Methylene blue


Logo pink
Are you a
new drug developer?
Contact us to learn more about our customized products and solutions.
Methylene blue
Accession Number
Small Molecule
Approved, Investigational

Methylene blue has been found to have many uses in medicine.

It has been widely used in Africa to treat malaria, but now it disappeared when chloroquine (CQ) and other drugs entered the market. It has been used as well for treatment of methemoglobinemia and other conditions. Methylene blue could also be used as urinary tract antiseptic.

Methylthioninium chloride (INN, or methylene blue, proposed trade name Rember) is an investigational drug being developed by the University of Aberdeen and TauRx Therapeutics that has been shown in early clinical trials to be an inhibitor of Tau protein aggregation. The drug is of potential interest for the treatment of patients with Alzheimer's disease.

  • Azul de metileno
  • Basic Blue 9
  • C.I. basic blue 9
  • Cloruro de metiltioninio
  • Lowacryl blue 9
  • Methylene blue
  • Methylene blue anhydrous
  • Methylenium ceruleum
  • Methylthioninium chloride
External IDs
C.I. 52015 / CI 52015 / CI-52015 / NSC-617593 / TRX-0014 / TRX0014
Product Ingredients
IngredientUNIICASInChI Key
Methylene blue trihydrateT42P99266K7220-79-3XQAXGZLFSSPBMK-UHFFFAOYSA-M
Active Moieties
Product Images
Prescription Products
NameDosageStrengthRouteLabellerMarketing StartMarketing End
Methylene Blue Inj 1%Liquid10 mgIntramuscular; IntravenousAllen & Hanburys A Glaxo Canada Ltd. Co.1979-12-311996-09-10Canada
Methylene Blue Inj 1% USPLiquid1 %IntravenousDavid Bull Laboratories (Pty) Ltd.1991-12-311999-08-10Canada
Methylene Blue Inj 10mg/ml USPLiquid10 mgIntravenousGlaxo Canada Inc1979-12-311996-09-10Canada
Methylene Blue InjectionSolution10 mgIntravenousTeligent Ou2016-02-19Not applicableCanada
Methylene Blue Injection USPSolution10 mgIntravenousAlveda Pharmaceuticals Inc2008-08-28Not applicableCanada
Methylene Blue Injection USPSolution10 mgParenteralSandoz Canada Incorporated1989-12-31Not applicableCanada
Methylene Blue Injection USPLiquid10 mgIntravenousOmega Laboratories Ltd2001-03-11Not applicableCanada
Methylene Blue Injection, USPLiquid1 %IntravenousHospira, Inc.1999-06-232010-03-24Canada
Methylene Blue Injection, USPSolution10 mgIntravenousMylan Pharmaceuticals1994-12-31Not applicableCanada
Methylthioninium Chloride ProveblueInjection, solution5 mg/mlIntravenousProvepharm Sas2011-05-06Not applicableEu
Additional Data Available
  • Application Number
    Application Number

    A unique ID assigned by the FDA when a product is submitted for approval by the labeller.

    Learn more
  • Product Code
    Product Code

    A governmentally-recognized ID which uniquely identifies the product within its regulatory market.

    Learn more
Over the Counter Products
NameDosageStrengthRouteLabellerMarketing StartMarketing End
Methylene Bleu Liq 1%Liquid1 %OralLaboratoire Atlas Inc1951-12-31Not applicableCanada
Methylene Bleu Liq 2%Liquid2 %OralLaboratoire Atlas Inc1951-12-31Not applicableCanada
Methylene Blue Solution 1%Liquid1 %Oral; TopicalRougier Pharma Division Of Ratiopharm Inc1981-12-312015-10-01Canada
Additional Data Available
  • Application Number
    Application Number

    A unique ID assigned by the FDA when a product is submitted for approval by the labeller.

    Learn more
  • Product Code
    Product Code

    A governmentally-recognized ID which uniquely identifies the product within its regulatory market.

    Learn more
Mixture Products
NameIngredientsDosageRouteLabellerMarketing StartMarketing End
Blue CollyriumMethylene blue (0.2 mg) + Naphazoline hydrochloride (0.5 mg)LiquidOphthalmicSandoz Canada Incorporated1997-05-13Not applicableCanada
Collyre BleuMethylene blue (0.2 mg) + Naphazoline hydrochloride (0.5 mg)Solution / dropsOphthalmicSabex Inc1991-12-311997-11-26Canada
Collyre Bleu LaiterMethylene blue (0.2 mg) + Naphazoline nitrate (0.5 mg)Solution / dropsOphthalmicBiocodex Sa1986-12-31Not applicableCanada
Eau Resolutive SokerMethylene blue (.1365 mg) + Camphor (.715 mg) + Cupric sulfate (28.925 mg) + Resorcinol (58.565 mg) + Zinc sulfate (88.4 mg)LiquidTopicalProduits Francais Labs Inc.1930-12-311997-05-30Canada
Saprolex TabMethylene blue (10 mg) + Methenamine mandelate (250 mg)TabletOralProduits Francais Labs Inc.1982-12-311997-05-30Canada
Unapproved/Other Products
NameIngredientsDosageRouteLabellerMarketing StartMarketing End
Azuphen MbMethylene blue trihydrate (10 mg/1) + Hyoscyamine sulfate dihydrate (0.12 mg/1) + Methenamine (120 mg/1) + Phenyl salicylate (36 mg/1) + Sodium phosphate, monobasic, monohydrate (40.8 mg/1)CapsuleOralBurel Pharmaceuticals, Llc2015-09-282016-11-01Us
DarcalmaMethylene blue trihydrate (10.8 mg/1) + Hyoscyamine sulfate dihydrate (.12 mg/1) + Methenamine (81.6 mg/1) + Phenyl salicylate (36.2 mg/1) + Sodium phosphate, monobasic, unspecified form (40.8 mg/1)TabletOralKylemore Pharmaceuticals, LLC2009-12-012009-12-02Us
DarcalmaMethylene blue trihydrate (10.8 mg/1) + Hyoscyamine sulfate dihydrate (0.12 mg/1) + Methenamine (81.6 mg/1) + Phenyl salicylate (36.2 mg/1) + Sodium phosphate, monobasic, unspecified form (40.8 mg/1)TabletOralRiver's Edge Pharmaceuticals, LLC2008-12-222011-07-31Us
DarpazMethylene blue trihydrate (10.8 mg/1) + Hyoscyamine sulfate dihydrate (.12 mg/1) + Methenamine (81 mg/1) + Phenyl salicylate (32.4 mg/1) + Sodium phosphate, monobasic (40.8 mg/1)TabletOralRiver's Edge Pharmaceuticals, LLC2008-12-012011-05-31Us
Hyolev MbMethylene blue trihydrate (10.8 mg/1) + Hyoscyamine sulfate dihydrate (0.12 mg/1) + Methenamine (81 mg/1) + Phenyl salicylate (32.4 mg/1) + Sodium phosphate, monobasic, monohydrate (40.8 mg/1)TabletOralBurel Pharmaceuticals, Llc2015-06-262016-11-01Us
HyophenMethylene blue trihydrate (10.8 mg/1) + Benzoic Acid (9 mg/1) + Hyoscyamine sulfate dihydrate (0.12 mg/1) + Methenamine (81.6 mg/1) + Phenyl salicylate (36.2 mg/1)TabletOralStar Pharmaceuticals, Llc2010-09-21Not applicableUs00076 0901 01 nlmimage10 cc15e64f
Indiomin MbMethylene blue trihydrate (10 mg/1) + Hyoscyamine sulfate dihydrate (0.12 mg/1) + Methenamine (120 mg/1) + Sodium phosphate, monobasic, monohydrate (40.8 mg/1)CapsuleOralBurel Pharmaceuticals, Llc2015-09-282016-10-24Us
Me NaPhos MB Hyo 1Methylene blue (10.8 mg/1) + Hyoscyamine sulfate (0.12 mg/1) + Methenamine (81.6 mg/1) + Sodium phosphate, monobasic, monohydrate (40.8 mg/1)TabletOralMethod Pharmaceuticals2015-12-01Not applicableUs
Methylene BlueMethylene blue trihydrate (10 mg/1mL)InjectionIntravenousAkorn2009-04-01Not applicableUs
Methylene BlueMethylene blue trihydrate (10 mg/1mL)Injection, solutionIntravenousAmerican Regent1990-09-302014-04-01Us
CAS number
Average: 319.85
Monoisotopic: 319.0909965
Chemical Formula
InChI Key
3,7-bis(dimethylamino)-5λ⁴-phenothiazin-5-ylium chloride



