
Accession Number
DB00468  (APRD00563)
Small Molecule

An alkaloid derived from the bark of the cinchona tree. It is used as an antimalarial drug, and is the active ingredient in extracts of the cinchona that have been used for that purpose since before 1633. Quinine is also a mild antipyretic and analgesic and has been used in common cold preparations for that purpose. It was used commonly and as a bitter and flavoring agent, and is still useful for the treatment of babesiosis. Quinine is also useful in some muscular disorders, especially nocturnal leg cramps and myotonia congenita, because of its direct effects on muscle membrane and sodium channels. The mechanisms of its antimalarial effects are not well understood. [PubChem]

  • (-)-Quinine
  • (8S,9R)-Quinine
  • (R)-(-)-Quinine
  • (R)-(6-Methoxyquinolin-4-yl)((2S,4S,8R)-8-vinylquinuclidin-2-yl)methanol
  • 6'-Methoxycinchonidine
  • Chinin
  • Chinine
  • Chininum
  • Quinina
  • Quinine
External IDs
Product Ingredients
IngredientUNIICASInChI Key
Quinine Hydrochloride711S8Y0T336119-47-7MPQKYZPYCSTMEI-FLZPLBAKSA-N
Quinine phosphate0E9UD56A3I549-60-0JGWCVXDJEMKYEA-INGJVHGESA-N
Product Images
Prescription Products
NameDosageStrengthRouteLabellerMarketing StartMarketing End
QualaquinCapsule324 mg/1OralSun Pharmaceutical Industries Limited2005-08-12Not applicableUs
QualaquinCapsule324 mg/1OralStat Rx USA2005-08-122018-02-08Us
QualaquinCapsule324 mg/1OralAR Scientific, Inc.2005-08-12Not applicableUs13310 0153 07 nlmimage10 e70e7393
Quinine - OdanTablet300 mgOralOdan Laboratories Ltd2001-11-08Not applicableCanada
Quinine - OdanCapsule300 mgOralOdan Laboratories Ltd1999-05-01Not applicableCanada
Quinine - OdanCapsule200 mgOralOdan Laboratories Ltd1999-05-01Not applicableCanada
Quinine SulfateCapsule200 mgOralPendopharm Division Of De Pharmascience IncNot applicableNot applicableCanada
Quinine SulfateCapsule300 mgOralPendopharm Division Of De Pharmascience IncNot applicableNot applicableCanada
Quinine Sulfate Cap 200mgCapsule200 mgOralParke Davis Division, Warner Lambert Canada Inc.1951-12-311998-04-07Canada
Quinine Sulfate Cap 200mgCapsule200 mgOralStanley Pharmaceuticals, A Division Of Vita Health Products Inc.1957-12-312001-07-20Canada
Generic Prescription Products
NameDosageStrengthRouteLabellerMarketing StartMarketing End
Apo-quinine CapsulesCapsule300 mgOralApotex Corporation2004-06-08Not applicableCanada
Apo-quinine CapsulesCapsule200 mgOralApotex Corporation2004-06-08Not applicableCanada
Jamp-quinineCapsule300 mgOralJamp Pharma Corporation2015-09-16Not applicableCanada
Jamp-quinineCapsule200 mgOralJamp Pharma Corporation2015-09-16Not applicableCanada
Pro-quinine - 200Capsule200 mgOralPro Doc Limitee2008-07-03Not applicableCanada
Pro-quinine - 300Capsule300 mgOralPro Doc Limitee2008-07-03Not applicableCanada
Quinine SulfateCapsule324 mg/1OralRiconpharma Llc2015-07-232017-12-22Us
Quinine SulfateCapsule324 mg/1OralMylan Pharmaceuticals2012-12-14Not applicableUs
Quinine SulfateCapsule324 mg/1OralAmerincan Health Packaging2015-03-31Not applicableUs
Quinine SulfateCapsule324 mg/1OralIngenus Pharmaceuticals Nj, Llc2015-07-232017-12-22Us
International/Other Brands
Cinkona (Ipca) / Jasoquin (Jayson) / QSM (Leben) / Quinlup (Lupin) / Qutil (Little Greave) / Sulquin (Saga)
CAS number
Average: 324.4168
Monoisotopic: 324.183778022
Chemical Formula
InChI Key



For the treatment of malaria and leg cramps

Structured Indications

Quinine is used parenterally to treat life-threatening infections caused by chloroquine-resistant Plasmodium falciparum malaria. Quinine acts as a blood schizonticide although it also has gametocytocidal activity against P. vivax and P. malariae. Because it is a weak base, it is concentrated in the food vacuoles of P. falciparum. It is thought to act by inhibiting heme polymerase, thereby allowing accumulation of its cytotoxic substrate, heme. As a schizonticidal drug, it is less effective and more toxic than chloroquine. However, it has a special place in the management of severe falciparum malaria in areas with known resistance to chloroquine.

Mechanism of action

The theorized mechanism of action for quinine and related anti-malarial drugs is that these drugs are toxic to the malaria parasite. Specifically, the drugs interfere with the parasite's ability to break down and digest hemoglobin. Consequently, the parasite starves and/or builds up toxic levels of partially degraded hemoglobin in itself.

AFe(II)-protoporphyrin IX
Plasmodium falciparum
UPlatelet glycoprotein IX
UIntermediate conductance calcium-activated potassium channel protein 4

76 - 88%

Volume of distribution
  • 1.43 ± 0.18 L/kg [Healthy Pediatric Controls]
  • 0.87 ± 0.12 L/kg [P. falciparum Malaria Pediatric Patients]
  • 2.5 to 7.1 L/kg [healthy subjects who received a single oral 600 mg dose]
Protein binding

Approximately 70%


Hepatic, over 80% metabolized by the liver.

Route of elimination

Quinine is eliminated primarily via hepatic biotransformation. Approximately 20% of quinine is excreted unchanged in urine.

Half life

Approximately 18 hours

  • 0.17 L/h/kg [healthy]
  • 0.09 L/h/kg [patients with uncomplicated malaria]
  • 18.4 L/h [healthy adult subjects with administration of multiple-dose activated charcoal]
  • 11.8 L/h [healthy adult subjects without administration of multiple-dose activated charcoal]
  • Oral cl=0.06 L/h/kg [elderly subjects]

Quinine is a documented causative agent of drug induced thrombocytopenia (DIT). Thrombocytopenia is a low amount of platelets in the blood. Quinine induces production of antibodies against glycoprotein (GP) Ib-IX complex in the majority of cases of DIT, or more rarely, the platelet-glycoprotein complex GPIIb-IIIa. Increased antibodies against these complexes increases platelet clearance, leading to the observed thrombocytopenia.

