Accession NumberDB00468  (APRD00563)
TypeSmall Molecule

An alkaloid derived from the bark of the cinchona tree. It is used as an antimalarial drug, and is the active ingredient in extracts of the cinchona that have been used for that purpose since before 1633. Quinine is also a mild antipyretic and analgesic and has been used in common cold preparations for that purpose. It was used commonly and as a bitter and flavoring agent, and is still useful for the treatment of babesiosis. Quinine is also useful in some muscular disorders, especially nocturnal leg cramps and myotonia congenita, because of its direct effects on muscle membrane and sodium channels. The mechanisms of its antimalarial effects are not well understood. [PubChem]

External IDs UNII-KF7Z0E0Q2B
Product Ingredients
IngredientUNIICASInChI KeyDetails
Quinine citrateL8D5LFU229 752-72-7YSFIPRFOHJQXJF-VMJVVOMYSA-NDetails
Quinine Hydrochloride711S8Y0T33 6119-47-7MPQKYZPYCSTMEI-FLZPLBAKSA-NDetails
Quinine phosphate0E9UD56A3I 549-60-0JGWCVXDJEMKYEA-INGJVHGESA-NDetails
Quinine sulfateM4XCR57IWG 804-63-7RONWGALEIBILOG-VMJVVOMYSA-NDetails
Approved Prescription Products
NameDosageStrengthRouteLabellerMarketing StartMarketing End
Jamp-quinineCapsule200 mgOralJamp Pharma Corporation2015-09-16Not applicableCanada
Jamp-quinineCapsule300 mgOralJamp Pharma Corporation2015-09-16Not applicableCanada
Pro-quinine - 200Capsule200 mgOralPro Doc Limitee2008-07-03Not applicableCanada
Pro-quinine - 300Capsule300 mgOralPro Doc Limitee2008-07-03Not applicableCanada
QualaquinCapsule324 mg/1OralAR Scientific, Inc.2005-08-12Not applicableUs
QualaquinCapsule324 mg/1OralStat Rx USA2005-08-12Not applicableUs
QualaquinCapsule324 mg/1OralCaraco Pharma, Inc.2005-08-12Not applicableUs
Quinine - OdanCapsule300 mgOralOdan Laboratories Ltd1999-05-01Not applicableCanada
Quinine - OdanTablet300 mgOralOdan Laboratories Ltd2001-11-08Not applicableCanada
Quinine - OdanCapsule200 mgOralOdan Laboratories Ltd1999-05-01Not applicableCanada
Quinine SulfateCapsule324 mg/1OralMutual Pharmaceutical2012-07-23Not applicableUs
Quinine SulfateCapsule300 mgOralPendopharm Division Of De Pharmascience IncNot applicableNot applicableCanada
Quinine SulfateCapsule324 mg/1OralAmerincan Health Packaging2015-03-31Not applicableUs
Quinine SulfateCapsule200 mgOralPendopharm Division Of De Pharmascience IncNot applicableNot applicableCanada
Quinine Sulfate Cap 200mgCapsule200 mgOralStanley Pharmaceuticals, A Division Of Vita Health Products Inc.1957-12-312001-07-20Canada
Quinine Sulfate Cap 200mgCapsule200 mgOralParke Davis Division, Warner Lambert Canada Inc.1951-12-311998-04-07Canada
Quinine Sulfate Cap 300mgCapsule300 mgOralStanley Pharmaceuticals, A Division Of Vita Health Products Inc.1957-12-312001-07-20Canada
Quinine Sulfate Cap 300mgCapsule300 mgOralParke Davis Division, Warner Lambert Canada Inc.1951-12-311998-04-07Canada
Quinine Sulfate Capsules 200mgCapsule200 mgOralD.C. Labs Limited1951-12-312002-04-23Canada
Quinine Sulfate Capsules 300mgCapsule300 mgOralD.C. Labs Limited1951-12-312002-04-23Canada
Teva-quinineCapsule200 mgOralTeva1966-12-31Not applicableCanada
Teva-quinineCapsule300 mgOralTeva1966-12-31Not applicableCanada
Approved Generic Prescription Products
NameDosageStrengthRouteLabellerMarketing StartMarketing End
Apo-quinine CapsulesCapsule200 mgOralApotex Corporation2004-06-08Not applicableCanada
Apo-quinine CapsulesCapsule300 mgOralApotex Corporation2004-06-08Not applicableCanada
Quinine SulfateCapsule324 mg/1OralTeva2012-09-28Not applicableUs
Quinine SulfateCapsule324 mg/1OralAmneal Pharmaceuticals of New York Llc2016-07-29Not applicableUs
Quinine SulfateCapsule324 mg/1OralLupin Pharmaceuticals2015-08-04Not applicableUs
Quinine SulfateCapsule324 mg/1OralMylan Pharmaceuticals2012-12-14Not applicableUs
Quinine SulfateCapsule324 mg/1OralRiconpharma Llc2015-07-23Not applicableUs
Quinine SulfateCapsule324 mg/1OralIngenus Pharmaceuticals Nj, Llc2015-07-23Not applicableUs
Quinine SulfateCapsule324 mg/1OralCore Pharma, Llc2015-07-23Not applicableUs
Approved Over the Counter ProductsNot Available
Unapproved/Other Products Not Available
International Brands
QutilLittle Greave
Brand mixturesNot Available
CAS number130-95-0
WeightAverage: 324.4168
Monoisotopic: 324.183778022
Chemical FormulaC20H24N2O2
[H][C@]1(C[C@@H]2CC[N@]1C[C@@H]2C=C)[[email protected]](O)C1=CC=NC2=CC=C(OC)C=C12

For the treatment of malaria and leg cramps

Structured Indications

Quinine is used parenterally to treat life-threatening infections caused by chloroquine-resistant Plasmodium falciparum malaria. Quinine acts as a blood schizonticide although it also has gametocytocidal activity against P. vivax and P. malariae. Because it is a weak base, it is concentrated in the food vacuoles of P. falciparum. It is thought to act by inhibiting heme polymerase, thereby allowing accumulation of its cytotoxic substrate, heme. As a schizonticidal drug, it is less effective and more toxic than chloroquine. However, it has a special place in the management of severe falciparum malaria in areas with known resistance to chloroquine.

Mechanism of action

The theorized mechanism of action for quinine and related anti-malarial drugs is that these drugs are toxic to the malaria parasite. Specifically, the drugs interfere with the parasite's ability to break down and digest hemoglobin. Consequently, the parasite starves and/or builds up toxic levels of partially degraded hemoglobin in itself.

