You are using an unsupported browser. Please upgrade your browser to a newer version to get the best experience on DrugBank.
Accession NumberDB00250  (APRD00345)
TypeSmall Molecule
GroupsApproved, Investigational
DescriptionA sulfone active against a wide range of bacteria but mainly employed for its actions against mycobacterium leprae. Its mechanism of action is probably similar to that of the sulfonamides which involves inhibition of folic acid synthesis in susceptible organisms. It is also used with pyrimethamine in the treatment of malaria. (From Martindale, The Extra Pharmacopoeia, 30th ed, p157-8)
4-Aminophenyl sulfone
4,4'-Diaminodiphenyl sulfone
4,4'-Diaminodiphenyl sulphone
Bis(P-aminophenyl) sulfone
P-Aminophenyl sulfone
P,P'-diaminodiphenyl sulfone
External IDs Not Available
Product Ingredients Not Available
Approved Prescription Products
NameDosageStrengthRouteLabellerMarketing StartMarketing End
AczoneGel5 %TopicalValeant Canada Lp Valeant Canada S.E.C.2011-10-21Not applicableCanada
AczoneGel50 mg/gTopicalAllergan2009-06-24Not applicableUs
Aczone (dapsone) Gel, 7.5%Gel75 mg/gTopicalAllergan2016-02-26Not applicableUs
Avlosulfon Tab 100mgTablet100 mgOralAyerst Laboratories1971-12-311996-09-10Canada
DapsoneTablet100 mgOralJacobus Pharmaceutical1994-12-31Not applicableCanada
Approved Generic Prescription Products
NameDosageStrengthRouteLabellerMarketing StartMarketing End
DapsoneTablet25 mg/1OralGolden State Medical Supply2016-05-09Not applicableUs
DapsoneTablet25 mg/1OralJacobus Pharmaceutical1979-07-03Not applicableUs
DapsoneTablet100 mg/1OralDepartment Of State Health Services, Pharmacy Branch2008-08-15Not applicableUs
DapsoneTablet100 mg/1OralGolden State Medical Supply2016-05-09Not applicableUs
DapsoneTablet25 mg/1OralPhysicians Total Care, Inc.2009-04-22Not applicableUs
DapsoneTablet25 mg/1OralNostrum Laboratories, Inc.2016-05-09Not applicableUs
DapsoneTablet25 mg/1OralVirtus Pharmaceuticals2016-06-01Not applicableUs
DapsoneTablet100 mg/1OralPhysicians Total Care, Inc.2005-12-16Not applicableUs
DapsoneTablet100 mg/1OralNostrum Laboratories, Inc.2016-05-09Not applicableUs
DapsoneTablet100 mg/1OralVirtus Pharmaceuticals2016-06-01Not applicableUs
DapsoneTablet25 mg/1OralSeton Pharmaceuticals2016-03-10Not applicableUs
DapsoneTablet25 mg/1OralAlvogen, Inc.2016-06-13Not applicableUs
DapsoneTablet100 mg/1OralRemedy Repack2010-11-182016-10-13Us
DapsoneTablet100 mg/1OralSeton Pharmaceuticals2016-03-10Not applicableUs
DapsoneTablet100 mg/1OralAlvogen, Inc.2016-06-13Not applicableUs
DapsoneTablet100 mg/1OralJacobus Pharmaceutical1979-07-03Not applicableUs
DapsoneTablet25 mg/1OralDepartment Of State Health Services, Pharmacy Branch2008-08-15Not applicableUs
Approved Over the Counter ProductsNot Available
Unapproved/Other Products Not Available
International BrandsNot Available
Brand mixturesNot Available
CAS number80-08-0
WeightAverage: 248.301
Monoisotopic: 248.061948328
Chemical FormulaC12H12N2O2S
IndicationFor the treatment and management of leprosy and dermatitis herpetiformis.
Structured Indications
PharmacodynamicsDapsone is a sulfone with anti-inflammatory immunosuppressive properties as well as antibacterial and antibiotic properties. Dapsone is the principal drug in a multidrug regimen recommended by the World Health Organization for the treatment of leprosy. As an anti-infective agent, it is also used for treating malaria and, recently, for Pneumocystic carinii pneumonia in AIDS patients. Dapsone is absorbed rapidly and nearly completely from the gastrointestinal tract. Dapsone is distributed throughout total body water and is present in all tissues. However, it tends to be retained in skin and muscle and especially in the liver and kidney: traces of the drug are present in these organs up to 3 weeks after therapy cessation.
Mechanism of actionDapsone acts against bacteria and protozoa in the same way as sulphonamides, that is by inhibiting the synthesis of dihydrofolic acid through competition with para-amino-benzoate for the active site of dihydropteroate synthetase. The anti-inflammatory action of the drug is unrelated to its antibacterial action and is still not fully understood.
TargetKindPharmacological actionActionsOrganismUniProt ID
Inactive dihydropteroate synthase 2Proteinyes
Mycobacterium leprae (strain TN)P0C0X2 details
Dihydropteroate synthaseProteinyes
Mycobacterium leprae (strain TN)P0C0X1 details
Related Articles
AbsorptionBioavailability is 70 to 80% following oral administration.
Volume of distributionNot Available
Protein binding70 to 90%

Hepatic, mostly CYP2E1-mediated.

dapsone hydroxylamineDetails
dapsone hydroxylamine
Not Available
Not Available
Dapsone mercaptal intermediateDetails
Dapsone mercaptal intermediate
Not Available
Dapsone GSH conjugateDetails
Route of eliminationRenal
Half life28 hours (range 10-50 hours)
ClearanceNot Available
ToxicityOverdosage might be expected to produce nasal congestion, syncope, or hallucinations. Measures to support blood pressure should be taken if necessary.
Affected organisms
  • Mycobacteria
  • Mycobacterium leprae
PathwaysNot Available
Pharmacogenomic Effects/ADRs
Interacting Gene/EnzymeAllele nameGenotype(s)Defining Change(s)Type(s)DescriptionDetails
Glucose-6-phosphate 1-dehydrogenaseVilleurbanne---1000_1002delACCADR InferredIncreased risk of hemolysis and hemolytic anemia. Details
Glucose-6-phosphate 1-dehydrogenaseTorun---1006A->GADR InferredIncreased risk of hemolysis and hemolytic anemia. Details
Glucose-6-phosphate 1-dehydrogenaseSunderland---105_107delCATADR InferredIncreased risk of hemolysis and hemolytic anemia. Details
Glucose-6-phosphate 1-dehydrogenaseIwatsuki---1081G->AADR InferredIncreased risk of hemolysis and hemolytic anemia. Details
Glucose-6-phosphate 1-dehydrogenaseSerres---1082C->TADR InferredIncreased risk of hemolysis and hemolytic anemia. Details
Glucose-6-phosphate 1-dehydrogenaseTondela---1084_1101delCTGAACGAGCGCAAGGCCADR InferredIncreased risk of hemolysis and hemolytic anemia. Details
Glucose-6-phosphate 1-dehydrogenaseLoma Linda---1089C->AADR InferredIncreased risk of hemolysis and hemolytic anemia. Details
Glucose-6-phosphate 1-dehydrogenaseAachen---1089C->GADR InferredIncreased risk of hemolysis and hemolytic anemia. Details
Glucose-6-phosphate 1-dehydrogenaseTenri---1096A->GADR InferredIncreased risk of hemolysis and hemolytic anemia. Details
Glucose-6-phosphate 1-dehydrogenaseMontpellier---1132G>AADR InferredIncreased risk of hemolysis and hemolytic anemia. Details
Glucose-6-phosphate 1-dehydrogenaseCalvo Mackenna---1138A->GADR InferredIncreased risk of hemolysis and hemolytic anemia. Details
Glucose-6-phosphate 1-dehydrogenaseRiley---1139T->CADR InferredIncreased risk of hemolysis and hemolytic anemia. Details
Glucose-6-phosphate 1-dehydrogenaseOlomouc---1141T->CADR InferredIncreased risk of hemolysis and hemolytic anemia. Details
Glucose-6-phosphate 1-dehydrogenaseTomah---1153T->CADR InferredIncreased risk of hemolysis and hemolytic anemia. Details
Glucose-6-phosphate 1-dehydrogenaseLynwood---1154G->TADR InferredIncreased risk of hemolysis and hemolytic anemia. Details
Glucose-6-phosphate 1-dehydrogenaseMadrid---1155C->GADR InferredIncreased risk of hemolysis and hemolytic anemia. Details
Glucose-6-phosphate 1-dehydrogenaseIowa, Walter Reed, Springfield---1156A->GADR InferredIncreased risk of hemolysis and hemolytic anemia. Details
Glucose-6-phosphate 1-dehydrogenaseBeverly Hills, Genova, Iwate, Niigata, Yamaguchi---1160G->AADR InferredIncreased risk of hemolysis and hemolytic anemia. Details
Glucose-6-phosphate 1-dehydrogenaseHartford---1162A->GADR InferredIncreased risk of hemolysis and hemolytic anemia. Details
Glucose-6-phosphate 1-dehydrogenasePraha---1166A->GADR InferredIncreased risk of hemolysis and hemolytic anemia. Details
Glucose-6-phosphate 1-dehydrogenaseKrakow---1175T>CADR InferredIncreased risk of hemolysis and hemolytic anemia. Details
Glucose-6-phosphate 1-dehydrogenaseWisconsin---1177C->GADR InferredIncreased risk of hemolysis and hemolytic anemia. Details
Glucose-6-phosphate 1-dehydrogenaseNashville, Anaheim, Portici---1178G->AADR InferredIncreased risk of hemolysis and hemolytic anemia. Details
Glucose-6-phosphate 1-dehydrogenaseAlhambra---1180G->CADR InferredIncreased risk of hemolysis and hemolytic anemia. Details
Glucose-6-phosphate 1-dehydrogenaseBari---1187C->TADR InferredIncreased risk of hemolysis and hemolytic anemia. Details
Glucose-6-phosphate 1-dehydrogenasePuerto Limon---1192G->AADR InferredIncreased risk of hemolysis and hemolytic anemia. Details
Glucose-6-phosphate 1-dehydrogenaseCovao do Lobo---1205C>AADR InferredIncreased risk of hemolysis and hemolytic anemia. Details
Glucose-6-phosphate 1-dehydrogenaseClinic---1215G->AADR InferredIncreased risk of hemolysis and hemolytic anemia. Details