Affected organisms
  • Humans and other mammals
Not Available
Pharmacogenomic Effects/ADRs
Interacting Gene/EnzymeAllele nameGenotype(s)Defining Change(s)Type(s)DescriptionDetails
Glucose-6-phosphate 1-dehydrogenaseVilleurbanneNot Available1000_1002delACCADR InferredIncreased risk of hemolysis.Details
Glucose-6-phosphate 1-dehydrogenaseTorunNot Available1006A->GADR InferredIncreased risk of hemolysis.Details
Glucose-6-phosphate 1-dehydrogenaseSunderlandNot Available105_107delCATADR InferredIncreased risk of hemolysis.Details
Glucose-6-phosphate 1-dehydrogenaseIwatsukiNot Available1081G->AADR InferredIncreased risk of hemolysis.Details
Glucose-6-phosphate 1-dehydrogenaseSerresNot Available1082C->TADR InferredIncreased risk of hemolysis.Details
Glucose-6-phosphate 1-dehydrogenaseTondelaNot Available1084_1101delCTGAACGAGCGCAAGGCCADR InferredIncreased risk of hemolysis.Details
Glucose-6-phosphate 1-dehydrogenaseLoma LindaNot Available1089C->AADR InferredIncreased risk of hemolysis.Details
Glucose-6-phosphate 1-dehydrogenaseAachenNot Available1089C->GADR InferredIncreased risk of hemolysis.Details
Glucose-6-phosphate 1-dehydrogenaseTenriNot Available1096A->GADR InferredIncreased risk of hemolysis.Details
Glucose-6-phosphate 1-dehydrogenaseMontpellierNot Available1132G>AADR InferredIncreased risk of hemolysis.Details
Glucose-6-phosphate 1-dehydrogenaseCalvo MackennaNot Available1138A->GADR InferredIncreased risk of hemolysis.Details
Glucose-6-phosphate 1-dehydrogenaseRileyNot Available1139T->CADR InferredIncreased risk of hemolysis.Details
Glucose-6-phosphate 1-dehydrogenaseOlomoucNot Available1141T->CADR InferredIncreased risk of hemolysis.Details
Glucose-6-phosphate 1-dehydrogenaseTomahNot Available1153T->CADR InferredIncreased risk of hemolysis.Details
Glucose-6-phosphate 1-dehydrogenaseLynwoodNot Available1154G->TADR InferredIncreased risk of hemolysis.Details
Glucose-6-phosphate 1-dehydrogenaseMadridNot Available1155C->GADR InferredIncreased risk of hemolysis.Details
Glucose-6-phosphate 1-dehydrogenaseIowa, Walter Reed, SpringfieldNot Available1156A->GADR InferredIncreased risk of hemolysis.Details
Glucose-6-phosphate 1-dehydrogenaseBeverly Hills, Genova, Iwate, Niigata, YamaguchiNot Available1160G->AADR InferredIncreased risk of hemolysis.Details
Glucose-6-phosphate 1-dehydrogenaseHartfordNot Available1162A->GADR InferredIncreased risk of hemolysis.Details
Glucose-6-phosphate 1-dehydrogenasePrahaNot Available1166A->GADR InferredIncreased risk of hemolysis.Details
Glucose-6-phosphate 1-dehydrogenaseKrakowNot Available1175T>CADR InferredIncreased risk of hemolysis.Details
Glucose-6-phosphate 1-dehydrogenaseWisconsinNot Available1177C->GADR InferredIncreased risk of hemolysis.Details
Glucose-6-phosphate 1-dehydrogenaseNashville, Anaheim, PorticiNot Available1178G->AADR InferredIncreased risk of hemolysis.Details
Glucose-6-phosphate 1-dehydrogenaseAlhambraNot Available1180G->CADR InferredIncreased risk of hemolysis.Details
Glucose-6-phosphate 1-dehydrogenaseBariNot Available1187C->TADR InferredIncreased risk of hemolysis.Details
Glucose-6-phosphate 1-dehydrogenasePuerto LimonNot Available1192G->AADR InferredIncreased risk of hemolysis.Details
Glucose-6-phosphate 1-dehydrogenaseCovao do LoboNot Available1205C>AADR InferredIncreased risk of hemolysis.Details
Glucose-6-phosphate 1-dehydrogenaseClinicNot Available1215G->AADR InferredIncreased risk of hemolysis.Details
Glucose-6-phosphate 1-dehydrogenaseUtrechtNot Available1225C->TADR InferredIncreased risk of hemolysis.Details
Glucose-6-phosphate 1-dehydrogenaseSuwalkiNot Available1226C->GADR InferredIncreased risk of hemolysis.Details
Glucose-6-phosphate 1-dehydrogenaseRiversideNot Available1228G->TADR InferredIncreased risk of hemolysis.Details
Glucose-6-phosphate 1-dehydrogenaseJapan, ShinagawaNot Available1229G->AADR InferredIncreased risk of hemolysis.Details
Glucose-6-phosphate 1-dehydrogenaseKawasakiNot Available1229G->CADR InferredIncreased risk of hemolysis.Details
Glucose-6-phosphate 1-dehydrogenaseMunichNot Available1231A->GADR InferredIncreased risk of hemolysis.Details
Glucose-6-phosphate 1-dehydrogenaseGeorgiaNot Available1284C->AADR InferredIncreased risk of hemolysis.Details
Glucose-6-phosphate 1-dehydrogenaseSumareNot Available1292T->GADR InferredIncreased risk of hemolysis.Details
Glucose-6-phosphate 1-dehydrogenaseTelti/KobeNot Available1318C->TADR InferredIncreased risk of hemolysis.Details
Glucose-6-phosphate 1-dehydrogenaseSantiago de Cuba, MoriokaNot Available1339G->AADR InferredIncreased risk of hemolysis.Details
Glucose-6-phosphate 1-dehydrogenaseHarimaNot Available1358T->AADR InferredIncreased risk of hemolysis.Details
Glucose-6-phosphate 1-dehydrogenaseFiguera da FozNot Available1366G->CADR InferredIncreased risk of hemolysis.Details
Glucose-6-phosphate 1-dehydrogenaseAmiensNot Available1367A>TADR InferredIncreased risk of hemolysis.Details
Glucose-6-phosphate 1-dehydrogenaseBangkok NoiNot Available1376G->T, 1502T->GADR InferredIncreased risk of hemolysis.Details
Glucose-6-phosphate 1-dehydrogenaseFukayaNot Available1462G->AADR InferredIncreased risk of hemolysis.Details
Glucose-6-phosphate 1-dehydrogenaseCampinasNot Available1463G->TADR InferredIncreased risk of hemolysis.Details
Glucose-6-phosphate 1-dehydrogenaseBuenos AiresNot Available1465C>TADR InferredIncreased risk of hemolysis.Details
Glucose-6-phosphate 1-dehydrogenaseArakawaNot Available1466C->TADR InferredIncreased risk of hemolysis.Details
Glucose-6-phosphate 1-dehydrogenaseBrightonNot Available1488_1490delGAAADR InferredIncreased risk of hemolysis.Details
Glucose-6-phosphate 1-dehydrogenaseKozukataNot Available159G->CADR InferredIncreased risk of hemolysis.Details
Glucose-6-phosphate 1-dehydrogenaseAmsterdamNot Available180_182delTCTADR InferredIncreased risk of hemolysis.Details
Glucose-6-phosphate 1-dehydrogenaseNo nameNot Available202G->A, 376A->G, 1264C>GADR InferredIncreased risk of hemolysis.Details
Glucose-6-phosphate 1-dehydrogenaseSwanseaNot Available224T->CADR InferredIncreased risk of hemolysis.Details
Glucose-6-phosphate 1-dehydrogenaseUrayasuNot Available281_283delAGAADR InferredIncreased risk of hemolysis.Details
Glucose-6-phosphate 1-dehydrogenaseVancouverNot Available317C->G544C->T592C->TADR InferredIncreased risk of hemolysis.Details
Glucose-6-phosphate 1-dehydrogenaseMt SinaiNot Available376A->G, 1159C->TADR InferredIncreased risk of hemolysis.Details
Glucose-6-phosphate 1-dehydrogenasePlymouthNot Available488G->AADR InferredIncreased risk of hemolysis.Details
Glucose-6-phosphate 1-dehydrogenaseVolendamNot Available514C->TADR InferredIncreased risk of hemolysis.Details
Glucose-6-phosphate 1-dehydrogenaseShinshuNot Available527A->GADR InferredIncreased risk of hemolysis.Details
Glucose-6-phosphate 1-dehydrogenaseChikugoNot Available535A->TADR InferredIncreased risk of hemolysis.Details
Glucose-6-phosphate 1-dehydrogenaseTsukuiNot Available561_563delCTCADR InferredIncreased risk of hemolysis.Details
Glucose-6-phosphate 1-dehydrogenasePedoplis-CkaroNot Available573C>GADR InferredIncreased risk of hemolysis.Details
Glucose-6-phosphate 1-dehydrogenaseSantiagoNot Available593G->CADR InferredIncreased risk of hemolysis.Details
Glucose-6-phosphate 1-dehydrogenaseMinnesota, Marion, Gastonia, LeJeuneNot Available637G->TADR InferredIncreased risk of hemolysis.Details
Glucose-6-phosphate 1-dehydrogenaseCincinnatiNot Available637G->T, 1037A->TADR InferredIncreased risk of hemolysis.Details
Glucose-6-phosphate 1-dehydrogenaseHarilaouNot Available648T->GADR InferredIncreased risk of hemolysis.Details
Glucose-6-phosphate 1-dehydrogenaseNorth DallasNot Available683_685delACAADR InferredIncreased risk of hemolysis.Details
Glucose-6-phosphate 1-dehydrogenaseAsahikawaNot Available695G->AADR InferredIncreased risk of hemolysis.Details
Glucose-6-phosphate 1-dehydrogenaseDurhamNot Available713A->GADR InferredIncreased risk of hemolysis.Details
Glucose-6-phosphate 1-dehydrogenaseStonybrookNot Available724_729delGGCACTADR InferredIncreased risk of hemolysis.Details
Glucose-6-phosphate 1-dehydrogenaseWayneNot Available769C->GADR InferredIncreased risk of hemolysis.Details
Glucose-6-phosphate 1-dehydrogenaseAveiroNot Available806G->AADR InferredIncreased risk of hemolysis.Details
Glucose-6-phosphate 1-dehydrogenaseCleveland CorumNot Available820G->AADR InferredIncreased risk of hemolysis.Details
Glucose-6-phosphate 1-dehydrogenaseLilleNot Available821A>TADR InferredIncreased risk of hemolysis.Details
Glucose-6-phosphate 1-dehydrogenaseBangkokNot Available825G>CADR InferredIncreased risk of hemolysis.Details
Glucose-6-phosphate 1-dehydrogenaseSugaoNot Available826C->TADR InferredIncreased risk of hemolysis.Details
Glucose-6-phosphate 1-dehydrogenaseLa JollaNot Available832T->CADR InferredIncreased risk of hemolysis.Details
Glucose-6-phosphate 1-dehydrogenaseWexhamNot Available833C->TADR InferredIncreased risk of hemolysis.Details
Glucose-6-phosphate 1-dehydrogenasePiotrkowNot Available851T>CADR InferredIncreased risk of hemolysis.Details
Glucose-6-phosphate 1-dehydrogenaseWest VirginiaNot Available910G->TADR InferredIncreased risk of hemolysis.Details
Glucose-6-phosphate 1-dehydrogenaseOmiyaNot Available921G->CADR InferredIncreased risk of hemolysis.Details
Glucose-6-phosphate 1-dehydrogenaseNaraNot Available953_976delCCACCAAAGGGTACCTGGAC GACCADR InferredIncreased risk of hemolysis.Details
Glucose-6-phosphate 1-dehydrogenaseManhattanNot Available962G->AADR InferredIncreased risk of hemolysis.Details
Glucose-6-phosphate 1-dehydrogenaseRehevotNot Available964T->CADR InferredIncreased risk of hemolysis.Details
Glucose-6-phosphate 1-dehydrogenaseHoniaraNot Available99A->G / 1360C->TADR InferredIncreased risk of hemolysis.Details
Glucose-6-phosphate 1-dehydrogenaseTokyo, FukushimaNot Available1246G->AADR InferredIncreased risk of hemolysis.Details
Glucose-6-phosphate 1-dehydrogenaseChathamNot Available1003G->AADR InferredIncreased risk of hemolysis.Details
Glucose-6-phosphate 1-dehydrogenaseFushanNot Available1004C->AADR InferredIncreased risk of hemolysis.Details
Glucose-6-phosphate 1-dehydrogenasePartenopeNot Available1052G->TADR InferredIncreased risk of hemolysis.Details
Glucose-6-phosphate 1-dehydrogenaseIerapetraNot Available1057C->TADR InferredIncreased risk of hemolysis.Details
Glucose-6-phosphate 1-dehydrogenaseAnadiaNot Available1193A->GADR InferredIncreased risk of hemolysis.Details
Glucose-6-phosphate 1-dehydrogenaseAbenoNot Available1220A->CADR InferredIncreased risk of hemolysis.Details
Glucose-6-phosphate 1-dehydrogenaseSurabayaNot Available1291G->AADR InferredIncreased risk of hemolysis.Details
Glucose-6-phosphate 1-dehydrogenasePawneeNot Available1316G->CADR InferredIncreased risk of hemolysis.Details
Glucose-6-phosphate 1-dehydrogenaseS. AntiocoNot Available1342A->GADR InferredIncreased risk of hemolysis.Details
Glucose-6-phosphate 1-dehydrogenaseCassanoNot Available1347G->CADR InferredIncreased risk of hemolysis.Details
Glucose-6-phosphate 1-dehydrogenaseHermoupolisNot Available1347G->C / 1360C->TADR InferredIncreased risk of hemolysis.Details
Glucose-6-phosphate 1-dehydrogenaseUnion,Maewo, Chinese-2, KaloNot Available1360C->TADR InferredIncreased risk of hemolysis.Details
Glucose-6-phosphate 1-dehydrogenaseAndalusNot Available1361G->AADR InferredIncreased risk of hemolysis.Details
Glucose-6-phosphate 1-dehydrogenaseCosenzaNot Available1376G->CADR InferredIncreased risk of hemolysis.Details
Glucose-6-phosphate 1-dehydrogenaseCanton, Taiwan- Hakka, Gifu-like, Agrigento-likeNot Available1376G->TADR InferredIncreased risk of hemolysis.Details
Glucose-6-phosphate 1-dehydrogenaseFloresNot Available1387C->AADR InferredIncreased risk of hemolysis.Details
Glucose-6-phosphate 1-dehydrogenaseKaiping, Anant, Dhon, Sapporo-like, WoseraNot Available1388G->AADR InferredIncreased risk of hemolysis.Details
Glucose-6-phosphate 1-dehydrogenaseKamogawaNot Available169C->TADR InferredIncreased risk of hemolysis.Details
Glucose-6-phosphate 1-dehydrogenaseCostanzoNot Available179T>CADR InferredIncreased risk of hemolysis.Details
Glucose-6-phosphate 1-dehydrogenaseAmazoniaNot Available185C->AADR InferredIncreased risk of hemolysis.Details
Glucose-6-phosphate 1-dehydrogenaseSongklanagarindNot Available196T->AADR InferredIncreased risk of hemolysis.Details
Glucose-6-phosphate 1-dehydrogenaseHechiNot Available202G->A / 871G->AADR InferredIncreased risk of hemolysis.Details
Glucose-6-phosphate 1-dehydrogenaseNamouruNot Available208T->CADR InferredIncreased risk of hemolysis.Details
Glucose-6-phosphate 1-dehydrogenaseBao LocNot Available352T>CADR InferredIncreased risk of hemolysis.Details
Glucose-6-phosphate 1-dehydrogenaseCrispimNot Available375G->T, 379G->T383T->C384C>TADR InferredIncreased risk of hemolysis.Details
Glucose-6-phosphate 1-dehydrogenaseAcrokorinthosNot Available376A->G / 463C->GADR InferredIncreased risk of hemolysis.Details
Glucose-6-phosphate 1-dehydrogenaseSanta MariaNot Available376A->G / 542A->TADR InferredIncreased risk of hemolysis.Details
Glucose-6-phosphate 1-dehydrogenaseAnanindeuaNot Available376A->G / 871G->AADR InferredIncreased risk of hemolysis.Details
Glucose-6-phosphate 1-dehydrogenaseVanua LavaNot Available383T->CADR InferredIncreased risk of hemolysis.Details
Glucose-6-phosphate 1-dehydrogenaseValladolidNot Available406C->TADR InferredIncreased risk of hemolysis.Details
Glucose-6-phosphate 1-dehydrogenaseBelemNot Available409C->TADR InferredIncreased risk of hemolysis.Details
Glucose-6-phosphate 1-dehydrogenaseLiuzhouNot Available442G->AADR InferredIncreased risk of hemolysis.Details
Glucose-6-phosphate 1-dehydrogenaseShenzenNot Available473G>AADR InferredIncreased risk of hemolysis.Details
Glucose-6-phosphate 1-dehydrogenaseTaipei “Chinese- 3”Not Available493A->GADR InferredIncreased risk of hemolysis.Details
Glucose-6-phosphate 1-dehydrogenaseToledoNot Available496C>TADR InferredIncreased risk of hemolysis.Details
Glucose-6-phosphate 1-dehydrogenaseNaoneNot Available497G->AADR InferredIncreased risk of hemolysis.Details
Glucose-6-phosphate 1-dehydrogenaseNankangNot Available517T->CADR InferredIncreased risk of hemolysis.Details
Glucose-6-phosphate 1-dehydrogenaseMiaoliNot Available519C->GADR InferredIncreased risk of hemolysis.Details
Glucose-6-phosphate 1-dehydrogenaseMediterranean, Dallas, Panama‚ Sassari, Cagliari, BirminghamNot Available563C->TADR InferredIncreased risk of hemolysis.Details
Glucose-6-phosphate 1-dehydrogenaseCoimbra ShundeNot Available592C->TADR InferredIncreased risk of hemolysis.Details
Glucose-6-phosphate 1-dehydrogenaseNilgiriNot Available593G>AADR InferredIncreased risk of hemolysis.Details
Glucose-6-phosphate 1-dehydrogenaseRadlowoNot Available679C->TADR InferredIncreased risk of hemolysis.Details
Glucose-6-phosphate 1-dehydrogenaseRoubaixNot Available811G>CADR InferredIncreased risk of hemolysis.Details
Glucose-6-phosphate 1-dehydrogenaseHaikouNot Available835A->GADR InferredIncreased risk of hemolysis.Details
Glucose-6-phosphate 1-dehydrogenaseChinese-1Not Available835A->TADR InferredIncreased risk of hemolysis.Details
Glucose-6-phosphate 1-dehydrogenaseMizushimaNot Available848A>GADR InferredIncreased risk of hemolysis.Details
Glucose-6-phosphate 1-dehydrogenaseOsakaNot Available853C->TADR InferredIncreased risk of hemolysis.Details
Glucose-6-phosphate 1-dehydrogenaseViangchan, JammuNot Available871G->AADR InferredIncreased risk of hemolysis.Details
Glucose-6-phosphate 1-dehydrogenaseSeoulNot Available916G->AADR InferredIncreased risk of hemolysis.Details
Glucose-6-phosphate 1-dehydrogenaseLudhianaNot Available929G->AADR InferredIncreased risk of hemolysis.Details
Glucose-6-phosphate 1-dehydrogenaseFarroupilhaNot Available977C->AADR InferredIncreased risk of hemolysis.Details
Glucose-6-phosphate 1-dehydrogenaseChinese-5Not Available1024C->TADR InferredIncreased risk of hemolysis.Details
Glucose-6-phosphate 1-dehydrogenaseRignanoNot Available130G>AADR InferredIncreased risk of hemolysis.Details
Glucose-6-phosphate 1-dehydrogenaseOrissaNot Available131C->GADR InferredIncreased risk of hemolysis.Details
Glucose-6-phosphate 1-dehydrogenaseG6PDNiceNot Available1380G>CADR InferredIncreased risk of hemolysis.Details
Glucose-6-phosphate 1-dehydrogenaseKamiube, KeelungNot Available1387C->TADR InferredIncreased risk of hemolysis.Details
Glucose-6-phosphate 1-dehydrogenaseNeapolisNot Available1400C->GADR InferredIncreased risk of hemolysis.Details
Glucose-6-phosphate 1-dehydrogenaseAuresNot Available143T->CADR InferredIncreased risk of hemolysis.Details
Glucose-6-phosphate 1-dehydrogenaseSplitNot Available1442C->GADR InferredIncreased risk of hemolysis.Details
Glucose-6-phosphate 1-dehydrogenaseKambosNot Available148C->TADR InferredIncreased risk of hemolysis.Details
Glucose-6-phosphate 1-dehydrogenasePalestrinaNot Available170G>AADR InferredIncreased risk of hemolysis.Details
Glucose-6-phosphate 1-dehydrogenaseMetapontoNot Available172G->AADR InferredIncreased risk of hemolysis.Details
Glucose-6-phosphate 1-dehydrogenaseMusashinoNot Available185C->TADR InferredIncreased risk of hemolysis.Details
Glucose-6-phosphate 1-dehydrogenaseAsahiNot Available202G->AADR InferredIncreased risk of hemolysis.Details
Glucose-6-phosphate 1-dehydrogenaseA- (202), Ferrara INot Available202G->A / 376A->GADR InferredIncreased risk of hemolysis.Details
Glucose-6-phosphate 1-dehydrogenaseMurcia OristanoNot Available209A->GADR InferredIncreased risk of hemolysis.Details
Glucose-6-phosphate 1-dehydrogenaseUbe KonanNot Available241C->TADR InferredIncreased risk of hemolysis.Details
Glucose-6-phosphate 1-dehydrogenaseLagosantoNot Available242G->AADR InferredIncreased risk of hemolysis.Details
Glucose-6-phosphate 1-dehydrogenaseGuangzhouNot Available274C->TADR InferredIncreased risk of hemolysis.Details
Glucose-6-phosphate 1-dehydrogenaseHammersmithNot Available323T->AADR InferredIncreased risk of hemolysis.Details
Glucose-6-phosphate 1-dehydrogenaseSinnaiNot Available34G->TADR InferredIncreased risk of hemolysis.Details
Glucose-6-phosphate 1-dehydrogenaseA- (680)Not Available376A->G / 680G->TADR InferredIncreased risk of hemolysis.Details
Glucose-6-phosphate 1-dehydrogenaseA- (968), Betica,Selma, GuantanamoNot Available376A->G / 968T->CADR InferredIncreased risk of hemolysis.Details
Glucose-6-phosphate 1-dehydrogenaseSalerno PyrgosNot Available383T>GADR InferredIncreased risk of hemolysis.Details
Glucose-6-phosphate 1-dehydrogenaseQuing YanNot Available392G->TADR InferredIncreased risk of hemolysis.Details
Glucose-6-phosphate 1-dehydrogenaseLagesNot Available40G->AADR InferredIncreased risk of hemolysis.Details
Glucose-6-phosphate 1-dehydrogenaseIleshaNot Available466G->AADR InferredIncreased risk of hemolysis.Details
Glucose-6-phosphate 1-dehydrogenaseMahidolNot Available487G->AADR InferredIncreased risk of hemolysis.Details
Glucose-6-phosphate 1-dehydrogenaseMalagaNot Available542A->TADR InferredIncreased risk of hemolysis.Details
Glucose-6-phosphate 1-dehydrogenaseSibariNot Available634A->GADR InferredIncreased risk of hemolysis.Details
Glucose-6-phosphate 1-dehydrogenaseMexico CityNot Available680G->AADR InferredIncreased risk of hemolysis.Details
Glucose-6-phosphate 1-dehydrogenaseNanningNot Available703C->TADR InferredIncreased risk of hemolysis.Details
Glucose-6-phosphate 1-dehydrogenaseSeattle, Lodi, Modena, Ferrara II, Athens-likeNot Available844G->CADR InferredIncreased risk of hemolysis.Details
Glucose-6-phosphate 1-dehydrogenaseBajo MaumereNot Available844G->TADR InferredIncreased risk of hemolysis.Details
Glucose-6-phosphate 1-dehydrogenaseMontalbanoNot Available854G->AADR InferredIncreased risk of hemolysis.Details
Glucose-6-phosphate 1-dehydrogenaseKalyan-Kerala, Jamnaga, RohiniNot Available949G->AADR InferredIncreased risk of hemolysis.Details
Glucose-6-phosphate 1-dehydrogenaseGaoheNot Available95A->GADR InferredIncreased risk of hemolysis.Details