TargetKindPharmacological actionActionsOrganismUniProt ID
Fe(II)-protoporphyrin IXSmall moleculeyes
Plasmodium falciparumnot applicabledetails
Platelet glycoprotein IXProteinunknown
HumanP14770 details
Intermediate conductance calcium-activated potassium channel protein 4Proteinunknown
HumanO15554 details
Related Articles

76 - 88%

Volume of distribution
  • 1.43 ± 0.18 L/kg [Healthy Pediatric Controls]
  • 0.87 ± 0.12 L/kg [P. falciparum Malaria Pediatric Patients]
  • 2.5 to 7.1 L/kg [healthy subjects who received a single oral 600 mg dose]
Protein binding

Approximately 70%


Hepatic, over 80% metabolized by the liver.

Route of elimination

Quinine is eliminated primarily via hepatic biotransformation. Approximately 20% of quinine is excreted unchanged in urine.

Half life

Approximately 18 hours

  • 0.17 L/h/kg [healthy]
  • 0.09 L/h/kg [patients with uncomplicated malaria]
  • 18.4 L/h [healthy adult subjects with administration of multiple-dose activated charcoal]
  • 11.8 L/h [healthy adult subjects without administration of multiple-dose activated charcoal]
  • Oral cl=0.06 L/h/kg [elderly subjects]

Quinine is a documented causative agent of drug induced thrombocytopenia (DIT). Thrombocytopenia is a low amount of platelets in the blood. Quinine induces production of antibodies against glycoprotein (GP) Ib-IX complex in the majority of cases of DIT, or more rarely, the platelet-glycoprotein complex GPIIb-IIIa. Increased antibodies against these complexes increases platelet clearance, leading to the observed thrombocytopenia.