Methylene blue has several indications in medicine: 1. found to improve the hypotension associated with various clinical states. 2. Antiseptic in urinary tract infections. 3. Improves hypoxia and hyper dynamic circulation in cirrhosis of liver and severe hepatopulmonary syndrome. 4. Results in transient and reproducible improvement in blood pressure and cardiac function in septic shock. 5. Investigated for the treatment of Alzheimer's disease. 6. Treatment of ifofosamide induced neurotoxicity.

Not Available
Mechanism of action
  • Main mechanism of action involves inhibition of nitric oxide synthase and guanylate cyclase.
  • In Alzheimers Disease: a mechanistic study found that methylene blue oxidizes cysteine sulfhydryl groups on tau to keep tau monomeric. One preclinical treatment study in tauopathy mice reported anti-inflammatory or neuroprotective effects mediated by the Nrf2/antioxidant response element (ARE); another reported insoluble tau reduction and a learning and memory benefit when given early.
  • In Methemoglobinemia: Methylene Blue acts by reacting within RBC to form leukomethylene blue, which is a reducing agent of oxidized hemoglobin converting the ferric ion (fe+++) back to its oxygen-carrying ferrous state(fe++).
  • As antimalarial agent: Methylene Blue, a specific inhibitor of P.falciparum glutathione reductase has the potential to reverse CQ resistance and it prevents the polymerization of haem into haemozoin similar to 4-amino-quinoline antimalarials.
  • For ifosfamide induced neurotoxicity: Methylene blue functions as an alternate electron acceptor. It acts to reverse the NADH inhibition caused by gluconeogenesis in the liver while blocking the transformation of chloroethylamine into chloroacetaldehyde. In addition, it inhibits various amine oxidase activities, which also prevents the formation of chloroacetaldehyde.
AGuanylate cyclase soluble subunit alpha-2
ANitric oxide synthase, brain
Additional Data Available
Adverse Effects

Comprehensive structured data on known drug adverse effects with statistical prevalence. MedDRA and ICD10 ids are provided for adverse effect conditions and symptoms.

Learn more
Additional Data Available

Structured data covering drug contraindications. Each contraindication describes a scenario in which the drug is not to be used. Includes restrictions on co-administration, contraindicated populations, and more.

Learn more
Additional Data Available
Blackbox Warnings

Structured data representing warnings from the black box section of drug labels. These warnings cover important and dangerous risks, contraindications, or adverse effects.

Learn more
Not Available
Volume of distribution

10 mg/kg (in rats).

Protein binding

Methylene blue was reported to bind strongly to rabbit plasma (71–77% of bound drug).


Following distribution into tissues, rapidly reduced to leukomethylene blue (leucomethylthioninium chloride). Metabolism to leucomethylene blue may be less efficient in neonates than in older individuals.

Route of elimination

Excreted in urine and bile. About 75% of an oral dose excreted in urine, primarily as stabilized colorless leukomethylene blue.

Half life

5–6.5 hours (after IV dose).


3.0 ± 0.7 L/min.


LD50 = 1180 mg/kg ( Rat ).