Drug Interactions
DrugInteractionDrug group
2,4-thiazolidinedione2,4-thiazolidinedione may increase the hypoglycemic activities of Quinine.Investigational
4-MethoxyamphetamineThe metabolism of 4-Methoxyamphetamine can be decreased when combined with Quinine.Experimental, Illicit
7,8-Dichloro-1,2,3,4-tetrahydroisoquinoline7,8-Dichloro-1,2,3,4-tetrahydroisoquinoline may increase the hypoglycemic activities of Quinine.Experimental
AbirateroneThe serum concentration of Quinine can be increased when it is combined with Abiraterone.Approved
AcarboseAcarbose may increase the hypoglycemic activities of Quinine.Approved, Investigational
AcebutololQuinine may increase the hypotensive activities of Acebutolol.Approved, Investigational
AceclofenacThe metabolism of Aceclofenac can be decreased when combined with Quinine.Approved, Investigational
AcenocoumarolQuinine may increase the anticoagulant activities of Acenocoumarol.Approved, Investigational
AcepromazineThe serum concentration of Acepromazine can be increased when it is combined with Quinine.Approved, Vet Approved
AceprometazineThe serum concentration of Aceprometazine can be increased when it is combined with Quinine.Approved
AcetaminophenThe metabolism of Acetaminophen can be decreased when combined with Quinine.Approved
AcetohexamideAcetohexamide may increase the hypoglycemic activities of Quinine.Approved, Investigational, Withdrawn
AcetylcholineThe metabolism of Acetylcholine can be decreased when combined with Quinine.Approved
Acetylsalicylic acidThe metabolism of Acetylsalicylic acid can be decreased when combined with Quinine.Approved, Vet Approved
AfatinibThe serum concentration of Afatinib can be increased when it is combined with Quinine.Approved
AICA ribonucleotideAICA ribonucleotide may increase the hypoglycemic activities of Quinine.Experimental, Investigational
AjmalineThe metabolism of Ajmaline can be decreased when combined with Quinine.Approved, Investigational
AlaproclateAlaproclate may increase the hypoglycemic activities of Quinine.Experimental
AlcuroniumQuinine may increase the neuromuscular blocking activities of Alcuronium.Experimental
AlfuzosinAlfuzosin may increase the QTc-prolonging activities of Quinine.Approved, Investigational
AlimemazineThe serum concentration of Alimemazine can be increased when it is combined with Quinine.Approved, Vet Approved
AliskirenQuinine may increase the hypotensive activities of Aliskiren.Approved, Investigational
AllicinAllicin may increase the hypoglycemic activities of Quinine.Investigational
AlmasilateThe serum concentration of Quinine can be increased when it is combined with Almasilate.Approved, Experimental
AlmotriptanThe metabolism of Almotriptan can be decreased when combined with Quinine.Approved, Investigational
AlogliptinThe metabolism of Alogliptin can be decreased when combined with Quinine.Approved
AloglutamolThe serum concentration of Quinine can be increased when it is combined with Aloglutamol.Experimental
AlosetronThe metabolism of Alosetron can be decreased when combined with Quinine.Approved, Withdrawn
AloxiprinAloxiprin may increase the hypoglycemic activities of Quinine.Experimental
AlprazolamThe metabolism of Alprazolam can be decreased when combined with Quinine.Approved, Illicit, Investigational
AlprenololThe metabolism of Alprenolol can be decreased when combined with Quinine.Approved, Withdrawn
AluminiumThe serum concentration of Quinine can be increased when it is combined with Aluminium.Approved, Investigational
Aluminium acetoacetateThe serum concentration of Quinine can be increased when it is combined with Aluminium acetoacetate.Experimental
Aluminium glycinateThe serum concentration of Quinine can be increased when it is combined with Aluminium glycinate.Experimental
Aluminum hydroxideThe serum concentration of Quinine can be increased when it is combined with Aluminum hydroxide.Approved, Investigational
AmantadineAmantadine may increase the QTc-prolonging activities of Quinine.Approved
AmbrisentanQuinine may increase the hypotensive activities of Ambrisentan.Approved, Investigational
Ambroxol acefyllinateThe serum concentration of Ambroxol acefyllinate can be increased when it is combined with Quinine.Experimental, Investigational
AminophenazoneThe metabolism of Aminophenazone can be decreased when combined with Quinine.Approved, Withdrawn
AminophyllineThe serum concentration of Aminophylline can be increased when it is combined with Quinine.Approved
Aminosalicylic AcidAminosalicylic Acid may increase the hypoglycemic activities of Quinine.Approved
AmiodaroneThe metabolism of Quinine can be decreased when combined with Amiodarone.Approved, Investigational
AmitriptylineAmitriptyline may increase the QTc-prolonging activities of Quinine.Approved
AmlodipineQuinine may increase the hypotensive activities of Amlodipine.Approved
AmodiaquineThe metabolism of Amodiaquine can be decreased when combined with Quinine.Approved, Investigational
AmodiaquineThe serum concentration of Amodiaquine can be increased when it is combined with Quinine.Approved, Investigational
AmoxapineAmoxapine may increase the QTc-prolonging activities of Quinine.Approved
AmphetamineThe metabolism of Amphetamine can be decreased when combined with Quinine.Approved, Illicit, Investigational
AmprenavirThe metabolism of Amprenavir can be decreased when combined with Quinine.Approved, Investigational
AmsacrineThe metabolism of Amsacrine can be decreased when combined with Quinine.Approved, Investigational
AnagrelideThe risk or severity of QTc prolongation can be increased when Anagrelide is combined with Quinine.Approved
AntipyrineThe metabolism of Antipyrine can be decreased when combined with Quinine.Approved, Investigational
ApalutamideThe serum concentration of Quinine can be decreased when it is combined with Apalutamide.Approved, Investigational
ApixabanThe metabolism of Apixaban can be decreased when combined with Quinine.Approved
ApomorphineApomorphine may increase the QTc-prolonging activities of Quinine.Approved, Investigational
AprepitantThe serum concentration of Quinine can be increased when it is combined with Aprepitant.Approved, Investigational
AprindineThe metabolism of Aprindine can be decreased when combined with Quinine.Approved
Arachidonic AcidThe metabolism of Arachidonic Acid can be decreased when combined with Quinine.Experimental
ArformoterolArformoterol may increase the QTc-prolonging activities of Quinine.Approved, Investigational
AripiprazoleThe serum concentration of Aripiprazole can be decreased when it is combined with Quinine.Approved, Investigational
ArmodafinilThe metabolism of Quinine can be decreased when combined with Armodafinil.Approved, Investigational
Arsenic trioxideThe risk or severity of QTc prolongation can be increased when Quinine is combined with Arsenic trioxide.Approved, Investigational
ArtemetherThe risk or severity of QTc prolongation can be increased when Quinine is combined with Artemether.Approved
AsenapineThe risk or severity of QTc prolongation can be increased when Quinine is combined with Asenapine.Approved
AstemizoleThe metabolism of Astemizole can be decreased when combined with Quinine.Approved, Withdrawn
AtazanavirThe metabolism of Quinine can be decreased when combined with Atazanavir.Approved, Investigational
AtenololQuinine may increase the hypotensive activities of Atenolol.Approved
AtomoxetineAtomoxetine may increase the QTc-prolonging activities of Quinine.Approved
AtorvastatinThe serum concentration of Atorvastatin can be increased when it is combined with Quinine.Approved
AtracuriumQuinine may increase the neuromuscular blocking activities of Atracurium.Approved, Experimental, Investigational
Atracurium besylateQuinine may increase the neuromuscular blocking activities of Atracurium besylate.Approved
AzelastineThe metabolism of Azelastine can be decreased when combined with Quinine.Approved
AzithromycinThe serum concentration of Quinine can be increased when it is combined with Azithromycin.Approved
BalaglitazoneBalaglitazone may increase the hypoglycemic activities of Quinine.Investigational
BalsalazideBalsalazide may increase the hypoglycemic activities of Quinine.Approved, Investigational
BedaquilineBedaquiline may increase the QTc-prolonging activities of Quinine.Approved
Bempedoic acidBempedoic acid may increase the hypoglycemic activities of Quinine.Investigational
BenazeprilQuinine may increase the hypotensive activities of Benazepril.Approved, Investigational
BendroflumethiazideQuinine may increase the hypotensive activities of Bendroflumethiazide.Approved
BenmoxinBenmoxin may increase the hypoglycemic activities of Quinine.Withdrawn
BenzatropineThe metabolism of Benzatropine can be decreased when combined with Quinine.Approved
Benzyl alcoholThe metabolism of Benzyl alcohol can be decreased when combined with Quinine.Approved
BepridilThe metabolism of Bepridil can be decreased when combined with Quinine.Approved, Withdrawn
BeraprostThe metabolism of Beraprost can be decreased when combined with Quinine.Investigational
BetaxololThe metabolism of Betaxolol can be decreased when combined with Quinine.Approved, Investigational
BethanidineQuinine may increase the hypotensive activities of Bethanidine.Approved
BexaroteneThe metabolism of Bexarotene can be decreased when combined with Quinine.Approved, Investigational
BietaserpineQuinine may increase the hypotensive activities of Bietaserpine.Experimental
BimatoprostQuinine may increase the hypotensive activities of Bimatoprost.Approved, Investigational
Bismuth SubcitrateThe serum concentration of Quinine can be increased when it is combined with Bismuth Subcitrate.Approved, Investigational
Bismuth subnitrateThe serum concentration of Quinine can be increased when it is combined with Bismuth subnitrate.Approved, Experimental
BisoprololThe metabolism of Bisoprolol can be decreased when combined with Quinine.Approved
BL-1020The serum concentration of BL-1020 can be increased when it is combined with Quinine.Investigational
BoceprevirThe metabolism of Quinine can be decreased when combined with Boceprevir.Approved, Withdrawn
BortezomibBortezomib may increase the QTc-prolonging activities of Quinine.Approved, Investigational
BosentanThe serum concentration of Bosentan can be increased when it is combined with Quinine.Approved, Investigational
BosutinibThe serum concentration of Bosutinib can be increased when it is combined with Quinine.Approved
BQ-123Quinine may increase the hypotensive activities of BQ-123.Investigational
Brentuximab vedotinThe serum concentration of Brentuximab vedotin can be increased when it is combined with Quinine.Approved
BretyliumQuinine may increase the hypotensive activities of Bretylium.Approved
BrexpiprazoleThe serum concentration of Brexpiprazole can be increased when it is combined with Quinine.Approved, Investigational
BrigatinibThe metabolism of Brigatinib can be decreased when combined with Quinine.Approved, Investigational
BrimonidineQuinine may increase the hypotensive activities of Brimonidine.Approved
BrivaracetamThe metabolism of Brivaracetam can be decreased when combined with Quinine.Approved, Investigational
BrofaromineBrofaromine may increase the hypoglycemic activities of Quinine.Experimental
BromocriptineThe risk or severity of adverse effects can be increased when Bromocriptine is combined with Quinine.Approved, Investigational
BrompheniramineThe metabolism of Brompheniramine can be decreased when combined with Quinine.Approved
BuforminBuformin may increase the hypoglycemic activities of Quinine.Investigational, Withdrawn
BufuralolThe metabolism of Bufuralol can be decreased when combined with Quinine.Experimental, Investigational
BupivacaineThe metabolism of Bupivacaine can be decreased when combined with Quinine.Approved, Investigational
BupranololQuinine may increase the hypotensive activities of Bupranolol.Approved
BuprenorphineThe metabolism of Buprenorphine can be decreased when combined with Quinine.Approved, Illicit, Investigational, Vet Approved
BupropionThe metabolism of Quinine can be decreased when combined with Bupropion.Approved
BuserelinBuserelin may increase the QTc-prolonging activities of Quinine.Approved, Investigational
BuspironeThe metabolism of Buspirone can be decreased when combined with Quinine.Approved, Investigational
CabazitaxelThe metabolism of Cabazitaxel can be decreased when combined with Quinine.Approved
CabergolineThe risk or severity of adverse effects can be increased when Cabergoline is combined with Quinine.Approved
CabozantinibThe metabolism of Cabozantinib can be decreased when combined with Quinine.Approved, Investigational
CadralazineQuinine may increase the hypotensive activities of Cadralazine.Experimental
CafedrineQuinine may increase the hypotensive activities of Cafedrine.Investigational
CaffeineThe metabolism of Quinine can be decreased when combined with Caffeine.Approved
Calcium CarbonateThe serum concentration of Quinine can be increased when it is combined with Calcium Carbonate.Approved, Investigational
Calcium silicateThe serum concentration of Quinine can be increased when it is combined with Calcium silicate.Experimental
CanagliflozinCanagliflozin may increase the hypoglycemic activities of Quinine.Approved
CandesartanThe metabolism of Candesartan can be decreased when combined with Quinine.Experimental
Candesartan cilexetilThe metabolism of Candesartan cilexetil can be decreased when combined with Quinine.Approved
CandoxatrilQuinine may increase the hypotensive activities of Candoxatril.Experimental
CannabidiolThe metabolism of Cannabidiol can be decreased when combined with Quinine.Approved, Investigational
CapecitabineThe metabolism of Quinine can be decreased when combined with Capecitabine.Approved, Investigational
CaptoprilThe metabolism of Captopril can be decreased when combined with Quinine.Approved
CarbamazepineThe serum concentration of Quinine can be decreased when it is combined with Carbamazepine.Approved, Investigational
Carbaspirin calciumCarbaspirin calcium may increase the hypoglycemic activities of Quinine.Experimental, Investigational
CarbinoxamineThe metabolism of Carbinoxamine can be decreased when combined with Quinine.Approved
CarbomycinThe serum concentration of Quinine can be increased when it is combined with Carbomycin.Vet Approved
CarbutamideCarbutamide may increase the hypoglycemic activities of Quinine.Experimental
CariprazineThe metabolism of Cariprazine can be decreased when combined with Quinine.Approved, Investigational
CaroxazoneCaroxazone may increase the hypoglycemic activities of Quinine.Withdrawn
CarteololThe metabolism of Carteolol can be decreased when combined with Quinine.Approved
CarvedilolThe serum concentration of Carvedilol can be increased when it is combined with Quinine.Approved, Investigational
CastanospermineCastanospermine may increase the hypoglycemic activities of Quinine.Experimental
CelecoxibThe metabolism of Quinine can be decreased when combined with Celecoxib.Approved, Investigational
CeliprololQuinine may increase the hypotensive activities of Celiprolol.Approved, Investigational
CephalexinThe metabolism of Cephalexin can be decreased when combined with Quinine.Approved, Investigational, Vet Approved
CeritinibThe serum concentration of Quinine can be increased when it is combined with Ceritinib.Approved
CerivastatinThe metabolism of Cerivastatin can be decreased when combined with Quinine.Approved, Withdrawn
CevimelineThe metabolism of Cevimeline can be decreased when combined with Quinine.Approved
ChloramphenicolThe metabolism of Quinine can be decreased when combined with Chloramphenicol.Approved, Vet Approved
ChlordiazepoxideThe metabolism of Chlordiazepoxide can be decreased when combined with Quinine.Approved, Illicit, Investigational
ChloroquineThe metabolism of Chloroquine can be decreased when combined with Quinine.Approved, Investigational, Vet Approved
ChlorothiazideQuinine may increase the hypotensive activities of Chlorothiazide.Approved, Vet Approved
ChlorphenamineThe metabolism of Chlorphenamine can be decreased when combined with Quinine.Approved
ChlorproethazineThe serum concentration of Chlorproethazine can be increased when it is combined with Quinine.Experimental
ChlorpromazineThe serum concentration of Chlorpromazine can be increased when it is combined with Quinine.Approved, Investigational, Vet Approved
ChlorpropamideThe metabolism of Chlorpropamide can be decreased when combined with Quinine.Approved, Investigational
ChlorthalidoneQuinine may increase the hypotensive activities of Chlorthalidone.Approved
ChlorzoxazoneThe metabolism of Chlorzoxazone can be decreased when combined with Quinine.Approved
CholecalciferolThe metabolism of Quinine can be decreased when combined with Cholecalciferol.Approved, Nutraceutical
CicletanineQuinine may increase the hypotensive activities of Cicletanine.Investigational
CiglitazoneCiglitazone may increase the hypoglycemic activities of Quinine.Experimental
CilazaprilQuinine may increase the hypotensive activities of Cilazapril.Approved
CilostazolThe serum concentration of Cilostazol can be increased when it is combined with Quinine.Approved, Investigational
CimetidineThe serum concentration of Quinine can be increased when it is combined with Cimetidine.Approved, Investigational
CinacalcetThe metabolism of Quinine can be decreased when combined with Cinacalcet.Approved
CinnarizineThe metabolism of Cinnarizine can be decreased when combined with Quinine.Approved, Investigational
CinoxacinCinoxacin may increase the hypoglycemic activities of Quinine.Approved, Investigational, Withdrawn
CiprofloxacinCiprofloxacin may increase the QTc-prolonging activities of Quinine.Approved, Investigational
CisaprideThe metabolism of Cisapride can be decreased when combined with Quinine.Approved, Investigational, Withdrawn
CisatracuriumQuinine may increase the neuromuscular blocking activities of Cisatracurium.Approved, Experimental
Cisatracurium besylateQuinine may increase the neuromuscular blocking activities of Cisatracurium besylate.Approved
CitalopramThe metabolism of Quinine can be decreased when combined with Citalopram.Approved
ClarithromycinThe serum concentration of Quinine can be increased when it is combined with Clarithromycin.Approved
ClemastineThe metabolism of Quinine can be decreased when combined with Clemastine.Approved, Investigational
ClevidipineThe metabolism of Clevidipine can be decreased when combined with Quinine.Approved, Investigational
ClobazamThe metabolism of Quinine can be decreased when combined with Clobazam.Approved, Illicit
ClomipramineClomipramine may increase the QTc-prolonging activities of Quinine.Approved, Investigational, Vet Approved
ClonidineThe metabolism of Clonidine can be decreased when combined with Quinine.Approved
ClopidogrelThe metabolism of Clopidogrel can be decreased when combined with Quinine.Approved
CloranololQuinine may increase the hypotensive activities of Cloranolol.Experimental
ClorindioneQuinine may increase the anticoagulant activities of Clorindione.Experimental
ClotrimazoleThe metabolism of Quinine can be decreased when combined with Clotrimazole.Approved, Vet Approved
ClozapineThe metabolism of Quinine can be decreased when combined with Clozapine.Approved
CobicistatThe serum concentration of Quinine can be increased when it is combined with Cobicistat.Approved
CocaineThe metabolism of Quinine can be decreased when combined with Cocaine.Approved, Illicit
CodeineThe therapeutic efficacy of Codeine can be decreased when used in combination with Quinine.Approved, Illicit
ColchicineThe serum concentration of Colchicine can be increased when it is combined with Quinine.Approved
ConivaptanThe serum concentration of Conivaptan can be increased when it is combined with Quinine.Approved, Investigational
CrisaboroleThe metabolism of Quinine can be decreased when combined with Crisaborole.Approved, Investigational
CrizotinibThe metabolism of Quinine can be decreased when combined with Crizotinib.Approved
CryptenamineQuinine may increase the hypotensive activities of Cryptenamine.Approved
CyclobenzaprineThe metabolism of Cyclobenzaprine can be decreased when combined with Quinine.Approved
CyclopenthiazideQuinine may increase the hypotensive activities of Cyclopenthiazide.Experimental
CyclophosphamideThe metabolism of Cyclophosphamide can be decreased when combined with Quinine.Approved, Investigational
CyclosporineThe metabolism of Quinine can be decreased when combined with Cyclosporine.Approved, Investigational, Vet Approved
CyclothiazideQuinine may increase the hypotensive activities of Cyclothiazide.Approved
Cyproterone acetateThe serum concentration of Quinine can be decreased when it is combined with Cyproterone acetate.Approved, Investigational
Dabigatran etexilateThe serum concentration of the active metabolites of Dabigatran etexilate can be increased when Dabigatran etexilate is used in combination with Quinine.Approved
DabrafenibThe serum concentration of Quinine can be decreased when it is combined with Dabrafenib.Approved, Investigational
DapagliflozinThe metabolism of Dapagliflozin can be decreased when combined with Quinine.Approved
DapoxetineDapoxetine may increase the hypoglycemic activities of Quinine.Investigational
DapsoneThe risk or severity of adverse effects can be increased when Quinine is combined with Dapsone.Approved, Investigational
DarifenacinThe metabolism of Quinine can be decreased when combined with Darifenacin.Approved, Investigational
DarunavirThe serum concentration of Quinine can be increased when it is combined with Darunavir.Approved
DasabuvirThe metabolism of Dasabuvir can be decreased when combined with Quinine.Approved
DasatinibThe serum concentration of Quinine can be increased when it is combined with Dasatinib.Approved, Investigational
DebrisoquinThe metabolism of Debrisoquin can be decreased when combined with Quinine.Approved, Investigational
DecamethoniumQuinine may increase the neuromuscular blocking activities of Decamethonium.Approved
DeferasiroxThe serum concentration of Quinine can be decreased when it is combined with Deferasirox.Approved, Investigational
DegarelixDegarelix may increase the QTc-prolonging activities of Quinine.Approved
DelaprilQuinine may increase the hypotensive activities of Delapril.Experimental
DelavirdineThe metabolism of Quinine can be decreased when combined with Delavirdine.Approved
DeoxyspergualinDeoxyspergualin may increase the hypoglycemic activities of Quinine.Investigational
DersalazineDersalazine may increase the hypoglycemic activities of Quinine.Investigational
DeserpidineQuinine may increase the hypotensive activities of Deserpidine.Approved
DesfluraneDesflurane may increase the QTc-prolonging activities of Quinine.Approved
DesipramineDesipramine may increase the QTc-prolonging activities of Quinine.Approved, Investigational
DesvenlafaxineDesvenlafaxine may increase the hypoglycemic activities of Quinine.Approved, Investigational
DeutetrabenazineThe metabolism of Deutetrabenazine can be decreased when combined with Quinine.Approved, Investigational
Dexchlorpheniramine maleateThe metabolism of Dexchlorpheniramine maleate can be decreased when combined with Quinine.Approved
DexfenfluramineThe metabolism of Dexfenfluramine can be decreased when combined with Quinine.Approved, Illicit, Investigational, Withdrawn
