabolism of Ombitasvir can be decreased when combined with Sulfamethoxazole.Approved
OmeprazoleThe metabolism of Sulfamethoxazole can be decreased when combined with Omeprazole.Approved, Investigational, Vet Approved
OndansetronSulfamethoxazole may increase the QTc-prolonging activities of Ondansetron.Approved
OsimertinibThe serum concentration of Sulfamethoxazole can be increased when it is combined with Osimertinib.Approved
OspemifeneThe metabolism of Ospemifene can be decreased when combined with Sulfamethoxazole.Approved
OxandroloneOxandrolone may increase the hypoglycemic activities of Sulfamethoxazole.Approved, Investigational
OxaprozinThe metabolism of Oxaprozin can be decreased when combined with Sulfamethoxazole.Approved
OxymetholoneOxymetholone may increase the hypoglycemic activities of Sulfamethoxazole.Approved, Illicit
PaclitaxelThe metabolism of Paclitaxel can be decreased when combined with Sulfamethoxazole.Approved, Vet Approved
PalbociclibThe serum concentration of Sulfamethoxazole can be increased when it is combined with Palbociclib.Approved
PaliperidoneSulfamethoxazole may increase the QTc-prolonging activities of Paliperidone.Approved
PanobinostatSulfamethoxazole may increase the QTc-prolonging activities of Panobinostat.Approved, Investigational
ParamethadioneThe metabolism of Paramethadione can be decreased when combined with Sulfamethoxazole.Approved
ParecoxibThe metabolism of Parecoxib can be decreased when combined with Sulfamethoxazole.Approved
PargylinePargyline may increase the hypoglycemic activities of Sulfamethoxazole.Approved
ParoxetineParoxetine may increase the hypoglycemic activities of Sulfamethoxazole.Approved, Investigational
PasireotideSulfamethoxazole may increase the hypoglycemic activities of Pasireotide.Approved
PazopanibSulfamethoxazole may increase the QTc-prolonging activities of Pazopanib.Approved
PazufloxacinPazufloxacin may increase the hypoglycemic activities of Sulfamethoxazole.Investigational
PefloxacinPefloxacin may increase the hypoglycemic activities of Sulfamethoxazole.Approved
PegvisomantPegvisomant may increase the hypoglycemic activities of Sulfamethoxazole.Approved
PentamidineSulfamethoxazole may increase the QTc-prolonging activities of Pentamidine.Approved
PentobarbitalThe metabolism of Sulfamethoxazole can be increased when combined with Pentobarbital.Approved, Vet Approved
PerflutrenSulfamethoxazole may increase the QTc-prolonging activities of Perflutren.Approved
PerphenazineThe metabolism of Perphenazine can be decreased when combined with Sulfamethoxazole.Approved
PhenacetinThe metabolism of Phenacetin can be decreased when combined with Sulfamethoxazole.Withdrawn
PhenelzinePhenelzine may increase the hypoglycemic activities of Sulfamethoxazole.Approved
PhenforminPhenformin may increase the hypoglycemic activities of Sulfamethoxazole.Approved, Withdrawn
PhenindioneSulfamethoxazole may increase the anticoagulant activities of Phenindione.Approved
PheniprazinePheniprazine may increase the hypoglycemic activities of Sulfamethoxazole.Withdrawn
PhenobarbitalThe metabolism of Sulfamethoxazole can be increased when combined with Phenobarbital.Approved
PhenoxypropazinePhenoxypropazine may increase the hypoglycemic activities of Sulfamethoxazole.Withdrawn
PhenprocoumonSulfamethoxazole may increase the anticoagulant activities of Phenprocoumon.Approved
PhenylbutazoneThe metabolism of Phenylbutazone can be decreased when combined with Sulfamethoxazole.Approved, Vet Approved
PhenytoinThe serum concentration of Phenytoin can be increased when it is combined with Sulfamethoxazole.Approved, Vet Approved
PimozideSulfamethoxazole may increase the QTc-prolonging activities of Pimozide.Approved
PioglitazoneThe metabolism of Pioglitazone can be decreased when combined with Sulfamethoxazole.Approved, Investigational
PirlindolePirlindole may increase the hypoglycemic activities of Sulfamethoxazole.Approved
PiroxicamThe metabolism of Piroxicam can be decreased when combined with Sulfamethoxazole.Approved, Investigational
PitavastatinThe metabolism of Pitavastatin can be decreased when combined with Sulfamethoxazole.Approved
PivhydrazinePivhydrazine may increase the hypoglycemic activities of Sulfamethoxazole.Withdrawn
PonatinibThe metabolism of Ponatinib can be decreased when combined with Sulfamethoxazole.Approved
PosaconazoleThe metabolism of Sulfamethoxazole can be decreased when combined with Posaconazole.Approved, Investigational, Vet Approved
PralatrexateThe serum concentration of Pralatrexate can be increased when it is combined with Sulfamethoxazole.Approved
PramlintidePramlintide may increase the hypoglycemic activities of Sulfamethoxazole.Approved, Investigational