Affected organisms
  • Humans and other mammals
Not Available
Pharmacogenomic Effects/ADRs
Interacting Gene/EnzymeAllele nameGenotype(s)Defining Change(s)Type(s)DescriptionDetails
Glucose-6-phosphate 1-dehydrogenaseVilleurbanneNot Available1000_1002delACCADR InferredRisk of severe hemolytic anemia or paradoxical methemoglobinemia.Details
Glucose-6-phosphate 1-dehydrogenaseTorunNot Available1006A->GADR InferredRisk of severe hemolytic anemia or paradoxical methemoglobinemia.Details
Glucose-6-phosphate 1-dehydrogenaseSunderlandNot Available105_107delCATADR InferredRisk of severe hemolytic anemia or paradoxical methemoglobinemia.Details
Glucose-6-phosphate 1-dehydrogenaseIwatsukiNot Available1081G->AADR InferredRisk of severe hemolytic anemia or paradoxical methemoglobinemia.Details
Glucose-6-phosphate 1-dehydrogenaseSerresNot Available1082C->TADR InferredRisk of severe hemolytic anemia or paradoxical methemoglobinemia.Details
Glucose-6-phosphate 1-dehydrogenaseTondelaNot Available1084_1101delCTGAACGAGCGCAAGGCCADR InferredRisk of severe hemolytic anemia or paradoxical methemoglobinemia.Details
Glucose-6-phosphate 1-dehydrogenaseLoma LindaNot Available1089C->AADR InferredRisk of severe hemolytic anemia or paradoxical methemoglobinemia.Details
Glucose-6-phosphate 1-dehydrogenaseAachenNot Available1089C->GADR InferredRisk of severe hemolytic anemia or paradoxical methemoglobinemia.Details
Glucose-6-phosphate 1-dehydrogenaseTenriNot Available1096A->GADR InferredRisk of severe hemolytic anemia or paradoxical methemoglobinemia.Details
Glucose-6-phosphate 1-dehydrogenaseMontpellierNot Available1132G>AADR InferredRisk of severe hemolytic anemia or paradoxical methemoglobinemia.Details
Glucose-6-phosphate 1-dehydrogenaseCalvo MackennaNot Available1138A->GADR InferredRisk of severe hemolytic anemia or paradoxical methemoglobinemia.Details
Glucose-6-phosphate 1-dehydrogenaseRileyNot Available1139T->CADR InferredRisk of severe hemolytic anemia or paradoxical methemoglobinemia.Details
Glucose-6-phosphate 1-dehydrogenaseOlomoucNot Available1141T->CADR InferredRisk of severe hemolytic anemia or paradoxical methemoglobinemia.Details
Glucose-6-phosphate 1-dehydrogenaseTomahNot Available1153T->CADR InferredRisk of severe hemolytic anemia or paradoxical methemoglobinemia.Details
Glucose-6-phosphate 1-dehydrogenaseLynwoodNot Available1154G->TADR InferredRisk of severe hemolytic anemia or paradoxical methemoglobinemia.Details
Glucose-6-phosphate 1-dehydrogenaseMadridNot Available1155C->GADR InferredRisk of severe hemolytic anemia or paradoxical methemoglobinemia.Details
Glucose-6-phosphate 1-dehydrogenaseIowa, Walter Reed, SpringfieldNot Available1156A->GADR InferredRisk of severe hemolytic anemia or paradoxical methemoglobinemia.Details
Glucose-6-phosphate 1-dehydrogenaseBeverly Hills, Genova, Iwate, Niigata, YamaguchiNot Available1160G->AADR InferredRisk of severe hemolytic anemia or paradoxical methemoglobinemia.Details
Glucose-6-phosphate 1-dehydrogenaseHartfordNot Available1162A->GADR InferredRisk of severe hemolytic anemia or paradoxical methemoglobinemia.Details
Glucose-6-phosphate 1-dehydrogenasePrahaNot Available1166A->GADR InferredRisk of severe hemolytic anemia or paradoxical methemoglobinemia.Details
Glucose-6-phosphate 1-dehydrogenaseKrakowNot Available1175T>CADR InferredRisk of severe hemolytic anemia or paradoxical methemoglobinemia.Details
Glucose-6-phosphate 1-dehydrogenaseWisconsinNot Available1177C->GADR InferredRisk of severe hemolytic anemia or paradoxical methemoglobinemia.Details
Glucose-6-phosphate 1-dehydrogenaseNashville, Anaheim, PorticiNot Available1178G->AADR InferredRisk of severe hemolytic anemia or paradoxical methemoglobinemia.Details
Glucose-6-phosphate 1-dehydrogenaseAlhambraNot Available1180G->CADR InferredRisk of severe hemolytic anemia or paradoxical methemoglobinemia.Details
Glucose-6-phosphate 1-dehydrogenaseBariNot Available1187C->TADR InferredRisk of severe hemolytic anemia or paradoxical methemoglobinemia.Details
Glucose-6-phosphate 1-dehydrogenasePuerto LimonNot Available1192G->AADR InferredRisk of severe hemolytic anemia or paradoxical methemoglobinemia.Details
Glucose-6-phosphate 1-dehydrogenaseCovao do LoboNot Available1205C>AADR InferredRisk of severe hemolytic anemia or paradoxical methemoglobinemia.Details
Glucose-6-phosphate 1-dehydrogenaseClinicNot Available1215G->AADR InferredRisk of severe hemolytic anemia or paradoxical methemoglobinemia.Details
Glucose-6-phosphate 1-dehydrogenaseUtrechtNot Available1225C->TADR InferredRisk of severe hemolytic anemia or paradoxical methemoglobinemia.Details
Glucose-6-phosphate 1-dehydrogenaseSuwalkiNot Available1226C->GADR InferredRisk of severe hemolytic anemia or paradoxical methemoglobinemia.Details
Glucose-6-phosphate 1-dehydrogenaseRiversideNot Available1228G->TADR InferredRisk of severe hemolytic anemia or paradoxical methemoglobinemia.Details
Glucose-6-phosphate 1-dehydrogenaseJapan, ShinagawaNot Available1229G->AADR InferredRisk of severe hemolytic anemia or paradoxical methemoglobinemia.Details
Glucose-6-phosphate 1-dehydrogenaseKawasakiNot Available1229G->CADR InferredRisk of severe hemolytic anemia or paradoxical methemoglobinemia.Details
Glucose-6-phosphate 1-dehydrogenaseMunichNot Available1231A->GADR InferredRisk of severe hemolytic anemia or paradoxical methemoglobinemia.Details
Glucose-6-phosphate 1-dehydrogenaseGeorgiaNot Available1284C->AADR InferredRisk of severe hemolytic anemia or paradoxical methemoglobinemia.Details
Glucose-6-phosphate 1-dehydrogenaseSumareNot Available1292T->GADR InferredRisk of severe hemolytic anemia or paradoxical methemoglobinemia.Details
Glucose-6-phosphate 1-dehydrogenaseTelti/KobeNot Available1318C->TADR InferredRisk of severe hemolytic anemia or paradoxical methemoglobinemia.Details
Glucose-6-phosphate 1-dehydrogenaseSantiago de Cuba, MoriokaNot Available1339G->AADR InferredRisk of severe hemolytic anemia or paradoxical methemoglobinemia.Details
Glucose-6-phosphate 1-dehydrogenaseHarimaNot Available1358T->AADR InferredRisk of severe hemolytic anemia or paradoxical methemoglobinemia.Details
Glucose-6-phosphate 1-dehydrogenaseFiguera da FozNot Available1366G->CADR InferredRisk of severe hemolytic anemia or paradoxical methemoglobinemia.Details
Glucose-6-phosphate 1-dehydrogenaseAmiensNot Available1367A>TADR InferredRisk of severe hemolytic anemia or paradoxical methemoglobinemia.Details
Glucose-6-phosphate 1-dehydrogenaseBangkok NoiNot Available1376G->T, 1502T->GADR InferredRisk of severe hemolytic anemia or paradoxical methemoglobinemia.Details
Glucose-6-phosphate 1-dehydrogenaseFukayaNot Available1462G->AADR InferredRisk of severe hemolytic anemia or paradoxical methemoglobinemia.Details
Glucose-6-phosphate 1-dehydrogenaseCampinasNot Available1463G->TADR InferredRisk of severe hemolytic anemia or paradoxical methemoglobinemia.Details
Glucose-6-phosphate 1-dehydrogenaseBuenos AiresNot Available1465C>TADR InferredRisk of severe hemolytic anemia or paradoxical methemoglobinemia.Details
Glucose-6-phosphate 1-dehydrogenaseArakawaNot Available1466C->TADR InferredRisk of severe hemolytic anemia or paradoxical methemoglobinemia.Details
Glucose-6-phosphate 1-dehydrogenaseBrightonNot Available1488_1490delGAAADR InferredRisk of severe hemolytic anemia or paradoxical methemoglobinemia.Details
Glucose-6-phosphate 1-dehydrogenaseKozukataNot Available159G->CADR InferredRisk of severe hemolytic anemia or paradoxical methemoglobinemia.Details
Glucose-6-phosphate 1-dehydrogenaseAmsterdamNot Available180_182delTCTADR InferredRisk of severe hemolytic anemia or paradoxical methemoglobinemia.Details
Glucose-6-phosphate 1-dehydrogenaseNo nameNot Available202G->A, 376A->G, 1264C>GADR InferredRisk of severe hemolytic anemia or paradoxical methemoglobinemia.Details
Glucose-6-phosphate 1-dehydrogenaseSwanseaNot Available224T->CADR InferredRisk of severe hemolytic anemia or paradoxical methemoglobinemia.Details
Glucose-6-phosphate 1-dehydrogenaseUrayasuNot Available281_283delAGAADR InferredRisk of severe hemolytic anemia or paradoxical methemoglobinemia.Details
Glucose-6-phosphate 1-dehydrogenaseVancouverNot Available317C->G544C->T592C->TADR InferredRisk of severe hemolytic anemia or paradoxical methemoglobinemia.Details
Glucose-6-phosphate 1-dehydrogenaseMt SinaiNot Available376A->G, 1159C->TADR InferredRisk of severe hemolytic anemia or paradoxical methemoglobinemia.Details
Glucose-6-phosphate 1-dehydrogenasePlymouthNot Available488G->AADR InferredRisk of severe hemolytic anemia or paradoxical methemoglobinemia.Details
Glucose-6-phosphate 1-dehydrogenaseVolendamNot Available514C->TADR InferredRisk of severe hemolytic anemia or paradoxical methemoglobinemia.Details