Glucose-6-phosphate 1-dehydrogenaseUtrecht---1225C->TADR InferredIncreased risk of hemolysis and hemolytic anemia. Details
Glucose-6-phosphate 1-dehydrogenaseSuwalki---1226C->GADR InferredIncreased risk of hemolysis and hemolytic anemia. Details
Glucose-6-phosphate 1-dehydrogenaseRiverside---1228G->TADR InferredIncreased risk of hemolysis and hemolytic anemia. Details
Glucose-6-phosphate 1-dehydrogenaseJapan, Shinagawa---1229G->AADR InferredIncreased risk of hemolysis and hemolytic anemia. Details
Glucose-6-phosphate 1-dehydrogenaseKawasaki---1229G->CADR InferredIncreased risk of hemolysis and hemolytic anemia. Details
Glucose-6-phosphate 1-dehydrogenaseMunich---1231A->GADR InferredIncreased risk of hemolysis and hemolytic anemia. Details
Glucose-6-phosphate 1-dehydrogenaseGeorgia---1284C->AADR InferredIncreased risk of hemolysis and hemolytic anemia. Details
Glucose-6-phosphate 1-dehydrogenaseSumare---1292T->GADR InferredIncreased risk of hemolysis and hemolytic anemia. Details
Glucose-6-phosphate 1-dehydrogenaseTelti/Kobe---1318C->TADR InferredIncreased risk of hemolysis and hemolytic anemia. Details
Glucose-6-phosphate 1-dehydrogenaseSantiago de Cuba, Morioka---1339G->AADR InferredIncreased risk of hemolysis and hemolytic anemia. Details
Glucose-6-phosphate 1-dehydrogenaseHarima---1358T->AADR InferredIncreased risk of hemolysis and hemolytic anemia. Details
Glucose-6-phosphate 1-dehydrogenaseFiguera da Foz---1366G->CADR InferredIncreased risk of hemolysis and hemolytic anemia. Details
Glucose-6-phosphate 1-dehydrogenaseAmiens---1367A>TADR InferredIncreased risk of hemolysis and hemolytic anemia. Details
Glucose-6-phosphate 1-dehydrogenaseBangkok Noi---1376G->T, 1502T->GADR InferredIncreased risk of hemolysis and hemolytic anemia. Details
Glucose-6-phosphate 1-dehydrogenaseFukaya---1462G->AADR InferredIncreased risk of hemolysis and hemolytic anemia. Details
Glucose-6-phosphate 1-dehydrogenaseCampinas---1463G->TADR InferredIncreased risk of hemolysis and hemolytic anemia. Details
Glucose-6-phosphate 1-dehydrogenaseBuenos Aires---1465C>TADR InferredIncreased risk of hemolysis and hemolytic anemia. Details
Glucose-6-phosphate 1-dehydrogenaseArakawa---1466C->TADR InferredIncreased risk of hemolysis and hemolytic anemia. Details
Glucose-6-phosphate 1-dehydrogenaseBrighton---1488_1490delGAAADR InferredIncreased risk of hemolysis and hemolytic anemia. Details
Glucose-6-phosphate 1-dehydrogenaseKozukata---159G->CADR InferredIncreased risk of hemolysis and hemolytic anemia. Details
Glucose-6-phosphate 1-dehydrogenaseAmsterdam---180_182delTCTADR InferredIncreased risk of hemolysis and hemolytic anemia. Details
Glucose-6-phosphate 1-dehydrogenaseNo name---202G->A, 376A->G, 1264C>GADR InferredIncreased risk of hemolysis and hemolytic anemia. Details
Glucose-6-phosphate 1-dehydrogenaseSwansea---224T->CADR InferredIncreased risk of hemolysis and hemolytic anemia. Details
Glucose-6-phosphate 1-dehydrogenaseUrayasu---281_283delAGAADR InferredIncreased risk of hemolysis and hemolytic anemia. Details
Glucose-6-phosphate 1-dehydrogenaseVancouver---317C->G544C->T592C->TADR InferredIncreased risk of hemolysis and hemolytic anemia. Details
Glucose-6-phosphate 1-dehydrogenaseMt Sinai---376A->G, 1159C->TADR InferredIncreased risk of hemolysis and hemolytic anemia. Details
Glucose-6-phosphate 1-dehydrogenasePlymouth---488G->AADR InferredIncreased risk of hemolysis and hemolytic anemia. Details
Glucose-6-phosphate 1-dehydrogenaseVolendam---514C->TADR InferredIncreased risk of hemolysis and hemolytic anemia. Details
Glucose-6-phosphate 1-dehydrogenaseShinshu---527A->GADR InferredIncreased risk of hemolysis and hemolytic anemia. Details
Glucose-6-phosphate 1-dehydrogenaseChikugo---535A->TADR InferredIncreased risk of hemolysis and hemolytic anemia. Details
Glucose-6-phosphate 1-dehydrogenaseTsukui---561_563delCTCADR InferredIncreased risk of hemolysis and hemolytic anemia. Details
Glucose-6-phosphate 1-dehydrogenasePedoplis-Ckaro---573C>GADR InferredIncreased risk of hemolysis and hemolytic anemia. Details
Glucose-6-phosphate 1-dehydrogenaseSantiago---593G->CADR InferredIncreased risk of hemolysis and hemolytic anemia. Details
Glucose-6-phosphate 1-dehydrogenaseMinnesota, Marion, Gastonia, LeJeune---637G->TADR InferredIncreased risk of hemolysis and hemolytic anemia. Details
Glucose-6-phosphate 1-dehydrogenaseCincinnati---637G->T, 1037A->TADR InferredIncreased risk of hemolysis and hemolytic anemia. Details
Glucose-6-phosphate 1-dehydrogenaseHarilaou---648T->GADR InferredIncreased risk of hemolysis and hemolytic anemia. Details
Glucose-6-phosphate 1-dehydrogenaseNorth Dallas---683_685delACAADR InferredIncreased risk of hemolysis and hemolytic anemia. Details
Glucose-6-phosphate 1-dehydrogenaseAsahikawa---695G->AADR InferredIncreased risk of hemolysis and hemolytic anemia. Details
Glucose-6-phosphate 1-dehydrogenaseDurham---713A->GADR InferredIncreased risk of hemolysis and hemolytic anemia. Details
Glucose-6-phosphate 1-dehydrogenaseStonybrook---724_729delGGCACTADR InferredIncreased risk of hemolysis and hemolytic anemia. Details
Glucose-6-phosphate 1-dehydrogenaseWayne---769C->GADR InferredIncreased risk of hemolysis and hemolytic anemia. Details
Glucose-6-phosphate 1-dehydrogenaseAveiro---806G->AADR InferredIncreased risk of hemolysis and hemolytic anemia. Details
Glucose-6-phosphate 1-dehydrogenaseCleveland Corum---820G->AADR InferredIncreased risk of hemolysis and hemolytic anemia. Details
Glucose-6-phosphate 1-dehydrogenaseLille---821A>TADR InferredIncreased risk of hemolysis and hemolytic anemia. Details
Glucose-6-phosphate 1-dehydrogenaseBangkok---825G>CADR InferredIncreased risk of hemolysis and hemolytic anemia. Details
Glucose-6-phosphate 1-dehydrogenaseSugao---826C->TADR InferredIncreased risk of hemolysis and hemolytic anemia. Details
Glucose-6-phosphate 1-dehydrogenaseLa Jolla---832T->CADR InferredIncreased risk of hemolysis and hemolytic anemia. Details
Glucose-6-phosphate 1-dehydrogenaseWexham---833C->TADR InferredIncreased risk of hemolysis and hemolytic anemia. Details
Glucose-6-phosphate 1-dehydrogenasePiotrkow---851T>CADR InferredIncreased risk of hemolysis and hemolytic anemia. Details
Glucose-6-phosphate 1-dehydrogenaseWest Virginia---910G->TADR InferredIncreased risk of hemolysis and hemolytic anemia. Details
Glucose-6-phosphate 1-dehydrogenaseOmiya---921G->CADR InferredIncreased risk of hemolysis and hemolytic anemia. Details
Glucose-6-phosphate 1-dehydrogenaseNara---953_976delCCACCAAAGGGTACCTGGAC GACCADR InferredIncreased risk of hemolysis and hemolytic anemia. Details
Glucose-6-phosphate 1-dehydrogenaseManhattan---962G->AADR InferredIncreased risk of hemolysis and hemolytic anemia. Details
Glucose-6-phosphate 1-dehydrogenaseRehevot---964T->CADR InferredIncreased risk of hemolysis and hemolytic anemia. Details
Glucose-6-phosphate 1-dehydrogenaseHoniara---99A->G / 1360C->TADR InferredIncreased risk of hemolysis and hemolytic anemia. Details
Glucose-6-phosphate 1-dehydrogenaseTokyo, Fukushima---1246G->AADR InferredIncreased risk of hemolysis and hemolytic anemia. Details
Glucose-6-phosphate 1-dehydrogenaseChatham---1003G->AADR InferredIncreased risk of hemolysis and hemolytic anemia. Details
Glucose-6-phosphate 1-dehydrogenaseFushan---1004C->AADR InferredIncreased risk of hemolysis and hemolytic anemia. Details
Glucose-6-phosphate 1-dehydrogenasePartenope---1052G->TADR InferredIncreased risk of hemolysis and hemolytic anemia. Details
Glucose-6-phosphate 1-dehydrogenaseIerapetra---1057C->TADR InferredIncreased risk of hemolysis and hemolytic anemia. Details
Glucose-6-phosphate 1-dehydrogenaseAnadia---1193A->GADR InferredIncreased risk of hemolysis and hemolytic anemia. Details
Glucose-6-phosphate 1-dehydrogenaseAbeno---1220A->CADR InferredIncreased risk of hemolysis and hemolytic anemia. Details
Glucose-6-phosphate 1-dehydrogenaseSurabaya---1291G->AADR InferredIncreased risk of hemolysis and hemolytic anemia. Details
Glucose-6-phosphate 1-dehydrogenasePawnee---1316G->CADR InferredIncreased risk of hemolysis and hemolytic anemia. Details
Glucose-6-phosphate 1-dehydrogenaseS. Antioco---1342A->GADR InferredIncreased risk of hemolysis and hemolytic anemia. Details
Glucose-6-phosphate 1-dehydrogenaseCassano---1347G->CADR InferredIncreased risk of hemolysis and hemolytic anemia. Details
Glucose-6-phosphate 1-dehydrogenaseHermoupolis---1347G->C / 1360C->TADR InferredIncreased risk of hemolysis and hemolytic anemia. Details
Glucose-6-phosphate 1-dehydrogenaseUnion,Maewo, Chinese-2, Kalo---1360C->TADR InferredIncreased risk of hemolysis and hemolytic anemia. Details
Glucose-6-phosphate 1-dehydrogenaseAndalus---1361G->AADR InferredIncreased risk of hemolysis and hemolytic anemia. Details
Glucose-6-phosphate 1-dehydrogenaseCosenza---1376G->CADR InferredIncreased risk of hemolysis and hemolytic anemia. Details