PrasugrelThe metabolism of Prasugrel can be decreased when combined with Sulfamethoxazole.Approved
PravastatinThe metabolism of Pravastatin can be decreased when combined with Sulfamethoxazole.Approved
PrilocaineThe risk or severity of adverse effects can be increased when Sulfamethoxazole is combined with Prilocaine.Approved
PrimaquineSulfamethoxazole may increase the QTc-prolonging activities of Primaquine.Approved
PrimidoneThe metabolism of Sulfamethoxazole can be increased when combined with Primidone.Approved, Vet Approved
ProcainamideSulfamethoxazole may increase the QTc-prolonging activities of Procainamide.Approved
ProcaineThe therapeutic efficacy of Sulfamethoxazole can be decreased when used in combination with Procaine.Approved, Investigational, Vet Approved
ProgesteroneThe metabolism of Progesterone can be decreased when combined with Sulfamethoxazole.Approved, Vet Approved
ProguanilThe metabolism of Proguanil can be decreased when combined with Sulfamethoxazole.Approved
PromazineSulfamethoxazole may increase the QTc-prolonging activities of Promazine.Approved, Vet Approved
PropafenoneSulfamethoxazole may increase the QTc-prolonging activities of Propafenone.Approved
PropofolThe metabolism of Propofol can be decreased when combined with Sulfamethoxazole.Approved, Investigational, Vet Approved
PrulifloxacinPrulifloxacin may increase the hypoglycemic activities of Sulfamethoxazole.Investigational
PyrimethamineThe metabolism of Sulfamethoxazole can be decreased when combined with Pyrimethamine.Approved, Vet Approved
QuazepamThe metabolism of Quazepam can be decreased when combined with Sulfamethoxazole.Approved, Illicit
QuetiapineSulfamethoxazole may increase the QTc-prolonging activities of Quetiapine.Approved
QuinidineSulfamethoxazole may increase the QTc-prolonging activities of Quinidine.Approved
QuinineSulfamethoxazole may increase the QTc-prolonging activities of Quinine.Approved
RanolazineThe metabolism of Sulfamethoxazole can be decreased when combined with Ranolazine.Approved, Investigational
RasagilineRasagiline may increase the hypoglycemic activities of Sulfamethoxazole.Approved
RepaglinideRepaglinide may increase the hypoglycemic activities of Sulfamethoxazole.Approved, Investigational
RifabutinThe metabolism of Sulfamethoxazole can be increased when combined with Rifabutin.Approved
RifampicinThe metabolism of Sulfamethoxazole can be increased when combined with Rifampicin.Approved
RifapentineThe metabolism of Sulfamethoxazole can be increased when combined with Rifapentine.Approved
RiociguatThe metabolism of Riociguat can be decreased when combined with Sulfamethoxazole.Approved
RitonavirThe metabolism of Sulfamethoxazole can be decreased when combined with Ritonavir.Approved, Investigational
RofecoxibThe metabolism of Rofecoxib can be decreased when combined with Sulfamethoxazole.Investigational, Withdrawn
RosiglitazoneThe metabolism of Rosiglitazone can be decreased when combined with Sulfamethoxazole.Approved, Investigational
RosoxacinRosoxacin may increase the hypoglycemic activities of Sulfamethoxazole.Approved
RosuvastatinThe metabolism of Rosuvastatin can be decreased when combined with Sulfamethoxazole.Approved
SafrazineSafrazine may increase the hypoglycemic activities of Sulfamethoxazole.Withdrawn
Salicylic acidThe metabolism of Salicylic acid can be decreased when combined with Sulfamethoxazole.Approved, Vet Approved
SaquinavirThe metabolism of Sulfamethoxazole can be decreased when combined with Saquinavir.Approved, Investigational
SaxagliptinSaxagliptin may increase the hypoglycemic activities of Sulfamethoxazole.Approved
SecobarbitalThe metabolism of Sulfamethoxazole can be increased when combined with Secobarbital.Approved, Vet Approved
SelegilineSelegiline may increase the hypoglycemic activities of Sulfamethoxazole.Approved, Investigational, Vet Approved
SelexipagThe metabolism of Selexipag can be decreased when combined with Sulfamethoxazole.Approved
SertralineThe metabolism of Sertraline can be decreased when combined with Sulfamethoxazole.Approved
SildenafilThe metabolism of Sulfamethoxazole can be decreased when combined with Sildenafil.Approved, Investigational
SiltuximabThe serum concentration of Sulfamethoxazole can be decreased when it is combined with Siltuximab.Approved
SimeprevirThe serum concentration of Sulfamethoxazole can be increased when it is combined with Simeprevir.Approved
SimvastatinThe metabolism of Simvastatin can be decreased when combined with Sulfamethoxazole.Approved
SitagliptinThe metabolism of Sitagliptin can be decreased when combined with Sulfamethoxazole.Approved, Investigational