Glucose-6-phosphate 1-dehydrogenaseShinshuNot Available527A->GADR InferredRisk of severe hemolytic anemia or paradoxical methemoglobinemia.Details
Glucose-6-phosphate 1-dehydrogenaseChikugoNot Available535A->TADR InferredRisk of severe hemolytic anemia or paradoxical methemoglobinemia.Details
Glucose-6-phosphate 1-dehydrogenaseTsukuiNot Available561_563delCTCADR InferredRisk of severe hemolytic anemia or paradoxical methemoglobinemia.Details
Glucose-6-phosphate 1-dehydrogenasePedoplis-CkaroNot Available573C>GADR InferredRisk of severe hemolytic anemia or paradoxical methemoglobinemia.Details
Glucose-6-phosphate 1-dehydrogenaseSantiagoNot Available593G->CADR InferredRisk of severe hemolytic anemia or paradoxical methemoglobinemia.Details
Glucose-6-phosphate 1-dehydrogenaseMinnesota, Marion, Gastonia, LeJeuneNot Available637G->TADR InferredRisk of severe hemolytic anemia or paradoxical methemoglobinemia.Details
Glucose-6-phosphate 1-dehydrogenaseCincinnatiNot Available637G->T, 1037A->TADR InferredRisk of severe hemolytic anemia or paradoxical methemoglobinemia.Details
Glucose-6-phosphate 1-dehydrogenaseHarilaouNot Available648T->GADR InferredRisk of severe hemolytic anemia or paradoxical methemoglobinemia.Details
Glucose-6-phosphate 1-dehydrogenaseNorth DallasNot Available683_685delACAADR InferredRisk of severe hemolytic anemia or paradoxical methemoglobinemia.Details
Glucose-6-phosphate 1-dehydrogenaseAsahikawaNot Available695G->AADR InferredRisk of severe hemolytic anemia or paradoxical methemoglobinemia.Details
Glucose-6-phosphate 1-dehydrogenaseDurhamNot Available713A->GADR InferredRisk of severe hemolytic anemia or paradoxical methemoglobinemia.Details
Glucose-6-phosphate 1-dehydrogenaseStonybrookNot Available724_729delGGCACTADR InferredRisk of severe hemolytic anemia or paradoxical methemoglobinemia.Details
Glucose-6-phosphate 1-dehydrogenaseWayneNot Available769C->GADR InferredRisk of severe hemolytic anemia or paradoxical methemoglobinemia.Details
Glucose-6-phosphate 1-dehydrogenaseAveiroNot Available806G->AADR InferredRisk of severe hemolytic anemia or paradoxical methemoglobinemia.Details
Glucose-6-phosphate 1-dehydrogenaseCleveland CorumNot Available820G->AADR InferredRisk of severe hemolytic anemia or paradoxical methemoglobinemia.Details
Glucose-6-phosphate 1-dehydrogenaseLilleNot Available821A>TADR InferredRisk of severe hemolytic anemia or paradoxical methemoglobinemia.Details
Glucose-6-phosphate 1-dehydrogenaseBangkokNot Available825G>CADR InferredRisk of severe hemolytic anemia or paradoxical methemoglobinemia.Details
Glucose-6-phosphate 1-dehydrogenaseSugaoNot Available826C->TADR InferredRisk of severe hemolytic anemia or paradoxical methemoglobinemia.Details
Glucose-6-phosphate 1-dehydrogenaseLa JollaNot Available832T->CADR InferredRisk of severe hemolytic anemia or paradoxical methemoglobinemia.Details
Glucose-6-phosphate 1-dehydrogenaseWexhamNot Available833C->TADR InferredRisk of severe hemolytic anemia or paradoxical methemoglobinemia.Details
Glucose-6-phosphate 1-dehydrogenasePiotrkowNot Available851T>CADR InferredRisk of severe hemolytic anemia or paradoxical methemoglobinemia.Details
Glucose-6-phosphate 1-dehydrogenaseWest VirginiaNot Available910G->TADR InferredRisk of severe hemolytic anemia or paradoxical methemoglobinemia.Details
Glucose-6-phosphate 1-dehydrogenaseOmiyaNot Available921G->CADR InferredRisk of severe hemolytic anemia or paradoxical methemoglobinemia.Details
Glucose-6-phosphate 1-dehydrogenaseNaraNot Available953_976delCCACCAAAGGGTACCTGGAC GACCADR InferredRisk of severe hemolytic anemia or paradoxical methemoglobinemia.Details
Glucose-6-phosphate 1-dehydrogenaseManhattanNot Available962G->AADR InferredRisk of severe hemolytic anemia or paradoxical methemoglobinemia.Details
Glucose-6-phosphate 1-dehydrogenaseRehevotNot Available964T->CADR InferredRisk of severe hemolytic anemia or paradoxical methemoglobinemia.Details
Glucose-6-phosphate 1-dehydrogenaseHoniaraNot Available99A->G / 1360C->TADR InferredRisk of severe hemolytic anemia or paradoxical methemoglobinemia.Details
Glucose-6-phosphate 1-dehydrogenaseTokyo, FukushimaNot Available1246G->AADR InferredRisk of severe hemolytic anemia or paradoxical methemoglobinemia.Details
Glucose-6-phosphate 1-dehydrogenaseChathamNot Available1003G->AADR InferredRisk of severe hemolytic anemia or paradoxical methemoglobinemia.Details
Glucose-6-phosphate 1-dehydrogenaseFushanNot Available1004C->AADR InferredRisk of severe hemolytic anemia or paradoxical methemoglobinemia.Details
Glucose-6-phosphate 1-dehydrogenasePartenopeNot Available1052G->TADR InferredRisk of severe hemolytic anemia or paradoxical methemoglobinemia.Details
Glucose-6-phosphate 1-dehydrogenaseIerapetraNot Available1057C->TADR InferredRisk of severe hemolytic anemia or paradoxical methemoglobinemia.Details
Glucose-6-phosphate 1-dehydrogenaseAnadiaNot Available1193A->GADR InferredRisk of severe hemolytic anemia or paradoxical methemoglobinemia.Details
Glucose-6-phosphate 1-dehydrogenaseAbenoNot Available1220A->CADR InferredRisk of severe hemolytic anemia or paradoxical methemoglobinemia.Details
Glucose-6-phosphate 1-dehydrogenaseSurabayaNot Available1291G->AADR InferredRisk of severe hemolytic anemia or paradoxical methemoglobinemia.Details
Glucose-6-phosphate 1-dehydrogenasePawneeNot Available1316G->CADR InferredRisk of severe hemolytic anemia or paradoxical methemoglobinemia.Details
Glucose-6-phosphate 1-dehydrogenaseS. AntiocoNot Available1342A->GADR InferredRisk of severe hemolytic anemia or paradoxical methemoglobinemia.Details
Glucose-6-phosphate 1-dehydrogenaseCassanoNot Available1347G->CADR InferredRisk of severe hemolytic anemia or paradoxical methemoglobinemia.Details
Glucose-6-phosphate 1-dehydrogenaseHermoupolisNot Available1347G->C / 1360C->TADR InferredRisk of severe hemolytic anemia or paradoxical methemoglobinemia.Details
Glucose-6-phosphate 1-dehydrogenaseUnion,Maewo, Chinese-2, KaloNot Available1360C->TADR InferredRisk of severe hemolytic anemia or paradoxical methemoglobinemia.Details
Glucose-6-phosphate 1-dehydrogenaseAndalusNot Available1361G->AADR InferredRisk of severe hemolytic anemia or paradoxical methemoglobinemia.Details
Glucose-6-phosphate 1-dehydrogenaseCosenzaNot Available1376G->CADR InferredRisk of severe hemolytic anemia or paradoxical methemoglobinemia.Details
Glucose-6-phosphate 1-dehydrogenaseCanton, Taiwan- Hakka, Gifu-like, Agrigento-likeNot Available1376G->TADR InferredRisk of severe hemolytic anemia or paradoxical methemoglobinemia.Details
Glucose-6-phosphate 1-dehydrogenaseFloresNot Available1387C->AADR InferredRisk of severe hemolytic anemia or paradoxical methemoglobinemia.Details
Glucose-6-phosphate 1-dehydrogenaseKaiping, Anant, Dhon, Sapporo-like, WoseraNot Available1388G->AADR InferredRisk of severe hemolytic anemia or paradoxical methemoglobinemia.Details
Glucose-6-phosphate 1-dehydrogenaseKamogawaNot Available169C->TADR InferredRisk of severe hemolytic anemia or paradoxical methemoglobinemia.Details
Glucose-6-phosphate 1-dehydrogenaseCostanzoNot Available179T>CADR InferredRisk of severe hemolytic anemia or paradoxical methemoglobinemia.Details
Glucose-6-phosphate 1-dehydrogenaseAmazoniaNot Available185C->AADR InferredRisk of severe hemolytic anemia or paradoxical methemoglobinemia.Details
Glucose-6-phosphate 1-dehydrogenaseSongklanagarindNot Available196T->AADR InferredRisk of severe hemolytic anemia or paradoxical methemoglobinemia.Details
Glucose-6-phosphate 1-dehydrogenaseHechiNot Available202G->A / 871G->AADR InferredRisk of severe hemolytic anemia or paradoxical methemoglobinemia.Details
Glucose-6-phosphate 1-dehydrogenaseNamouruNot Available208T->CADR InferredRisk of severe hemolytic anemia or paradoxical methemoglobinemia.Details
Glucose-6-phosphate 1-dehydrogenaseBao LocNot Available352T>CADR InferredRisk of severe hemolytic anemia or paradoxical methemoglobinemia.Details
Glucose-6-phosphate 1-dehydrogenaseCrispimNot Available375G->T, 379G->T383T->C384C>TADR InferredRisk of severe hemolytic anemia or paradoxical methemoglobinemia.Details
Glucose-6-phosphate 1-dehydrogenaseAcrokorinthosNot Available376A->G / 463C->GADR InferredRisk of severe hemolytic anemia or paradoxical methemoglobinemia.Details
Glucose-6-phosphate 1-dehydrogenaseSanta MariaNot Available376A->G / 542A->TADR InferredRisk of severe hemolytic anemia or paradoxical methemoglobinemia.Details
Glucose-6-phosphate 1-dehydrogenaseAnanindeuaNot Available376A->G / 871G->AADR InferredRisk of severe hemolytic anemia or paradoxical methemoglobinemia.Details
Glucose-6-phosphate 1-dehydrogenaseVanua LavaNot Available383T->CADR InferredRisk of severe hemolytic anemia or paradoxical methemoglobinemia.Details