Affected organisms
  • Humans and other mammals
PathwaysNot Available
Pharmacogenomic Effects/ADRs
Interacting Gene/EnzymeAllele nameGenotype(s)Defining Change(s)Type(s)DescriptionDetails
Glucose-6-phosphate 1-dehydrogenaseVilleurbanneNot Available1000_1002delACCADR InferredIncreased risk of hemolysis. Details
Glucose-6-phosphate 1-dehydrogenaseTorunNot Available1006A->GADR InferredIncreased risk of hemolysis. Details
Glucose-6-phosphate 1-dehydrogenaseSunderlandNot Available105_107delCATADR InferredIncreased risk of hemolysis. Details
Glucose-6-phosphate 1-dehydrogenaseIwatsukiNot Available1081G->AADR InferredIncreased risk of hemolysis. Details
Glucose-6-phosphate 1-dehydrogenaseSerresNot Available1082C->TADR InferredIncreased risk of hemolysis. Details
Glucose-6-phosphate 1-dehydrogenaseTondelaNot Available1084_1101delCTGAACGAGCGCAAGGCCADR InferredIncreased risk of hemolysis. Details
Glucose-6-phosphate 1-dehydrogenaseLoma LindaNot Available1089C->AADR InferredIncreased risk of hemolysis. Details
Glucose-6-phosphate 1-dehydrogenaseAachenNot Available1089C->GADR InferredIncreased risk of hemolysis. Details
Glucose-6-phosphate 1-dehydrogenaseTenriNot Available1096A->GADR InferredIncreased risk of hemolysis. Details
Glucose-6-phosphate 1-dehydrogenaseMontpellierNot Available1132G>AADR InferredIncreased risk of hemolysis. Details
Glucose-6-phosphate 1-dehydrogenaseCalvo MackennaNot Available1138A->GADR InferredIncreased risk of hemolysis. Details
Glucose-6-phosphate 1-dehydrogenaseRileyNot Available1139T->CADR InferredIncreased risk of hemolysis. Details
Glucose-6-phosphate 1-dehydrogenaseOlomoucNot Available1141T->CADR InferredIncreased risk of hemolysis. Details
Glucose-6-phosphate 1-dehydrogenaseTomahNot Available1153T->CADR InferredIncreased risk of hemolysis. Details
Glucose-6-phosphate 1-dehydrogenaseLynwoodNot Available1154G->TADR InferredIncreased risk of hemolysis. Details
Glucose-6-phosphate 1-dehydrogenaseMadridNot Available1155C->GADR InferredIncreased risk of hemolysis. Details
Glucose-6-phosphate 1-dehydrogenaseIowa, Walter Reed, SpringfieldNot Available1156A->GADR InferredIncreased risk of hemolysis. Details
Glucose-6-phosphate 1-dehydrogenaseBeverly Hills, Genova, Iwate, Niigata, YamaguchiNot Available1160G->AADR InferredIncreased risk of hemolysis. Details
Glucose-6-phosphate 1-dehydrogenaseHartfordNot Available1162A->GADR InferredIncreased risk of hemolysis. Details
Glucose-6-phosphate 1-dehydrogenasePrahaNot Available1166A->GADR InferredIncreased risk of hemolysis. Details
Glucose-6-phosphate 1-dehydrogenaseKrakowNot Available1175T>CADR InferredIncreased risk of hemolysis. Details
Glucose-6-phosphate 1-dehydrogenaseWisconsinNot Available1177C->GADR InferredIncreased risk of hemolysis. Details
Glucose-6-phosphate 1-dehydrogenaseNashville, Anaheim, PorticiNot Available1178G->AADR InferredIncreased risk of hemolysis. Details
Glucose-6-phosphate 1-dehydrogenaseAlhambraNot Available1180G->CADR InferredIncreased risk of hemolysis. Details
Glucose-6-phosphate 1-dehydrogenaseBariNot Available1187C->TADR InferredIncreased risk of hemolysis. Details
Glucose-6-phosphate 1-dehydrogenasePuerto LimonNot Available1192G->AADR InferredIncreased risk of hemolysis. Details
Glucose-6-phosphate 1-dehydrogenaseCovao do LoboNot Available1205C>AADR InferredIncreased risk of hemolysis. Details
Glucose-6-phosphate 1-dehydrogenaseClinicNot Available1215G->AADR InferredIncreased risk of hemolysis. Details
Glucose-6-phosphate 1-dehydrogenaseUtrechtNot Available1225C->TADR InferredIncreased risk of hemolysis. Details
Glucose-6-phosphate 1-dehydrogenaseSuwalkiNot Available1226C->GADR InferredIncreased risk of hemolysis. Details
Glucose-6-phosphate 1-dehydrogenaseRiversideNot Available1228G->TADR InferredIncreased risk of hemolysis. Details
Glucose-6-phosphate 1-dehydrogenaseJapan, ShinagawaNot Available1229G->AADR InferredIncreased risk of hemolysis. Details
Glucose-6-phosphate 1-dehydrogenaseKawasakiNot Available1229G->CADR InferredIncreased risk of hemolysis. Details
Glucose-6-phosphate 1-dehydrogenaseMunichNot Available1231A->GADR InferredIncreased risk of hemolysis. Details
Glucose-6-phosphate 1-dehydrogenaseGeorgiaNot Available1284C->AADR InferredIncreased risk of hemolysis. Details
Glucose-6-phosphate 1-dehydrogenaseSumareNot Available1292T->GADR InferredIncreased risk of hemolysis. Details
Glucose-6-phosphate 1-dehydrogenaseTelti/KobeNot Available1318C->TADR InferredIncreased risk of hemolysis. Details
Glucose-6-phosphate 1-dehydrogenaseSantiago de Cuba, MoriokaNot Available1339G->AADR InferredIncreased risk of hemolysis. Details
Glucose-6-phosphate 1-dehydrogenaseHarimaNot Available1358T->AADR InferredIncreased risk of hemolysis. Details
Glucose-6-phosphate 1-dehydrogenaseFiguera da FozNot Available1366G->CADR InferredIncreased risk of hemolysis. Details
Glucose-6-phosphate 1-dehydrogenaseAmiensNot Available1367A>TADR InferredIncreased risk of hemolysis. Details
Glucose-6-phosphate 1-dehydrogenaseBangkok NoiNot Available1376G->T, 1502T->GADR InferredIncreased risk of hemolysis. Details
Glucose-6-phosphate 1-dehydrogenaseFukayaNot Available1462G->AADR InferredIncreased risk of hemolysis. Details
Glucose-6-phosphate 1-dehydrogenaseCampinasNot Available1463G->TADR InferredIncreased risk of hemolysis. Details
Glucose-6-phosphate 1-dehydrogenaseBuenos AiresNot Available1465C>TADR InferredIncreased risk of hemolysis. Details
Glucose-6-phosphate 1-dehydrogenaseArakawaNot Available1466C->TADR InferredIncreased risk of hemolysis. Details
Glucose-6-phosphate 1-dehydrogenaseBrightonNot Available1488_1490delGAAADR InferredIncreased risk of hemolysis. Details
Glucose-6-phosphate 1-dehydrogenaseKozukataNot Available159G->CADR InferredIncreased risk of hemolysis. Details
Glucose-6-phosphate 1-dehydrogenaseAmsterdamNot Available180_182delTCTADR InferredIncreased risk of hemolysis. Details
Glucose-6-phosphate 1-dehydrogenaseNo nameNot Available202G->A, 376A->G, 1264C>GADR InferredIncreased risk of hemolysis. Details
Glucose-6-phosphate 1-dehydrogenaseSwanseaNot Available224T->CADR InferredIncreased risk of hemolysis. Details
Glucose-6-phosphate 1-dehydrogenaseUrayasuNot Available281_283delAGAADR InferredIncreased risk of hemolysis. Details
Glucose-6-phosphate 1-dehydrogenaseVancouverNot Available317C->G544C->T592C->TADR InferredIncreased risk of hemolysis. Details
Glucose-6-phosphate 1-dehydrogenaseMt SinaiNot Available376A->G, 1159C->TADR InferredIncreased risk of hemolysis. Details
Glucose-6-phosphate 1-dehydrogenasePlymouthNot Available488G->AADR InferredIncreased risk of hemolysis. Details
Glucose-6-phosphate 1-dehydrogenaseVolendamNot Available514C->TADR InferredIncreased risk of hemolysis. Details
Glucose-6-phosphate 1-dehydrogenaseShinshuNot Available527A->GADR InferredIncreased risk of hemolysis. Details
Glucose-6-phosphate 1-dehydrogenaseChikugoNot Available535A->TADR InferredIncreased risk of hemolysis. Details
Glucose-6-phosphate 1-dehydrogenaseTsukuiNot Available561_563delCTCADR InferredIncreased risk of hemolysis. Details