Glucose-6-phosphate 1-dehydrogenaseCanton, Taiwan- Hakka, Gifu-like, Agrigento-like---1376G->TADR InferredIncreased risk of hemolysis and hemolytic anemia. Details
Glucose-6-phosphate 1-dehydrogenaseFlores---1387C->AADR InferredIncreased risk of hemolysis and hemolytic anemia. Details
Glucose-6-phosphate 1-dehydrogenaseKaiping, Anant, Dhon, Sapporo-like, Wosera---1388G->AADR InferredIncreased risk of hemolysis and hemolytic anemia. Details
Glucose-6-phosphate 1-dehydrogenaseKamogawa---169C->TADR InferredIncreased risk of hemolysis and hemolytic anemia. Details
Glucose-6-phosphate 1-dehydrogenaseCostanzo---179T>CADR InferredIncreased risk of hemolysis and hemolytic anemia. Details
Glucose-6-phosphate 1-dehydrogenaseAmazonia---185C->AADR InferredIncreased risk of hemolysis and hemolytic anemia. Details
Glucose-6-phosphate 1-dehydrogenaseSongklanagarind---196T->AADR InferredIncreased risk of hemolysis and hemolytic anemia. Details
Glucose-6-phosphate 1-dehydrogenaseHechi---202G->A / 871G->AADR InferredIncreased risk of hemolysis and hemolytic anemia. Details
Glucose-6-phosphate 1-dehydrogenaseNamouru---208T->CADR InferredIncreased risk of hemolysis and hemolytic anemia. Details
Glucose-6-phosphate 1-dehydrogenaseBao Loc---352T>CADR InferredIncreased risk of hemolysis and hemolytic anemia. Details
Glucose-6-phosphate 1-dehydrogenaseCrispim---375G->T, 379G->T383T->C384C>TADR InferredIncreased risk of hemolysis and hemolytic anemia. Details
Glucose-6-phosphate 1-dehydrogenaseAcrokorinthos---376A->G / 463C->GADR InferredIncreased risk of hemolysis and hemolytic anemia. Details
Glucose-6-phosphate 1-dehydrogenaseSanta Maria---376A->G / 542A->TADR InferredIncreased risk of hemolysis and hemolytic anemia. Details
Glucose-6-phosphate 1-dehydrogenaseAnanindeua---376A->G / 871G->AADR InferredIncreased risk of hemolysis and hemolytic anemia. Details
Glucose-6-phosphate 1-dehydrogenaseVanua Lava---383T->CADR InferredIncreased risk of hemolysis and hemolytic anemia. Details
Glucose-6-phosphate 1-dehydrogenaseValladolid---406C->TADR InferredIncreased risk of hemolysis and hemolytic anemia. Details
Glucose-6-phosphate 1-dehydrogenaseBelem---409C->TADR InferredIncreased risk of hemolysis and hemolytic anemia. Details
Glucose-6-phosphate 1-dehydrogenaseLiuzhou---442G->AADR InferredIncreased risk of hemolysis and hemolytic anemia. Details
Glucose-6-phosphate 1-dehydrogenaseShenzen---473G>AADR InferredIncreased risk of hemolysis and hemolytic anemia. Details
Glucose-6-phosphate 1-dehydrogenaseTaipei “Chinese- 3”---493A->GADR InferredIncreased risk of hemolysis and hemolytic anemia. Details
Glucose-6-phosphate 1-dehydrogenaseToledo---496C>TADR InferredIncreased risk of hemolysis and hemolytic anemia. Details
Glucose-6-phosphate 1-dehydrogenaseNaone---497G->AADR InferredIncreased risk of hemolysis and hemolytic anemia. Details
Glucose-6-phosphate 1-dehydrogenaseNankang---517T->CADR InferredIncreased risk of hemolysis and hemolytic anemia. Details
Glucose-6-phosphate 1-dehydrogenaseMiaoli---519C->GADR InferredIncreased risk of hemolysis and hemolytic anemia. Details
Glucose-6-phosphate 1-dehydrogenaseMediterranean, Dallas, Panama‚ Sassari, Cagliari, Birmingham---563C->TADR InferredIncreased risk of hemolysis and hemolytic anemia. Details
Glucose-6-phosphate 1-dehydrogenaseCoimbra Shunde---592C->TADR InferredIncreased risk of hemolysis and hemolytic anemia. Details
Glucose-6-phosphate 1-dehydrogenaseNilgiri---593G>AADR InferredIncreased risk of hemolysis and hemolytic anemia. Details
Glucose-6-phosphate 1-dehydrogenaseRadlowo---679C->TADR InferredIncreased risk of hemolysis and hemolytic anemia. Details
Glucose-6-phosphate 1-dehydrogenaseRoubaix---811G>CADR InferredIncreased risk of hemolysis and hemolytic anemia. Details
Glucose-6-phosphate 1-dehydrogenaseHaikou---835A->GADR InferredIncreased risk of hemolysis and hemolytic anemia. Details
Glucose-6-phosphate 1-dehydrogenaseChinese-1---835A->TADR InferredIncreased risk of hemolysis and hemolytic anemia. Details
Glucose-6-phosphate 1-dehydrogenaseMizushima---848A>GADR InferredIncreased risk of hemolysis and hemolytic anemia. Details
Glucose-6-phosphate 1-dehydrogenaseOsaka---853C->TADR InferredIncreased risk of hemolysis and hemolytic anemia. Details
Glucose-6-phosphate 1-dehydrogenaseViangchan, Jammu---871G->AADR InferredIncreased risk of hemolysis and hemolytic anemia. Details
Glucose-6-phosphate 1-dehydrogenaseSeoul---916G->AADR InferredIncreased risk of hemolysis and hemolytic anemia. Details
Glucose-6-phosphate 1-dehydrogenaseLudhiana---929G->AADR InferredIncreased risk of hemolysis and hemolytic anemia. Details
Glucose-6-phosphate 1-dehydrogenaseFarroupilha---977C->AADR InferredIncreased risk of hemolysis and hemolytic anemia. Details
Glucose-6-phosphate 1-dehydrogenaseChinese-5---1024C->TADR InferredIncreased risk of hemolysis and hemolytic anemia. Details
Glucose-6-phosphate 1-dehydrogenaseRignano---130G>AADR InferredIncreased risk of hemolysis and hemolytic anemia. Details
Glucose-6-phosphate 1-dehydrogenaseOrissa---131C->GADR InferredIncreased risk of hemolysis and hemolytic anemia. Details
Glucose-6-phosphate 1-dehydrogenaseG6PDNice---1380G>CADR InferredIncreased risk of hemolysis and hemolytic anemia. Details
Glucose-6-phosphate 1-dehydrogenaseKamiube, Keelung---1387C->TADR InferredIncreased risk of hemolysis and hemolytic anemia. Details
Glucose-6-phosphate 1-dehydrogenaseNeapolis---1400C->GADR InferredIncreased risk of hemolysis and hemolytic anemia. Details
Glucose-6-phosphate 1-dehydrogenaseAures---143T->CADR InferredIncreased risk of hemolysis and hemolytic anemia. Details
Glucose-6-phosphate 1-dehydrogenaseSplit---1442C->GADR InferredIncreased risk of hemolysis and hemolytic anemia. Details
Glucose-6-phosphate 1-dehydrogenaseKambos---148C->TADR InferredIncreased risk of hemolysis and hemolytic anemia. Details
Glucose-6-phosphate 1-dehydrogenasePalestrina---170G>AADR InferredIncreased risk of hemolysis and hemolytic anemia. Details
Glucose-6-phosphate 1-dehydrogenaseMetaponto---172G->AADR InferredIncreased risk of hemolysis and hemolytic anemia. Details
Glucose-6-phosphate 1-dehydrogenaseMusashino---185C->TADR InferredIncreased risk of hemolysis and hemolytic anemia. Details
Glucose-6-phosphate 1-dehydrogenaseAsahi---202G->AADR InferredIncreased risk of hemolysis and hemolytic anemia. Details
Glucose-6-phosphate 1-dehydrogenaseA- (202), Ferrara I---202G->A / 376A->GADR InferredIncreased risk of hemolysis and hemolytic anemia. Details
Glucose-6-phosphate 1-dehydrogenaseMurcia Oristano---209A->GADR InferredIncreased risk of hemolysis and hemolytic anemia. Details
Glucose-6-phosphate 1-dehydrogenaseUbe Konan---241C->TADR InferredIncreased risk of hemolysis and hemolytic anemia. Details
Glucose-6-phosphate 1-dehydrogenaseLagosanto---242G->AADR InferredIncreased risk of hemolysis and hemolytic anemia. Details
Glucose-6-phosphate 1-dehydrogenaseGuangzhou---274C->TADR InferredIncreased risk of hemolysis and hemolytic anemia. Details
Glucose-6-phosphate 1-dehydrogenaseHammersmith---323T->AADR InferredIncreased risk of hemolysis and hemolytic anemia. Details
Glucose-6-phosphate 1-dehydrogenaseSinnai---34G->TADR InferredIncreased risk of hemolysis and hemolytic anemia. Details
Glucose-6-phosphate 1-dehydrogenaseA- (680)---376A->G / 680G->TADR InferredIncreased risk of hemolysis and hemolytic anemia. Details
Glucose-6-phosphate 1-dehydrogenaseA- (968), Betica,Selma, Guantanamo---376A->G / 968T->CADR InferredIncreased risk of hemolysis and hemolytic anemia. Details
Glucose-6-phosphate 1-dehydrogenaseSalerno Pyrgos---383T>GADR InferredIncreased risk of hemolysis and hemolytic anemia. Details
Glucose-6-phosphate 1-dehydrogenaseQuing Yan---392G->TADR InferredIncreased risk of hemolysis and hemolytic anemia. Details
Glucose-6-phosphate 1-dehydrogenaseLages---40G->AADR InferredIncreased risk of hemolysis and hemolytic anemia. Details
Glucose-6-phosphate 1-dehydrogenaseIlesha---466G->AADR InferredIncreased risk of hemolysis and hemolytic anemia. Details
Glucose-6-phosphate 1-dehydrogenaseMahidol---487G->AADR InferredIncreased risk of hemolysis and hemolytic anemia. Details
Glucose-6-phosphate 1-dehydrogenaseMalaga---542A->TADR InferredIncreased risk of hemolysis and hemolytic anemia. Details
Glucose-6-phosphate 1-dehydrogenaseSibari---634A->GADR InferredIncreased risk of hemolysis and hemolytic anemia. Details
Glucose-6-phosphate 1-dehydrogenaseMexico City---680G->AADR InferredIncreased risk of hemolysis and hemolytic anemia. Details
Glucose-6-phosphate 1-dehydrogenaseNanning---703C->TADR InferredIncreased risk of hemolysis and hemolytic anemia. Details
Glucose-6-phosphate 1-dehydrogenaseSeattle, Lodi, Modena, Ferrara II, Athens-like---844G->CADR InferredIncreased risk of hemolysis and hemolytic anemia. Details