DexmethylphenidateThe metabolism of Dexmethylphenidate can be decreased when combined with Quinine.Approved, Investigational
DextroamphetamineThe metabolism of Dextroamphetamine can be decreased when combined with Quinine.Approved, Illicit
DextromethorphanThe metabolism of Dextromethorphan can be decreased when combined with Quinine.Approved
DiazepamThe metabolism of Diazepam can be decreased when combined with Quinine.Approved, Illicit, Investigational, Vet Approved
DiazoxideQuinine may increase the hypotensive activities of Diazoxide.Approved
DiclofenacThe metabolism of Diclofenac can be decreased when combined with Quinine.Approved, Vet Approved
DicoumarolQuinine may increase the anticoagulant activities of Dicoumarol.Approved
DiethylnorspermineQuinine may increase the hypotensive activities of Diethylnorspermine.Investigational
DiflunisalDiflunisal may increase the hypoglycemic activities of Quinine.Approved, Investigational
DigoxinThe serum concentration of Digoxin can be increased when it is combined with Quinine.Approved
DihydralazineQuinine may increase the hypotensive activities of Dihydralazine.Approved, Investigational
DihydrocodeineThe metabolism of Dihydrocodeine can be decreased when combined with Quinine.Approved, Illicit
DihydroergocornineThe risk or severity of adverse effects can be increased when Dihydroergocornine is combined with Quinine.Approved
DihydroergocristineThe risk or severity of adverse effects can be increased when Dihydroergocristine is combined with Quinine.Approved, Experimental
DihydroergocryptineThe risk or severity of adverse effects can be increased when Dihydroergocryptine is combined with Quinine.Experimental
DihydroergotamineThe metabolism of Quinine can be decreased when combined with Dihydroergotamine.Approved, Investigational
DiltiazemThe metabolism of Quinine can be decreased when combined with Diltiazem.Approved, Investigational
DiphenadioneQuinine may increase the anticoagulant activities of Diphenadione.Experimental
DiphenhydramineDiphenhydramine may increase the QTc-prolonging activities of Quinine.Approved, Investigational
DisopyramideDisopyramide may increase the hypoglycemic activities of Quinine.Approved
DoconexentThe metabolism of Doconexent can be decreased when combined with Quinine.Approved, Investigational
DofetilideThe risk or severity of QTc prolongation can be increased when Dofetilide is combined with Quinine.Approved, Investigational
DolasetronThe metabolism of Dolasetron can be decreased when combined with Quinine.Approved, Investigational
Domoic AcidQuinine may increase the neuromuscular blocking activities of Domoic Acid.Experimental
DomperidoneThe metabolism of Domperidone can be decreased when combined with Quinine.Approved, Investigational, Vet Approved
DonepezilThe metabolism of Donepezil can be decreased when combined with Quinine.Approved
DopamineThe metabolism of Dopamine can be decreased when combined with Quinine.Approved
DorzolamideThe metabolism of Dorzolamide can be decreased when combined with Quinine.Approved
DosulepinThe metabolism of Quinine can be decreased when combined with Dosulepin.Approved
Doxacurium chlorideQuinine may increase the neuromuscular blocking activities of Doxacurium chloride.Approved
DoxazosinThe metabolism of Doxazosin can be decreased when combined with Quinine.Approved
DoxepinDoxepin may increase the QTc-prolonging activities of Quinine.Approved, Investigational
DoxorubicinThe serum concentration of Doxorubicin can be increased when it is combined with Quinine.Approved, Investigational
DoxorubicinThe metabolism of Doxorubicin can be decreased when combined with Quinine.Approved, Investigational
DoxycyclineThe metabolism of Quinine can be decreased when combined with Doxycycline.Approved, Investigational, Vet Approved
DronabinolThe serum concentration of Dronabinol can be increased when it is combined with Quinine.Approved, Illicit
DronedaroneThe metabolism of Quinine can be decreased when combined with Dronedarone.Approved
DroperidolDroperidol may increase the QTc-prolonging activities of Quinine.Approved, Vet Approved
DulaglutideDulaglutide may increase the hypoglycemic activities of Quinine.Approved, Investigational
DuloxetineThe metabolism of Quinine can be decreased when combined with Duloxetine.Approved
DyphyllineThe serum concentration of Dyphylline can be increased when it is combined with Quinine.Approved
EdoxabanThe serum concentration of Edoxaban can be increased when it is combined with Quinine.Approved
EfavirenzThe metabolism of Quinine can be decreased when combined with Efavirenz.Approved, Investigational
EfonidipineQuinine may increase the hypotensive activities of Efonidipine.Approved, Investigational
EletriptanThe metabolism of Eletriptan can be decreased when combined with Quinine.Approved, Investigational
EliglustatThe serum concentration of Eliglustat can be increased when it is combined with Quinine.Approved
EltrombopagThe metabolism of Eltrombopag can be decreased when combined with Quinine.Approved
EmpagliflozinEmpagliflozin may increase the hypoglycemic activities of Quinine.Approved
EnalaprilQuinine may increase the hypotensive activities of Enalapril.Approved, Vet Approved
EnalaprilatQuinine may increase the hypotensive activities of Enalaprilat.Approved
EnasidenibThe metabolism of Enasidenib can be decreased when combined with Quinine.Approved, Investigational
EncainideThe metabolism of Encainide can be decreased when combined with Quinine.Approved, Investigational, Withdrawn
EnclomipheneThe metabolism of Enclomiphene can be decreased when combined with Quinine.Investigational
EndralazineQuinine may increase the hypotensive activities of Endralazine.Experimental
EnoxacinEnoxacin may increase the hypoglycemic activities of Quinine.Approved, Investigational
EnzalutamideThe serum concentration of Quinine can be decreased when it is combined with Enzalutamide.Approved
EpanololQuinine may increase the hypotensive activities of Epanolol.Experimental
EpinastineThe metabolism of Epinastine can be decreased when combined with Quinine.Approved, Investigational
EpoprostenolThe metabolism of Epoprostenol can be decreased when combined with Quinine.Approved
EprosartanQuinine may increase the hypotensive activities of Eprosartan.Approved
ErgonovineThe risk or severity of adverse effects can be increased when Ergonovine is combined with Quinine.Approved
ErgotamineThe risk or severity of adverse effects can be increased when Ergotamine is combined with Quinine.Approved
EribulinEribulin may increase the QTc-prolonging activities of Quinine.Approved, Investigational
ErlotinibThe metabolism of Erlotinib can be decreased when combined with Quinine.Approved, Investigational
ErythromycinThe serum concentration of Quinine can be increased when it is combined with Erythromycin.Approved, Investigational, Vet Approved
EscitalopramThe metabolism of Escitalopram can be decreased when combined with Quinine.Approved, Investigational
Eslicarbazepine acetateThe metabolism of Quinine can be decreased when combined with Eslicarbazepine acetate.Approved
EsmirtazapineThe metabolism of Esmirtazapine can be decreased when combined with Quinine.Investigational
EsomeprazoleThe metabolism of Quinine can be decreased when combined with Esomeprazole.Approved, Investigational
EstradiolThe metabolism of Estradiol can be decreased when combined with Quinine.Approved, Investigational, Vet Approved
Estradiol acetateThe metabolism of Estradiol acetate can be decreased when combined with Quinine.Approved, Investigational, Vet Approved
Estradiol benzoateThe metabolism of Estradiol benzoate can be decreased when combined with Quinine.Approved, Investigational, Vet Approved
Estradiol cypionateThe metabolism of Estradiol cypionate can be decreased when combined with Quinine.Approved, Investigational, Vet Approved
Estradiol dienanthateThe metabolism of Estradiol dienanthate can be decreased when combined with Quinine.Approved, Investigational, Vet Approved
Estradiol valerateThe metabolism of Estradiol valerate can be decreased when combined with Quinine.Approved, Investigational, Vet Approved
EstroneThe metabolism of Estrone can be decreased when combined with Quinine.Approved
EszopicloneThe metabolism of Eszopiclone can be decreased when combined with Quinine.Approved, Investigational
Ethyl biscoumacetateQuinine may increase the anticoagulant activities of Ethyl biscoumacetate.Withdrawn
EthylmorphineThe metabolism of Ethylmorphine can be decreased when combined with Quinine.Approved, Illicit
EtodolacThe metabolism of Etodolac can be decreased when combined with Quinine.Approved, Investigational, Vet Approved
EtoperidoneEtoperidone may increase the hypoglycemic activities of Quinine.Withdrawn
EtoricoxibThe metabolism of Etoricoxib can be decreased when combined with Quinine.Approved, Investigational
EtravirineThe metabolism of Quinine can be decreased when combined with Etravirine.Approved
EverolimusThe serum concentration of Everolimus can be increased when it is combined with Quinine.Approved
ExenatideExenatide may increase the hypoglycemic activities of Quinine.Approved, Investigational
EzogabineEzogabine may increase the QTc-prolonging activities of Quinine.Approved, Investigational
FamotidineFamotidine may increase the QTc-prolonging activities of Quinine.Approved
FelbamateFelbamate may increase the QTc-prolonging activities of Quinine.Approved
FelodipineThe metabolism of Quinine can be decreased when combined with Felodipine.Approved, Investigational
FenoldopamQuinine may increase the hypotensive activities of Fenoldopam.Approved
Ferulic acidQuinine may increase the hypotensive activities of Ferulic acid.Experimental
FesoterodineThe serum concentration of the active metabolites of Fesoterodine can be increased when Fesoterodine is used in combination with Quinine.Approved
FingolimodFingolimod may increase the QTc-prolonging activities of Quinine.Approved, Investigational
FlecainideThe metabolism of Flecainide can be decreased when combined with Quinine.Approved, Withdrawn
FleroxacinFleroxacin may increase the hypoglycemic activities of Quinine.Approved
FloxuridineThe metabolism of Quinine can be decreased when combined with Floxuridine.Approved
FluconazoleThe metabolism of Quinine can be decreased when combined with Fluconazole.Approved, Investigational
FluindioneQuinine may increase the anticoagulant activities of Fluindione.Approved, Investigational
FlumequineFlumequine may increase the hypoglycemic activities of Quinine.Withdrawn
FlunarizineThe metabolism of Flunarizine can be decreased when combined with Quinine.Approved
FlunitrazepamThe metabolism of Flunitrazepam can be decreased when combined with Quinine.Approved, Illicit
FluorouracilThe metabolism of Quinine can be decreased when combined with Fluorouracil.Approved
FluoxetineThe metabolism of Quinine can be decreased when combined with Fluoxetine.Approved, Vet Approved
FluoxymesteroneFluoxymesterone may increase the hypoglycemic activities of Quinine.Approved, Illicit
FlupentixolThe risk or severity of QTc prolongation can be increased when Quinine is combined with Flupentixol.Approved, Investigational, Withdrawn
FluphenazineThe serum concentration of Fluphenazine can be increased when it is combined with Quinine.Approved
FlurbiprofenThe metabolism of Flurbiprofen can be decreased when combined with Quinine.Approved, Investigational
FluvastatinThe metabolism of Fluvastatin can be decreased when combined with Quinine.Approved
FluvoxamineThe metabolism of Quinine can be decreased when combined with Fluvoxamine.Approved, Investigational
FormoterolFormoterol may increase the QTc-prolonging activities of Quinine.Approved, Investigational
FosamprenavirThe metabolism of Quinine can be decreased when combined with Fosamprenavir.Approved
FosaprepitantThe serum concentration of Quinine can be increased when it is combined with Fosaprepitant.Approved
FoscarnetFoscarnet may increase the QTc-prolonging activities of Quinine.Approved
FosinoprilQuinine may increase the hypotensive activities of Fosinopril.Approved
FosphenytoinThe serum concentration of Quinine can be decreased when it is combined with Fosphenytoin.Approved, Investigational
FurazolidoneFurazolidone may increase the hypoglycemic activities of Quinine.Approved, Investigational, Vet Approved
Fusidic AcidThe serum concentration of Quinine can be increased when it is combined with Fusidic Acid.Approved, Investigational
Gadobenic acidGadobenic acid may increase the QTc-prolonging activities of Quinine.Approved, Investigational
GalantamineGalantamine may increase the QTc-prolonging activities of Quinine.Approved
GallamineQuinine may increase the neuromuscular blocking activities of Gallamine.Experimental
Gallamine TriethiodideQuinine may increase the neuromuscular blocking activities of Gallamine Triethiodide.Approved
GarenoxacinGarenoxacin may increase the hypoglycemic activities of Quinine.Investigational
GatifloxacinGatifloxacin may increase the hypoglycemic activities of Quinine.Approved, Investigational
GavestinelThe metabolism of Gavestinel can be decreased when combined with Quinine.Investigational
GefitinibThe metabolism of Gefitinib can be decreased when combined with Quinine.Approved, Investigational
GemfibrozilThe metabolism of Quinine can be decreased when combined with Gemfibrozil.Approved
GemifloxacinGemifloxacin may increase the hypoglycemic activities of Quinine.Approved, Investigational
GlibornurideGlibornuride may increase the hypoglycemic activities of Quinine.Investigational, Withdrawn
GliclazideThe metabolism of Gliclazide can be decreased when combined with Quinine.Approved
GlimepirideThe metabolism of Glimepiride can be decreased when combined with Quinine.Approved
GlipizideThe metabolism of Glipizide can be decreased when combined with Quinine.Approved, Investigational
GliquidoneGliquidone may increase the hypoglycemic activities of Quinine.Approved, Investigational
GLPG-0492GLPG-0492 may increase the hypoglycemic activities of Quinine.Investigational
GlyburideThe metabolism of Glyburide can be decreased when combined with Quinine.Approved
GoserelinGoserelin may increase the QTc-prolonging activities of Quinine.Approved
GranisetronThe metabolism of Granisetron can be decreased when combined with Quinine.Approved, Investigational
GrepafloxacinGrepafloxacin may increase the hypoglycemic activities of Quinine.Approved, Investigational, Withdrawn
GuacetisalGuacetisal may increase the hypoglycemic activities of Quinine.Experimental
GuanabenzQuinine may increase the hypotensive activities of Guanabenz.Approved, Investigational
GuanadrelQuinine may increase the hypotensive activities of Guanadrel.Approved
GuanazodineQuinine may increase the hypotensive activities of Guanazodine.Experimental
GuanethidineQuinine may increase the hypotensive activities of Guanethidine.Approved
GuanfacineThe metabolism of Guanfacine can be decreased when combined with Quinine.Approved, Investigational
GuanoclorQuinine may increase the hypotensive activities of Guanoclor.Experimental
GuanoxabenzQuinine may increase the hypotensive activities of Guanoxabenz.Experimental
GuanoxanQuinine may increase the hypotensive activities of Guanoxan.Experimental
GusperimusGusperimus may increase the hypoglycemic activities of Quinine.Investigational
HalofantrineThe risk or severity of adverse effects can be increased when Quinine is combined with Halofantrine.Approved
HaloperidolThe metabolism of Quinine can be decreased when combined with Haloperidol.Approved
HalothaneThe metabolism of Halothane can be decreased when combined with Quinine.Approved, Vet Approved
HarmalineHarmaline may increase the hypoglycemic activities of Quinine.Experimental
Hemoglobin crosfumarilHemoglobin crosfumaril may increase the hypoglycemic activities of Quinine.Experimental
HexamethoniumQuinine may increase the hypotensive activities of Hexamethonium.Experimental
HexobarbitalThe metabolism of Hexobarbital can be decreased when combined with Quinine.Approved
HistamineThe metabolism of Histamine can be decreased when combined with Quinine.Approved, Investigational
HistrelinHistrelin may increase the QTc-prolonging activities of Quinine.Approved
HydracarbazineHydracarbazine may increase the hypoglycemic activities of Quinine.Experimental
HydralazineQuinine may increase the hypotensive activities of Hydralazine.Approved
HydrochlorothiazideQuinine may increase the hypotensive activities of Hydrochlorothiazide.Approved, Vet Approved
HydrocodoneThe metabolism of Hydrocodone can be decreased when combined with Quinine.Approved, Illicit
HydroflumethiazideQuinine may increase the hypotensive activities of Hydroflumethiazide.Approved, Investigational
HydromorphoneThe metabolism of Hydromorphone can be decreased when combined with Quinine.Approved, Illicit
HydrotalciteThe serum concentration of Quinine can be increased when it is combined with Hydrotalcite.Approved, Experimental, Investigational
HydroxyzineHydroxyzine may increase the QTc-prolonging activities of Quinine.Approved
IbandronateIbandronate may increase the QTc-prolonging activities of Quinine.Approved, Investigational
IbrutinibThe serum concentration of Ibrutinib can be increased when it is combined with Quinine.Approved
IbuprofenThe metabolism of Ibuprofen can be decreased when combined with Quinine.Approved
IbutilideThe risk or severity of QTc prolongation can be increased when Ibutilide is combined with Quinine.Approved
IdarubicinThe metabolism of Idarubicin can be decreased when combined with Quinine.Approved
IdelalisibThe metabolism of Quinine can be decreased when combined with Idelalisib.Approved
IfosfamideThe metabolism of Ifosfamide can be decreased when combined with Quinine.Approved
IloperidoneThe metabolism of Iloperidone can be decreased when combined with Quinine.Approved
ImatinibThe metabolism of Quinine can be decreased when combined with Imatinib.Approved
ImidaprilQuinine may increase the hypotensive activities of Imidapril.Investigational
ImipramineImipramine may increase the QTc-prolonging activities of Quinine.Approved
IndacaterolIndacaterol may increase the QTc-prolonging activities of Quinine.Approved
IndalpineIndalpine may increase the hypoglycemic activities of Quinine.Investigational, Withdrawn
IndapamideIndapamide may increase the QTc-prolonging activities of Quinine.Approved
IndenololQuinine may increase the hypotensive activities of Indenolol.Withdrawn
IndinavirThe metabolism of Quinine can be decreased when combined with Indinavir.Approved
IndisulamThe metabolism of Indisulam can be decreased when combined with Quinine.Investigational
IndomethacinThe metabolism of Indomethacin can be decreased when combined with Quinine.Approved, Investigational
IndoraminQuinine may increase the hypotensive activities of Indoramin.Withdrawn
Insulin AspartQuinine may increase the hypoglycemic activities of Insulin Aspart.Approved
Insulin DetemirQuinine may increase the hypoglycemic activities of Insulin Detemir.Approved
Insulin GlargineInsulin Glargine may increase the hypoglycemic activities of Quinine.Approved
Insulin GlulisineQuinine may increase the hypoglycemic activities of Insulin Glulisine.Approved
Insulin HumanInsulin Human may increase the hypoglycemic activities of Quinine.Approved, Investigational
Insulin LisproInsulin Lispro may increase the hypoglycemic activities of Quinine.Approved
Insulin PorkInsulin Pork may increase the hypoglycemic activities of Quinine.Approved
Ipratropium bromideThe metabolism of Ipratropium bromide can be decreased when combined with Quinine.Approved
IproclozideIproclozide may increase the hypoglycemic activities of Quinine.Withdrawn
IproniazidIproniazid may increase the hypoglycemic activities of Quinine.Withdrawn
IrbesartanThe metabolism of Quinine can be decreased when combined with Irbesartan.Approved, Investigational
IsavuconazoniumThe metabolism of Quinine can be decreased when combined with Isavuconazonium.Approved, Investigational
IsocarboxazidIsocarboxazid may increase the hypoglycemic activities of Quinine.Approved
IsofluraneIsoflurane may increase the QTc-prolonging activities of Quinine.Approved, Vet Approved
IsoniazidThe metabolism of Quinine can be decreased when combined with Isoniazid.Approved, Investigational
IsradipineIsradipine may increase the QTc-prolonging activities of Quinine.Approved, Investigational
ItraconazoleThe metabolism of Quinine can be decreased when combined with Itraconazole.Approved, Investigational
IvabradineQuinine may increase the QTc-prolonging activities of Ivabradine.Approved
IvacaftorThe serum concentration of Quinine can be increased when it is combined with Ivacaftor.Approved
IxazomibThe metabolism of Ixazomib can be decreased when combined with Quinine.Approved, Investigational
JosamycinThe serum concentration of Quinine can be increased when it is combined with Josamycin.Approved, Investigational
KetamineThe metabolism of Ketamine can be decreased when combined with Quinine.Approved, Vet Approved
KetanserinQuinine may increase the hypotensive activities of Ketanserin.Investigational
KetobemidoneThe metabolism of Ketobemidone can be decreased when combined with Quinine.Approved, Investigational
KetoconazoleThe metabolism of Quinine can be decreased when combined with Ketoconazole.Approved, Investigational
KetoprofenThe metabolism of Ketoprofen can be decreased when combined with Quinine.Approved, Vet Approved
KitasamycinThe serum concentration of Quinine can be increased when it is combined with Kitasamycin.Experimental
LabetalolThe metabolism of Labetalol can be decreased when combined with Quinine.Approved
LacidipineQuinine may increase the hypotensive activities of Lacidipine.Approved, Investigational
LanreotideQuinine may increase the hypoglycemic activities of Lanreotide.Approved
LansoprazoleThe metabolism of Lansoprazole can be decreased when combined with Quinine.Approved, Investigational
LapatinibLapatinib may increase the QTc-prolonging activities of Quinine.Approved, Investigational
LatanoprostQuinine may increase the hypotensive activities of Latanoprost.Approved, Investigational
LedipasvirThe serum concentration of Ledipasvir can be increased when it is combined with Quinine.Approved
LeflunomideThe metabolism of Leflunomide can be decreased when combined with Quinine.Approved, Investigational
LenvatinibLenvatinib may increase the QTc-prolonging activities of Quinine.Approved, Investigational
LercanidipineQuinine may increase the hypotensive activities of Lercanidipine.Approved, Investigational
LesinuradThe metabolism of Lesinurad can be decreased when combined with Quinine.Approved, Investigational
LetermovirThe metabolism of Letermovir can be decreased when combined with Quinine.Approved, Investigational
LeuprolideLeuprolide may increase the QTc-prolonging activities of Quinine.Approved, Investigational
LevodopaThe metabolism of Levodopa can be decreased when combined with Quinine.Approved
LevofloxacinLevofloxacin may increase the hypoglycemic activities of Quinine.Approved, Investigational
LevomilnacipranThe metabolism of Levomilnacipran can be decreased when combined with Quinine.Approved, Investigational
LicofeloneThe metabolism of Licofelone can be decreased when combined with Quinine.Investigational
LidocaineThe metabolism of Quinine can be decreased when combined with Lidocaine.Approved, Vet Approved
LinagliptinLinagliptin may increase the hypoglycemic activities of Quinine.Approved
LinsidomineQuinine may increase the hypotensive activities of Linsidomine.Experimental