Glucose-6-phosphate 1-dehydrogenasePedoplis-CkaroNot Available573C>GADR InferredIncreased risk of hemolysis. Details
Glucose-6-phosphate 1-dehydrogenaseSantiagoNot Available593G->CADR InferredIncreased risk of hemolysis. Details
Glucose-6-phosphate 1-dehydrogenaseMinnesota, Marion, Gastonia, LeJeuneNot Available637G->TADR InferredIncreased risk of hemolysis. Details
Glucose-6-phosphate 1-dehydrogenaseCincinnatiNot Available637G->T, 1037A->TADR InferredIncreased risk of hemolysis. Details
Glucose-6-phosphate 1-dehydrogenaseHarilaouNot Available648T->GADR InferredIncreased risk of hemolysis. Details
Glucose-6-phosphate 1-dehydrogenaseNorth DallasNot Available683_685delACAADR InferredIncreased risk of hemolysis. Details
Glucose-6-phosphate 1-dehydrogenaseAsahikawaNot Available695G->AADR InferredIncreased risk of hemolysis. Details
Glucose-6-phosphate 1-dehydrogenaseDurhamNot Available713A->GADR InferredIncreased risk of hemolysis. Details
Glucose-6-phosphate 1-dehydrogenaseStonybrookNot Available724_729delGGCACTADR InferredIncreased risk of hemolysis. Details
Glucose-6-phosphate 1-dehydrogenaseWayneNot Available769C->GADR InferredIncreased risk of hemolysis. Details
Glucose-6-phosphate 1-dehydrogenaseAveiroNot Available806G->AADR InferredIncreased risk of hemolysis. Details
Glucose-6-phosphate 1-dehydrogenaseCleveland CorumNot Available820G->AADR InferredIncreased risk of hemolysis. Details
Glucose-6-phosphate 1-dehydrogenaseLilleNot Available821A>TADR InferredIncreased risk of hemolysis. Details
Glucose-6-phosphate 1-dehydrogenaseBangkokNot Available825G>CADR InferredIncreased risk of hemolysis. Details
Glucose-6-phosphate 1-dehydrogenaseSugaoNot Available826C->TADR InferredIncreased risk of hemolysis. Details
Glucose-6-phosphate 1-dehydrogenaseLa JollaNot Available832T->CADR InferredIncreased risk of hemolysis. Details
Glucose-6-phosphate 1-dehydrogenaseWexhamNot Available833C->TADR InferredIncreased risk of hemolysis. Details
Glucose-6-phosphate 1-dehydrogenasePiotrkowNot Available851T>CADR InferredIncreased risk of hemolysis. Details
Glucose-6-phosphate 1-dehydrogenaseWest VirginiaNot Available910G->TADR InferredIncreased risk of hemolysis. Details
Glucose-6-phosphate 1-dehydrogenaseOmiyaNot Available921G->CADR InferredIncreased risk of hemolysis. Details
Glucose-6-phosphate 1-dehydrogenaseNaraNot Available953_976delCCACCAAAGGGTACCTGGAC GACCADR InferredIncreased risk of hemolysis. Details
Glucose-6-phosphate 1-dehydrogenaseManhattanNot Available962G->AADR InferredIncreased risk of hemolysis. Details
Glucose-6-phosphate 1-dehydrogenaseRehevotNot Available964T->CADR InferredIncreased risk of hemolysis. Details
Glucose-6-phosphate 1-dehydrogenaseHoniaraNot Available99A->G / 1360C->TADR InferredIncreased risk of hemolysis. Details
Glucose-6-phosphate 1-dehydrogenaseTokyo, FukushimaNot Available1246G->AADR InferredIncreased risk of hemolysis. Details
Glucose-6-phosphate 1-dehydrogenaseChathamNot Available1003G->AADR InferredIncreased risk of hemolysis. Details
Glucose-6-phosphate 1-dehydrogenaseFushanNot Available1004C->AADR InferredIncreased risk of hemolysis. Details
Glucose-6-phosphate 1-dehydrogenasePartenopeNot Available1052G->TADR InferredIncreased risk of hemolysis. Details
Glucose-6-phosphate 1-dehydrogenaseIerapetraNot Available1057C->TADR InferredIncreased risk of hemolysis. Details
Glucose-6-phosphate 1-dehydrogenaseAnadiaNot Available1193A->GADR InferredIncreased risk of hemolysis. Details
Glucose-6-phosphate 1-dehydrogenaseAbenoNot Available1220A->CADR InferredIncreased risk of hemolysis. Details
Glucose-6-phosphate 1-dehydrogenaseSurabayaNot Available1291G->AADR InferredIncreased risk of hemolysis. Details
Glucose-6-phosphate 1-dehydrogenasePawneeNot Available1316G->CADR InferredIncreased risk of hemolysis. Details
Glucose-6-phosphate 1-dehydrogenaseS. AntiocoNot Available1342A->GADR InferredIncreased risk of hemolysis. Details
Glucose-6-phosphate 1-dehydrogenaseCassanoNot Available1347G->CADR InferredIncreased risk of hemolysis. Details
Glucose-6-phosphate 1-dehydrogenaseHermoupolisNot Available1347G->C / 1360C->TADR InferredIncreased risk of hemolysis. Details
Glucose-6-phosphate 1-dehydrogenaseUnion,Maewo, Chinese-2, KaloNot Available1360C->TADR InferredIncreased risk of hemolysis. Details
Glucose-6-phosphate 1-dehydrogenaseAndalusNot Available1361G->AADR InferredIncreased risk of hemolysis. Details
Glucose-6-phosphate 1-dehydrogenaseCosenzaNot Available1376G->CADR InferredIncreased risk of hemolysis. Details
Glucose-6-phosphate 1-dehydrogenaseCanton, Taiwan- Hakka, Gifu-like, Agrigento-likeNot Available1376G->TADR InferredIncreased risk of hemolysis. Details
Glucose-6-phosphate 1-dehydrogenaseFloresNot Available1387C->AADR InferredIncreased risk of hemolysis. Details
Glucose-6-phosphate 1-dehydrogenaseKaiping, Anant, Dhon, Sapporo-like, WoseraNot Available1388G->AADR InferredIncreased risk of hemolysis. Details
Glucose-6-phosphate 1-dehydrogenaseKamogawaNot Available169C->TADR InferredIncreased risk of hemolysis. Details
Glucose-6-phosphate 1-dehydrogenaseCostanzoNot Available179T>CADR InferredIncreased risk of hemolysis. Details
Glucose-6-phosphate 1-dehydrogenaseAmazoniaNot Available185C->AADR InferredIncreased risk of hemolysis. Details
Glucose-6-phosphate 1-dehydrogenaseSongklanagarindNot Available196T->AADR InferredIncreased risk of hemolysis. Details
Glucose-6-phosphate 1-dehydrogenaseHechiNot Available202G->A / 871G->AADR InferredIncreased risk of hemolysis. Details
Glucose-6-phosphate 1-dehydrogenaseNamouruNot Available208T->CADR InferredIncreased risk of hemolysis. Details
Glucose-6-phosphate 1-dehydrogenaseBao LocNot Available352T>CADR InferredIncreased risk of hemolysis. Details
Glucose-6-phosphate 1-dehydrogenaseCrispimNot Available375G->T, 379G->T383T->C384C>TADR InferredIncreased risk of hemolysis. Details
Glucose-6-phosphate 1-dehydrogenaseAcrokorinthosNot Available376A->G / 463C->GADR InferredIncreased risk of hemolysis. Details
Glucose-6-phosphate 1-dehydrogenaseSanta MariaNot Available376A->G / 542A->TADR InferredIncreased risk of hemolysis. Details
Glucose-6-phosphate 1-dehydrogenaseAnanindeuaNot Available376A->G / 871G->AADR InferredIncreased risk of hemolysis. Details
Glucose-6-phosphate 1-dehydrogenaseVanua LavaNot Available383T->CADR InferredIncreased risk of hemolysis. Details
Glucose-6-phosphate 1-dehydrogenaseValladolidNot Available406C->TADR InferredIncreased risk of hemolysis. Details
Glucose-6-phosphate 1-dehydrogenaseBelemNot Available409C->TADR InferredIncreased risk of hemolysis. Details
Glucose-6-phosphate 1-dehydrogenaseLiuzhouNot Available442G->AADR InferredIncreased risk of hemolysis. Details
Glucose-6-phosphate 1-dehydrogenaseShenzenNot Available473G>AADR InferredIncreased risk of hemolysis. Details
Glucose-6-phosphate 1-dehydrogenaseTaipei “Chinese- 3”Not Available493A->GADR InferredIncreased risk of hemolysis. Details
Glucose-6-phosphate 1-dehydrogenaseToledoNot Available496C>TADR InferredIncreased risk of hemolysis. Details
Glucose-6-phosphate 1-dehydrogenaseNaoneNot Available497G->AADR InferredIncreased risk of hemolysis. Details