Glucose-6-phosphate 1-dehydrogenaseBajo Maumere---844G->TADR InferredIncreased risk of hemolysis and hemolytic anemia. Details
Glucose-6-phosphate 1-dehydrogenaseMontalbano---854G->AADR InferredIncreased risk of hemolysis and hemolytic anemia. Details
Glucose-6-phosphate 1-dehydrogenaseKalyan-Kerala, Jamnaga, Rohini---949G->AADR InferredIncreased risk of hemolysis and hemolytic anemia. Details
Glucose-6-phosphate 1-dehydrogenaseGaohe---95A->GADR InferredIncreased risk of hemolysis and hemolytic anemia. Details
Drug Interactions
DrugInteractionDrug group
5'-Deoxy-5'-MethylthioadenosineThe risk or severity of adverse effects can be increased when 5'-Deoxy-5'-Methylthioadenosine is combined with Dapsone.Experimental
AbirateroneThe serum concentration of Dapsone can be increased when it is combined with Abiraterone.Approved
AcepromazineThe serum concentration of Acepromazine can be increased when it is combined with Dapsone.Approved, Vet Approved
AceprometazineThe serum concentration of Aceprometazine can be increased when it is combined with Dapsone.Approved
AcetaminophenThe risk or severity of adverse effects can be increased when Dapsone is combined with Acetaminophen.Approved
AlimemazineThe serum concentration of Alimemazine can be increased when it is combined with Dapsone.Approved, Vet Approved
AmiodaroneThe metabolism of Dapsone can be decreased when combined with Amiodarone.Approved, Investigational
AmodiaquineThe risk or severity of adverse effects can be increased when Amodiaquine is combined with Dapsone.Approved
Amyl NitriteThe risk or severity of adverse effects can be increased when Dapsone is combined with Amyl Nitrite.Approved
AntipyrineThe risk or severity of adverse effects can be increased when Dapsone is combined with Antipyrine.Approved
AprepitantThe serum concentration of Dapsone can be increased when it is combined with Aprepitant.Approved, Investigational
ArmodafinilThe metabolism of Dapsone can be decreased when combined with Armodafinil.Approved, Investigational
ArtemetherThe risk or severity of adverse effects can be increased when Artemether is combined with Dapsone.Approved
ArtesunateThe risk or severity of adverse effects can be increased when Artesunate is combined with Dapsone.Approved
AtazanavirThe metabolism of Dapsone can be decreased when combined with Atazanavir.Approved, Investigational
AtomoxetineThe metabolism of Dapsone can be decreased when combined with Atomoxetine.Approved
AtovaquoneThe risk or severity of adverse effects can be increased when Atovaquone is combined with Dapsone.Approved
BenzocaineThe risk or severity of adverse effects can be increased when Dapsone is combined with Benzocaine.Approved
Benzoyl peroxideThe risk or severity of adverse effects can be increased when Benzoyl peroxide is combined with Dapsone.Approved
BexaroteneThe serum concentration of Dapsone can be decreased when it is combined with Bexarotene.Approved, Investigational
BL-1020The serum concentration of BL-1020 can be increased when it is combined with Dapsone.Investigational
BoceprevirThe metabolism of Dapsone can be decreased when combined with Boceprevir.Approved
BortezomibThe metabolism of Dapsone can be decreased when combined with Bortezomib.Approved, Investigational
BosentanThe serum concentration of Dapsone can be decreased when it is combined with Bosentan.Approved, Investigational
ButalbitalThe risk or severity of adverse effects can be increased when Dapsone is combined with Butalbital.Approved, Illicit
CapecitabineThe metabolism of Dapsone can be decreased when combined with Capecitabine.Approved, Investigational
CarbamazepineThe metabolism of Dapsone can be increased when combined with Carbamazepine.Approved, Investigational
CelecoxibThe risk or severity of adverse effects can be increased when Dapsone is combined with Celecoxib.Approved, Investigational
CelecoxibThe metabolism of Dapsone can be decreased when combined with Celecoxib.Approved, Investigational
CeritinibThe serum concentration of Dapsone can be increased when it is combined with Ceritinib.Approved
ChloramphenicolThe metabolism of Dapsone can be decreased when combined with Chloramphenicol.Approved, Vet Approved
ChloroquineThe risk or severity of adverse effects can be increased when Chloroquine is combined with Dapsone.Approved, Vet Approved
ChlorpromazineThe serum concentration of Chlorpromazine can be increased when it is combined with Dapsone.Approved, Vet Approved
CholecalciferolThe metabolism of Dapsone can be decreased when combined with Cholecalciferol.Approved, Nutraceutical
CimetidineThe metabolism of Dapsone can be decreased when combined with Cimetidine.Approved
CitalopramThe metabolism of Dapsone can be decreased when combined with Citalopram.Approved
ClarithromycinThe metabolism of Dapsone can be decreased when combined with Clarithromycin.Approved
ClemastineThe metabolism of Dapsone can be decreased when combined with Clemastine.Approved
ClopidogrelThe metabolism of Dapsone can be decreased when combined with Clopidogrel.Approved, Nutraceutical
ClotrimazoleThe metabolism of Dapsone can be decreased when combined with Clotrimazole.Approved, Vet Approved
CobicistatThe metabolism of Dapsone can be decreased when combined with Cobicistat.Approved
ConivaptanThe serum concentration of Dapsone can be increased when it is combined with Conivaptan.Approved, Investigational
CrizotinibThe metabolism of Dapsone can be decreased when combined with Crizotinib.Approved
CyclosporineThe metabolism of Dapsone can be decreased when combined with Cyclosporine.Approved, Investigational, Vet Approved
Cyproterone acetateThe serum concentration of Dapsone can be decreased when it is combined with Cyproterone acetate.Approved, Investigational
DabrafenibThe serum concentration of Dapsone can be decreased when it is combined with Dabrafenib.Approved
DarunavirThe metabolism of Dapsone can be decreased when combined with Darunavir.Approved
DasatinibThe serum concentration of Dapsone can be increased when it is combined with Dasatinib.Approved, Investigational
DeferasiroxThe serum concentration of Dapsone can be decreased when it is combined with Deferasirox.Approved, Investigational
DelavirdineThe metabolism of Dapsone can be decreased when combined with Delavirdine.Approved
DexamethasoneThe serum concentration of Dapsone can be decreased when it is combined with Dexamethasone.Approved, Investigational, Vet Approved
DihydroergotamineThe metabolism of Dapsone can be decreased when combined with Dihydroergotamine.Approved
DiltiazemThe metabolism of Dapsone can be decreased when combined with Diltiazem.Approved
DisulfiramThe metabolism of Dapsone can be decreased when combined with Disulfiram.Approved
DoxycyclineThe risk or severity of adverse effects can be increased when Doxycycline is combined with Dapsone.Approved, Investigational, Vet Approved
DoxycyclineThe metabolism of Dapsone can be decreased when combined with Doxycycline.Approved, Investigational, Vet Approved
DronedaroneThe metabolism of Dapsone can be decreased when combined with Dronedarone.Approved
EfavirenzThe serum concentration of Dapsone can be decreased when it is combined with Efavirenz.Approved, Investigational
EnzalutamideThe serum concentration of Dapsone can be decreased when it is combined with Enzalutamide.Approved
ErythromycinThe metabolism of Dapsone can be decreased when combined with Erythromycin.Approved, Vet Approved
Eslicarbazepine acetateThe serum concentration of Dapsone can be decreased when it is combined with Eslicarbazepine acetate.Approved
EsomeprazoleThe metabolism of Dapsone can be decreased when combined with Esomeprazole.Approved, Investigational
EtravirineThe serum concentration of Dapsone can be decreased when it is combined with Etravirine.Approved
FelodipineThe metabolism of Dapsone can be decreased when combined with Felodipine.Approved, Investigational
FloxuridineThe metabolism of Dapsone can be decreased when combined with Floxuridine.Approved
FluconazoleThe metabolism of Dapsone can be decreased when combined with Fluconazole.Approved
FluorouracilThe metabolism of Dapsone can be decreased when combined with Fluorouracil.Approved
FluoxetineThe metabolism of Dapsone can be decreased when combined with Fluoxetine.Approved, Vet Approved
FluphenazineThe serum concentration of Fluphenazine can be increased when it is combined with Dapsone.Approved
FlutamideThe risk or severity of adverse effects can be increased when Dapsone is combined with Flutamide.Approved
FluvastatinThe metabolism of Dapsone can be decreased when combined with Fluvastatin.Approved
FluvoxamineThe metabolism of Dapsone can be decreased when combined with Fluvoxamine.Approved, Investigational
FosamprenavirThe metabolism of Dapsone can be decreased when combined with Fosamprenavir.Approved