Glucose-6-phosphate 1-dehydrogenaseValladolidNot Available406C->TADR InferredRisk of severe hemolytic anemia or paradoxical methemoglobinemia.Details
Glucose-6-phosphate 1-dehydrogenaseBelemNot Available409C->TADR InferredRisk of severe hemolytic anemia or paradoxical methemoglobinemia.Details
Glucose-6-phosphate 1-dehydrogenaseLiuzhouNot Available442G->AADR InferredRisk of severe hemolytic anemia or paradoxical methemoglobinemia.Details
Glucose-6-phosphate 1-dehydrogenaseShenzenNot Available473G>AADR InferredRisk of severe hemolytic anemia or paradoxical methemoglobinemia.Details
Glucose-6-phosphate 1-dehydrogenaseTaipei “Chinese- 3”Not Available493A->GADR InferredRisk of severe hemolytic anemia or paradoxical methemoglobinemia.Details
Glucose-6-phosphate 1-dehydrogenaseToledoNot Available496C>TADR InferredRisk of severe hemolytic anemia or paradoxical methemoglobinemia.Details
Glucose-6-phosphate 1-dehydrogenaseNaoneNot Available497G->AADR InferredRisk of severe hemolytic anemia or paradoxical methemoglobinemia.Details
Glucose-6-phosphate 1-dehydrogenaseNankangNot Available517T->CADR InferredRisk of severe hemolytic anemia or paradoxical methemoglobinemia.Details
Glucose-6-phosphate 1-dehydrogenaseMiaoliNot Available519C->GADR InferredRisk of severe hemolytic anemia or paradoxical methemoglobinemia.Details
Glucose-6-phosphate 1-dehydrogenaseMediterranean, Dallas, Panama‚ Sassari, Cagliari, BirminghamNot Available563C->TADR InferredRisk of severe hemolytic anemia or paradoxical methemoglobinemia.Details
Glucose-6-phosphate 1-dehydrogenaseCoimbra ShundeNot Available592C->TADR InferredRisk of severe hemolytic anemia or paradoxical methemoglobinemia.Details
Glucose-6-phosphate 1-dehydrogenaseNilgiriNot Available593G>AADR InferredRisk of severe hemolytic anemia or paradoxical methemoglobinemia.Details
Glucose-6-phosphate 1-dehydrogenaseRadlowoNot Available679C->TADR InferredRisk of severe hemolytic anemia or paradoxical methemoglobinemia.Details
Glucose-6-phosphate 1-dehydrogenaseRoubaixNot Available811G>CADR InferredRisk of severe hemolytic anemia or paradoxical methemoglobinemia.Details
Glucose-6-phosphate 1-dehydrogenaseHaikouNot Available835A->GADR InferredRisk of severe hemolytic anemia or paradoxical methemoglobinemia.Details
Glucose-6-phosphate 1-dehydrogenaseChinese-1Not Available835A->TADR InferredRisk of severe hemolytic anemia or paradoxical methemoglobinemia.Details
Glucose-6-phosphate 1-dehydrogenaseMizushimaNot Available848A>GADR InferredRisk of severe hemolytic anemia or paradoxical methemoglobinemia.Details
Glucose-6-phosphate 1-dehydrogenaseOsakaNot Available853C->TADR InferredRisk of severe hemolytic anemia or paradoxical methemoglobinemia.Details
Glucose-6-phosphate 1-dehydrogenaseViangchan, JammuNot Available871G->AADR InferredRisk of severe hemolytic anemia or paradoxical methemoglobinemia.Details
Glucose-6-phosphate 1-dehydrogenaseSeoulNot Available916G->AADR InferredRisk of severe hemolytic anemia or paradoxical methemoglobinemia.Details
Glucose-6-phosphate 1-dehydrogenaseLudhianaNot Available929G->AADR InferredRisk of severe hemolytic anemia or paradoxical methemoglobinemia.Details
Glucose-6-phosphate 1-dehydrogenaseFarroupilhaNot Available977C->AADR InferredRisk of severe hemolytic anemia or paradoxical methemoglobinemia.Details
Glucose-6-phosphate 1-dehydrogenaseChinese-5Not Available1024C->TADR InferredRisk of severe hemolytic anemia or paradoxical methemoglobinemia.Details
Glucose-6-phosphate 1-dehydrogenaseRignanoNot Available130G>AADR InferredRisk of severe hemolytic anemia or paradoxical methemoglobinemia.Details
Glucose-6-phosphate 1-dehydrogenaseOrissaNot Available131C->GADR InferredRisk of severe hemolytic anemia or paradoxical methemoglobinemia.Details
Glucose-6-phosphate 1-dehydrogenaseG6PDNiceNot Available1380G>CADR InferredRisk of severe hemolytic anemia or paradoxical methemoglobinemia.Details
Glucose-6-phosphate 1-dehydrogenaseKamiube, KeelungNot Available1387C->TADR InferredRisk of severe hemolytic anemia or paradoxical methemoglobinemia.Details
Glucose-6-phosphate 1-dehydrogenaseNeapolisNot Available1400C->GADR InferredRisk of severe hemolytic anemia or paradoxical methemoglobinemia.Details
Glucose-6-phosphate 1-dehydrogenaseAuresNot Available143T->CADR InferredRisk of severe hemolytic anemia or paradoxical methemoglobinemia.Details
Glucose-6-phosphate 1-dehydrogenaseSplitNot Available1442C->GADR InferredRisk of severe hemolytic anemia or paradoxical methemoglobinemia.Details
Glucose-6-phosphate 1-dehydrogenaseKambosNot Available148C->TADR InferredRisk of severe hemolytic anemia or paradoxical methemoglobinemia.Details
Glucose-6-phosphate 1-dehydrogenasePalestrinaNot Available170G>AADR InferredRisk of severe hemolytic anemia or paradoxical methemoglobinemia.Details
Glucose-6-phosphate 1-dehydrogenaseMetapontoNot Available172G->AADR InferredRisk of severe hemolytic anemia or paradoxical methemoglobinemia.Details
Glucose-6-phosphate 1-dehydrogenaseMusashinoNot Available185C->TADR InferredRisk of severe hemolytic anemia or paradoxical methemoglobinemia.Details
Glucose-6-phosphate 1-dehydrogenaseAsahiNot Available202G->AADR InferredRisk of severe hemolytic anemia or paradoxical methemoglobinemia.Details
Glucose-6-phosphate 1-dehydrogenaseA- (202), Ferrara INot Available202G->A / 376A->GADR InferredRisk of severe hemolytic anemia or paradoxical methemoglobinemia.Details
Glucose-6-phosphate 1-dehydrogenaseMurcia OristanoNot Available209A->GADR InferredRisk of severe hemolytic anemia or paradoxical methemoglobinemia.Details
Glucose-6-phosphate 1-dehydrogenaseUbe KonanNot Available241C->TADR InferredRisk of severe hemolytic anemia or paradoxical methemoglobinemia.Details
Glucose-6-phosphate 1-dehydrogenaseLagosantoNot Available242G->AADR InferredRisk of severe hemolytic anemia or paradoxical methemoglobinemia.Details
Glucose-6-phosphate 1-dehydrogenaseGuangzhouNot Available274C->TADR InferredRisk of severe hemolytic anemia or paradoxical methemoglobinemia.Details
Glucose-6-phosphate 1-dehydrogenaseHammersmithNot Available323T->AADR InferredRisk of severe hemolytic anemia or paradoxical methemoglobinemia.Details
Glucose-6-phosphate 1-dehydrogenaseSinnaiNot Available34G->TADR InferredRisk of severe hemolytic anemia or paradoxical methemoglobinemia.Details
Glucose-6-phosphate 1-dehydrogenaseA- (680)Not Available376A->G / 680G->TADR InferredRisk of severe hemolytic anemia or paradoxical methemoglobinemia.Details
Glucose-6-phosphate 1-dehydrogenaseA- (968), Betica,Selma, GuantanamoNot Available376A->G / 968T->CADR InferredRisk of severe hemolytic anemia or paradoxical methemoglobinemia.Details
Glucose-6-phosphate 1-dehydrogenaseSalerno PyrgosNot Available383T>GADR InferredRisk of severe hemolytic anemia or paradoxical methemoglobinemia.Details
Glucose-6-phosphate 1-dehydrogenaseQuing YanNot Available392G->TADR InferredRisk of severe hemolytic anemia or paradoxical methemoglobinemia.Details
Glucose-6-phosphate 1-dehydrogenaseLagesNot Available40G->AADR InferredRisk of severe hemolytic anemia or paradoxical methemoglobinemia.Details
Glucose-6-phosphate 1-dehydrogenaseIleshaNot Available466G->AADR InferredRisk of severe hemolytic anemia or paradoxical methemoglobinemia.Details
Glucose-6-phosphate 1-dehydrogenaseMahidolNot Available487G->AADR InferredRisk of severe hemolytic anemia or paradoxical methemoglobinemia.Details
Glucose-6-phosphate 1-dehydrogenaseMalagaNot Available542A->TADR InferredRisk of severe hemolytic anemia or paradoxical methemoglobinemia.Details
Glucose-6-phosphate 1-dehydrogenaseSibariNot Available634A->GADR InferredRisk of severe hemolytic anemia or paradoxical methemoglobinemia.Details
Glucose-6-phosphate 1-dehydrogenaseMexico CityNot Available680G->AADR InferredRisk of severe hemolytic anemia or paradoxical methemoglobinemia.Details
Glucose-6-phosphate 1-dehydrogenaseNanningNot Available703C->TADR InferredRisk of severe hemolytic anemia or paradoxical methemoglobinemia.Details
Glucose-6-phosphate 1-dehydrogenaseSeattle, Lodi, Modena, Ferrara II, Athens-likeNot Available844G->CADR InferredRisk of severe hemolytic anemia or paradoxical methemoglobinemia.Details
Glucose-6-phosphate 1-dehydrogenaseBajo MaumereNot Available844G->TADR InferredRisk of severe hemolytic anemia or paradoxical methemoglobinemia.Details
Glucose-6-phosphate 1-dehydrogenaseMontalbanoNot Available854G->AADR InferredRisk of severe hemolytic anemia or paradoxical methemoglobinemia.Details
Glucose-6-phosphate 1-dehydrogenaseKalyan-Kerala, Jamnaga, RohiniNot Available949G->AADR InferredRisk of severe hemolytic anemia or paradoxical methemoglobinemia.Details
Glucose-6-phosphate 1-dehydrogenaseGaoheNot Available95A->GADR InferredRisk of severe hemolytic anemia or paradoxical methemoglobinemia.Details