Glucose-6-phosphate 1-dehydrogenaseNankangNot Available517T->CADR InferredIncreased risk of hemolysis. Details
Glucose-6-phosphate 1-dehydrogenaseMiaoliNot Available519C->GADR InferredIncreased risk of hemolysis. Details
Glucose-6-phosphate 1-dehydrogenaseMediterranean, Dallas, Panama‚ Sassari, Cagliari, BirminghamNot Available563C->TADR InferredIncreased risk of hemolysis. Details
Glucose-6-phosphate 1-dehydrogenaseCoimbra ShundeNot Available592C->TADR InferredIncreased risk of hemolysis. Details
Glucose-6-phosphate 1-dehydrogenaseNilgiriNot Available593G>AADR InferredIncreased risk of hemolysis. Details
Glucose-6-phosphate 1-dehydrogenaseRadlowoNot Available679C->TADR InferredIncreased risk of hemolysis. Details
Glucose-6-phosphate 1-dehydrogenaseRoubaixNot Available811G>CADR InferredIncreased risk of hemolysis. Details
Glucose-6-phosphate 1-dehydrogenaseHaikouNot Available835A->GADR InferredIncreased risk of hemolysis. Details
Glucose-6-phosphate 1-dehydrogenaseChinese-1Not Available835A->TADR InferredIncreased risk of hemolysis. Details
Glucose-6-phosphate 1-dehydrogenaseMizushimaNot Available848A>GADR InferredIncreased risk of hemolysis. Details
Glucose-6-phosphate 1-dehydrogenaseOsakaNot Available853C->TADR InferredIncreased risk of hemolysis. Details
Glucose-6-phosphate 1-dehydrogenaseViangchan, JammuNot Available871G->AADR InferredIncreased risk of hemolysis. Details
Glucose-6-phosphate 1-dehydrogenaseSeoulNot Available916G->AADR InferredIncreased risk of hemolysis. Details
Glucose-6-phosphate 1-dehydrogenaseLudhianaNot Available929G->AADR InferredIncreased risk of hemolysis. Details
Glucose-6-phosphate 1-dehydrogenaseFarroupilhaNot Available977C->AADR InferredIncreased risk of hemolysis. Details
Glucose-6-phosphate 1-dehydrogenaseChinese-5Not Available1024C->TADR InferredIncreased risk of hemolysis. Details
Glucose-6-phosphate 1-dehydrogenaseRignanoNot Available130G>AADR InferredIncreased risk of hemolysis. Details
Glucose-6-phosphate 1-dehydrogenaseOrissaNot Available131C->GADR InferredIncreased risk of hemolysis. Details
Glucose-6-phosphate 1-dehydrogenaseG6PDNiceNot Available1380G>CADR InferredIncreased risk of hemolysis. Details
Glucose-6-phosphate 1-dehydrogenaseKamiube, KeelungNot Available1387C->TADR InferredIncreased risk of hemolysis. Details
Glucose-6-phosphate 1-dehydrogenaseNeapolisNot Available1400C->GADR InferredIncreased risk of hemolysis. Details
Glucose-6-phosphate 1-dehydrogenaseAuresNot Available143T->CADR InferredIncreased risk of hemolysis. Details
Glucose-6-phosphate 1-dehydrogenaseSplitNot Available1442C->GADR InferredIncreased risk of hemolysis. Details
Glucose-6-phosphate 1-dehydrogenaseKambosNot Available148C->TADR InferredIncreased risk of hemolysis. Details
Glucose-6-phosphate 1-dehydrogenasePalestrinaNot Available170G>AADR InferredIncreased risk of hemolysis. Details
Glucose-6-phosphate 1-dehydrogenaseMetapontoNot Available172G->AADR InferredIncreased risk of hemolysis. Details
Glucose-6-phosphate 1-dehydrogenaseMusashinoNot Available185C->TADR InferredIncreased risk of hemolysis. Details
Glucose-6-phosphate 1-dehydrogenaseAsahiNot Available202G->AADR InferredIncreased risk of hemolysis. Details
Glucose-6-phosphate 1-dehydrogenaseA- (202), Ferrara INot Available202G->A / 376A->GADR InferredIncreased risk of hemolysis. Details
Glucose-6-phosphate 1-dehydrogenaseMurcia OristanoNot Available209A->GADR InferredIncreased risk of hemolysis. Details
Glucose-6-phosphate 1-dehydrogenaseUbe KonanNot Available241C->TADR InferredIncreased risk of hemolysis. Details
Glucose-6-phosphate 1-dehydrogenaseLagosantoNot Available242G->AADR InferredIncreased risk of hemolysis. Details
Glucose-6-phosphate 1-dehydrogenaseGuangzhouNot Available274C->TADR InferredIncreased risk of hemolysis. Details
Glucose-6-phosphate 1-dehydrogenaseHammersmithNot Available323T->AADR InferredIncreased risk of hemolysis. Details
Glucose-6-phosphate 1-dehydrogenaseSinnaiNot Available34G->TADR InferredIncreased risk of hemolysis. Details
Glucose-6-phosphate 1-dehydrogenaseA- (680)Not Available376A->G / 680G->TADR InferredIncreased risk of hemolysis. Details
Glucose-6-phosphate 1-dehydrogenaseA- (968), Betica,Selma, GuantanamoNot Available376A->G / 968T->CADR InferredIncreased risk of hemolysis. Details
Glucose-6-phosphate 1-dehydrogenaseSalerno PyrgosNot Available383T>GADR InferredIncreased risk of hemolysis. Details
Glucose-6-phosphate 1-dehydrogenaseQuing YanNot Available392G->TADR InferredIncreased risk of hemolysis. Details
Glucose-6-phosphate 1-dehydrogenaseLagesNot Available40G->AADR InferredIncreased risk of hemolysis. Details
Glucose-6-phosphate 1-dehydrogenaseIleshaNot Available466G->AADR InferredIncreased risk of hemolysis. Details
Glucose-6-phosphate 1-dehydrogenaseMahidolNot Available487G->AADR InferredIncreased risk of hemolysis. Details
Glucose-6-phosphate 1-dehydrogenaseMalagaNot Available542A->TADR InferredIncreased risk of hemolysis. Details
Glucose-6-phosphate 1-dehydrogenaseSibariNot Available634A->GADR InferredIncreased risk of hemolysis. Details
Glucose-6-phosphate 1-dehydrogenaseMexico CityNot Available680G->AADR InferredIncreased risk of hemolysis. Details
Glucose-6-phosphate 1-dehydrogenaseNanningNot Available703C->TADR InferredIncreased risk of hemolysis. Details
Glucose-6-phosphate 1-dehydrogenaseSeattle, Lodi, Modena, Ferrara II, Athens-likeNot Available844G->CADR InferredIncreased risk of hemolysis. Details
Glucose-6-phosphate 1-dehydrogenaseBajo MaumereNot Available844G->TADR InferredIncreased risk of hemolysis. Details
Glucose-6-phosphate 1-dehydrogenaseMontalbanoNot Available854G->AADR InferredIncreased risk of hemolysis. Details
Glucose-6-phosphate 1-dehydrogenaseKalyan-Kerala, Jamnaga, RohiniNot Available949G->AADR InferredIncreased risk of hemolysis. Details
Glucose-6-phosphate 1-dehydrogenaseGaoheNot Available95A->GADR InferredIncreased risk of hemolysis. Details
Drug Interactions
DrugInteractionDrug group
4-MethoxyamphetamineThe metabolism of 4-Methoxyamphetamine can be decreased when combined with Quinine.Experimental, Illicit
7,8-DICHLORO-1,2,3,4-TETRAHYDROISOQUINOLINE7,8-DICHLORO-1,2,3,4-TETRAHYDROISOQUINOLINE may increase the hypoglycemic activities of Quinine.Experimental
AbirateroneThe serum concentration of Quinine can be increased when it is combined with Abiraterone.Approved
AcarboseAcarbose may increase the hypoglycemic activities of Quinine.Approved, Investigational
AcebutololQuinine may increase the hypotensive activities of Acebutolol.Approved
AceclofenacThe metabolism of Aceclofenac can be decreased when combined with Quinine.Approved
AcenocoumarolQuinine may increase the anticoagulant activities of Acenocoumarol.Approved
AcepromazineThe serum concentration of Acepromazine can be increased when it is combined with Quinine.Approved, Vet Approved
AceprometazineThe serum concentration of Aceprometazine can be increased when it is combined with Quinine.Approved
AcetaminophenThe serum concentration of Acetaminophen can be increased when it is combined with Quinine.Approved