FosaprepitantThe serum concentration of Dapsone can be increased when it is combined with Fosaprepitant.Approved
FosphenytoinThe metabolism of Dapsone can be increased when combined with Fosphenytoin.Approved
Fusidic AcidThe serum concentration of Dapsone can be increased when it is combined with Fusidic Acid.Approved
GemfibrozilThe metabolism of Dapsone can be decreased when combined with Gemfibrozil.Approved
HalofantrineThe risk or severity of adverse effects can be increased when Halofantrine is combined with Dapsone.Approved
HydroxychloroquineThe risk or severity of adverse effects can be increased when Hydroxychloroquine is combined with Dapsone.Approved
IdelalisibThe serum concentration of Dapsone can be increased when it is combined with Idelalisib.Approved
ImatinibThe metabolism of Dapsone can be decreased when combined with Imatinib.Approved
IndinavirThe metabolism of Dapsone can be decreased when combined with Indinavir.Approved
IrbesartanThe metabolism of Dapsone can be decreased when combined with Irbesartan.Approved, Investigational
IsavuconazoniumThe metabolism of Dapsone can be decreased when combined with Isavuconazonium.Approved, Investigational
IsomethepteneThe risk or severity of adverse effects can be increased when Dapsone is combined with Isometheptene.Approved
IsoniazidThe metabolism of Dapsone can be decreased when combined with Isoniazid.Approved
Isosorbide DinitrateThe risk or severity of adverse effects can be increased when Dapsone is combined with Isosorbide Dinitrate.Approved
Isosorbide MononitrateThe risk or severity of adverse effects can be increased when Dapsone is combined with Isosorbide Mononitrate.Approved
IsradipineThe metabolism of Dapsone can be decreased when combined with Isradipine.Approved
ItraconazoleThe metabolism of Dapsone can be decreased when combined with Itraconazole.Approved, Investigational
IvacaftorThe serum concentration of Dapsone can be increased when it is combined with Ivacaftor.Approved
KetoconazoleThe metabolism of Dapsone can be decreased when combined with Ketoconazole.Approved, Investigational
LapatinibThe metabolism of Dapsone can be decreased when combined with Lapatinib.Approved, Investigational
LeflunomideThe metabolism of Dapsone can be decreased when combined with Leflunomide.Approved, Investigational
LidocaineThe risk or severity of adverse effects can be increased when Dapsone is combined with Lidocaine.Approved, Vet Approved
LopinavirThe metabolism of Dapsone can be decreased when combined with Lopinavir.Approved
LosartanThe metabolism of Dapsone can be decreased when combined with Losartan.Approved
LovastatinThe metabolism of Dapsone can be decreased when combined with Lovastatin.Approved, Investigational
LuliconazoleThe serum concentration of Dapsone can be increased when it is combined with Luliconazole.Approved
LumacaftorThe serum concentration of Dapsone can be increased when it is combined with Lumacaftor.Approved
LumefantrineThe risk or severity of adverse effects can be increased when Dapsone is combined with Lumefantrine.Approved
MafenideThe risk or severity of adverse effects can be increased when Dapsone is combined with Mafenide.Approved, Vet Approved
MefloquineThe risk or severity of adverse effects can be increased when Mefloquine is combined with Dapsone.Approved
MesoridazineThe serum concentration of Mesoridazine can be increased when it is combined with Dapsone.Approved
MethotrimeprazineThe serum concentration of Methotrimeprazine can be increased when it is combined with Dapsone.Approved
Methylene blueThe serum concentration of Methylene blue can be increased when it is combined with Dapsone.Investigational
MetoclopramideThe risk or severity of adverse effects can be increased when Dapsone is combined with Metoclopramide.Approved, Investigational
MifepristoneThe serum concentration of Dapsone can be increased when it is combined with Mifepristone.Approved, Investigational
MitotaneThe serum concentration of Dapsone can be decreased when it is combined with Mitotane.Approved
MoclobemideThe metabolism of Dapsone can be decreased when combined with Moclobemide.Approved
ModafinilThe serum concentration of Dapsone can be decreased when it is combined with Modafinil.Approved, Investigational
MoricizineThe serum concentration of Moricizine can be increased when it is combined with Dapsone.Approved, Withdrawn
NafcillinThe serum concentration of Dapsone can be decreased when it is combined with Nafcillin.Approved
NefazodoneThe metabolism of Dapsone can be decreased when combined with Nefazodone.Approved, Withdrawn
NelfinavirThe metabolism of Dapsone can be decreased when combined with Nelfinavir.Approved
NetupitantThe serum concentration of Dapsone can be increased when it is combined with Netupitant.Approved
NevirapineThe metabolism of Dapsone can be increased when combined with Nevirapine.Approved
NicardipineThe metabolism of Dapsone can be decreased when combined with Nicardipine.Approved
NicotineThe metabolism of Dapsone can be decreased when combined with Nicotine.Approved
NilotinibThe metabolism of Dapsone can be decreased when combined with Nilotinib.Approved, Investigational
Nitric OxideThe risk or severity of adverse effects can be increased when Dapsone is combined with Nitric Oxide.Approved
NitrofurantoinThe risk or severity of adverse effects can be increased when Dapsone is combined with Nitrofurantoin.Approved, Vet Approved
NitroglycerinThe risk or severity of adverse effects can be increased when Dapsone is combined with Nitroglycerin.Approved, Investigational
NitroprussideThe risk or severity of adverse effects can be increased when Dapsone is combined with Nitroprusside.Approved
OlaparibThe metabolism of Dapsone can be decreased when combined with Olaparib.Approved
OmeprazoleThe metabolism of Dapsone can be decreased when combined with Omeprazole.Approved, Investigational, Vet Approved
OsimertinibThe serum concentration of Dapsone can be increased when it is combined with Osimertinib.Approved
PalbociclibThe serum concentration of Dapsone can be increased when it is combined with Palbociclib.Approved
PantoprazoleThe metabolism of Dapsone can be decreased when combined with Pantoprazole.Approved
PentobarbitalThe metabolism of Dapsone can be increased when combined with Pentobarbital.Approved, Vet Approved
PerphenazineThe serum concentration of Perphenazine can be increased when it is combined with Dapsone.Approved
PhenazopyridineThe risk or severity of adverse effects can be increased when Dapsone is combined with Phenazopyridine.Approved
PhenobarbitalThe metabolism of Dapsone can be increased when combined with Phenobarbital.Approved
PhenobarbitalThe risk or severity of adverse effects can be increased when Dapsone is combined with Phenobarbital.Approved
PhenytoinThe metabolism of Dapsone can be increased when combined with Phenytoin.Approved, Vet Approved
PhenytoinThe risk or severity of adverse effects can be increased when Dapsone is combined with Phenytoin.Approved, Vet Approved
Picosulfuric acidThe therapeutic efficacy of Picosulfuric acid can be decreased when used in combination with Dapsone.Approved
PioglitazoneThe metabolism of Dapsone can be decreased when combined with Pioglitazone.Approved, Investigational
PosaconazoleThe metabolism of Dapsone can be decreased when combined with Posaconazole.Approved, Investigational, Vet Approved
PrilocaineThe risk or severity of adverse effects can be increased when Dapsone is combined with Prilocaine.Approved
PrimaquineThe risk or severity of adverse effects can be increased when Primaquine is combined with Dapsone.Approved
PrimidoneThe metabolism of Dapsone can be increased when combined with Primidone.Approved, Vet Approved
ProbenecidThe serum concentration of Dapsone can be increased when it is combined with Probenecid.Approved
ProchlorperazineThe serum concentration of Prochlorperazine can be increased when it is combined with Dapsone.Approved, Vet Approved
ProguanilThe risk or severity of adverse effects can be increased when Proguanil is combined with Dapsone.Approved
PromazineThe serum concentration of Promazine can be increased when it is combined with Dapsone.Approved, Vet Approved
PromethazineThe serum concentration of Promethazine can be increased when it is combined with Dapsone.Approved
PyrimethamineThe risk or severity of adverse effects can be increased when Pyrimethamine is combined with Dapsone.Approved, Vet Approved
PyrimethamineThe metabolism of Dapsone can be decreased when combined with Pyrimethamine.Approved, Vet Approved
QuinacrineThe risk or severity of adverse effects can be increased when Quinacrine is combined with Dapsone.Approved
QuinidineThe risk or severity of adverse effects can be increased when Quinidine is combined with Dapsone.Approved