SitaxentanThe metabolism of Sitaxentan can be decreased when combined with Sulfamethoxazole.Approved, Investigational, Withdrawn
Sodium NitriteThe risk or severity of adverse effects can be increased when Sulfamethoxazole is combined with Sodium Nitrite.Approved
SorafenibThe metabolism of Sulfamethoxazole can be decreased when combined with Sorafenib.Approved, Investigational
SotalolSulfamethoxazole may increase the QTc-prolonging activities of Sotalol.Approved
SparfloxacinSparfloxacin may increase the hypoglycemic activities of Sulfamethoxazole.Approved
St. John's WortThe serum concentration of Sulfamethoxazole can be decreased when it is combined with St. John's Wort.Nutraceutical
StanozololStanozolol may increase the hypoglycemic activities of Sulfamethoxazole.Approved, Vet Approved
StiripentolThe serum concentration of Sulfamethoxazole can be increased when it is combined with Stiripentol.Approved
SulfadiazineThe metabolism of Sulfamethoxazole can be decreased when combined with Sulfadiazine.Approved, Vet Approved
SulfamoxoleThe metabolism of Sulfamoxole can be decreased when combined with Sulfamethoxazole.Approved
SulfinpyrazoneThe metabolism of Sulfinpyrazone can be decreased when combined with Sulfamethoxazole.Approved
SulfisoxazoleThe metabolism of Sulfamethoxazole can be decreased when combined with Sulfisoxazole.Approved, Vet Approved
SulodexideSulodexide may increase the hypoglycemic activities of Sulfamethoxazole.Approved, Investigational
SunitinibSulfamethoxazole may increase the hypoglycemic activities of Sunitinib.Approved, Investigational
SuprofenThe metabolism of Suprofen can be decreased when combined with Sulfamethoxazole.Approved, Withdrawn
TamoxifenThe metabolism of Tamoxifen can be decreased when combined with Sulfamethoxazole.Approved
TapentadolThe metabolism of Tapentadol can be decreased when combined with Sulfamethoxazole.Approved
TazaroteneThe metabolism of Tazarotene can be decreased when combined with Sulfamethoxazole.Approved, Investigational
TelaprevirThe metabolism of Sulfamethoxazole can be decreased when combined with Telaprevir.Withdrawn
TelavancinSulfamethoxazole may increase the QTc-prolonging activities of Telavancin.Approved
TelithromycinThe metabolism of Sulfamethoxazole can be decreased when combined with Telithromycin.Approved
TemafloxacinTemafloxacin may increase the hypoglycemic activities of Sulfamethoxazole.Withdrawn
TemazepamThe metabolism of Temazepam can be decreased when combined with Sulfamethoxazole.Approved
TenoxicamThe metabolism of Tenoxicam can be decreased when combined with Sulfamethoxazole.Approved
TerbinafineThe metabolism of Terbinafine can be decreased when combined with Sulfamethoxazole.Approved, Investigational, Vet Approved
TerfenadineThe metabolism of Terfenadine can be decreased when combined with Sulfamethoxazole.Withdrawn
TestosteroneThe metabolism of Testosterone can be decreased when combined with Sulfamethoxazole.Approved, Investigational
TetrabenazineSulfamethoxazole may increase the QTc-prolonging activities of Tetrabenazine.Approved
ThalidomideThe metabolism of Thalidomide can be decreased when combined with Sulfamethoxazole.Approved, Investigational, Withdrawn
TheophyllineThe metabolism of Theophylline can be decreased when combined with Sulfamethoxazole.Approved
ThiamylalThe metabolism of Thiamylal can be decreased when combined with Sulfamethoxazole.Approved, Vet Approved
ThioridazineSulfamethoxazole may increase the QTc-prolonging activities of Thioridazine.Withdrawn
TicagrelorThe metabolism of Sulfamethoxazole can be decreased when combined with Ticagrelor.Approved
TiclopidineThe metabolism of Sulfamethoxazole can be decreased when combined with Ticlopidine.Approved
TocilizumabThe serum concentration of Sulfamethoxazole can be decreased when it is combined with Tocilizumab.Approved
TolazamideTolazamide may increase the hypoglycemic activities of Sulfamethoxazole.Approved
TolbutamideThe metabolism of Sulfamethoxazole can be decreased when combined with Tolbutamide.Approved
ToloxatoneToloxatone may increase the hypoglycemic activities of Sulfamethoxazole.Approved
TolterodineThe metabolism of Tolterodine can be decreased when combined with Sulfamethoxazole.Approved, Investigational
TorasemideThe metabolism of Torasemide can be decreased when combined with Sulfamethoxazole.Approved
ToremifeneSulfamethoxazole may increase the QTc-prolonging activities of Toremifene.Approved, Investigational
TrabectedinThe metabolism of Trabectedin can be decreased when combined with Sulfamethoxazole.Approved, Investigational