Drug Interactions
(R)-warfarinThe risk or severity of bleeding and hemorrhage can be increased when Methylene blue is combined with (R)-warfarin.
(S)-WarfarinThe risk or severity of bleeding and hemorrhage can be increased when Methylene blue is combined with (S)-Warfarin.
1-(3-Mercapto-2-Methyl-Propionyl)-Pyrrolidine-2-Carboxylic AcidMethylene blue may increase the hypotensive activities of 1-(3-Mercapto-2-Methyl-Propionyl)-Pyrrolidine-2-Carboxylic Acid.
1-benzylimidazoleThe risk or severity of hypertension can be increased when 1-benzylimidazole is combined with Methylene blue.
2,4-thiazolidinedioneMethylene blue may increase the hypoglycemic activities of 2,4-thiazolidinedione.
2,5-Dimethoxy-4-ethylamphetamine2,5-Dimethoxy-4-ethylamphetamine may increase the serotonergic activities of Methylene blue.
2,5-Dimethoxy-4-ethylthioamphetamine2,5-Dimethoxy-4-ethylthioamphetamine may increase the serotonergic activities of Methylene blue.
4-Bromo-2,5-dimethoxyamphetamine4-Bromo-2,5-dimethoxyamphetamine may increase the serotonergic activities of Methylene blue.
4-hydroxycoumarinThe risk or severity of bleeding and hemorrhage can be increased when Methylene blue is combined with 4-hydroxycoumarin.
4-MethoxyamphetamineMethylene blue may increase the hypertensive activities of 4-Methoxyamphetamine.
Additional Data Available
  • Extended Description
    Extended Description