QuinineThe risk or severity of adverse effects can be increased when Quinine is combined with Dapsone.Approved
QuinineThe metabolism of Dapsone can be decreased when combined with Quinine.Approved
RabeprazoleThe metabolism of Dapsone can be decreased when combined with Rabeprazole.Approved, Investigational
RadicicolThe risk or severity of adverse effects can be increased when Radicicol is combined with Dapsone.Experimental
RanolazineThe metabolism of Dapsone can be decreased when combined with Ranolazine.Approved, Investigational
RifabutinThe metabolism of Dapsone can be increased when combined with Rifabutin.Approved
RifampicinThe metabolism of Dapsone can be increased when combined with Rifampicin.Approved
RifapentineThe metabolism of Dapsone can be increased when combined with Rifapentine.Approved
RitonavirThe metabolism of Dapsone can be decreased when combined with Ritonavir.Approved, Investigational
RosiglitazoneThe metabolism of Dapsone can be decreased when combined with Rosiglitazone.Approved, Investigational
SaquinavirThe metabolism of Dapsone can be decreased when combined with Saquinavir.Approved, Investigational
SecobarbitalThe metabolism of Dapsone can be increased when combined with Secobarbital.Approved, Vet Approved
SertralineThe metabolism of Dapsone can be decreased when combined with Sertraline.Approved
SildenafilThe metabolism of Dapsone can be decreased when combined with Sildenafil.Approved, Investigational
SiltuximabThe serum concentration of Dapsone can be decreased when it is combined with Siltuximab.Approved
SimeprevirThe serum concentration of Dapsone can be increased when it is combined with Simeprevir.Approved
SinefunginThe risk or severity of adverse effects can be increased when Sinefungin is combined with Dapsone.Experimental
Sodium NitriteThe risk or severity of adverse effects can be increased when Dapsone is combined with Sodium Nitrite.Approved
SorafenibThe metabolism of Dapsone can be decreased when combined with Sorafenib.Approved, Investigational
St. John's WortThe serum concentration of Dapsone can be decreased when it is combined with St. John's Wort.Nutraceutical
StiripentolThe serum concentration of Dapsone can be increased when it is combined with Stiripentol.Approved
SulfadiazineThe metabolism of Dapsone can be decreased when combined with Sulfadiazine.Approved, Vet Approved
SulfadiazineThe risk or severity of adverse effects can be increased when Dapsone is combined with Sulfadiazine.Approved, Vet Approved
SulfadoxineThe risk or severity of adverse effects can be increased when Sulfadoxine is combined with Dapsone.Approved
SulfamethoxazoleThe risk or severity of adverse effects can be increased when Dapsone is combined with Sulfamethoxazole.Approved
SulfamethoxazoleThe metabolism of Dapsone can be decreased when combined with Sulfamethoxazole.Approved
SulfametopyrazineThe risk or severity of adverse effects can be increased when Sulfametopyrazine is combined with Dapsone.Approved, Withdrawn
SulfisoxazoleThe metabolism of Dapsone can be decreased when combined with Sulfisoxazole.Approved, Vet Approved
TamoxifenThe metabolism of Dapsone can be decreased when combined with Tamoxifen.Approved
TelaprevirThe metabolism of Dapsone can be decreased when combined with Telaprevir.Approved
TelithromycinThe metabolism of Dapsone can be decreased when combined with Telithromycin.Approved
TeriflunomideThe metabolism of Dapsone can be decreased when combined with Teriflunomide.Approved
ThiethylperazineThe serum concentration of Thiethylperazine can be increased when it is combined with Dapsone.Withdrawn
ThioridazineThe serum concentration of Thioridazine can be increased when it is combined with Dapsone.Withdrawn
TicagrelorThe metabolism of Dapsone can be decreased when combined with Ticagrelor.Approved
TiclopidineThe metabolism of Dapsone can be decreased when combined with Ticlopidine.Approved
TocilizumabThe serum concentration of Dapsone can be decreased when it is combined with Tocilizumab.Approved
TolbutamideThe metabolism of Dapsone can be decreased when combined with Tolbutamide.Approved
TopiramateThe metabolism of Dapsone can be decreased when combined with Topiramate.Approved
TranylcypromineThe metabolism of Dapsone can be decreased when combined with Tranylcypromine.Approved
TrifluoperazineThe serum concentration of Trifluoperazine can be increased when it is combined with Dapsone.Approved
TriflupromazineThe serum concentration of Triflupromazine can be increased when it is combined with Dapsone.Approved, Vet Approved
TrimethoprimThe risk or severity of adverse effects can be increased when Trimethoprim is combined with Dapsone.Approved, Vet Approved
TrimethoprimThe serum concentration of Dapsone can be increased when it is combined with Trimethoprim.Approved, Vet Approved
TrimethoprimThe metabolism of Dapsone can be decreased when combined with Trimethoprim.Approved, Vet Approved
Valproic AcidThe metabolism of Dapsone can be decreased when combined with Valproic Acid.Approved, Investigational
ValsartanThe metabolism of Dapsone can be decreased when combined with Valsartan.Approved, Investigational
VenlafaxineThe metabolism of Dapsone can be decreased when combined with Venlafaxine.Approved
VerapamilThe metabolism of Dapsone can be decreased when combined with Verapamil.Approved
VoriconazoleThe metabolism of Dapsone can be decreased when combined with Voriconazole.Approved, Investigational
ZafirlukastThe metabolism of Dapsone can be decreased when combined with Zafirlukast.Approved, Investigational
ZiprasidoneThe metabolism of Dapsone can be decreased when combined with Ziprasidone.Approved
ZopicloneThe risk or severity of adverse effects can be increased when Dapsone is combined with Zopiclone.Approved
Food Interactions
  • Take without regard to meals.
Synthesis Reference

Weijiard, J.and Messerly, J.P.; U.S. Patent 2,385,899; October 2,1945; assigned to Merck
& Co., Inc.

General ReferencesNot Available
External Links
ATC CodesD10AX05J04BA02
AHFS Codes
  • 08:16.92
PDB EntriesNot Available
FDA labelDownload (515 KB)
MSDSDownload (53.5 KB)
Clinical Trials
Clinical Trials
1CompletedBasic ScienceAcne Vulgaris1
1CompletedBasic ScienceLinear IgA Bullous Dermatosis / Methaemoglobinaemia1
1CompletedTreatmentAcne Vulgaris1
1CompletedTreatmentHealthy Volunteers3
1CompletedTreatmentHuman Immunodeficiency Virus (HIV) Infections / Infections, Bacterial / Mycoses1
1CompletedTreatmentHuman Immunodeficiency Virus (HIV) Infections / Pneumonia, Pneumocystis Carinii2
1WithdrawnNot AvailableAcne Vulgaris1
1WithdrawnTreatmentAcne Vulgaris1
2CompletedTreatmentChronic Lung Diseases / Pulmonary Fibrosis / Sarcoidosis1
2RecruitingTreatmentCutaneous Polyarteritis Nodosa / Henoch-Schönlein Purpura / IgA Vasculitis / Primary Cutaneous Vasculitis1
2TerminatedTreatmentNon-Small-Cell Lung Cancer (NSCLC) / Rash1
2TerminatedTreatmentPemphigus Vulgaris (PV)1
2, 3Unknown StatusPreventionCerebral Stroke / Cerebrovascular Accident, Acute / Cerebrovascular Stroke / Stroke / Stroke, Acute1
3CompletedTreatmentAcne Vulgaris4
3CompletedTreatmentCetuximab-induced Papulopustular (Acneiform) Rash Who Have / Metastatic Colorectal Cancer or Head and Neck Squamous Cell Carcinoma1
3CompletedTreatmentHuman Immunodeficiency Virus (HIV) Infections / Pneumonia, Pneumocystis Carinii4
3Not Yet RecruitingTreatmentAdult Immune Thrombocytopenia (ITP) / Dapsone1
4Active Not RecruitingTreatmentLeprosy1
4CompletedTreatmentAcne Vulgaris7
4CompletedTreatmentBMI >30 kg/m2 / Leprosy / Tuberculosis1
4RecruitingTreatmentAcne Vulgaris1
4RecruitingTreatmentAcne / Allergic Cutaneous Vasculitis / Bullous Skin Diseases / Leprosy / Pneumonia, Pneumocystis / Psoriasis / Sterile Pustulosis / Urticarias1
4WithdrawnTreatmentPneumonia, Pneumocystis Carinii1
Not AvailableCompletedNot AvailableChronic Myeloproliferative Disorders / Leukemias / Lymphoma NOS / Lymphoproliferative Disorders / Methaemoglobinaemia / Multiple Myeloma and Plasma Cell Neoplasm / Myelodysplastic Syndromes / Myelodysplastic/Myeloproliferative Neoplasms / Nonmalignant Neoplasm1
Not AvailableCompletedTreatmentHuman Immunodeficiency Virus (HIV) Infections / Pneumonia, Pneumocystis Carinii2
Not AvailableNot Yet RecruitingTreatmentLichen Simples Chronicus and Prurigo1
Not AvailableRecruitingOtherHealthy Volunteers1
Not AvailableUnknown StatusTreatmentBullous dermatitis herpetiformis1
  • Jacobus pharmaceutical co
Dosage forms
GelTopical5 %
GelTopical50 mg/g
GelTopical75 mg/g
TabletOral100 mg
TabletOral100 mg/1
TabletOral25 mg/1
Unit descriptionCostUnit
Dapsone 30 100 mg tablet Box42.99USD box
Dapsone 30 25 mg tablet Box35.99USD box
Aczone 5% gel5.52USD g
Dapsone powder5.38USD g
Dapsone 100 mg tablet0.86USD tablet
Dapsone 25 mg tablet0.2USD tablet
DrugBank does not sell nor buy drugs. Pricing information is supplied for informational purposes only.