Trans-2-PhenylcyclopropylamineTrans-2-Phenylcyclopropylamine may increase the hypoglycemic activities of Sulfamethoxazole.Experimental
TranylcypromineTranylcypromine may increase the hypoglycemic activities of Sulfamethoxazole.Approved
TreprostinilThe metabolism of Treprostinil can be decreased when combined with Sulfamethoxazole.Approved, Investigational
TretinoinThe metabolism of Tretinoin can be decreased when combined with Sulfamethoxazole.Approved, Investigational, Nutraceutical
TrimethadioneThe metabolism of Trimethadione can be decreased when combined with Sulfamethoxazole.Approved
TrimethoprimThe metabolism of Sulfamethoxazole can be decreased when combined with Trimethoprim.Approved, Vet Approved
TrimipramineThe metabolism of Trimipramine can be decreased when combined with Sulfamethoxazole.Approved
TroglitazoneThe metabolism of Troglitazone can be decreased when combined with Sulfamethoxazole.Withdrawn
TrovafloxacinTrovafloxacin may increase the hypoglycemic activities of Sulfamethoxazole.Approved, Withdrawn
ValdecoxibThe metabolism of Valdecoxib can be decreased when combined with Sulfamethoxazole.Investigational, Withdrawn
Valproic AcidThe metabolism of Sulfamethoxazole can be decreased when combined with Valproic Acid.Approved, Investigational
ValsartanThe metabolism of Sulfamethoxazole can be decreased when combined with Valsartan.Approved, Investigational
VandetanibSulfamethoxazole may increase the QTc-prolonging activities of Vandetanib.Approved
VemurafenibSulfamethoxazole may increase the QTc-prolonging activities of Vemurafenib.Approved
VenlafaxineThe metabolism of Sulfamethoxazole can be decreased when combined with Venlafaxine.Approved
VerapamilThe metabolism of Sulfamethoxazole can be decreased when combined with Verapamil.Approved
VildagliptinVildagliptin may increase the hypoglycemic activities of Sulfamethoxazole.Approved, Investigational
VismodegibThe metabolism of Vismodegib can be decreased when combined with Sulfamethoxazole.Approved
VogliboseVoglibose may increase the hypoglycemic activities of Sulfamethoxazole.Approved, Investigational
VoriconazoleThe metabolism of Sulfamethoxazole can be decreased when combined with Voriconazole.Approved, Investigational
VortioxetineThe metabolism of Vortioxetine can be decreased when combined with Sulfamethoxazole.Approved
WarfarinSulfamethoxazole may increase the anticoagulant activities of Warfarin.Approved
XimelagatranThe metabolism of Ximelagatran can be decreased when combined with Sulfamethoxazole.Approved, Investigational, Withdrawn
ZafirlukastThe metabolism of Sulfamethoxazole can be decreased when combined with Zafirlukast.Approved, Investigational
ZalcitabineThe metabolism of Zalcitabine can be decreased when combined with Sulfamethoxazole.Approved
ZaltoprofenThe metabolism of Zaltoprofen can be decreased when combined with Sulfamethoxazole.Approved
ZidovudineThe metabolism of Zidovudine can be decreased when combined with Sulfamethoxazole.Approved
ZileutonThe metabolism of Zileuton can be decreased when combined with Sulfamethoxazole.Approved, Investigational, Withdrawn
ZimelidineZimelidine may increase the hypoglycemic activities of Sulfamethoxazole.Withdrawn
ZiprasidoneSulfamethoxazole may increase the QTc-prolonging activities of Ziprasidone.Approved
ZolpidemThe metabolism of Zolpidem can be decreased when combined with Sulfamethoxazole.Approved
ZopicloneThe metabolism of Zopiclone can be decreased when combined with Sulfamethoxazole.Approved
ZuclopenthixolSulfamethoxazole may increase the QTc-prolonging activities of Zuclopenthixol.Approved, Investigational
Food Interactions
  • Do not take calcium, aluminium, magnesium or iron supplements within 2 hours of taking this medication.
  • Take on empty stomach: 1 hour before or 2 hours after meals.
  • Take with a full glass of water.
Synthesis Reference

Yasushi Takagishi, Kiichiro Ohsuga, Sadao Ohama, "Suppository containing sulfamethoxazole/trimethoprim complex and process for preparing the same." U.S. Patent US4461765, issued December, 1975.

General ReferencesNot Available
External Links
ATC CodesJ01EE01 — Sulfamethoxazole and trimethoprimG01AE10 — Combinations of sulfonamidesJ01EC01 — Sulfamethoxazole
AHFS Codes
  • 08:12.20
PDB Entries
FDA labelNot Available
MSDSDownload (35 KB)
Clinical Trials
Clinical Trials
1CompletedTreatmentHuman Immunodeficiency Virus (HIV) Infections / Pneumonia, Pneumocystis Carinii1
1RecruitingNot AvailableInfections, Bacterial1
1RecruitingTreatmentAnaplastic Astrocytoma (AA) / Astrocytic Tumors / Glioblastoma Multiforme / Neoplasms, Brain1
1, 2CompletedTreatmentHIV-1 Infections / Pf Subclinical Parasitemia1
1, 2CompletedTreatmentKidney Diseases / Transplant, Kidney / Transplantation, Kidney / Transplantation, Renal1