    Extended description of the mechanism of action and particular properties of each drug interaction.

    Learn more
  • Severity

    A severity rating for each drug interaction, from minor to major.

    Learn more
  • Evidence Level
    Evidence Level

    A rating for the strength of the evidence supporting each drug interaction.

    Learn more
  • Action
    Evidence Level

    An effect category for each drug interaction. Know how this interaction affects the subject drug.

    Learn more
Food Interactions
Not Available


General References
  1. Ozal E, Kuralay E, Yildirim V, Kilic S, Bolcal C, Kucukarslan N, Gunay C, Demirkilic U, Tatar H: Preoperative methylene blue administration in patients at high risk for vasoplegic syndrome during cardiac surgery. Ann Thorac Surg. 2005 May;79(5):1615-9. [PubMed:15854942]
  2. Tuman KJ, McCarthy RJ, O'Connor CJ, Holm WE, Ivankovich AD: Angiotensin-converting enzyme inhibitors increase vasoconstrictor requirements after cardiopulmonary bypass. Anesth Analg. 1995 Mar;80(3):473-9. [PubMed:7864410]
  3. Meissner PE, Mandi G, Coulibaly B, Witte S, Tapsoba T, Mansmann U, Rengelshausen J, Schiek W, Jahn A, Walter-Sack I, Mikus G, Burhenne J, Riedel KD, Schirmer RH, Kouyate B, Muller O: Methylene blue for malaria in Africa: results from a dose-finding study in combination with chloroquine. Malar J. 2006 Oct 8;5:84. [PubMed:17026773]
  4. Boylston M, Beer D: Methemoglobinemia: a case study. Crit Care Nurse. 2002 Aug;22(4):50-5. [PubMed:12166056]
  5. Pelgrims J, De Vos F, Van den Brande J, Schrijvers D, Prove A, Vermorken JB: Methylene blue in the treatment and prevention of ifosfamide-induced encephalopathy: report of 12 cases and a review of the literature. Br J Cancer. 2000 Jan;82(2):291-4. [PubMed:10646879]
  6. product info [Link]
  7. Article [Link]
  8. article [Link]
  9. Drug info [Link]
  10. Monograph [Link]
  11. msds [Link]
External Links
KEGG Compound
PubChem Compound
PubChem Substance
ATC Codes
V03AB17 — Methylthioninium chlorideV04CG05 — Methylthioninium chloride
AHFS Codes
  • 92:12.00 — Antidotes
  • 36:36.00 — Gastric Function
  • 92:00.00 — Miscellaneous Therapeutic Agents