Patent NumberPediatric ExtensionApprovedExpires (estimated)
CA2265461 No2004-11-302017-09-10Canada
US5863560 No1996-09-112016-09-11Us
US6060085 No1996-09-112016-09-11Us
US6620435 No1996-09-112016-09-11Us
US9161926 No2013-11-182033-11-18Us
Experimental Properties
melting point175.5 °CNot Available
water solubility380 mg/L (at 37 °C)YALKOWSKY,SH & DANNENFELSER,RM (1992)
logP0.97HANSCH,C ET AL. (1995)
logS-2.82ADME Research, USCD
pKa2.41PERRIN,DD (1965)
Predicted Properties
Water Solubility0.284 mg/mLALOGPS
pKa (Strongest Basic)2.39ChemAxon
Physiological Charge0ChemAxon
Hydrogen Acceptor Count4ChemAxon
Hydrogen Donor Count2ChemAxon
Polar Surface Area86.18 Å2ChemAxon
Rotatable Bond Count2ChemAxon
Refractivity68.99 m3·mol-1ChemAxon
Polarizability25.05 Å3ChemAxon
Number of Rings2ChemAxon
Rule of FiveYesChemAxon
Ghose FilterYesChemAxon
Veber's RuleYesChemAxon
MDDR-like RuleYesChemAxon
Predicted ADMET features
Human Intestinal Absorption+0.8476
Blood Brain Barrier+0.9705
Caco-2 permeable+0.5879
P-glycoprotein substrateNon-substrate0.8699
P-glycoprotein inhibitor INon-inhibitor0.9311
P-glycoprotein inhibitor IINon-inhibitor0.9572
Renal organic cation transporterNon-inhibitor0.8739
CYP450 2C9 substrateNon-substrate0.7416
CYP450 2D6 substrateSubstrate0.86
CYP450 3A4 substrateNon-substrate0.7175
CYP450 1A2 substrateNon-inhibitor0.9046
CYP450 2C9 inhibitorNon-inhibitor0.8955
CYP450 2D6 inhibitorNon-inhibitor0.9231
CYP450 2C19 inhibitorNon-inhibitor0.9026
CYP450 3A4 inhibitorInhibitor0.6127
CYP450 inhibitory promiscuityHigh CYP Inhibitory Promiscuity0.556
Ames testNon AMES toxic0.9132
BiodegradationNot ready biodegradable0.9778
Rat acute toxicity2.3635 LD50, mol/kg Not applicable
hERG inhibition (predictor I)Weak inhibitor0.9859
hERG inhibition (predictor II)Non-inhibitor0.864
ADMET data is predicted using admetSAR, a free tool for evaluating chemical ADMET properties. (23092397 )
Mass Spec (NIST)Download (9.27 KB)
Spectrum TypeDescriptionSplash Key
LC-MS/MSLC-MS/MS Spectrum - LC-ESI-QQ , negativesplash10-0002-0190000000-7de0f1aeb77cf9b122f5View in MoNA
LC-MS/MSLC-MS/MS Spectrum - LC-ESI-QQ , negativesplash10-0002-0290000000-f1e61c46f1720875a177View in MoNA
LC-MS/MSLC-MS/MS Spectrum - LC-ESI-QQ , negativesplash10-0a4i-0920000000-ed66532a51b7d047462aView in MoNA
LC-MS/MSLC-MS/MS Spectrum - LC-ESI-QQ , negativesplash10-0a4l-3900000000-a1f636a2e557bc9b69a5View in MoNA
LC-MS/MSLC-MS/MS Spectrum - LC-ESI-QQ , negativesplash10-052f-9800000000-3557ad8246dc0a0aa05cView in MoNA
LC-MS/MSLC-MS/MS Spectrum - LC-ESI-QTOF , positivesplash10-0a4i-5910000000-0c8eb03605a271970f1dView in MoNA
LC-MS/MSLC-MS/MS Spectrum - LC-ESI-QFT , positivesplash10-052b-0590000000-a23b099ad5d2d3cd716dView in MoNA
LC-MS/MSLC-MS/MS Spectrum - LC-ESI-QFT , positivesplash10-0a4i-1920000000-0260de715fec538fe8bbView in MoNA
LC-MS/MSLC-MS/MS Spectrum - LC-ESI-QFT , positivesplash10-0a4l-5900000000-6ba41fa3598abafdb242View in MoNA
LC-MS/MSLC-MS/MS Spectrum - LC-ESI-QFT , positivesplash10-052f-9600000000-d2fe4c5ba425499ba98cView in MoNA
LC-MS/MSLC-MS/MS Spectrum - LC-ESI-QFT , positivesplash10-052f-9400000000-e29e2bdac763fc5e250bView in MoNA
LC-MS/MSLC-MS/MS Spectrum - LC-ESI-QFT , positivesplash10-066u-9200000000-71494cee2792628e6a0cView in MoNA
LC-MS/MSLC-MS/MS Spectrum - LC-ESI-QFT , positivesplash10-014i-9000000000-38433ad894a5e08f6ee0View in MoNA
LC-MS/MSLC-MS/MS Spectrum - LC-ESI-QFT , positivesplash10-014i-9000000000-e4782e47ceb05d1ffbdaView in MoNA
LC-MS/MSLC-MS/MS Spectrum - LC-ESI-QFT , positivesplash10-014i-9000000000-4ab9019e60b1718d1d29View in MoNA
LC-MS/MSLC-MS/MS Spectrum - LC-ESI-QQ , positivesplash10-0002-0190000000-d7cf0928be57fafd7ea4View in MoNA
LC-MS/MSLC-MS/MS Spectrum - LC-ESI-QQ , positivesplash10-0a4i-1930000000-09cf0e392eeef139f2b1View in MoNA
LC-MS/MSLC-MS/MS Spectrum - LC-ESI-QQ , positivesplash10-0a4l-8900000000-5da3a6d058cb14fc8300View in MoNA
LC-MS/MSLC-MS/MS Spectrum - LC-ESI-QQ , positivesplash10-052f-9500000000-caa724a9dddce38f915bView in MoNA
Predicted LC-MS/MSPredicted LC-MS/MS Spectrum - 10V, PositiveNot Available
Predicted LC-MS/MSPredicted LC-MS/MS Spectrum - 20V, PositiveNot Available
Predicted LC-MS/MSPredicted LC-MS/MS Spectrum - 40V, PositiveNot Available
Predicted LC-MS/MSPredicted LC-MS/MS Spectrum - 10V, NegativeNot Available
Predicted LC-MS/MSPredicted LC-MS/MS Spectrum - 20V, NegativeNot Available
Predicted LC-MS/MSPredicted LC-MS/MS Spectrum - 40V, NegativeNot Available
MSMass Spectrum (Electron Ionization)splash10-052g-8930000000-c51783649020dadfb20fView in MoNA
1D NMR1H NMR SpectrumNot Available
1D NMR13C NMR SpectrumNot Available
DescriptionThis compound belongs to the class of organic compounds known as benzenesulfonyl compounds. These are aromatic compounds containing a benzenesulfonyl group, which consists of a monocyclic benzene moiety that carries a sulfonyl group.
KingdomOrganic compounds
Super ClassBenzenoids
ClassBenzene and substituted derivatives
Sub ClassBenzenesulfonyl compounds
Direct ParentBenzenesulfonyl compounds
Alternative Parents
  • Benzenesulfonyl group
  • Aniline or substituted anilines
  • Sulfonyl
  • Sulfone
  • Organic nitrogen compound
  • Organic oxygen compound
  • Organopnictogen compound
  • Organic oxide
  • Hydrocarbon derivative
  • Primary amine
  • Organosulfur compound
  • Organonitrogen compound
  • Amine
  • Aromatic homomonocyclic compound
Molecular FrameworkAromatic homomonocyclic compounds
External Descriptors


Mycobacterium leprae (strain TN)
Pharmacological action
General Function:
Dihydropteroate synthase activity
Specific Function:
Has very low affinity for the DHPS substrate 6-hydroxymethyl-7,8-dihydropterin-pyrophosphate, but can bind the inhibitor dapsone. Seems to lack dihydropteroate synthase activity, and does probably not function in folate metabolism (By similarity).
Gene Name:
Uniprot ID:
Molecular Weight:
30850.89 Da
  1. Gillis TP, Williams DL: Dapsone resistance does not appear to be associated with a mutation in the dihydropteroate synthase-2 gene of Mycobacterium leprae. Indian J Lepr. 1999 Jan-Mar;71(1):11-8. [PubMed:10439322 ]
  2. Williams DL, Spring L, Harris E, Roche P, Gillis TP: Dihydropteroate synthase of Mycobacterium leprae and dapsone resistance. Antimicrob Agents Chemother. 2000 Jun;44(6):1530-7. [PubMed:10817704 ]
  3. Gengenbacher M, Xu T, Niyomrattanakit P, Spraggon G, Dick T: Biochemical and structural characterization of the putative dihydropteroate synthase ortholog Rv1207 of Mycobacterium tuberculosis. FEMS Microbiol Lett. 2008 Oct;287(1):128-35. doi: 10.1111/j.1574-6968.2008.01302.x. Epub 2008 Aug 1. [PubMed:18680522 ]
Mycobacterium leprae (strain TN)
Pharmacological action
General Function:
Metal ion binding
Specific Function:
Catalyzes the condensation of para-aminobenzoate (pABA) with 6-hydroxymethyl-7,8-dihydropterin diphosphate (DHPt-PP) to form 7,8-dihydropteroate, the immediate precursor of folate derivatives.
Gene Name:
Uniprot ID:
Molecular Weight:
29447.355 Da
  1. Cambau E, Carthagena L, Chauffour A, Ji B, Jarlier V: Dihydropteroate synthase mutations in the folP1 gene predict dapsone resistance in relapsed cases of leprosy. Clin Infect Dis. 2006 Jan 15;42(2):238-41. Epub 2005 Dec 12. [PubMed:16355335 ]
  2. Lee SB, Kim SK, Kang TJ, Chae GT, Chun JH, Shin HK, Kim JP, Ko YH, Kim NH: The prevalence of folP1 mutations associated with clinical resistance to dapsone, in Mycobacterium leprae isolates from South Korea. Ann Trop Med Parasitol. 2001 Jun;95(4):429-32. [PubMed:11454253 ]
  3. Williams DL, Spring L, Harris E, Roche P, Gillis TP: Dihydropteroate synthase of Mycobacterium leprae and dapsone resistance. Antimicrob Agents Chemother. 2000 Jun;44(6):1530-7. [PubMed:10817704 ]
  4. Gengenbacher M, Xu T, Niyomrattanakit P, Spraggon G, Dick T: Biochemical and structural characterization of the putative dihydropteroate synthase ortholog Rv1207 of Mycobacterium tuberculosis. FEMS Microbiol Lett. 2008 Oct;287(1):128-35. doi: 10.1111/j.1574-6968.2008.01302.x. Epub 2008 Aug 1. [PubMed:18680522 ]


Pharmacological action
General Function:
Steroid hydroxylase activity
Specific Function:
Cytochromes P450 are a group of heme-thiolate monooxygenases. In liver microsomes, this enzyme is involved in an NADPH-dependent electron transport pathway. It oxidizes a variety of structurally unrelated compounds, including steroids, fatty acids, and xenobiotics. This enzyme contributes to the wide pharmacokinetics variability of the metabolism of drugs such as S-warfarin, diclofenac, phenyto...
Gene Name:
Uniprot ID:
Molecular Weight:
55627.365 Da
  1. Zhou SF, Zhou ZW, Yang LP, Cai JP: Substrates, inducers, inhibitors and structure-activity relationships of human Cytochrome P450 2C9 and implications in drug development. Curr Med Chem. 2009;16(27):3480-675. Epub 2009 Sep 1. [PubMed:19515014 ]
  2. Preissner S, Kroll K, Dunkel M, Senger C, Goldsobel G, Kuzman D, Guenther S, Winnenburg R, Schroeder M, Preissner R: SuperCYP: a comprehensive database on Cytochrome P450 enzymes including a tool for analysis of CYP-drug interactions. Nucleic Acids Res. 2010 Jan;38(Database issue):D237-43. doi: 10.1093/nar/gkp970. Epub 2009 Nov 24. [PubMed:19934256 ]
  3. Winter HR, Wang Y, Unadkat JD: CYP2C8/9 mediate dapsone N-hydroxylation at clinical concentrations of dapsone. Drug Metab Dispos. 2000 Aug;28(8):865-8. [PubMed:10901692 ]
Pharmacological action
General Function:
Steroid hydroxylase activity
Specific Function:
Metabolizes several precarcinogens, drugs, and solvents to reactive metabolites. Inactivates a number of drugs and xenobiotics and also bioactivates many xenobiotic substrates to their hepatotoxic or carcinogenic forms.