1, 2WithdrawnSupportive CareChronic Myeloproliferative Disorders / Infection NOS / Leukemias / Lymphoproliferative Disorders / Malignant Lymphomas / Multiple Myeloma and Plasma Cell Neoplasm / Myelodysplastic Syndromes / Myelodysplastic/Myeloproliferative Neoplasms / Unspecified Adult Solid Tumor, Protocol Specific1
2Active Not RecruitingTreatmentCystic Fibrosis (CF)1
2CompletedNot AvailableTuberculosis1
2CompletedTreatmentCystic Fibrosis (CF) / Methicillin-Resistant Staphylococcus Aureus (MRSA)1
2CompletedTreatmentDiabetes Mellitus, Insulin-Dependent1
2CompletedTreatmentMalignant Lymphomas2
2CompletedTreatmentUrinary Tract Infections (UTIs)1
2Enrolling by InvitationTreatmentHypotonia Cystinuria Syndrome / Isolated PREPL Deficiency1
2RecruitingPreventionProstate Infections1
2RecruitingTreatmentCommunity-acquired Methicillin-resistant Staphylococcus Aureus Infection / Community-Acquired MRSA Infections1
2RecruitingTreatmentInfection NOS / Multiple Myeloma (MM)1
2RecruitingTreatmentUrinary Tract Infections (UTIs)1
2RecruitingTreatmentModerate, refractory Atopic dermatitis1
2TerminatedTreatmentEnd-Stage Renal Disease (ESRD)1
2Unknown StatusTreatmentHip Prosthetic Joint Infection1
2WithdrawnTreatmentRecurrent Urinary Tract Infections1
2, 3TerminatedPreventionHuman Immunodeficiency Virus (HIV) Infections / Pneumonia, Interstitial Plasma Cell / Tuberculosis1
2, 3Unknown StatusTreatmentPneumonia, Pneumocystis / Prevention & Control1
3CompletedPreventionLife-threatening Infection / Nutrition Disorders1
3CompletedPreventionPlasmodium Infections1
3CompletedPreventionUrinary Tract Infections (UTIs) / Vesicoureteral Reflux1
3CompletedSupportive CareInfection NOS / Multiple Myeloma (MM)1
3CompletedTreatmentAntibiotics / Chronic Obstructive Pulmonary Disease (COPD) / Sepsis1
3CompletedTreatmentHuman Immunodeficiency Virus (HIV) Infections / Pneumonia, Pneumocystis Carinii1
3CompletedTreatmentRecurrent Urinary Tract Infections1
3RecruitingPreventionChronic Kidney Disease (CKD) / Renal HYPODYSPLASIA, Nonsyndromic, 1 / Vesicoureteral Reflux1
3RecruitingTreatmentEnterobacteriaceae Infections1
3TerminatedPreventionMalaria in Pregnancy1
3TerminatedTreatmentHuman Immunodeficiency Virus (HIV) Infections / Pneumonia, Interstitial Plasma Cell / Pneumonia, Pneumocystis Carinii1
4CompletedPreventionAcquired Immune Deficiency Syndrome (AIDS) / Anemias / Human Immunodeficiency Virus (HIV) Infections / Neutropenias / Newborn Infants1
4CompletedPreventionPyelonephritis / Renal Scars1
4CompletedTreatmentBMI >30 kg/m2 / MRSA / PCP / Pharmacokinetics / Tuberculosis1
4CompletedTreatmentHuman Immunodeficiency Virus (HIV)1
4CompletedTreatmentSkin Diseases, Infectious1
4WithdrawnPreventionComplications; Breast Prosthesis, Infection or Inflammation1
4WithdrawnTreatmentPneumonia, Pneumocystis Carinii1
Not AvailableActive Not RecruitingPreventionHIV Disease1
Not AvailableActive Not RecruitingTreatmentUrinary Tract Infections (UTIs)1
Not AvailableCompletedTreatmentAbscesses1
Not AvailableCompletedTreatmentAbscesses / Infections caused by penicillinase-producing staphylococci1
Not AvailableCompletedTreatmentAbscesses / Skin Diseases, Bacterial1
Not AvailableCompletedTreatmentCellulitis1
Not AvailableCompletedTreatmentEnd-Stage Renal Disease (ESRD)1
Not AvailableCompletedTreatmentHuman Immunodeficiency Virus (HIV) Infections / Pneumonia, Pneumocystis Carinii2
Not AvailableNo Longer AvailableNot AvailableDiabetes, Diabetes Mellitus Type 11
Not AvailableRecruitingNot AvailableBronchitis2
Not AvailableRecruitingPreventionUrolithiasis / UTI1
Not AvailableRecruitingTreatmentHypospadias1
Not AvailableRecruitingTreatmentLiver Abscess, Pyogenic1
Not AvailableTerminatedNot AvailablePrescribers' Drug Orders1
Not AvailableTerminatedPreventionCatheter-Associated Urinary Tract Infection1
Not AvailableUnknown StatusNot AvailableAsymptomatic Infections / Bacteriuria / Transplantation Infection / Urinary Tract Infections (UTIs)1
Not AvailableUnknown StatusPreventionUreteric Stent After Stone Surgery1
Not AvailableUnknown StatusTreatmentAbscesses1
Not AvailableWithdrawnTreatmentAbscesses1
  • Hoffmann la roche inc
  • Ascot hosp pharmaceuticals inc div travenol laboratories inc
  • Barr laboratories inc
  • Heather drug co inc
  • Sandoz inc
  • Watson laboratories inc
  • Shionogi usa inc
Dosage forms
TabletOral500 mg
Injection, solution, concentrateIntravenous
Unit descriptionCostUnit
Sulfamethoxazole-TMP DS 800-160 mg tablet0.94USD tablet
Sulfamethoxazole powder0.41USD g
DrugBank does not sell nor buy drugs. Pricing information is supplied for informational purposes only.