AcetohexamideAcetohexamide may increase the hypoglycemic activities of Quinine.Withdrawn
AcetylcholineThe metabolism of Acetylcholine can be decreased when combined with Quinine.Approved
Acetylsalicylic acidThe serum concentration of Acetylsalicylic acid can be increased when it is combined with Quinine.Approved, Vet Approved
AfatinibThe serum concentration of Afatinib can be increased when it is combined with Quinine.Approved
AICA ribonucleotideAicar may increase the hypoglycemic activities of Quinine.Experimental
AjmalineThe metabolism of Ajmaline can be decreased when combined with Quinine.Approved
AlbendazoleThe serum concentration of Quinine can be increased when it is combined with Albendazole.Approved, Vet Approved
AldosteroneThe serum concentration of Quinine can be decreased when it is combined with Aldosterone.Experimental
AlectinibThe serum concentration of Quinine can be increased when it is combined with Alectinib.Approved
AlfentanilThe serum concentration of Quinine can be increased when it is combined with Alfentanil.Approved, Illicit
AlfuzosinAlfuzosin may increase the QTc-prolonging activities of Quinine.Approved, Investigational
AlimemazineThe serum concentration of Alimemazine can be increased when it is combined with Quinine.Approved, Vet Approved
AliskirenQuinine may increase the hypotensive activities of Aliskiren.Approved, Investigational
AlitretinoinThe serum concentration of Alitretinoin can be increased when it is combined with Quinine.Approved, Investigational
AlmotriptanThe metabolism of Almotriptan can be decreased when combined with Quinine.Approved, Investigational
AlogliptinThe metabolism of Alogliptin can be decreased when combined with Quinine.Approved
AlosetronThe metabolism of Alosetron can be decreased when combined with Quinine.Approved, Withdrawn
AlprazolamThe metabolism of Alprazolam can be decreased when combined with Quinine.Approved, Illicit, Investigational
AlprenololQuinine may increase the hypotensive activities of Alprenolol.Approved, Withdrawn
Aluminum hydroxideThe serum concentration of Quinine can be decreased when it is combined with Aluminum hydroxide.Approved
AmantadineAmantadine may increase the QTc-prolonging activities of Quinine.Approved
AmbrisentanQuinine may increase the hypotensive activities of Ambrisentan.Approved, Investigational
Ambroxol acefyllinateThe serum concentration of Ambroxol acefyllinate can be increased when it is combined with Quinine.Experimental
Aminohippuric acidThe serum concentration of Quinine can be increased when it is combined with Aminohippuric acid.Approved
AminophenazoneThe metabolism of Aminophenazone can be decreased when combined with Quinine.Approved, Withdrawn
AminophyllineThe serum concentration of Aminophylline can be increased when it is combined with Quinine.Approved
Aminosalicylic AcidAminosalicylic Acid may increase the hypoglycemic activities of Quinine.Approved
AmiodaroneQuinine may increase the QTc-prolonging activities of Amiodarone.Approved, Investigational
AmitriptylineAmitriptyline may increase the QTc-prolonging activities of Quinine.Approved
AmlodipineQuinine may increase the hypotensive activities of Amlodipine.Approved
AmodiaquineThe serum concentration of Amodiaquine can be increased when it is combined with Quinine.Approved
AmoxapineAmoxapine may increase the QTc-prolonging activities of Quinine.Approved
AmphetamineThe metabolism of Amphetamine can be decreased when combined with Quinine.Approved, Illicit
AmprenavirThe serum concentration of Quinine can be decreased when it is combined with Amprenavir.Approved
AmsacrineThe serum concentration of Quinine can be increased when it is combined with Amsacrine.Approved
AnagrelideAnagrelide may increase the QTc-prolonging activities of Quinine.Approved
AntipyrineThe metabolism of Antipyrine can be decreased when combined with Quinine.Approved
ApixabanThe serum concentration of Apixaban can be increased when it is combined with Quinine.Approved
ApomorphineApomorphine may increase the QTc-prolonging activities of Quinine.Approved, Investigational
AprepitantThe serum concentration of Quinine can be increased when it is combined with Aprepitant.Approved, Investigational
AprindineThe metabolism of Aprindine can be decreased when combined with Quinine.Approved
Arachidonic AcidThe metabolism of Arachidonic Acid can be decreased when combined with Quinine.Experimental
ArformoterolArformoterol may increase the QTc-prolonging activities of Quinine.Approved, Investigational
AripiprazoleThe serum concentration of Aripiprazole can be decreased when it is combined with Quinine.Approved, Investigational
ArmodafinilThe metabolism of Quinine can be decreased when combined with Armodafinil.Approved, Investigational
Arsenic trioxideQuinine may increase the QTc-prolonging activities of Arsenic trioxide.Approved, Investigational
ArtemetherThe risk or severity of adverse effects can be increased when Artemether is combined with Quinine.Approved
AsenapineQuinine may increase the QTc-prolonging activities of Asenapine.Approved
AstemizoleThe serum concentration of Quinine can be increased when it is combined with Astemizole.Approved, Withdrawn
AtazanavirThe metabolism of Quinine can be decreased when combined with Atazanavir.Approved, Investigational
AtenololQuinine may increase the hypotensive activities of Atenolol.Approved
AtomoxetineAtomoxetine may increase the QTc-prolonging activities of Quinine.Approved
AtorvastatinThe serum concentration of Atorvastatin can be increased when it is combined with Quinine.Approved
Atracurium besylateQuinine may increase the neuromuscular blocking activities of Atracurium besylate.Approved
AxitinibThe serum concentration of Axitinib can be increased when it is combined with Quinine.Approved, Investigational
AzelastineThe serum concentration of Quinine can be increased when it is combined with Azelastine.Approved
AzithromycinThe serum concentration of Quinine can be increased when it is combined with Azithromycin.Approved
BalsalazideBalsalazide may increase the hypoglycemic activities of Quinine.Approved, Investigational
BedaquilineBedaquiline may increase the QTc-prolonging activities of Quinine.Approved
BenazeprilQuinine may increase the hypotensive activities of Benazepril.Approved, Investigational
BendroflumethiazideQuinine may increase the hypotensive activities of Bendroflumethiazide.Approved
BenmoxinBenmoxin may increase the hypoglycemic activities of Quinine.Withdrawn
BenzatropineThe metabolism of Benzatropine can be decreased when combined with Quinine.Approved
BenzocaineThe serum concentration of Quinine can be increased when it is combined with Benzocaine.Approved
Benzyl alcoholThe metabolism of Benzyl alcohol can be decreased when combined with Quinine.Approved
BepridilQuinine may increase the hypotensive activities of Bepridil.Approved, Withdrawn
BeraprostThe metabolism of Beraprost can be decreased when combined with Quinine.Investigational
BetamethasoneThe serum concentration of Betamethasone can be increased when it is combined with Quinine.Approved, Vet Approved
BetaxololQuinine may increase the hypotensive activities of Betaxolol.Approved