Gene Name:
Uniprot ID:
Molecular Weight:
56848.42 Da
  1. Zhou SF, Zhou ZW, Yang LP, Cai JP: Substrates, inducers, inhibitors and structure-activity relationships of human Cytochrome P450 2C9 and implications in drug development. Curr Med Chem. 2009;16(27):3480-675. Epub 2009 Sep 1. [PubMed:19515014 ]
  2. Preissner S, Kroll K, Dunkel M, Senger C, Goldsobel G, Kuzman D, Guenther S, Winnenburg R, Schroeder M, Preissner R: SuperCYP: a comprehensive database on Cytochrome P450 enzymes including a tool for analysis of CYP-drug interactions. Nucleic Acids Res. 2010 Jan;38(Database issue):D237-43. doi: 10.1093/nar/gkp970. Epub 2009 Nov 24. [PubMed:19934256 ]
Pharmacological action
General Function:
Vitamin d3 25-hydroxylase activity
Specific Function:
Cytochromes P450 are a group of heme-thiolate monooxygenases. In liver microsomes, this enzyme is involved in an NADPH-dependent electron transport pathway. It performs a variety of oxidation reactions (e.g. caffeine 8-oxidation, omeprazole sulphoxidation, midazolam 1'-hydroxylation and midazolam 4-hydroxylation) of structurally unrelated compounds, including steroids, fatty acids, and xenobiot...
Gene Name:
Uniprot ID:
Molecular Weight:
57342.67 Da
  1. Zhou SF, Zhou ZW, Yang LP, Cai JP: Substrates, inducers, inhibitors and structure-activity relationships of human Cytochrome P450 2C9 and implications in drug development. Curr Med Chem. 2009;16(27):3480-675. Epub 2009 Sep 1. [PubMed:19515014 ]
  2. Preissner S, Kroll K, Dunkel M, Senger C, Goldsobel G, Kuzman D, Guenther S, Winnenburg R, Schroeder M, Preissner R: SuperCYP: a comprehensive database on Cytochrome P450 enzymes including a tool for analysis of CYP-drug interactions. Nucleic Acids Res. 2010 Jan;38(Database issue):D237-43. doi: 10.1093/nar/gkp970. Epub 2009 Nov 24. [PubMed:19934256 ]
  3. Ekins S, Bravi G, Wikel JH, Wrighton SA: Three-dimensional-quantitative structure activity relationship analysis of cytochrome P-450 3A4 substrates. J Pharmacol Exp Ther. 1999 Oct;291(1):424-33. [PubMed:10490933 ]
  4. Drug Interactions: Cytochrome P450 Drug Interaction Table [Link]
Pharmacological action
General Function:
Trimethylamine monooxygenase activity
Specific Function:
Involved in the oxidative metabolism of a variety of xenobiotics such as drugs and pesticides. It N-oxygenates primary aliphatic alkylamines as well as secondary and tertiary amines. Plays an important role in the metabolism of trimethylamine (TMA), via the production of TMA N-oxide (TMAO). Is also able to perform S-oxidation when acting on sulfide compounds (PubMed:9224773).
Gene Name:
Uniprot ID:
Molecular Weight:
60032.975 Da
  1. Zhou SF, Zhou ZW, Yang LP, Cai JP: Substrates, inducers, inhibitors and structure-activity relationships of human Cytochrome P450 2C9 and implications in drug development. Curr Med Chem. 2009;16(27):3480-675. Epub 2009 Sep 1. [PubMed:19515014 ]
Pharmacological action
General Function:
Prostaglandin-endoperoxide synthase activity
Specific Function:
Converts arachidonate to prostaglandin H2 (PGH2), a committed step in prostanoid synthesis. Involved in the constitutive production of prostanoids in particular in the stomach and platelets. In gastric epithelial cells, it is a key step in the generation of prostaglandins, such as prostaglandin E2 (PGE2), which plays an important role in cytoprotection. In platelets, it is involved in the gener...
Gene Name:
Uniprot ID:
Molecular Weight:
68685.82 Da
  1. Zhou SF, Zhou ZW, Yang LP, Cai JP: Substrates, inducers, inhibitors and structure-activity relationships of human Cytochrome P450 2C9 and implications in drug development. Curr Med Chem. 2009;16(27):3480-675. Epub 2009 Sep 1. [PubMed:19515014 ]
Pharmacological action
General Function:
Prostaglandin-endoperoxide synthase activity
Specific Function:
Converts arachidonate to prostaglandin H2 (PGH2), a committed step in prostanoid synthesis. Constitutively expressed in some tissues in physiological conditions, such as the endothelium, kidney and brain, and in pathological conditions, such as in cancer. PTGS2 is responsible for production of inflammatory prostaglandins. Up-regulation of PTGS2 is also associated with increased cell adhesion, p...
Gene Name:
Uniprot ID:
Molecular Weight:
68995.625 Da
  1. Zhou SF, Zhou ZW, Yang LP, Cai JP: Substrates, inducers, inhibitors and structure-activity relationships of human Cytochrome P450 2C9 and implications in drug development. Curr Med Chem. 2009;16(27):3480-675. Epub 2009 Sep 1. [PubMed:19515014 ]
Pharmacological action
General Function:
Steroid hydroxylase activity
Specific Function:
Cytochromes P450 are a group of heme-thiolate monooxygenases. In liver microsomes, this enzyme is involved in an NADPH-dependent electron transport pathway. It oxidizes a variety of structurally unrelated compounds, including steroids, fatty acids, and xenobiotics. In the epoxidation of arachidonic acid it generates only 14,15- and 11,12-cis-epoxyeicosatrienoic acids. It is the principal enzyme...
Gene Name:
Uniprot ID:
Molecular Weight:
55824.275 Da
  1. Zhou SF, Zhou ZW, Yang LP, Cai JP: Substrates, inducers, inhibitors and structure-activity relationships of human Cytochrome P450 2C9 and implications in drug development. Curr Med Chem. 2009;16(27):3480-675. Epub 2009 Sep 1. [PubMed:19515014 ]
  2. Preissner S, Kroll K, Dunkel M, Senger C, Goldsobel G, Kuzman D, Guenther S, Winnenburg R, Schroeder M, Preissner R: SuperCYP: a comprehensive database on Cytochrome P450 enzymes including a tool for analysis of CYP-drug interactions. Nucleic Acids Res. 2010 Jan;38(Database issue):D237-43. doi: 10.1093/nar/gkp970. Epub 2009 Nov 24. [PubMed:19934256 ]
Pharmacological action
General Function:
Steroid hydroxylase activity
Specific Function:
Responsible for the metabolism of a number of therapeutic agents such as the anticonvulsant drug S-mephenytoin, omeprazole, proguanil, certain barbiturates, diazepam, propranolol, citalopram and imipramine.
Gene Name:
Uniprot ID:
Molecular Weight:
55930.545 Da
  1. Zhou SF, Zhou ZW, Yang LP, Cai JP: Substrates, inducers, inhibitors and structure-activity relationships of human Cytochrome P450 2C9 and implications in drug development. Curr Med Chem. 2009;16(27):3480-675. Epub 2009 Sep 1. [PubMed:19515014 ]
  2. Preissner S, Kroll K, Dunkel M, Senger C, Goldsobel G, Kuzman D, Guenther S, Winnenburg R, Schroeder M, Preissner R: SuperCYP: a comprehensive database on Cytochrome P450 enzymes including a tool for analysis of CYP-drug interactions. Nucleic Acids Res. 2010 Jan;38(Database issue):D237-43. doi: 10.1093/nar/gkp970. Epub 2009 Nov 24. [PubMed:19934256 ]
Pharmacological action
General Function:
Arylamine n-acetyltransferase activity
Specific Function:
Participates in the detoxification of a plethora of hydrazine and arylamine drugs. Catalyzes the N- or O-acetylation of various arylamine and heterocyclic amine substrates and is able to bioactivate several known carcinogens.
Gene Name:
Uniprot ID:
Molecular Weight:
33542.235 Da
  1. Zhou SF, Zhou ZW, Yang LP, Cai JP: Substrates, inducers, inhibitors and structure-activity relationships of human Cytochrome P450 2C9 and implications in drug development. Curr Med Chem. 2009;16(27):3480-675. Epub 2009 Sep 1. [PubMed:19515014 ]
Pharmacological action
General Function:
Oxygen binding
Specific Function:
Cytochromes P450 are a group of heme-thiolate monooxygenases. In liver microsomes, this enzyme is involved in an NADPH-dependent electron transport pathway. It oxidizes a variety of structurally unrelated compounds, including steroids, fatty acids, and xenobiotics.
Gene Name:
Uniprot ID:
Molecular Weight:
57108.065 Da
  1. Drug Interactions: Cytochrome P450 Drug Interaction Table [Link]
Pharmacological action
General Function:
Oxygen binding
Specific Function:
Cytochromes P450 are a group of heme-thiolate monooxygenases. In liver microsomes, this enzyme is involved in an NADPH-dependent electron transport pathway. It oxidizes a variety of structurally unrelated compounds, including steroids, fatty acids, and xenobiotics.
Gene Name:
Uniprot ID:
Molecular Weight:
57525.03 Da
  1. Drug Interactions: Cytochrome P450 Drug Interaction Table [Link]
Pharmacological action
General Function:
Peroxidase activity
Specific Function:
Part of the host defense system of polymorphonuclear leukocytes. It is responsible for microbicidal activity against a wide range of organisms. In the stimulated PMN, MPO catalyzes the production of hypohalous acids, primarily hypochlorous acid in physiologic situations, and other toxic intermediates that greatly enhance PMN microbicidal activity.
Gene Name:
Uniprot ID:
Molecular Weight:
83867.71 Da
  1. Zhou SF, Zhou ZW, Yang LP, Cai JP: Substrates, inducers, inhibitors and structure-activity relationships of human Cytochrome P450 2C9 and implications in drug development. Curr Med Chem. 2009;16(27):3480-675. Epub 2009 Sep 1. [PubMed:19515014 ]
Pharmacological action
General Function:
Steroid hydroxylase activity
Specific Function:
Cytochromes P450 are a group of heme-thiolate monooxygenases. In liver microsomes, this enzyme is involved in an NADPH-dependent electron transport pathway. It oxidizes a variety of structurally unrelated compounds, including steroids, fatty acids, and xenobiotics.
Gene Name:
Uniprot ID:
Molecular Weight:
55710.075 Da
  1. Preissner S, Kroll K, Dunkel M, Senger C, Goldsobel G, Kuzman D, Guenther S, Winnenburg R, Schroeder M, Preissner R: SuperCYP: a comprehensive database on Cytochrome P450 enzymes including a tool for analysis of CYP-drug interactions. Nucleic Acids Res. 2010 Jan;38(Database issue):D237-43. doi: 10.1093/nar/gkp970. Epub 2009 Nov 24. [PubMed:19934256 ]
comments powered by Disqus
Drug created on June 13, 2005 07:24 / Updated on April 29, 2017 05:17