PatentsNot Available
Experimental Properties
melting point (°C)167 °CPhysProp
water solubility610 mg/L (at 37 °C)YALKOWSKY,SH & DANNENFELSER,RM (1992)
logP0.89HANSCH,C ET AL. (1995)
logS-2.62ADME Research, USCD
Predicted Properties
Water Solubility0.459 mg/mLALOGPS
pKa (Strongest Acidic)6.16ChemAxon
pKa (Strongest Basic)1.97ChemAxon
Physiological Charge-1ChemAxon
Hydrogen Acceptor Count4ChemAxon
Hydrogen Donor Count2ChemAxon
Polar Surface Area98.22 Å2ChemAxon
Rotatable Bond Count2ChemAxon
Refractivity64.5 m3·mol-1ChemAxon
Polarizability24.99 Å3ChemAxon
Number of Rings2ChemAxon
Rule of FiveYesChemAxon
Ghose FilterYesChemAxon
Veber's RuleNoChemAxon
MDDR-like RuleNoChemAxon
Predicted ADMET features
Human Intestinal Absorption+1.0
Blood Brain Barrier+0.9382
Caco-2 permeable-0.5346
P-glycoprotein substrateNon-substrate0.8884
P-glycoprotein inhibitor INon-inhibitor0.9362
P-glycoprotein inhibitor IINon-inhibitor0.8754
Renal organic cation transporterNon-inhibitor0.9195
CYP450 2C9 substrateNon-substrate0.7652
CYP450 2D6 substrateNon-substrate0.9115
CYP450 3A4 substrateNon-substrate0.7632
CYP450 1A2 substrateNon-inhibitor0.9045
CYP450 2C9 inhibitorNon-inhibitor0.9071
CYP450 2D6 inhibitorNon-inhibitor0.9231
CYP450 2C19 inhibitorNon-inhibitor0.9025
CYP450 3A4 inhibitorNon-inhibitor0.9744
CYP450 inhibitory promiscuityLow CYP Inhibitory Promiscuity0.7151
Ames testNon AMES toxic0.9132
BiodegradationNot ready biodegradable0.9882
Rat acute toxicity1.6422 LD50, mol/kg Not applicable
hERG inhibition (predictor I)Weak inhibitor0.9143
hERG inhibition (predictor II)Non-inhibitor0.8956
ADMET data is predicted using admetSAR, a free tool for evaluating chemical ADMET properties. (23092397 )
Mass Spec (NIST)Download (9.61 KB)
Spectrum TypeDescriptionSplash Key
LC-MS/MSLC-MS/MS Spectrum - LC-ESI-QTOF , negativesplash10-0a4i-0940000000-88c5b1ef2f503737ca9aView in MoNA
LC-MS/MSLC-MS/MS Spectrum - LC-ESI-QTOF , negativesplash10-0a4i-0900000000-b1b1b8e70ec8043bb89bView in MoNA
LC-MS/MSLC-MS/MS Spectrum - LC-ESI-QTOF , negativesplash10-0a4i-0900000000-f9d7f50685c7e96eefcdView in MoNA
LC-MS/MSLC-MS/MS Spectrum - LC-ESI-ITFT , negativesplash10-0a4i-0900000000-465bcb56920d86311f93View in MoNA
LC-MS/MSLC-MS/MS Spectrum - LC-ESI-ITFT , negativesplash10-0udi-0390000000-5dac2c73d05262cd10c0View in MoNA
LC-MS/MSLC-MS/MS Spectrum - LC-ESI-ITFT , negativesplash10-0a4i-0900000000-754d521e9fa8d49057e7View in MoNA
LC-MS/MSLC-MS/MS Spectrum - LC-ESI-ITFT , negativesplash10-0a4i-0900000000-5dea192ddf68e39f5c6cView in MoNA
LC-MS/MSLC-MS/MS Spectrum - LC-ESI-ITFT , negativesplash10-0a4i-5900000000-f376319dc72913e8db61View in MoNA
LC-MS/MSLC-MS/MS Spectrum - LC-ESI-ITFT , negativesplash10-08fu-9300000000-275ed92901e4719e8eb0View in MoNA
LC-MS/MSLC-MS/MS Spectrum - LC-ESI-ITFT , negativesplash10-0udi-0290000000-b02c397c2d2954785c81View in MoNA
LC-MS/MSLC-MS/MS Spectrum - LC-ESI-ITFT , negativesplash10-0a4i-0900000000-c61eade368561111e908View in MoNA
LC-MS/MSLC-MS/MS Spectrum - LC-ESI-ITFT , negativesplash10-0a4i-0900000000-c85d502fd299d3c8942cView in MoNA
LC-MS/MSLC-MS/MS Spectrum - LC-ESI-ITFT , negativesplash10-0a4i-4900000000-c8c24b18f27b59f6e693View in MoNA
LC-MS/MSLC-MS/MS Spectrum - LC-ESI-ITFT , negativesplash10-0a4i-0900000000-c61eade368561111e908View in MoNA
LC-MS/MSLC-MS/MS Spectrum - LC-ESI-QTOF , negativesplash10-0a4i-0910000000-64449078c4fdd8bf4614View in MoNA
LC-MS/MSLC-MS/MS Spectrum - LC-ESI-QTOF , negativesplash10-0a4i-3900000000-58869a5ce23e7feeeedfView in MoNA
LC-MS/MSLC-MS/MS Spectrum - LC-ESI-QTOF , negativesplash10-03di-9000000000-c388b00730b45caa4648View in MoNA
LC-MS/MSLC-MS/MS Spectrum - LC-ESI-QTOF , positivesplash10-0a4i-3910000000-a82697559a690c6121eaView in MoNA
LC-MS/MSLC-MS/MS Spectrum - LC-ESI-QTOF , positivesplash10-0a4i-0910000000-44dbcbdfb3ce5df0ba57View in MoNA
Predicted LC-MS/MSPredicted LC-MS/MS Spectrum - 10V, PositiveNot Available
Predicted LC-MS/MSPredicted LC-MS/MS Spectrum - 20V, PositiveNot Available
Predicted LC-MS/MSPredicted LC-MS/MS Spectrum - 40V, PositiveNot Available
Predicted LC-MS/MSPredicted LC-MS/MS Spectrum - 10V, NegativeNot Available
Predicted LC-MS/MSPredicted LC-MS/MS Spectrum - 20V, NegativeNot Available
Predicted LC-MS/MSPredicted LC-MS/MS Spectrum - 40V, NegativeNot Available
DescriptionThis compound belongs to the class of organic compounds known as aminobenzenesulfonamides. These are organic compounds containing a benzenesulfonamide moiety with an amine group attached to the benzene ring.