BethanidineQuinine may increase the hypotensive activities of Bethanidine.Approved
BexaroteneThe serum concentration of Quinine can be decreased when it is combined with Bexarotene.Approved, Investigational
BimatoprostQuinine may increase the hypotensive activities of Bimatoprost.Approved, Investigational
BiperidenThe serum concentration of Quinine can be increased when it is combined with Biperiden.Approved
Bismuth SubcitrateThe serum concentration of Quinine can be decreased when it is combined with Bismuth Subcitrate.Approved
BisoprololQuinine may increase the hypotensive activities of Bisoprolol.Approved
BL-1020The serum concentration of BL-1020 can be increased when it is combined with Quinine.Investigational
BoceprevirThe metabolism of Quinine can be decreased when combined with Boceprevir.Approved, Investigational
BortezomibBortezomib may increase the QTc-prolonging activities of Quinine.Approved, Investigational
BosentanThe serum concentration of Bosentan can be increased when it is combined with Quinine.Approved, Investigational
BosutinibThe serum concentration of Bosutinib can be increased when it is combined with Quinine.Approved
Brentuximab vedotinThe serum concentration of Brentuximab vedotin can be increased when it is combined with Quinine.Approved
BretyliumQuinine may increase the hypotensive activities of Bretylium.Approved
BrexpiprazoleThe serum concentration of Brexpiprazole can be increased when it is combined with Quinine.Approved
BrimonidineQuinine may increase the hypotensive activities of Brimonidine.Approved
BromocriptineThe serum concentration of Bromocriptine can be increased when it is combined with Quinine.Approved, Investigational
BrompheniramineThe metabolism of Brompheniramine can be decreased when combined with Quinine.Approved
BuforminBuformin may increase the hypoglycemic activities of Quinine.Withdrawn
BufuralolThe metabolism of Bufuralol can be decreased when combined with Quinine.Experimental, Investigational
BupivacaineThe metabolism of Bupivacaine can be decreased when combined with Quinine.Approved, Investigational
BupranololQuinine may increase the hypotensive activities of Bupranolol.Approved
BuprenorphineThe serum concentration of Quinine can be increased when it is combined with Buprenorphine.Approved, Illicit, Investigational, Vet Approved
BupropionThe metabolism of Quinine can be decreased when combined with Bupropion.Approved
BuserelinBuserelin may increase the QTc-prolonging activities of Quinine.Approved
BuspironeThe serum concentration of Quinine can be increased when it is combined with Buspirone.Approved, Investigational
CabazitaxelThe serum concentration of Cabazitaxel can be increased when it is combined with Quinine.Approved
CabozantinibThe metabolism of Cabozantinib can be decreased when combined with Quinine.Approved
CaffeineThe serum concentration of Caffeine can be increased when it is combined with Quinine.Approved
Calcium carbonateThe serum concentration of Quinine can be decreased when it is combined with Calcium carbonate.Approved
CamptothecinThe serum concentration of Camptothecin can be increased when it is combined with Quinine.Experimental
CanagliflozinThe serum concentration of Canagliflozin can be increased when it is combined with Quinine.Approved
CandesartanQuinine may increase the hypotensive activities of Candesartan.Approved
CandoxatrilQuinine may increase the hypotensive activities of Candoxatril.Experimental
CapecitabineThe metabolism of Quinine can be decreased when combined with Capecitabine.Approved, Investigational
CaptoprilQuinine may increase the hypotensive activities of Captopril.Approved
CarbamazepineThe serum concentration of Quinine can be decreased when it is combined with Carbamazepine.Approved, Investigational
CarbinoxamineThe metabolism of Carbinoxamine can be decreased when combined with Quinine.Approved
CarfilzomibThe serum concentration of Carfilzomib can be increased when it is combined with Quinine.Approved
CariprazineThe metabolism of Cariprazine can be decreased when combined with Quinine.Approved
CaroxazoneCaroxazone may increase the hypoglycemic activities of Quinine.Withdrawn
CarteololQuinine may increase the hypotensive activities of Carteolol.Approved
CarvedilolThe serum concentration of Carvedilol can be increased when it is combined with Quinine.Approved, Investigational
CaspofunginThe serum concentration of Quinine can be increased when it is combined with Caspofungin.Approved
CastanospermineCastanospermine may increase the hypoglycemic activities of Quinine.Experimental
CelecoxibThe metabolism of Quinine can be decreased when combined with Celecoxib.Approved, Investigational
CeliprololQuinine may increase the hypotensive activities of Celiprolol.Approved, Investigational
CephalexinThe metabolism of Cephalexin can be decreased when combined with Quinine.Approved, Vet Approved
CeritinibThe serum concentration of Quinine can be increased when it is combined with Ceritinib.Approved
CerivastatinThe serum concentration of Cerivastatin can be increased when it is combined with Quinine.Withdrawn
CevimelineThe metabolism of Cevimeline can be decreased when combined with Quinine.Approved
ChloramphenicolThe metabolism of Quinine can be decreased when combined with Chloramphenicol.Approved, Vet Approved
ChlordiazepoxideThe metabolism of Chlordiazepoxide can be decreased when combined with Quinine.Approved, Illicit
ChloroquineChloroquine may increase the QTc-prolonging activities of Quinine.Approved, Vet Approved
ChlorothiazideQuinine may increase the hypotensive activities of Chlorothiazide.Approved, Vet Approved
ChlorphenamineThe metabolism of Chlorphenamine can be decreased when combined with Quinine.Approved
ChlorpromazineChlorpromazine may increase the QTc-prolonging activities of Quinine.Approved, Vet Approved
ChlorpropamideQuinine may increase the hypoglycemic activities of Chlorpropamide.Approved
ChlorprothixeneThe serum concentration of Quinine can be increased when it is combined with Chlorprothixene.Approved, Withdrawn
ChlorthalidoneQuinine may increase the hypotensive activities of Chlorthalidone.Approved
ChlorzoxazoneThe metabolism of Chlorzoxazone can be decreased when combined with Quinine.Approved
CholecalciferolThe metabolism of Quinine can be decreased when combined with Cholecalciferol.Approved, Nutraceutical
CholesterolThe serum concentration of Quinine can be increased when it is combined with Cholesterol.Experimental
Cholic AcidThe serum concentration of Quinine can be decreased when it is combined with Cholic Acid.Approved
CiglitazoneCiglitazone may increase the hypoglycemic activities of Quinine.Experimental
CilazaprilQuinine may increase the hypotensive activities of Cilazapril.Approved
CilostazolThe serum concentration of Cilostazol can be increased when it is combined with Quinine.Approved
CimetidineThe serum concentration of Quinine can be increased when it is combined with Cimetidine.Approved
CinacalcetThe metabolism of Quinine can be decreased when combined with Cinacalcet.Approved