LiraglutideLiraglutide may increase the hypoglycemic activities of Quinine.Approved
LisinoprilQuinine may increase the hypotensive activities of Lisinopril.Approved, Investigational
LisurideThe metabolism of Lisuride can be decreased when combined with Quinine.Approved, Investigational
LithiumLithium may increase the QTc-prolonging activities of Quinine.Approved
LobeglitazoneThe metabolism of Quinine can be decreased when combined with Lobeglitazone.Approved, Investigational
LofexidineQuinine may increase the hypotensive activities of Lofexidine.Approved, Investigational
LomustineThe metabolism of Lomustine can be decreased when combined with Quinine.Approved, Investigational
LoperamideThe metabolism of Loperamide can be decreased when combined with Quinine.Approved
LopinavirThe serum concentration of Quinine can be decreased when it is combined with Lopinavir.Approved
LoratadineThe metabolism of Loratadine can be decreased when combined with Quinine.Approved, Investigational
LorcaserinThe metabolism of Lorcaserin can be decreased when combined with Quinine.Approved
LornoxicamThe metabolism of Lornoxicam can be decreased when combined with Quinine.Approved, Investigational
LorpiprazoleThe serum concentration of Quinine can be increased when it is combined with Lorpiprazole.Approved
LosartanThe metabolism of Quinine can be decreased when combined with Losartan.Approved
LovastatinThe metabolism of Quinine can be decreased when combined with Lovastatin.Approved, Investigational
LuliconazoleThe serum concentration of Quinine can be increased when it is combined with Luliconazole.Approved
LumacaftorThe serum concentration of Quinine can be increased when it is combined with Lumacaftor.Approved
LumefantrineThe risk or severity of QTc prolongation can be increased when Quinine is combined with Lumefantrine.Approved
LumiracoxibThe metabolism of Lumiracoxib can be decreased when combined with Quinine.Approved, Investigational
Lysergic Acid DiethylamideThe risk or severity of adverse effects can be increased when Lysergic Acid Diethylamide is combined with Quinine.Illicit, Investigational, Withdrawn
MacitentanQuinine may increase the hypotensive activities of Macitentan.Approved
MagaldrateThe serum concentration of Quinine can be increased when it is combined with Magaldrate.Approved, Withdrawn
Magnesium hydroxideThe serum concentration of Quinine can be increased when it is combined with Magnesium hydroxide.Approved, Investigational
Magnesium oxideThe serum concentration of Quinine can be increased when it is combined with Magnesium oxide.Approved
Magnesium peroxideThe serum concentration of Quinine can be increased when it is combined with Magnesium peroxide.Experimental
Magnesium silicateThe serum concentration of Quinine can be increased when it is combined with Magnesium silicate.Approved, Experimental
Magnesium TrisilicateThe serum concentration of Quinine can be increased when it is combined with Magnesium Trisilicate.Approved
ManidipineThe metabolism of Quinine can be decreased when combined with Manidipine.Approved, Investigational
MaprotilineMaprotiline may increase the QTc-prolonging activities of Quinine.Approved, Investigational
MebanazineMebanazine may increase the hypoglycemic activities of Quinine.Withdrawn
MecamylamineQuinine may increase the hypotensive activities of Mecamylamine.Approved, Investigational
MecaserminQuinine may increase the hypoglycemic activities of Mecasermin.Approved, Investigational
Mefenamic acidThe metabolism of Mefenamic acid can be decreased when combined with Quinine.Approved
MefloquineThe risk or severity of adverse effects can be increased when Quinine is combined with Mefloquine.Approved, Investigational
MelatoninThe metabolism of Melatonin can be decreased when combined with Quinine.Approved, Nutraceutical, Vet Approved
MeloxicamThe metabolism of Meloxicam can be decreased when combined with Quinine.Approved, Vet Approved
MephenytoinThe metabolism of Mephenytoin can be decreased when combined with Quinine.Investigational, Withdrawn
MequitazineThe metabolism of Mequitazine can be decreased when combined with Quinine.Approved
MesalazineMesalazine may increase the hypoglycemic activities of Quinine.Approved
MesoridazineThe serum concentration of Mesoridazine can be increased when it is combined with Quinine.Approved, Investigational
MesteroloneMesterolone may increase the hypoglycemic activities of Quinine.Experimental
MestranolThe metabolism of Mestranol can be decreased when combined with Quinine.Approved
MetergolineThe risk or severity of adverse effects can be increased when Metergoline is combined with Quinine.Experimental
MetforminMetformin may increase the hypoglycemic activities of Quinine.Approved
MethadoneThe metabolism of Methadone can be decreased when combined with Quinine.Approved
MethamphetamineThe metabolism of Methamphetamine can be decreased when combined with Quinine.Approved, Illicit
MethoserpidineQuinine may increase the hypotensive activities of Methoserpidine.Experimental
MethotrimeprazineThe metabolism of Quinine can be decreased when combined with Methotrimeprazine.Approved, Investigational
MethoxyfluraneThe metabolism of Methoxyflurane can be decreased when combined with Quinine.Approved, Investigational, Vet Approved
Methyl salicylateMethyl salicylate may increase the hypoglycemic activities of Quinine.Approved, Vet Approved
MethyldopaQuinine may increase the hypotensive activities of Methyldopa.Approved
Methylene blueThe serum concentration of Methylene blue can be increased when it is combined with Quinine.Approved, Investigational
MethylergometrineThe risk or severity of adverse effects can be increased when Methylergometrine is combined with Quinine.Approved
MethylphenidateThe metabolism of Methylphenidate can be decreased when combined with Quinine.Approved, Investigational
MethyltestosteroneMethyltestosterone may increase the hypoglycemic activities of Quinine.Approved
MethyprylonThe metabolism of Methyprylon can be decreased when combined with Quinine.Approved, Illicit, Withdrawn
MethysergideThe risk or severity of adverse effects can be increased when Methysergide is combined with Quinine.Approved
MetipranololQuinine may increase the hypotensive activities of Metipranolol.Approved
MetoclopramideMetoclopramide may increase the QTc-prolonging activities of Quinine.Approved, Investigational
MetocurineQuinine may increase the neuromuscular blocking activities of Metocurine.Approved
Metocurine IodideQuinine may increase the neuromuscular blocking activities of Metocurine Iodide.Approved, Withdrawn
MetolazoneQuinine may increase the hypotensive activities of Metolazone.Approved
MetoprololThe serum concentration of Metoprolol can be increased when it is combined with Quinine.Approved, Investigational
MetronidazoleMetronidazole may increase the QTc-prolonging activities of Quinine.Approved
MetyrosineQuinine may increase the hypotensive activities of Metyrosine.Approved
MevastatinThe serum concentration of Mevastatin can be increased when it is combined with Quinine.Experimental
MexiletineThe metabolism of Quinine can be decreased when combined with Mexiletine.Approved, Investigational
MianserinThe metabolism of Mianserin can be decreased when combined with Quinine.Approved, Investigational
MibefradilQuinine may increase the hypotensive activities of Mibefradil.Investigational, Withdrawn
MidostaurinThe metabolism of Quinine can be decreased when combined with Midostaurin.Approved, Investigational
MifepristoneThe serum concentration of Quinine can be increased when it is combined with Mifepristone.Approved, Investigational
MiglitolMiglitol may increase the hypoglycemic activities of Quinine.Approved
MiglustatMiglustat may increase the hypoglycemic activities of Quinine.Approved
MilnacipranMilnacipran may increase the hypoglycemic activities of Quinine.Approved, Investigational
MinaprineThe metabolism of Minaprine can be decreased when combined with Quinine.Approved
MinoxidilQuinine may increase the hypotensive activities of Minoxidil.Approved, Investigational
MirabegronMirabegron may increase the QTc-prolonging activities of Quinine.Approved
MirtazapineMirtazapine may increase the QTc-prolonging activities of Quinine.Approved
MitiglinideMitiglinide may increase the hypoglycemic activities of Quinine.Approved, Investigational
MitotaneThe serum concentration of Quinine can be decreased when it is combined with Mitotane.Approved
MivacuriumQuinine may increase the neuromuscular blocking activities of Mivacurium.Approved
MoclobemideThe metabolism of Moclobemide can be decreased when combined with Quinine.Approved, Investigational
ModafinilThe metabolism of Quinine can be decreased when combined with Modafinil.Approved, Investigational
MoexiprilMoexipril may increase the QTc-prolonging activities of Quinine.Approved
MontelukastThe metabolism of Montelukast can be decreased when combined with Quinine.Approved
MoricizineThe serum concentration of Moricizine can be increased when it is combined with Quinine.Approved, Investigational, Withdrawn
MorphineThe metabolism of Morphine can be decreased when combined with Quinine.Approved, Investigational
MoxifloxacinMoxifloxacin may increase the QTc-prolonging activities of Quinine.Approved, Investigational
MoxonidineQuinine may increase the hypotensive activities of Moxonidine.Approved, Investigational
MuraglitazarThe metabolism of Muraglitazar can be decreased when combined with Quinine.Investigational
MuzolimineQuinine may increase the hypotensive activities of Muzolimine.Experimental
Mycophenolate mofetilThe metabolism of Mycophenolate mofetil can be decreased when combined with Quinine.Approved, Investigational
NadololQuinine may increase the hypotensive activities of Nadolol.Approved
NaftopidilQuinine may increase the hypotensive activities of Naftopidil.Investigational
Nalidixic AcidNalidixic Acid may increase the hypoglycemic activities of Quinine.Approved, Investigational
NaloxegolThe serum concentration of Naloxegol can be increased when it is combined with Quinine.Approved
NaloxoneThe metabolism of Naloxone can be decreased when combined with Quinine.Approved, Vet Approved
NandroloneNandrolone may increase the hypoglycemic activities of Quinine.Experimental, Investigational
Nandrolone decanoateNandrolone decanoate may increase the hypoglycemic activities of Quinine.Approved, Illicit
NaproxenThe metabolism of Naproxen can be decreased when combined with Quinine.Approved, Vet Approved
NateglinideThe metabolism of Nateglinide can be decreased when combined with Quinine.Approved, Investigational
NebivololThe serum concentration of Nebivolol can be increased when it is combined with Quinine.Approved, Investigational
NefazodoneThe metabolism of Quinine can be decreased when combined with Nefazodone.Approved, Withdrawn
NelfinavirThe metabolism of Quinine can be decreased when combined with Nelfinavir.Approved
NemonoxacinNemonoxacin may increase the hypoglycemic activities of Quinine.Investigational
NeosaxitoxinQuinine may increase the neuromuscular blocking activities of Neosaxitoxin.Investigational
NetupitantThe serum concentration of Quinine can be increased when it is combined with Netupitant.Approved, Investigational
NevirapineThe metabolism of Quinine can be increased when combined with Nevirapine.Approved
NialamideNialamide may increase the hypoglycemic activities of Quinine.Withdrawn
NicardipineThe metabolism of Quinine can be decreased when combined with Nicardipine.Approved, Investigational
NicergolineThe metabolism of Nicergoline can be decreased when combined with Quinine.Approved, Investigational
NiclosamideThe metabolism of Niclosamide can be decreased when combined with Quinine.Approved, Investigational, Vet Approved
NicorandilQuinine may increase the hypotensive activities of Nicorandil.Approved, Investigational
NicotineThe metabolism of Nicotine can be decreased when combined with Quinine.Approved
NifedipineThe metabolism of Nifedipine can be decreased when combined with Quinine.Approved
NiguldipineQuinine may increase the hypotensive activities of Niguldipine.Experimental
NilotinibThe metabolism of Quinine can be decreased when combined with Nilotinib.Approved, Investigational
NilvadipineQuinine may increase the hypotensive activities of Nilvadipine.Approved, Investigational
NimodipineQuinine may increase the hypotensive activities of Nimodipine.Approved, Investigational
NintedanibThe serum concentration of Nintedanib can be increased when it is combined with Quinine.Approved
NisoldipineQuinine may increase the hypotensive activities of Nisoldipine.Approved
NitrendipineQuinine may increase the hypotensive activities of Nitrendipine.Approved, Investigational
Nitric OxideThe risk or severity of adverse effects can be increased when Nitric Oxide is combined with Quinine.Approved
NitroaspirinNitroaspirin may increase the hypoglycemic activities of Quinine.Investigational
NitrofuralThe metabolism of Nitrofural can be decreased when combined with Quinine.Approved, Investigational, Vet Approved
NitroprussideQuinine may increase the hypotensive activities of Nitroprusside.Approved, Investigational
NorfloxacinNorfloxacin may increase the QTc-prolonging activities of Quinine.Approved
NortriptylineNortriptyline may increase the QTc-prolonging activities of Quinine.Approved
OctamoxinOctamoxin may increase the hypoglycemic activities of Quinine.Withdrawn
OctreotideOctreotide may increase the QTc-prolonging activities of Quinine.Approved, Investigational
OdanacatibThe metabolism of Odanacatib can be decreased when combined with Quinine.Investigational
OfloxacinOfloxacin may increase the QTc-prolonging activities of Quinine.Approved
OlanzapineOlanzapine may increase the QTc-prolonging activities of Quinine.Approved, Investigational
OlaparibThe metabolism of Quinine can be decreased when combined with Olaparib.Approved
OleandomycinThe serum concentration of Quinine can be increased when it is combined with Oleandomycin.Vet Approved
OlmesartanQuinine may increase the hypotensive activities of Olmesartan.Approved, Investigational
OlodaterolOlodaterol may increase the QTc-prolonging activities of Quinine.Approved
OlsalazineOlsalazine may increase the hypoglycemic activities of Quinine.Approved
OmapatrilatQuinine may increase the hypotensive activities of Omapatrilat.Investigational
OmbitasvirThe metabolism of Ombitasvir can be decreased when combined with Quinine.Approved, Investigational
OmeprazoleThe metabolism of Quinine can be decreased when combined with Omeprazole.Approved, Investigational, Vet Approved
OndansetronThe metabolism of Ondansetron can be decreased when combined with Quinine.Approved
OsimertinibThe serum concentration of Quinine can be increased when it is combined with Osimertinib.Approved
OspemifeneThe metabolism of Ospemifene can be decreased when combined with Quinine.Approved, Investigational
OxandroloneOxandrolone may increase the hypoglycemic activities of Quinine.Approved, Investigational
OxaprozinThe metabolism of Oxaprozin can be decreased when combined with Quinine.Approved
Oxolinic acidOxolinic acid may increase the hypoglycemic activities of Quinine.Experimental
OxprenololQuinine may increase the hypotensive activities of Oxprenolol.Approved
OxycodoneThe metabolism of Oxycodone can be decreased when combined with Quinine.Approved, Illicit, Investigational
OxymetholoneOxymetholone may increase the hypoglycemic activities of Quinine.Approved, Illicit
OxymorphoneThe metabolism of Oxymorphone can be decreased when combined with Quinine.Approved, Investigational, Vet Approved
OxytocinOxytocin may increase the QTc-prolonging activities of Quinine.Approved, Vet Approved
PaclitaxelThe metabolism of Paclitaxel can be decreased when combined with Quinine.Approved, Vet Approved
PalbociclibThe serum concentration of Quinine can be increased when it is combined with Palbociclib.Approved, Investigational
PaliperidoneThe risk or severity of QTc prolongation can be increased when Quinine is combined with Paliperidone.Approved
PalonosetronThe metabolism of Palonosetron can be decreased when combined with Quinine.Approved, Investigational
PancuroniumQuinine may increase the neuromuscular blocking activities of Pancuronium.Approved
PanobinostatThe serum concentration of Quinine can be increased when it is combined with Panobinostat.Approved, Investigational
PantoprazoleThe metabolism of Quinine can be decreased when combined with Pantoprazole.Approved
ParamethadioneThe metabolism of Paramethadione can be decreased when combined with Quinine.Approved
ParecoxibThe metabolism of Parecoxib can be decreased when combined with Quinine.Approved
PargylineQuinine may increase the hypotensive activities of Pargyline.Approved
ParoxetineThe metabolism of Quinine can be decreased when combined with Paroxetine.Approved, Investigational
PasireotidePasireotide may increase the QTc-prolonging activities of Quinine.Approved
PazopanibThe serum concentration of Pazopanib can be increased when it is combined with Quinine.Approved
PazufloxacinPazufloxacin may increase the hypoglycemic activities of Quinine.Investigational
PefloxacinPefloxacin may increase the hypoglycemic activities of Quinine.Approved
Peginterferon alfa-2bThe serum concentration of Quinine can be decreased when it is combined with Peginterferon alfa-2b.Approved
PegvisomantPegvisomant may increase the hypoglycemic activities of Quinine.Approved
PenbutololQuinine may increase the hypotensive activities of Penbutolol.Approved, Investigational
PentamidineThe metabolism of Pentamidine can be decreased when combined with Quinine.Approved, Investigational
PentobarbitalThe metabolism of Quinine can be increased when combined with Pentobarbital.Approved, Investigational, Vet Approved
PentoliniumQuinine may increase the hypotensive activities of Pentolinium.Approved
PerazineThe serum concentration of Perazine can be increased when it is combined with Quinine.Approved, Investigational
PerflutrenPerflutren may increase the QTc-prolonging activities of Quinine.Approved
PergolideThe risk or severity of adverse effects can be increased when Pergolide is combined with Quinine.Approved, Investigational, Vet Approved, Withdrawn
PerhexilineThe metabolism of Perhexiline can be decreased when combined with Quinine.Approved, Investigational
PerindoprilQuinine may increase the hypotensive activities of Perindopril.Approved
PerospironeThe metabolism of Perospirone can be decreased when combined with Quinine.Approved
PerphenazineThe serum concentration of Perphenazine can be increased when it is combined with Quinine.Approved
PethidineThe metabolism of Pethidine can be decreased when combined with Quinine.Approved
PhenacetinThe metabolism of Phenacetin can be decreased when combined with Quinine.Withdrawn
PhenelzinePhenelzine may increase the hypoglycemic activities of Quinine.Approved
PhenforminThe metabolism of Phenformin can be decreased when combined with Quinine.Approved, Investigational, Withdrawn
PhenindioneQuinine may increase the anticoagulant activities of Phenindione.Approved, Investigational
PheniprazinePheniprazine may increase the hypoglycemic activities of Quinine.Withdrawn
PhenobarbitalThe serum concentration of Phenobarbital can be increased when it is combined with Quinine.Approved, Investigational
PhenoxybenzamineQuinine may increase the hypotensive activities of Phenoxybenzamine.Approved
PhenoxypropazinePhenoxypropazine may increase the hypoglycemic activities of Quinine.Withdrawn
PhenprocoumonQuinine may increase the anticoagulant activities of Phenprocoumon.Approved, Investigational
PhentolamineQuinine may increase the hypotensive activities of Phentolamine.Approved
PhenylbutazoneThe metabolism of Phenylbutazone can be decreased when combined with Quinine.Approved, Vet Approved
PhenytoinThe serum concentration of Quinine can be decreased when it is combined with Phenytoin.Approved, Vet Approved
PimozideThe risk or severity of QTc prolongation can be increased when Quinine is combined with Pimozide.Approved
PinacidilQuinine may increase the hypotensive activities of Pinacidil.Approved
PindololThe metabolism of Pindolol can be decreased when combined with Quinine.Approved, Investigational
PioglitazoneThe metabolism of Pioglitazone can be decreased when combined with Quinine.Approved, Investigational
PipecuroniumQuinine may increase the neuromuscular blocking activities of Pipecuronium.Approved
Pipemidic acidPipemidic acid may increase the hypoglycemic activities of Quinine.Experimental
PiperaquineThe metabolism of Piperaquine can be decreased when combined with Quinine.Approved, Investigational
PiperazineThe metabolism of Piperazine can be decreased when combined with Quinine.Approved, Vet Approved
PipotiazineThe metabolism of Pipotiazine can be decreased when combined with Quinine.Approved, Investigational
PirlindolePirlindole may increase the hypoglycemic activities of Quinine.Approved
Piromidic acidPiromidic acid may increase the hypoglycemic activities of Quinine.Experimental
PiroxicamThe metabolism of Piroxicam can be decreased when combined with Quinine.Approved, Investigational
PitavastatinThe metabolism of Pitavastatin can be decreased when combined with Quinine.Approved
PivhydrazinePivhydrazine may increase the hypoglycemic activities of Quinine.Withdrawn
Platelet Activating FactorQuinine may increase the hypotensive activities of Platelet Activating Factor.Experimental
PolythiazideQuinine may increase the hypotensive activities of Polythiazide.Approved
PonatinibThe metabolism of Ponatinib can be decreased when combined with Quinine.Approved, Investigational
PosaconazoleThe metabolism of Quinine can be decreased when combined with Posaconazole.Approved, Investigational, Vet Approved
PramlintidePramlintide may increase the hypoglycemic activities of Quinine.Approved, Investigational
PrasugrelThe metabolism of Prasugrel can be decreased when combined with Quinine.Approved
PravastatinThe metabolism of Pravastatin can be decreased when combined with Quinine.Approved
PrazosinQuinine may increase the hypotensive activities of Prazosin.Approved
PrilocaineThe risk or severity of adverse effects can be increased when Quinine is combined with Prilocaine.Approved
PrimaquinePrimaquine may increase the QTc-prolonging activities of Quinine.Approved
PrimidoneThe metabolism of Quinine can be increased when combined with Primidone.Approved, Vet Approved
ProcainamideThe metabolism of Procainamide can be decreased when combined with Quinine.Approved
ProcarbazineProcarbazine may increase the hypoglycemic activities of Quinine.Approved, Investigational
ProchlorperazineThe serum concentration of Prochlorperazine can be increased when it is combined with Quinine.Approved, Vet Approved
ProgesteroneThe metabolism of Progesterone can be decreased when combined with Quinine.Approved, Vet Approved
ProguanilThe metabolism of Proguanil can be decreased when combined with Quinine.Approved
PromazineThe serum concentration of Promazine can be increased when it is combined with Quinine.Approved, Vet Approved
PromethazinePromethazine may increase the QTc-prolonging activities of Quinine.Approved, Investigational
PropafenoneThe serum concentration of Quinine can be increased when it is combined with Propafenone.Approved
PropericiazineThe serum concentration of Propericiazine can be increased when it is combined with Quinine.Approved, Investigational