KingdomOrganic compounds
Super ClassBenzenoids
ClassBenzene and substituted derivatives
Sub ClassBenzenesulfonamides
Direct ParentAminobenzenesulfonamides
Alternative ParentsBenzenesulfonyl compounds / Aniline and substituted anilines / Organosulfonamides / Imidolactams / Isoxazoles / Heteroaromatic compounds / Aminosulfonyl compounds / Oxacyclic compounds / Azacyclic compounds / Primary amines
SubstituentsAminobenzenesulfonamide / Benzenesulfonyl group / Aniline or substituted anilines / Organosulfonic acid amide / Imidolactam / Azole / Isoxazole / Organic sulfonic acid or derivatives / Organosulfonic acid or derivatives / Sulfonyl
Molecular FrameworkAromatic heteromonocyclic compounds
External Descriptorssubstituted aniline, sulfonamide, isoxazoles, sulfonamide antibiotic (CHEBI:9332 )


Escherichia coli (strain K12)
Pharmacological action
General Function:
Metal ion binding
Specific Function:
Catalyzes the condensation of para-aminobenzoate (pABA) with 6-hydroxymethyl-7,8-dihydropterin diphosphate (DHPt-PP) to form 7,8-dihydropteroate (H2Pte), the immediate precursor of folate derivatives.
Gene Name:
Uniprot ID:
Molecular Weight:
30614.855 Da
  1. Hong YL, Hossler PA, Calhoun DH, Meshnick SR: Inhibition of recombinant Pneumocystis carinii dihydropteroate synthetase by sulfa drugs. Antimicrob Agents Chemother. 1995 Aug;39(8):1756-63. [PubMed:7486915 ]
Escherichia coli (strain K12)
Pharmacological action
General Function:
Tetrahydrofolylpolyglutamate synthase activity
Specific Function:
Conversion of folates to polyglutamate derivatives.
Gene Name:
Uniprot ID:
Molecular Weight:
45405.225 Da
  1. Overington JP, Al-Lazikani B, Hopkins AL: How many drug targets are there? Nat Rev Drug Discov. 2006 Dec;5(12):993-6. [PubMed:17139284 ]
  2. Imming P, Sinning C, Meyer A: Drugs, their targets and the nature and number of drug targets. Nat Rev Drug Discov. 2006 Oct;5(10):821-34. [PubMed:17016423 ]
  3. Winstanley PA, Mberu EK, Szwandt IS, Breckenridge AM, Watkins WM: In vitro activities of novel antifolate drug combinations against Plasmodium falciparum and human granulocyte CFUs. Antimicrob Agents Chemother. 1995 Apr;39(4):948-52. [PubMed:7786001 ]
Pharmacological action
General Function:
S-nitrosoglutathione binding
Specific Function:
Conjugation of reduced glutathione to a wide number of exogenous and endogenous hydrophobic electrophiles. Regulates negatively CDK5 activity via p25/p35 translocation to prevent neurodegeneration.
Gene Name:
Uniprot ID:
Molecular Weight:
23355.625 Da
  1. Callan HE, Jenkins RE, Maggs JL, Lavergne SN, Clarke SE, Naisbitt DJ, Park BK: Multiple adduction reactions of nitroso sulfamethoxazole with cysteinyl residues of peptides and proteins: implications for hapten formation. Chem Res Toxicol. 2009 May;22(5):937-48. doi: 10.1021/tx900034r. [PubMed:19358516 ]


Pharmacological action
General Function:
Steroid hydroxylase activity
Specific Function:
Cytochromes P450 are a group of heme-thiolate monooxygenases. In liver microsomes, this enzyme is involved in an NADPH-dependent electron transport pathway. It oxidizes a variety of structurally unrelated compounds, including steroids, fatty acids, and xenobiotics. This enzyme contributes to the wide pharmacokinetics variability of the metabolism of drugs such as S-warfarin, diclofenac, phenyto...
Gene Name:
Uniprot ID:
Molecular Weight:
55627.365 Da
  1. Zhou SF, Zhou ZW, Yang LP, Cai JP: Substrates, inducers, inhibitors and structure-activity relationships of human Cytochrome P450 2C9 and implications in drug development. Curr Med Chem. 2009;16(27):3480-675. Epub 2009 Sep 1. [PubMed:19515014 ]
  2. Cribb AE, Spielberg SP, Griffin GP: N4-hydroxylation of sulfamethoxazole by cytochrome P450 of the cytochrome P4502C subfamily and reduction of sulfamethoxazole hydroxylamine in human and rat hepatic microsomes. Drug Metab Dispos. 1995 Mar;23(3):406-14. [PubMed:7628308 ]
  3. Preissner S, Kroll K, Dunkel M, Senger C, Goldsobel G, Kuzman D, Guenther S, Winnenburg R, Schroeder M, Preissner R: SuperCYP: a comprehensive database on Cytochrome P450 enzymes including a tool for analysis of CYP-drug interactions. Nucleic Acids Res. 2010 Jan;38(Database issue):D237-43. doi: 10.1093/nar/gkp970. Epub 2009 Nov 24. [PubMed:19934256 ]
  4. Drug Interactions: Cytochrome P450 Drug Interaction Table [Link]
Pharmacological action
General Function:
Arylamine n-acetyltransferase activity
Specific Function:
Participates in the detoxification of a plethora of hydrazine and arylamine drugs. Catalyzes the N- or O-acetylation of various arylamine and heterocyclic amine substrates and is able to bioactivate several known carcinogens.