Clinical Trials

Clinical Trials
0RecruitingTreatmentDiseases of Oral Cavity Salivary Glands and Jaws / Neoplasms, Malignant / Orofacial Pain / Vesicular Stomatitis1
1CompletedTreatmentCongenital methaemoglobinaemia / Methaemoglobinaemia1
1CompletedTreatmentG6PD Deficient / G6PD Normal / Healthy Volunteers1
2CompletedNot AvailableBrain Activity1
2CompletedDiagnosticCancer, Breast1
2CompletedTreatmentAlzheimer's Disease (AD)1
2CompletedTreatmentDementia, Alzheimer Type1
2CompletedTreatmentMalaria caused by Plasmodium falciparum1
2CompletedTreatmentPlasmodium Infections2
2Not Yet RecruitingTreatmentArterial Hypotension / Cardiac Valve Disease / Coronary Artery Disease / Vasoplegia1
2RecruitingTreatmentPeriradicular Disease1
2SuspendedTreatmentAD / Aging / Alzheimer's Disease (AD) / MCI / Mild Cognitive Impairment (MCI)1
2TerminatedSupportive CareLymphedema of the extremities / Recurrent Breast Cancer / Stage IA Breast Cancer / Stage IB Breast Cancer / Stage II Breast Cancer1
3CompletedTreatmentBipolar Disorder (BD)1
3Not Yet RecruitingTreatmentDysuria1
3RecruitingDiagnosticLiver Diseases1
3RecruitingTreatmentRefractory Shock / Shock, Septic1
3RecruitingTreatmentSevere Sepsis / Shock, Septic1
4CompletedSupportive CareLiver Cirrhosis / Refractory Shock / Shock, Septic / Vasoplegia1
4Not Yet RecruitingSupportive CareSepsis1
4RecruitingTreatmentAcquired Methaemoglobinaemia1
4TerminatedPreventionSecretion Removal Above ETT Cuff1
Not AvailableCompletedNot AvailableHyperparathyroidism1
Not AvailableCompletedBasic SciencePeriodontitis, Chronic1
Not AvailableCompletedDiagnosticMelanoma / Sentinel Node1
Not AvailableCompletedPreventionRespiratory Aspiration1
Not AvailableCompletedTreatmentCancer, Breast / Sentinel Lymph Node1
Not AvailableCompletedTreatmentInfiltrative Breast Cancer1
Not AvailableCompletedTreatmentLaparoscopy / Methylene Blue / Tubal Patency1
Not AvailableCompletedTreatmentPain, Neuropathic1
Not AvailableEnrolling by InvitationDiagnosticEarly Gastric Cancer / Malignant Neoplasm of Stomach / Sentinel Lymph Node1
Not AvailableEnrolling by InvitationTreatmentCancer, Breast / Sentinel Lymph Node1
Not AvailableRecruitingNot AvailableMethaemoglobinaemia / Methemoglobinemia, Acquired1
Not AvailableRecruitingOtherBile Duct Injury1
Not AvailableRecruitingPreventionJaundice, Obstructive1
Not AvailableTerminatedDiagnosticAdenocarcinoma of the Cervix / Adenosquamous carcinoma of the cervix / Cervical Squamous Cell Carcinoma / Stage I Cervical Cancer1
Not AvailableWithdrawnTreatmentSepsis1


Not Available
Not Available
Dosage forms
Solution / dropsOphthalmic
LiquidOral1 %
LiquidOral2 %
InjectionIntravenous10 mg/1mL
Injection, solutionIntravenous10 mg/1mL
LiquidIntramuscular; Intravenous10 mg
LiquidIntravenous1 %
SolutionIntravenous10 mg
LiquidIntravenous10 mg
SolutionParenteral10 mg
LiquidOral; Topical1 %
Injection, solutionIntravenous5 mg/ml
InjectionIntravenous5 mg/1mL
Tablet, coatedOral
Tablet, sugar coatedOral
Not Available
Not Available


Experimental Properties
melting point (°C)100 to 110 °C (with decomposition)Not Available
Predicted Properties
Water Solubility0.0296 mg/mLALOGPS
pKa (Strongest Basic)2.44ChemAxon
Physiological Charge1ChemAxon
Hydrogen Acceptor Count3ChemAxon
Hydrogen Donor Count0ChemAxon
Polar Surface Area19.37 Å2ChemAxon
Rotatable Bond Count2ChemAxon
Refractivity86.98 m3·mol-1ChemAxon
Polarizability33.1 Å3ChemAxon
Number of Rings3ChemAxon
Rule of FiveYesChemAxon
Ghose FilterYesChemAxon
Veber's RuleYesChemAxon
MDDR-like RuleNoChemAxon
Predicted ADMET features
Not Available


Mass Spec (NIST)
Not Available
SpectrumSpectrum TypeSplash Key
Predicted MS/MS Spectrum - 10V, Positive (Annotated)Predicted LC-MS/MSNot Available
Predicted MS/MS Spectrum - 20V, Positive (Annotated)Predicted LC-MS/MSNot Available
Predicted MS/MS Spectrum - 40V, Positive (Annotated)Predicted LC-MS/MSNot Available
Predicted MS/MS Spectrum - 10V, Negative (Annotated)Predicted LC-MS/MSNot Available
Predicted MS/MS Spectrum - 20V, Negative (Annotated)Predicted LC-MS/MSNot Available
Predicted MS/MS Spectrum - 40V, Negative (Annotated)Predicted LC-MS/MSNot Available


This compound belongs to the class of organic compounds known as benzothiazines. These are organic compounds containing a benzene fused to a thiazine ring (a six-membered ring with four carbon atoms, one nitrogen atom and one sulfur atom).
Organic compounds
Super Class
Organoheterocyclic compounds
Sub Class
Not Available
Direct Parent
Alternative Parents
Dialkylarylamines / Benzenoids / Heteroaromatic compounds / Azacyclic compounds / Organopnictogen compounds / Organic chloride salts / Hydrocarbon derivatives
Benzothiazine / Dialkylarylamine / Tertiary aliphatic/aromatic amine / Benzenoid / Heteroaromatic compound / Tertiary amine / Azacycle / Organic nitrogen compound / Organopnictogen compound / Hydrocarbon derivative
Molecular Framework
Aromatic heteropolycyclic compounds
External Descriptors
organic chloride salt (CHEBI:6872)


Pharmacological action
General Function
Heme binding
Specific Function
Has guanylyl cyclase on binding to the beta-1 subunit.Isoform 2 acts as a negative regulator of guanylyl cyclase activity as it forms non-functional heterodimers with the beta subunits.
Gene Name
Uniprot ID
Uniprot Name
Guanylate cyclase soluble subunit alpha-2
Molecular Weight
81749.185 Da
Pharmacological action
General Function
Tetrahydrobiopterin binding
Specific Function
Produces nitric oxide (NO) which is a messenger molecule with diverse functions throughout the body. In the brain and peripheral nervous system, NO displays many properties of a neurotransmitter. P...
Gene Name
Uniprot ID
Uniprot Name
Nitric oxide synthase, brain
Molecular Weight
160969.095 Da

Drug created on October 23, 2015 14:18 / Updated on May 18, 2019 18:05