PropiopromazineThe serum concentration of Propiopromazine can be increased when it is combined with Quinine.Vet Approved
PropofolPropofol may increase the QTc-prolonging activities of Quinine.Approved, Investigational, Vet Approved
PropranololThe metabolism of Propranolol can be decreased when combined with Quinine.Approved, Investigational
ProtriptylineProtriptyline may increase the QTc-prolonging activities of Quinine.Approved
PrucaloprideThe serum concentration of Prucalopride can be increased when it is combined with Quinine.Approved
PrulifloxacinPrulifloxacin may increase the hypoglycemic activities of Quinine.Investigational
PseudoephedrineThe metabolism of Pseudoephedrine can be decreased when combined with Quinine.Approved
PyrantelQuinine may increase the neuromuscular blocking activities of Pyrantel.Approved, Vet Approved
PyrimethamineThe metabolism of Quinine can be decreased when combined with Pyrimethamine.Approved, Investigational, Vet Approved
QuazepamThe metabolism of Quazepam can be decreased when combined with Quinine.Approved, Illicit
QuetiapineThe metabolism of Quetiapine can be decreased when combined with Quinine.Approved
QuinaprilQuinine may increase the hypotensive activities of Quinapril.Approved, Investigational
QuinidineThe metabolism of Quinine can be decreased when combined with Quinidine.Approved, Investigational
RabeprazoleThe metabolism of Quinine can be decreased when combined with Rabeprazole.Approved, Investigational
RamiprilQuinine may increase the hypotensive activities of Ramipril.Approved
RanitidineThe metabolism of Ranitidine can be decreased when combined with Quinine.Approved
RanolazineThe serum concentration of Ranolazine can be increased when it is combined with Quinine.Approved, Investigational
RapacuroniumQuinine may increase the neuromuscular blocking activities of Rapacuronium.Withdrawn
RasagilineRasagiline may increase the hypoglycemic activities of Quinine.Approved
RemikirenQuinine may increase the hypotensive activities of Remikiren.Approved
RemoxiprideThe metabolism of Remoxipride can be decreased when combined with Quinine.Approved, Withdrawn
RepaglinideThe metabolism of Repaglinide can be decreased when combined with Quinine.Approved, Investigational
RepinotanThe metabolism of Repinotan can be decreased when combined with Quinine.Investigational
RescinnamineQuinine may increase the hypotensive activities of Rescinnamine.Approved
ReserpineQuinine may increase the hypotensive activities of Reserpine.Approved, Investigational
RifabutinThe metabolism of Quinine can be increased when combined with Rifabutin.Approved, Investigational
RifampicinThe serum concentration of Quinine can be decreased when it is combined with Rifampicin.Approved
RifapentineThe metabolism of Quinine can be increased when combined with Rifapentine.Approved, Investigational
RifaximinThe serum concentration of Rifaximin can be increased when it is combined with Quinine.Approved, Investigational
RilmenidineQuinine may increase the hypotensive activities of Rilmenidine.Approved, Investigational
RilpivirineThe serum concentration of Rilpivirine can be increased when it is combined with Quinine.Approved
RiociguatThe metabolism of Riociguat can be decreased when combined with Quinine.Approved
RisperidoneRisperidone may increase the QTc-prolonging activities of Quinine.Approved, Investigational
RitonavirThe serum concentration of Quinine can be decreased when it is combined with Ritonavir.Approved, Investigational
RocuroniumQuinine may increase the neuromuscular blocking activities of Rocuronium.Approved
RofecoxibThe metabolism of Rofecoxib can be decreased when combined with Quinine.Approved, Investigational, Withdrawn
RolapitantThe metabolism of Quinine can be decreased when combined with Rolapitant.Approved, Investigational
RopiniroleThe metabolism of Quinine can be decreased when combined with Ropinirole.Approved, Investigational
RopivacaineThe metabolism of Ropivacaine can be decreased when combined with Quinine.Approved
RosiglitazoneThe metabolism of Rosiglitazone can be decreased when combined with Quinine.Approved, Investigational
RosoxacinRosoxacin may increase the hypoglycemic activities of Quinine.Approved, Investigational
RosuvastatinThe metabolism of Rosuvastatin can be decreased when combined with Quinine.Approved
RotigotineThe metabolism of Rotigotine can be decreased when combined with Quinine.Approved
RucaparibThe metabolism of Rucaparib can be decreased when combined with Quinine.Approved, Investigational
RufloxacinRufloxacin may increase the hypoglycemic activities of Quinine.Experimental
RupatadineThe metabolism of Rupatadine can be decreased when combined with Quinine.Approved
SafrazineSafrazine may increase the hypoglycemic activities of Quinine.Withdrawn
SalbutamolSalbutamol may increase the QTc-prolonging activities of Quinine.Approved, Vet Approved
Salicylic acidThe metabolism of Salicylic acid can be decreased when combined with Quinine.Approved, Investigational, Vet Approved
SalmeterolSalmeterol may increase the QTc-prolonging activities of Quinine.Approved
SaprisartanQuinine may increase the hypotensive activities of Saprisartan.Experimental
SaquinavirThe metabolism of Quinine can be decreased when combined with Saquinavir.Approved, Investigational
SarilumabThe therapeutic efficacy of Quinine can be decreased when used in combination with Sarilumab.Approved, Investigational
SaxagliptinThe serum concentration of Saxagliptin can be decreased when it is combined with Quinine.Approved
SecobarbitalThe metabolism of Quinine can be increased when combined with Secobarbital.Approved, Vet Approved
SelegilineThe metabolism of Selegiline can be decreased when combined with Quinine.Approved, Investigational, Vet Approved
SelexipagThe metabolism of Selexipag can be decreased when combined with Quinine.Approved
SeratrodastThe metabolism of Seratrodast can be decreased when combined with Quinine.Approved
SertindoleThe metabolism of Sertindole can be decreased when combined with Quinine.Approved, Investigational, Withdrawn
SertralineSertraline may increase the QTc-prolonging activities of Quinine.Approved
SevofluraneSevoflurane may increase the QTc-prolonging activities of Quinine.Approved, Vet Approved
SildenafilThe metabolism of Quinine can be decreased when combined with Sildenafil.Approved, Investigational
SilodosinThe serum concentration of Silodosin can be increased when it is combined with Quinine.Approved
SiltuximabThe serum concentration of Quinine can be decreased when it is combined with Siltuximab.Approved, Investigational
SimeprevirThe serum concentration of Quinine can be increased when it is combined with Simeprevir.Approved
SimvastatinThe metabolism of Simvastatin can be decreased when combined with Quinine.Approved
SitafloxacinSitafloxacin may increase the hypoglycemic activities of Quinine.Experimental, Investigational
SitagliptinThe metabolism of Sitagliptin can be decreased when combined with Quinine.Approved, Investigational
SitaxentanThe metabolism of Sitaxentan can be decreased when combined with Quinine.Approved, Investigational, Withdrawn
Sodium bicarbonateThe serum concentration of Quinine can be increased when it is combined with Sodium bicarbonate.Approved
Sodium NitriteThe risk or severity of adverse effects can be increased when Quinine is combined with Sodium Nitrite.Approved, Investigational
SolifenacinSolifenacin may increase the QTc-prolonging activities of Quinine.Approved
SolithromycinThe serum concentration of Quinine can be increased when it is combined with Solithromycin.Investigational
SorafenibSorafenib may increase the QTc-prolonging activities of Quinine.Approved, Investigational
SotagliflozinSotagliflozin may increase the hypoglycemic activities of Quinine.Investigational
SotalolThe risk or severity of QTc prolongation can be increased when Quinine is combined with Sotalol.Approved
SparfloxacinSparfloxacin may increase the hypoglycemic activities of Quinine.Approved, Investigational
SparteineThe metabolism of Sparteine can be decreased when combined with Quinine.Experimental
SpiraprilQuinine may increase the hypotensive activities of Spirapril.Approved
St. John's WortThe serum concentration of Quinine can be decreased when it is combined with St. John's Wort.Approved, Investigational, Nutraceutical
StanoloneStanolone may increase the hypoglycemic activities of Quinine.Illicit, Investigational
StanozololStanozolol may increase the hypoglycemic activities of Quinine.Approved, Vet Approved
StiripentolThe serum concentration of Quinine can be increased when it is combined with Stiripentol.Approved
SuccinylcholineQuinine may increase the neuromuscular blocking activities of Succinylcholine.Approved
SulfadiazineThe metabolism of Quinine can be decreased when combined with Sulfadiazine.Approved, Investigational, Vet Approved
SulfamethoxazoleSulfamethoxazole may increase the QTc-prolonging activities of Quinine.Approved
SulfamoxoleThe metabolism of Sulfamoxole can be decreased when combined with Quinine.Approved
SulfinpyrazoneThe metabolism of Sulfinpyrazone can be decreased when combined with Quinine.Approved
SulfisoxazoleThe metabolism of Quinine can be decreased when combined with Sulfisoxazole.Approved, Vet Approved
SulodexideSulodexide may increase the hypoglycemic activities of Quinine.Approved, Investigational
SunitinibSunitinib may increase the QTc-prolonging activities of Quinine.Approved, Investigational
SuprofenThe metabolism of Suprofen can be decreased when combined with Quinine.Approved, Withdrawn
TalinololQuinine may increase the hypotensive activities of Talinolol.Investigational
TamoxifenThe serum concentration of the active metabolites of Tamoxifen can be reduced when Tamoxifen is used in combination with Quinine resulting in a loss in efficacy.Approved
TamsulosinThe metabolism of Tamsulosin can be decreased when combined with Quinine.Approved, Investigational
TapentadolThe metabolism of Tapentadol can be decreased when combined with Quinine.Approved
TazaroteneThe metabolism of Tazarotene can be decreased when combined with Quinine.Approved, Investigational
TegaserodThe metabolism of Tegaserod can be decreased when combined with Quinine.Approved, Investigational, Withdrawn
TelaprevirThe metabolism of Quinine can be decreased when combined with Telaprevir.Approved, Withdrawn
TelavancinTelavancin may increase the QTc-prolonging activities of Quinine.Approved
TelithromycinThe serum concentration of Quinine can be increased when it is combined with Telithromycin.Approved
TelmisartanQuinine may increase the hypotensive activities of Telmisartan.Approved, Investigational
TemafloxacinTemafloxacin may increase the hypoglycemic activities of Quinine.Withdrawn
TemazepamThe metabolism of Temazepam can be decreased when combined with Quinine.Approved, Investigational
TemocaprilQuinine may increase the hypotensive activities of Temocapril.Experimental, Investigational
Tenofovir disoproxilThe metabolism of Quinine can be decreased when combined with Tenofovir disoproxil.Approved, Investigational
TenoxicamThe metabolism of Tenoxicam can be decreased when combined with Quinine.Approved
TerbinafineThe metabolism of Quinine can be decreased when combined with Terbinafine.Approved, Investigational, Vet Approved
TerbutalineTerbutaline may increase the QTc-prolonging activities of Quinine.Approved
TerfenadineThe metabolism of Terfenadine can be decreased when combined with Quinine.Approved, Withdrawn
TergurideThe risk or severity of adverse effects can be increased when Terguride is combined with Quinine.Experimental
TeriflunomideThe serum concentration of Quinine can be decreased when it is combined with Teriflunomide.Approved
TerlipressinQuinine may increase the hypotensive activities of Terlipressin.Approved, Investigational
TesmilifeneThe metabolism of Tesmilifene can be decreased when combined with Quinine.Investigational
TestosteroneThe metabolism of Testosterone can be decreased when combined with Quinine.Approved, Investigational
Testosterone cypionateThe metabolism of Testosterone cypionate can be decreased when combined with Quinine.Approved
Testosterone enanthateThe metabolism of Testosterone enanthate can be decreased when combined with Quinine.Approved
Testosterone propionateTestosterone propionate may increase the hypoglycemic activities of Quinine.Approved, Investigational, Vet Approved, Withdrawn
Testosterone undecanoateThe metabolism of Testosterone undecanoate can be decreased when combined with Quinine.Approved, Investigational
TetrabenazineThe metabolism of Tetrabenazine can be decreased when combined with Quinine.Approved, Investigational
TetracyclineThe serum concentration of Quinine can be increased when it is combined with Tetracycline.Approved, Vet Approved
TetrahydropalmatineQuinine may increase the hypotensive activities of Tetrahydropalmatine.Investigational
ThalidomideThe metabolism of Thalidomide can be decreased when combined with Quinine.Approved, Investigational, Withdrawn
TheodrenalineQuinine may increase the hypotensive activities of Theodrenaline.Investigational
TheophyllineThe serum concentration of Theophylline can be increased when it is combined with Quinine.Approved
ThiamylalThe metabolism of Thiamylal can be decreased when combined with Quinine.Approved, Vet Approved
ThiazinamThe serum concentration of Thiazinam can be increased when it is combined with Quinine.Experimental
ThiethylperazineThe serum concentration of Thiethylperazine can be increased when it is combined with Quinine.Withdrawn
ThioproperazineThe serum concentration of Thioproperazine can be increased when it is combined with Quinine.Approved
ThioridazineThe serum concentration of Thioridazine can be increased when it is combined with Quinine.Approved, Withdrawn
ThiothixeneThiothixene may increase the QTc-prolonging activities of Quinine.Approved
TiboloneQuinine may increase the hypotensive activities of Tibolone.Approved, Investigational
TicagrelorThe metabolism of Quinine can be decreased when combined with Ticagrelor.Approved
TiclopidineThe metabolism of Quinine can be decreased when combined with Ticlopidine.Approved
TicrynafenQuinine may increase the hypotensive activities of Ticrynafen.Withdrawn
TimololThe metabolism of Timolol can be decreased when combined with Quinine.Approved
TioclomarolQuinine may increase the anticoagulant activities of Tioclomarol.Experimental
TiotropiumThe metabolism of Tiotropium can be decreased when combined with Quinine.Approved
TipranavirThe metabolism of Quinine can be decreased when combined with Tipranavir.Approved, Investigational
TizanidineTizanidine may increase the QTc-prolonging activities of Quinine.Approved, Investigational
TocilizumabThe serum concentration of Quinine can be decreased when it is combined with Tocilizumab.Approved
TolazamideQuinine may increase the hypoglycemic activities of Tolazamide.Approved, Investigational
TolazolineQuinine may increase the hypotensive activities of Tolazoline.Approved, Vet Approved
TolbutamideThe metabolism of Quinine can be decreased when combined with Tolbutamide.Approved, Investigational
TolonidineQuinine may increase the hypotensive activities of Tolonidine.Experimental
ToloxatoneToloxatone may increase the hypoglycemic activities of Quinine.Approved
TolterodineTolterodine may increase the QTc-prolonging activities of Quinine.Approved, Investigational
TolvaptanThe serum concentration of Tolvaptan can be increased when it is combined with Quinine.Approved
TopiramateThe metabolism of Quinine can be decreased when combined with Topiramate.Approved
TopiroxostatThe metabolism of Quinine can be decreased when combined with Topiroxostat.Approved, Investigational
TopotecanThe serum concentration of Topotecan can be increased when it is combined with Quinine.Approved, Investigational
TorasemideThe metabolism of Torasemide can be decreased when combined with Quinine.Approved
ToremifeneThe risk or severity of QTc prolongation can be increased when Quinine is combined with Toremifene.Approved, Investigational
TrabectedinThe metabolism of Trabectedin can be decreased when combined with Quinine.Approved, Investigational
TramadolThe therapeutic efficacy of Tramadol can be decreased when used in combination with Quinine.Approved, Investigational
TrandolaprilQuinine may increase the hypotensive activities of Trandolapril.Approved
Trans-2-PhenylcyclopropylamineTrans-2-Phenylcyclopropylamine may increase the hypoglycemic activities of Quinine.Experimental
TranylcypromineThe metabolism of Quinine can be decreased when combined with Tranylcypromine.Approved, Investigational
TravoprostQuinine may increase the hypotensive activities of Travoprost.Approved
TrazodoneTrazodone may increase the QTc-prolonging activities of Quinine.Approved, Investigational
TreprostinilTreprostinil may increase the QTc-prolonging activities of Quinine.Approved, Investigational
TretinoinThe metabolism of Tretinoin can be decreased when combined with Quinine.Approved, Investigational, Nutraceutical
TrichlormethiazideQuinine may increase the hypotensive activities of Trichlormethiazide.Approved, Vet Approved
TrifluoperazineThe serum concentration of Trifluoperazine can be increased when it is combined with Quinine.Approved, Investigational
TriflupromazineThe serum concentration of Triflupromazine can be increased when it is combined with Quinine.Approved, Vet Approved
TrimazosinQuinine may increase the hypotensive activities of Trimazosin.Experimental
TrimethadioneThe metabolism of Trimethadione can be decreased when combined with Quinine.Approved
TrimethaphanQuinine may increase the hypotensive activities of Trimethaphan.Approved, Investigational
TrimethoprimTrimethoprim may increase the QTc-prolonging activities of Quinine.Approved, Vet Approved
TrimipramineTrimipramine may increase the QTc-prolonging activities of Quinine.Approved
TriptorelinTriptorelin may increase the QTc-prolonging activities of Quinine.Approved, Vet Approved
TroglitazoneThe metabolism of Troglitazone can be decreased when combined with Quinine.Investigational, Withdrawn
Trolamine salicylateTrolamine salicylate may increase the hypoglycemic activities of Quinine.Approved
TromethamineThe serum concentration of Quinine can be increased when it is combined with Tromethamine.Approved
TrovafloxacinTrovafloxacin may increase the hypoglycemic activities of Quinine.Approved, Investigational, Withdrawn
TubocurarineQuinine may increase the neuromuscular blocking activities of Tubocurarine.Approved
TylosinThe serum concentration of Quinine can be increased when it is combined with Tylosin.Vet Approved
UmeclidiniumThe metabolism of Umeclidinium can be decreased when combined with Quinine.Approved
UnoprostoneQuinine may increase the hypotensive activities of Unoprostone.Approved, Investigational
UrapidilQuinine may increase the hypotensive activities of Urapidil.Investigational
ValbenazineThe metabolism of Valbenazine can be decreased when combined with Quinine.Approved, Investigational
ValdecoxibThe metabolism of Valdecoxib can be decreased when combined with Quinine.Approved, Investigational, Withdrawn
Valproic AcidThe metabolism of Valproic Acid can be decreased when combined with Quinine.Approved, Investigational
ValsartanThe metabolism of Valsartan can be decreased when combined with Quinine.Approved, Investigational
VandetanibThe risk or severity of QTc prolongation can be increased when Quinine is combined with Vandetanib.Approved
VardenafilVardenafil may increase the QTc-prolonging activities of Quinine.Approved
VecuroniumQuinine may increase the neuromuscular blocking activities of Vecuronium.Approved
VelpatasvirThe metabolism of Velpatasvir can be decreased when combined with Quinine.Approved, Investigational
VemurafenibThe serum concentration of Quinine can be increased when it is combined with Vemurafenib.Approved
VenlafaxineVenlafaxine may increase the QTc-prolonging activities of Quinine.Approved
VerapamilThe metabolism of Quinine can be decreased when combined with Verapamil.Approved
VernakalantThe metabolism of Vernakalant can be decreased when combined with Quinine.Approved, Investigational
VicrivirocThe metabolism of Vicriviroc can be decreased when combined with Quinine.Investigational
VilanterolVilanterol may increase the QTc-prolonging activities of Quinine.Approved
VilazodoneThe metabolism of Vilazodone can be decreased when combined with Quinine.Approved
VildagliptinVildagliptin may increase the hypoglycemic activities of Quinine.Approved, Investigational
VinblastineThe metabolism of Vinblastine can be decreased when combined with Quinine.Approved
VincamineQuinine may increase the hypotensive activities of Vincamine.Experimental
VincristineThe excretion of Vincristine can be decreased when combined with Quinine.Approved, Investigational
VinorelbineThe metabolism of Vinorelbine can be decreased when combined with Quinine.Approved, Investigational
VinpocetineQuinine may increase the hypotensive activities of Vinpocetine.Investigational
VismodegibThe metabolism of Vismodegib can be decreased when combined with Quinine.Approved, Investigational
VogliboseVoglibose may increase the hypoglycemic activities of Quinine.Approved, Investigational
VoriconazoleThe metabolism of Quinine can be decreased when combined with Voriconazole.Approved, Investigational
VorinostatVorinostat may increase the QTc-prolonging activities of Quinine.Approved, Investigational
VortioxetineThe metabolism of Vortioxetine can be decreased when combined with Quinine.Approved, Investigational
VoxilaprevirThe metabolism of Voxilaprevir can be decreased when combined with Quinine.Approved, Investigational
WarfarinQuinine may increase the anticoagulant activities of Warfarin.Approved
XimelagatranThe metabolism of Ximelagatran can be decreased when combined with Quinine.Approved, Investigational, Withdrawn
XipamideQuinine may increase the hypotensive activities of Xipamide.Experimental
XylometazolineQuinine may increase the hypotensive activities of Xylometazoline.Approved, Investigational
YohimbineThe metabolism of Yohimbine can be decreased when combined with Quinine.Approved, Investigational, Vet Approved
ZafirlukastThe metabolism of Quinine can be decreased when combined with Zafirlukast.Approved, Investigational
ZalcitabineThe metabolism of Zalcitabine can be decreased when combined with Quinine.Approved, Investigational
ZaltoprofenThe metabolism of Zaltoprofen can be decreased when combined with Quinine.Approved, Investigational
ZidovudineThe metabolism of Zidovudine can be decreased when combined with Quinine.Approved
ZileutonThe metabolism of Zileuton can be decreased when combined with Quinine.Approved, Investigational, Withdrawn
ZimelidineZimelidine may increase the hypoglycemic activities of Quinine.Withdrawn
ZiprasidoneThe metabolism of Quinine can be decreased when combined with Ziprasidone.Approved
ZofenoprilQuinine may increase the hypotensive activities of Zofenopril.Experimental
ZolpidemThe metabolism of Zolpidem can be decreased when combined with Quinine.Approved
ZopicloneThe metabolism of Zopiclone can be decreased when combined with Quinine.Approved
ZucapsaicinThe metabolism of Quinine can be decreased when combined with Zucapsaicin.Approved, Investigational
ZuclopenthixolThe metabolism of Zuclopenthixol can be decreased when combined with Quinine.Approved, Investigational
Food Interactions
  • Take with food to reduce irritation.