Gene Name:
Uniprot ID:
Molecular Weight:
33898.445 Da
  1. Zhou SF, Zhou ZW, Yang LP, Cai JP: Substrates, inducers, inhibitors and structure-activity relationships of human Cytochrome P450 2C9 and implications in drug development. Curr Med Chem. 2009;16(27):3480-675. Epub 2009 Sep 1. [PubMed:19515014 ]
Pharmacological action
General Function:
Arylamine n-acetyltransferase activity
Specific Function:
Participates in the detoxification of a plethora of hydrazine and arylamine drugs. Catalyzes the N- or O-acetylation of various arylamine and heterocyclic amine substrates and is able to bioactivate several known carcinogens.
Gene Name:
Uniprot ID:
Molecular Weight:
33542.235 Da
  1. Zhou SF, Zhou ZW, Yang LP, Cai JP: Substrates, inducers, inhibitors and structure-activity relationships of human Cytochrome P450 2C9 and implications in drug development. Curr Med Chem. 2009;16(27):3480-675. Epub 2009 Sep 1. [PubMed:19515014 ]
Pharmacological action
General Function:
Prostaglandin-endoperoxide synthase activity
Specific Function:
Converts arachidonate to prostaglandin H2 (PGH2), a committed step in prostanoid synthesis. Involved in the constitutive production of prostanoids in particular in the stomach and platelets. In gastric epithelial cells, it is a key step in the generation of prostaglandins, such as prostaglandin E2 (PGE2), which plays an important role in cytoprotection. In platelets, it is involved in the gener...
Gene Name:
Uniprot ID:
Molecular Weight:
68685.82 Da
  1. Zhou SF, Zhou ZW, Yang LP, Cai JP: Substrates, inducers, inhibitors and structure-activity relationships of human Cytochrome P450 2C9 and implications in drug development. Curr Med Chem. 2009;16(27):3480-675. Epub 2009 Sep 1. [PubMed:19515014 ]
Pharmacological action
General Function:
Retinoic acid binding
Specific Function:
UDPGT is of major importance in the conjugation and subsequent elimination of potentially toxic xenobiotics and endogenous compounds. This isoform has specificity for phenols. Isoform 2 lacks transferase activity but acts as a negative regulator of isoform 1.
Gene Name:
Uniprot ID:
Molecular Weight:
59940.495 Da
  1. Zhou SF, Zhou ZW, Yang LP, Cai JP: Substrates, inducers, inhibitors and structure-activity relationships of human Cytochrome P450 2C9 and implications in drug development. Curr Med Chem. 2009;16(27):3480-675. Epub 2009 Sep 1. [PubMed:19515014 ]
Pharmacological action
General Function:
Steroid hydroxylase activity
Specific Function:
Cytochromes P450 are a group of heme-thiolate monooxygenases. In liver microsomes, this enzyme is involved in an NADPH-dependent electron transport pathway. It oxidizes a variety of structurally unrelated compounds, including steroids, fatty acids, and xenobiotics. In the epoxidation of arachidonic acid it generates only 14,15- and 11,12-cis-epoxyeicosatrienoic acids. It is the principal enzyme...
Gene Name:
Uniprot ID:
Molecular Weight:
55824.275 Da
  1. Preissner S, Kroll K, Dunkel M, Senger C, Goldsobel G, Kuzman D, Guenther S, Winnenburg R, Schroeder M, Preissner R: SuperCYP: a comprehensive database on Cytochrome P450 enzymes including a tool for analysis of CYP-drug interactions. Nucleic Acids Res. 2010 Jan;38(Database issue):D237-43. doi: 10.1093/nar/gkp970. Epub 2009 Nov 24. [PubMed:19934256 ]
Pharmacological action
General Function:
Vitamin d3 25-hydroxylase activity
Specific Function:
Cytochromes P450 are a group of heme-thiolate monooxygenases. In liver microsomes, this enzyme is involved in an NADPH-dependent electron transport pathway. It performs a variety of oxidation reactions (e.g. caffeine 8-oxidation, omeprazole sulphoxidation, midazolam 1'-hydroxylation and midazolam 4-hydroxylation) of structurally unrelated compounds, including steroids, fatty acids, and xenobiot...
Gene Name:
Uniprot ID:
Molecular Weight:
57342.67 Da
  1. Preissner S, Kroll K, Dunkel M, Senger C, Goldsobel G, Kuzman D, Guenther S, Winnenburg R, Schroeder M, Preissner R: SuperCYP: a comprehensive database on Cytochrome P450 enzymes including a tool for analysis of CYP-drug interactions. Nucleic Acids Res. 2010 Jan;38(Database issue):D237-43. doi: 10.1093/nar/gkp970. Epub 2009 Nov 24. [PubMed:19934256 ]


Pharmacological action
General Function:
Toxic substance binding
Specific Function:
Serum albumin, the main protein of plasma, has a good binding capacity for water, Ca(2+), Na(+), K(+), fatty acids, hormones, bilirubin and drugs. Its main function is the regulation of the colloidal osmotic pressure of blood. Major zinc transporter in plasma, typically binds about 80% of all plasma zinc.
Gene Name:
Uniprot ID:
Molecular Weight:
69365.94 Da
  1. Bratlid D, Bergan T: Displacement of albumin-bound antimicrobial agents by bilirubin. Pharmacology. 1976;14(5):464-72. [PubMed:1031216 ]
  2. Angelakou A, Valsami G, Koupparis M, Macheras P: Use of 1-anilino-8-napthalenesulphonate as an ion probe for the potentiometric study of the binding of sulphonamides to bovine serum albumin and plasma. J Pharm Pharmacol. 1993 May;45(5):434-8. [PubMed:8099962 ]
Drug created on June 13, 2005 07:24 / Updated on July 18, 2017 16:55