Synthesis Reference

Tong Sun, Shawn Watson, Wei Lai, Stephan D. Parent, "QUININE SULFATE/BISULFATE SOLID COMPLEX; METHODS OF MAKING; AND METHODS OF USE THEREOF." U.S. Patent US20090326005, issued December 31, 2009.

General References
  1. Paintaud G, Alvan G, Berninger E, Gustafsson LL, Idrizbegovic E, Karlsson KK, Wakelkamp M: The concentration-effect relationship of quinine-induced hearing impairment. Clin Pharmacol Ther. 1994 Mar;55(3):317-23. [PubMed:8143397]
External Links
Human Metabolome Database
KEGG Compound
PubChem Compound
PubChem Substance
Therapeutic Targets Database
Guide to Pharmacology
GtP Drug Page
RxList Drug Page Drug Page
ATC Codes
M09AA72 — Quinine, combinations with psycholepticsP01BC01 — Quinine
AHFS Codes
  • 08:30.08 — Antimalarials
PDB Entries
4uil / 4uin / 4wnv
FDA label
Download (718 KB)
Download (72.1 KB)

Clinical Trials

Clinical Trials
1CompletedBasic ScienceHealthy Volunteers5
1CompletedBasic SciencePharmacokinetics1
1CompletedDiagnosticCocaine Use / Pharmacokinetics1
1TerminatedBasic ScienceHealthy Volunteers / Impaired Renal Function1
1, 2Active Not RecruitingTreatmentRhinitis / Sinusitis1
2CompletedBasic SciencePlasmodium Infections1
2CompletedTreatmentMalaria caused by Plasmodium falciparum1
2CompletedTreatmentPlasmodium Falciparum Malaria1
2WithdrawnOtherCompliance / Pain, Chronic1
3CompletedTreatmentDrug Resistant Malaria Due to Plasmodium Falciparum1
3CompletedTreatmentPlasmodium Falciparum Malaria1
3CompletedTreatmentPlasmodium Infections2
4CompletedNot AvailablePlasmodium Infections1
4CompletedTreatmentPlasmodium Infections1
4Unknown StatusTreatmentPlasmodium Infections1
4Unknown StatusTreatmentUncomplicated Malaria1
Not AvailableActive Not RecruitingBasic ScienceBMI >30 kg/m2 / Healthy Volunteers1
Not AvailableCompletedTreatmentHuman Immunodeficiency Virus (HIV) Infections1


  • Ar holding co inc
Dosage forms
CapsuleOral200 mg
TabletOral300 mg
CapsuleOral324 mg/1
CapsuleOral300 mg
Unit descriptionCostUnit
Quinine sulfate powd ultrex25.86USD g
Apo-Quinine 300 mg Capsule0.39USD capsule
Novo-Quinine 300 mg Capsule0.39USD capsule
Apo-Quinine 200 mg Capsule0.25USD capsule
Novo-Quinine 200 mg Capsule0.25USD capsule
DrugBank does not sell nor buy drugs. Pricing information is supplied for informational purposes only.
Not Available


Experimental Properties
melting point (°C)57 °CPhysProp
water solubility500 mg/L (at 15 °C)YALKOWSKY,SH & DANNENFELSER,RM (1992)
logP3.44HANSCH,C ET AL. (1995)
logS-2.76ADME Research, USCD
Predicted Properties
Water Solubility0.334 mg/mLALOGPS
pKa (Strongest Acidic)13.89ChemAxon
pKa (Strongest Basic)9.05ChemAxon
Physiological Charge1ChemAxon
Hydrogen Acceptor Count4ChemAxon
Hydrogen Donor Count1ChemAxon
Polar Surface Area45.59 Å2ChemAxon
Rotatable Bond Count4ChemAxon
Refractivity94.69 m3·mol-1ChemAxon
Polarizability35.96 Å3ChemAxon
Number of Rings4ChemAxon
Rule of FiveYesChemAxon
Ghose FilterYesChemAxon
Veber's RuleNoChemAxon
MDDR-like RuleNoChemAxon
Predicted ADMET features
Human Intestinal Absorption+0.9836
Blood Brain Barrier+0.9382
Caco-2 permeable+0.8867
P-glycoprotein substrateSubstrate0.7863
P-glycoprotein inhibitor IInhibitor0.8208
P-glycoprotein inhibitor IIInhibitor0.8387
Renal organic cation transporterInhibitor0.762
CYP450 2C9 substrateNon-substrate0.7898
CYP450 2D6 substrateNon-substrate0.9116
CYP450 3A4 substrateSubstrate0.5754
CYP450 1A2 substrateNon-inhibitor0.9045
CYP450 2C9 inhibitorNon-inhibitor0.9071
CYP450 2D6 inhibitorInhibitor0.8931
CYP450 2C19 inhibitorNon-inhibitor0.9026
CYP450 3A4 inhibitorNon-inhibitor0.8309
CYP450 inhibitory promiscuityLow CYP Inhibitory Promiscuity0.7225
Ames testNon AMES toxic0.9133
BiodegradationNot ready biodegradable1.0
Rat acute toxicity3.0596 LD50, mol/kg Not applicable
hERG inhibition (predictor I)Strong inhibitor0.5884
hERG inhibition (predictor II)Inhibitor0.538
ADMET data is predicted using admetSAR, a free tool for evaluating chemical ADMET properties. (23092397)


Mass Spec (NIST)
Not Available
SpectrumSpectrum TypeSplash Key
Predicted GC-MS Spectrum - GC-MSPredicted GC-MSNot Available
Predicted MS/MS Spectrum - 10V, Positive (Annotated)Predicted LC-MS/MSNot Available
Predicted MS/MS Spectrum - 20V, Positive (Annotated)Predicted LC-MS/MSNot Available
Predicted MS/MS Spectrum - 40V, Positive (Annotated)Predicted LC-MS/MSNot Available
Predicted MS/MS Spectrum - 10V, Negative (Annotated)Predicted LC-MS/MSNot Available
Predicted MS/MS Spectrum - 20V, Negative (Annotated)Predicted LC-MS/MSNot Available
Predicted MS/MS Spectrum - 40V, Negative (Annotated)Predicted LC-MS/MSNot Available


This compound belongs to the class of organic compounds known as cinchona alkaloids. These are alkaloids structurally characterized by the presence of the cinchonan skeleton, which consists of a quinoline linked to an azabicyclo[2.2.2]octane moiety.
Organic compounds
Super Class
Alkaloids and derivatives
Cinchona alkaloids
Sub Class
Not Available
Direct Parent
Cinchona alkaloids
Alternative Parents
4-quinolinemethanols / Quinuclidines / Anisoles / Aralkylamines / Alkyl aryl ethers / Pyridines and derivatives / Piperidines / Heteroaromatic compounds / Trialkylamines / Secondary alcohols
show 5 more
Cinchonan-skeleton / 4-quinolinemethanol / Quinoline / Anisole / Quinuclidine / Alkyl aryl ether / Aralkylamine / Piperidine / Pyridine / Benzenoid
show 18 more
Molecular Framework
Aromatic heteropolycyclic compounds
External Descriptors
cinchona alkaloid (CHEBI:15854)


1. Fe(II)-protoporphyrin IX
Small molecule
Plasmodium falciparum
Pharmacological action
  1. Alumasa JN, Gorka AP, Casabianca LB, Comstock E, de Dios AC, Roepe PD: The hydroxyl functionality and a rigid proximal N are required for forming a novel non-covalent quinine-heme complex. J Inorg Biochem. 2011 Mar;105(3):467-75. doi: 10.1016/j.jinorgbio.2010.08.011. Epub 2010 Sep 22. [PubMed:20864177]
  2. Fitch CD: Ferriprotoporphyrin IX, phospholipids, and the antimalarial actions of quinoline drugs. Life Sci. 2004 Mar 5;74(16):1957-72. [PubMed:14967191]
Pharmacological action
General Function
Not Available
Specific Function
The GPIb-V-IX complex functions as the vWF receptor and mediates vWF-dependent platelet adhesion to blood vessels. The adhesion of platelets to injured vascular surfaces in the arterial circulation...
Gene Name
Uniprot ID
Uniprot Name
Platelet glycoprotein IX
Molecular Weight
19045.87 Da
  1. Asvadi P, Ahmadi Z, Chong BH: Drug-induced thrombocytopenia: localization of the binding site of GPIX-specific quinine-dependent antibodies. Blood. 2003 Sep 1;102(5):1670-7. Epub 2003 May 8. [PubMed:12738668]
Pharmacological action
General Function
Protein phosphatase binding
Specific Function
Forms a voltage-independent potassium channel that is activated by intracellular calcium (PubMed:26148990). Activation is followed by membrane hyperpolarization which promotes calcium influx. Requi...
Gene Name
Uniprot ID
Uniprot Name
Intermediate conductance calcium-activated potassium channel protein 4
Molecular Weight
47695.12 Da
  1. Chen X, Ji ZL, Chen YZ: TTD: Therapeutic Target Database. Nucleic Acids Res. 2002 Jan 1;30(1):412-5. [PubMed:11752352]


Pharmacological action
General Function
Vitamin d3 25-hydroxylase activity
Specific Function
Cytochromes P450 are a group of heme-thiolate monooxygenases. In liver microsomes, this enzyme is involved in an NADPH-dependent electron transport pathway. It performs a variety of oxidation react...
Gene Name
Uniprot ID
Uniprot Name
Cytochrome P450 3A4
Molecular Weight
57342.67 Da
  1. Zhao XJ, Yokoyama H, Chiba K, Wanwimolruk S, Ishizaki T: Identification of human cytochrome P450 isoforms involved in the 3-hydroxylation of quinine by human live microsomes and nine recombinant human cytochromes P450. J Pharmacol Exp Ther. 1996 Dec;279(3):1327-34. [PubMed:8968357]
  2. Preissner S, Kroll K, Dunkel M, Senger C, Goldsobel G, Kuzman D, Guenther S, Winnenburg R, Schroeder M, Preissner R: SuperCYP: a comprehensive database on Cytochrome P450 enzymes including a tool for analysis of CYP-drug interactions. Nucleic Acids Res. 2010 Jan;38(Database issue):D237-43. doi: 10.1093/nar/gkp970. Epub 2009 Nov 24. [PubMed:19934256]
  3. Ekins S, Bravi G, Wikel JH, Wrighton SA: Three-dimensional-quantitative structure activity relationship analysis of cytochrome P-450 3A4 substrates. J Pharmacol Exp Ther. 1999 Oct;291(1):424-33. [PubMed:10490933]
  4. Drug Interactions: Cytochrome P450 Drug Interaction Table [Link]
Pharmacological action
General Function
Oxygen binding
Specific Function
Cytochromes P450 are a group of heme-thiolate monooxygenases. In liver microsomes, this enzyme is involved in an NADPH-dependent electron transport pathway. It oxidizes a variety of structurally un...
Gene Name
Uniprot ID
Uniprot Name
Cytochrome P450 3A5
Molecular Weight
57108.065 Da
  1. Drug Interactions: Cytochrome P450 Drug Interaction Table [Link]
Pharmacological action
General Function
Vitamin d 24-hydroxylase activity
Specific Function
Cytochromes P450 are a group of heme-thiolate monooxygenases. In liver microsomes, this enzyme is involved in an NADPH-dependent electron transport pathway. It oxidizes a variety of structurally un...
Gene Name
Uniprot ID
Uniprot Name
Cytochrome P450 1A1
Molecular Weight
58164.815 Da
  1. Preissner S, Kroll K, Dunkel M, Senger C, Goldsobel G, Kuzman D, Guenther S, Winnenburg R, Schroeder M, Preissner R: SuperCYP: a comprehensive database on Cytochrome P450 enzymes including a tool for analysis of CYP-drug interactions. Nucleic Acids Res. 2010 Jan;38(Database issue):D237-43. doi: 10.1093/nar/gkp970. Epub 2009 Nov 24. [PubMed:19934256]
4. Cytochrome P450 2D6
Pharmacological action
General Function
Steroid hydroxylase activity
Specific Function
Responsible for the metabolism of many drugs and environmental chemicals that it oxidizes. It is involved in the metabolism of drugs such as antiarrhythmics, adrenoceptor antagonists, and tricyclic...
Gene Name
Uniprot ID
Uniprot Name
Cytochrome P450 2D6
Molecular Weight
55768.94 Da
  1. Preissner S, Kroll K, Dunkel M, Senger C, Goldsobel G, Kuzman D, Guenther S, Winnenburg R, Schroeder M, Preissner R: SuperCYP: a comprehensive database on Cytochrome P450 enzymes including a tool for analysis of CYP-drug interactions. Nucleic Acids Res. 2010 Jan;38(Database issue):D237-43. doi: 10.1093/nar/gkp970. Epub 2009 Nov 24. [PubMed:19934256]
Pharmacological action
General Function
Oxidoreductase activity, acting on paired donors, with incorporation or reduction of molecular oxygen, reduced flavin or flavoprotein as one donor, and incorporation of one atom of oxygen
Specific Function
Cytochromes P450 are a group of heme-thiolate monooxygenases. In liver microsomes, this enzyme is involved in an NADPH-dependent electron transport pathway. It oxidizes a variety of structurally un...
Gene Name
Uniprot ID
Uniprot Name
Cytochrome P450 1A2
Molecular Weight
58293.76 Da
  1. Preissner S, Kroll K, Dunkel M, Senger C, Goldsobel G, Kuzman D, Guenther S, Winnenburg R, Schroeder M, Preissner R: SuperCYP: a comprehensive database on Cytochrome P450 enzymes including a tool for analysis of CYP-drug interactions. Nucleic Acids Res. 2010 Jan;38(Database issue):D237-43. doi: 10.1093/nar/gkp970. Epub 2009 Nov 24. [PubMed:19934256]
Pharmacological action
General Function
Steroid hydroxylase activity
Specific Function
Cytochromes P450 are a group of heme-thiolate monooxygenases. In liver microsomes, this enzyme is involved in an NADPH-dependent electron transport pathway. It oxidizes a variety of structurally un...
Gene Name
Uniprot ID
Uniprot Name
Cytochrome P450 2C8
Molecular Weight
55824.275 Da
  1. Preissner S, Kroll K, Dunkel M, Senger C, Goldsobel G, Kuzman D, Guenther S, Winnenburg R, Schroeder M, Preissner R: SuperCYP: a comprehensive database on Cytochrome P450 enzymes including a tool for analysis of CYP-drug interactions. Nucleic Acids Res. 2010 Jan;38(Database issue):D237-43. doi: 10.1093/nar/gkp970. Epub 2009 Nov 24. [PubMed:19934256]
Pharmacological action
General Function
Steroid hydroxylase activity
Specific Function
Cytochromes P450 are a group of heme-thiolate monooxygenases. In liver microsomes, this enzyme is involved in an NADPH-dependent electron transport pathway. It oxidizes a variety of structurally un...
Gene Name
Uniprot ID
Uniprot Name
Cytochrome P450 2C9
Molecular Weight
55627.365 Da
  1. Zhao XJ, Yokoyama H, Chiba K, Wanwimolruk S, Ishizaki T: Identification of human cytochrome P450 isoforms involved in the 3-hydroxylation of quinine by human live microsomes and nine recombinant human cytochromes P450. J Pharmacol Exp Ther. 1996 Dec;279(3):1327-34. [PubMed:8968357]
  2. Preissner S, Kroll K, Dunkel M, Senger C, Goldsobel G, Kuzman D, Guenther S, Winnenburg R, Schroeder M, Preissner R: SuperCYP: a comprehensive database on Cytochrome P450 enzymes including a tool for analysis of CYP-drug interactions. Nucleic Acids Res. 2010 Jan;38(Database issue):D237-43. doi: 10.1093/nar/gkp970. Epub 2009 Nov 24. [PubMed:19934256]
Pharmacological action
General Function
Steroid hydroxylase activity
Specific Function
Responsible for the metabolism of a number of therapeutic agents such as the anticonvulsant drug S-mephenytoin, omeprazole, proguanil, certain barbiturates, diazepam, propranolol, citalopram and im...
Gene Name
Uniprot ID
Uniprot Name
Cytochrome P450 2C19
Molecular Weight
55930.545 Da
  1. Preissner S, Kroll K, Dunkel M, Senger C, Goldsobel G, Kuzman D, Guenther S, Winnenburg R, Schroeder M, Preissner R: SuperCYP: a comprehensive database on Cytochrome P450 enzymes including a tool for analysis of CYP-drug interactions. Nucleic Acids Res. 2010 Jan;38(Database issue):D237-43. doi: 10.1093/nar/gkp970. Epub 2009 Nov 24. [PubMed:19934256]
  2. Kullak-Ublick GA, Ismair MG, Stieger B, Landmann L, Huber R, Pizzagalli F, Fattinger K, Meier PJ, Hagenbuch B: Organic anion-transporting polypeptide B (OATP-B) and its functional comparison with three other OATPs of human liver. Gastroenterology. 2001 Feb;120(2):525-33. [PubMed:11159893]
Pharmacological action
General Function
Steroid hydroxylase activity
Specific Function
Metabolizes several precarcinogens, drugs, and solvents to reactive metabolites. Inactivates a number of drugs and xenobiotics and also bioactivates many xenobiotic substrates to their hepatotoxic ...
Gene Name
Uniprot ID
Uniprot Name
Cytochrome P450 2E1
Molecular Weight
56848.42 Da
Pharmacological action
General Function
Oxygen binding
Specific Function
Cytochromes P450 are a group of heme-thiolate monooxygenases. In liver microsomes, this enzyme is involved in an NADPH-dependent electron transport pathway. It oxidizes a variety of structurally un...
Gene Name
Uniprot ID
Uniprot Name
Cytochrome P450 3A7
Molecular Weight
57525.03 Da
  1. Drug Interactions: Cytochrome P450 Drug Interaction Table [Link]


Pharmacological action
General Function
Quaternary ammonium group transmembrane transporter activity
Specific Function
Mediates tubular uptake of organic compounds from circulation. Mediates the influx of agmatine, dopamine, noradrenaline (norepinephrine), serotonin, choline, famotidine, ranitidine, histamin, creat...
Gene Name
Uniprot ID
Uniprot Name
Solute carrier family 22 member 2
Molecular Weight
62579.99 Da
  1. Sweet DH, Miller DS, Pritchard JB: Ventricular choline transport: a role for organic cation transporter 2 expressed in choroid plexus. J Biol Chem. 2001 Nov 9;276(45):41611-9. Epub 2001 Sep 11. [PubMed:11553644]
  2. Gorboulev V, Ulzheimer JC, Akhoundova A, Ulzheimer-Teuber I, Karbach U, Quester S, Baumann C, Lang F, Busch AE, Koepsell H: Cloning and characterization of two human polyspecific organic cation transporters. DNA Cell Biol. 1997 Jul;16(7):871-81. [PubMed:9260930]
  3. Kakehi M, Koyabu N, Nakamura T, Uchiumi T, Kuwano M, Ohtani H, Sawada Y: Functional characterization of mouse cation transporter mOCT2 compared with mOCT1. Biochem Biophys Res Commun. 2002 Aug 23;296(3):644-50. [PubMed:12176030]
  4. Arndt P, Volk C, Gorboulev V, Budiman T, Popp C, Ulzheimer-Teuber I, Akhoundova A, Koppatz S, Bamberg E, Nagel G, Koepsell H: Interaction of cations, anions, and weak base quinine with rat renal cation transporter rOCT2 compared with rOCT1. Am J Physiol Renal Physiol. 2001 Sep;281(3):F454-68. [PubMed:11502595]
  5. Goralski KB, Lou G, Prowse MT, Gorboulev V, Volk C, Koepsell H, Sitar DS: The cation transporters rOCT1 and rOCT2 interact with bicarbonate but play only a minor role for amantadine uptake into rat renal proximal tubules. J Pharmacol Exp Ther. 2002 Dec;303(3):959-68. [PubMed:12438515]
  6. Sweet DH, Pritchard JB: rOCT2 is a basolateral potential-driven carrier, not an organic cation/proton exchanger. Am J Physiol. 1999 Dec;277(6 Pt 2):F890-8. [PubMed:10600936]
Pharmacological action
General Function
Secondary active organic cation transmembrane transporter activity
Specific Function
Translocates a broad array of organic cations with various structures and molecular weights including the model compounds 1-methyl-4-phenylpyridinium (MPP), tetraethylammonium (TEA), N-1-methylnico...
Gene Name
Uniprot ID
Uniprot Name
Solute carrier family 22 member 1
Molecular Weight
61153.345 Da
  1. Zhang L, Dresser MJ, Gray AT, Yost SC, Terashita S, Giacomini KM: Cloning and functional expression of a human liver organic cation transporter. Mol Pharmacol. 1997 Jun;51(6):913-21. [PubMed:9187257]
  2. Zhang L, Schaner ME, Giacomini KM: Functional characterization of an organic cation transporter (hOCT1) in a transiently transfected human cell line (HeLa). J Pharmacol Exp Ther. 1998 Jul;286(1):354-61. [PubMed:9655880]
  3. Kakehi M, Koyabu N, Nakamura T, Uchiumi T, Kuwano M, Ohtani H, Sawada Y: Functional characterization of mouse cation transporter mOCT2 compared with mOCT1. Biochem Biophys Res Commun. 2002 Aug 23;296(3):644-50. [PubMed:12176030]
  4. Arndt P, Volk C, Gorboulev V, Budiman T, Popp C, Ulzheimer-Teuber I, Akhoundova A, Koppatz S, Bamberg E, Nagel G, Koepsell H: Interaction of cations, anions, and weak base quinine with rat renal cation transporter rOCT2 compared with rOCT1. Am J Physiol Renal Physiol. 2001 Sep;281(3):F454-68. [PubMed:11502595]
  5. Sweet DH, Miller DS, Pritchard JB: Ventricular choline transport: a role for organic cation transporter 2 expressed in choroid plexus. J Biol Chem. 2001 Nov 9;276(45):41611-9. Epub 2001 Sep 11. [PubMed:11553644]
  6. Goralski KB, Lou G, Prowse MT, Gorboulev V, Volk C, Koepsell H, Sitar DS: The cation transporters rOCT1 and rOCT2 interact with bicarbonate but play only a minor role for amantadine uptake into rat renal proximal tubules. J Pharmacol Exp Ther. 2002 Dec;303(3):959-68. [PubMed:12438515]
  7. Grundemann D, Gorboulev V, Gambaryan S, Veyhl M, Koepsell H: Drug excretion mediated by a new prototype of polyspecific transporter. Nature. 1994 Dec 8;372(6506):549-52. [PubMed:7990927]
  8. Martel F, Vetter T, Russ H, Grundemann D, Azevedo I, Koepsell H, Schomig E: Transport of small organic cations in the rat liver. The role of the organic cation transporter OCT1. Naunyn Schmiedebergs Arch Pharmacol. 1996 Aug-Sep;354(3):320-6. [PubMed:8878062]
  9. Busch AE, Quester S, Ulzheimer JC, Gorboulev V, Akhoundova A, Waldegger S, Lang F, Koepsell H: Monoamine neurotransmitter transport mediated by the polyspecific cation transporter rOCT1. FEBS Lett. 1996 Oct 21;395(2-3):153-6. [PubMed:8898084]
  10. Busch AE, Quester S, Ulzheimer JC, Waldegger S, Gorboulev V, Arndt P, Lang F, Koepsell H: Electrogenic properties and substrate specificity of the polyspecific rat cation transporter rOCT1. J Biol Chem. 1996 Dec 20;271(51):32599-604. [PubMed:8955087]
Pharmacological action
General Function
Symporter activity
Specific Function
Sodium-ion dependent, high affinity carnitine transporter. Involved in the active cellular uptake of carnitine. Transports one sodium ion with one molecule of carnitine. Also transports organic cat...
Gene Name
Uniprot ID
Uniprot Name
Solute carrier family 22 member 5
Molecular Weight
62751.08 Da
  1. Ohashi R, Tamai I, Yabuuchi H, Nezu JI, Oku A, Sai Y, Shimane M, Tsuji A: Na(+)-dependent carnitine transport by organic cation transporter (OCTN2): its pharmacological and toxicological relevance. J Pharmacol Exp Ther. 1999 Nov;291(2):778-84. [PubMed:10525100]
Pharmacological action
General Function
Xenobiotic-transporting atpase activity
Specific Function
Energy-dependent efflux pump responsible for decreased drug accumulation in multidrug-resistant cells.
Gene Name
Uniprot ID
Uniprot Name
Multidrug resistance protein 1
Molecular Weight
141477.255 Da
  1. Wang EJ, Casciano CN, Clement RP, Johnson WW: Active transport of fluorescent P-glycoprotein substrates: evaluation as markers and interaction with inhibitors. Biochem Biophys Res Commun. 2001 Nov 30;289(2):580-5. [PubMed:11716514]
  2. van der Sandt IC, Blom-Roosemalen MC, de Boer AG, Breimer DD: Specificity of doxorubicin versus rhodamine-123 in assessing P-glycoprotein functionality in the LLC-PK1, LLC-PK1:MDR1 and Caco-2 cell lines. Eur J Pharm Sci. 2000 Sep;11(3):207-14. [PubMed:11042226]
  3. Nagy H, Goda K, Fenyvesi F, Bacso Z, Szilasi M, Kappelmayer J, Lustyik G, Cianfriglia M, Szabo G Jr: Distinct groups of multidrug resistance modulating agents are distinguished by competition of P-glycoprotein-specific antibodies. Biochem Biophys Res Commun. 2004 Mar 19;315(4):942-9. [PubMed:14985103]
  4. Borgnia MJ, Eytan GD, Assaraf YG: Competition of hydrophobic peptides, cytotoxic drugs, and chemosensitizers on a common P-glycoprotein pharmacophore as revealed by its ATPase activity. J Biol Chem. 1996 Feb 9;271(6):3163-71. [PubMed:8621716]
Pharmacological action
General Function
Sodium-independent organic anion transmembrane transporter activity
Specific Function
Mediates the Na(+)-independent transport of organic anions such as sulfobromophthalein (BSP) and conjugated (taurocholate) and unconjugated (cholate) bile acids (By similarity). Selectively inhibit...
Gene Name
Uniprot ID
Uniprot Name
Solute carrier organic anion transporter family member 1A2
Molecular Weight
74144.105 Da
  1. Shitara Y, Sugiyama D, Kusuhara H, Kato Y, Abe T, Meier PJ, Itoh T, Sugiyama Y: Comparative inhibitory effects of different compounds on rat oatpl (slc21a1)- and Oatp2 (Slc21a5)-mediated transport. Pharm Res. 2002 Feb;19(2):147-53. [PubMed:11883641]
  2. Kullak-Ublick GA, Ismair MG, Stieger B, Landmann L, Huber R, Pizzagalli F, Fattinger K, Meier PJ, Hagenbuch B: Organic anion-transporting polypeptide B (OATP-B) and its functional comparison with three other OATPs of human liver. Gastroenterology. 2001 Feb;120(2):525-33. [PubMed:11159893]
Pharmacological action
General Function
Symporter activity
Specific Function
Sodium-ion dependent, low affinity carnitine transporter. Probably transports one sodium ion with one molecule of carnitine. Also transports organic cations such as tetraethylammonium (TEA) without...
Gene Name
Uniprot ID
Uniprot Name
Solute carrier family 22 member 4
Molecular Weight
62154.48 Da
  1. Yabuuchi H, Tamai I, Nezu J, Sakamoto K, Oku A, Shimane M, Sai Y, Tsuji A: Novel membrane transporter OCTN1 mediates multispecific, bidirectional, and pH-dependent transport of organic cations. J Pharmacol Exp Ther. 1999 May;289(2):768-73. [PubMed:10215651]

Drug created on June 13, 2005 07:24 / Updated on February 21, 2018 17:11