CinnarizineThe metabolism of Cinnarizine can be decreased when combined with Quinine.Approved
CinoxacinCinoxacin may increase the hypoglycemic activities of Quinine.Approved, Withdrawn
CiprofloxacinCiprofloxacin may increase the QTc-prolonging activities of Quinine.Approved, Investigational
CisaprideQuinine may increase the QTc-prolonging activities of Cisapride.Approved, Investigational, Withdrawn
Cisatracurium besylateQuinine may increase the neuromuscular blocking activities of Cisatracurium besylate.Approved
CisplatinThe serum concentration of Cisplatin can be increased when it is combined with Quinine.Approved
CitalopramCitalopram may increase the QTc-prolonging activities of Quinine.Approved
ClarithromycinThe serum concentration of Quinine can be increased when it is combined with Clarithromycin.Approved
ClemastineThe metabolism of Quinine can be decreased when combined with Clemastine.Approved
ClevidipineThe metabolism of Clevidipine can be decreased when combined with Quinine.Approved
ClobazamThe serum concentration of Clobazam can be increased when it is combined with Quinine.Approved, Illicit
ClofazimineThe serum concentration of Quinine can be increased when it is combined with Clofazimine.Approved, Investigational
ClomifeneThe serum concentration of Clomifene can be increased when it is combined with Quinine.Approved, Investigational
ClomipramineClomipramine may increase the QTc-prolonging activities of Quinine.Approved, Vet Approved
ClonidineQuinine may increase the hypotensive activities of Clonidine.Approved
ClopidogrelThe metabolism of Quinine can be decreased when combined with Clopidogrel.Approved, Nutraceutical
ClotrimazoleThe metabolism of Quinine can be decreased when combined with Clotrimazole.Approved, Vet Approved
ClozapineClozapine may increase the QTc-prolonging activities of Quinine.Approved
CobicistatThe serum concentration of Quinine can be increased when it is combined with Cobicistat.Approved
CobimetinibThe serum concentration of Cobimetinib can be increased when it is combined with Quinine.Approved
CocaineThe metabolism of Quinine can be decreased when combined with Cocaine.Approved, Illicit
CodeineThe therapeutic efficacy of Codeine can be decreased when used in combination with Quinine.Approved, Illicit
ColchicineThe serum concentration of Colchicine can be increased when it is combined with Quinine.Approved
ColforsinThe serum concentration of Quinine can be increased when it is combined with Colforsin.Experimental
ConivaptanThe serum concentration of Quinine can be increased when it is combined with Conivaptan.Approved, Investigational
Conjugated estrogensThe serum concentration of Conjugated Equine Estrogens can be increased when it is combined with Quinine.Approved
CrizotinibCrizotinib may increase the QTc-prolonging activities of Quinine.Approved
CryptenamineQuinine may increase the hypotensive activities of Cryptenamine.Approved
CyclobenzaprineThe metabolism of Cyclobenzaprine can be decreased when combined with Quinine.Approved
CyclophosphamideThe serum concentration of Quinine can be increased when it is combined with Cyclophosphamide.Approved, Investigational
CyclosporineThe metabolism of Quinine can be decreased when combined with Cyclosporine.Approved, Investigational, Vet Approved
CyclothiazideQuinine may increase the hypotensive activities of Cyclothiazide.Approved
Cyproterone acetateThe serum concentration of Quinine can be decreased when it is combined with Cyproterone acetate.Approved, Investigational
Dabigatran etexilateThe serum concentration of the active metabolites of Dabigatran etexilate can be increased when Dabigatran etexilate is used in combination with Quinine.Approved
DabrafenibThe serum concentration of Quinine can be decreased when it is combined with Dabrafenib.Approved
DaclatasvirThe serum concentration of Quinine can be increased when it is combined with Daclatasvir.Approved
DactinomycinThe serum concentration of Quinine can be increased when it is combined with Dactinomycin.Approved
DapagliflozinThe serum concentration of Dapagliflozin can be increased when it is combined with Quinine.Approved
DapoxetineDapoxetine may increase the hypoglycemic activities of Quinine.Investigational
DapsoneThe risk or severity of adverse effects can be increased when Quinine is combined with Dapsone.Approved, Investigational
DapsoneThe metabolism of Dapsone can be decreased when combined with Quinine.Approved, Investigational
DarifenacinThe metabolism of Darifenacin can be decreased when combined with Quinine.Approved, Investigational
DarunavirThe serum concentration of Quinine can be increased when it is combined with Darunavir.Approved
DasabuvirThe metabolism of Dasabuvir can be decreased when combined with Quinine.Approved
DasatinibThe serum concentration of Quinine can be increased when it is combined with Dasatinib.Approved, Investigational
DaunorubicinThe serum concentration of Quinine can be decreased when it is combined with Daunorubicin.Approved
DebrisoquinQuinine may increase the hypotensive activities of Debrisoquin.Approved
DecamethoniumQuinine may increase the neuromuscular blocking activities of Decamethonium.Approved
DeferasiroxThe serum concentration of Quinine can be decreased when it is combined with Deferasirox.Approved, Investigational
DegarelixDegarelix may increase the QTc-prolonging activities of Quinine.Approved
DelavirdineThe metabolism of Quinine can be decreased when combined with Delavirdine.Approved
DeserpidineQuinine may increase the hypotensive activities of Deserpidine.Approved
DesfluraneDesflurane may increase the QTc-prolonging activities of Quinine.Approved
DesipramineDesipramine may increase the QTc-prolonging activities of Quinine.Approved
DesloratadineThe serum concentration of Quinine can be increased when it is combined with Desloratadine.Approved, Investigational
DesvenlafaxineDesvenlafaxine may increase the hypoglycemic activities of Quinine.Approved
DexamethasoneThe serum concentration of Quinine can be decreased when it is combined with Dexamethasone.Approved, Investigational, Vet Approved
DexfenfluramineThe metabolism of Dexfenfluramine can be decreased when combined with Quinine.Approved, Illicit, Withdrawn
DexmethylphenidateThe metabolism of Dexmethylphenidate can be decreased when combined with Quinine.Approved
DextroamphetamineThe metabolism of Dextroamphetamine can be decreased when combined with Quinine.Approved, Illicit
DextromethorphanThe serum concentration of Quinine can be increased when it is combined with Dextromethorphan.Approved
DiazepamThe serum concentration of Diazepam can be increased when it is combined with Quinine.Approved, Illicit, Vet Approved
DiazoxideQuinine may increase the hypotensive activities of Diazoxide.Approved
DiclofenacThe serum concentration of Quinine can be increased when it is combined with Diclofenac.Approved, Vet Approved
DicoumarolQuinine may increase the anticoagulant activities of Dicoumarol.Approved
DiethylstilbestrolThe serum concentration of Diethylstilbestrol can be increased when it is combined with Quinine.Approved
DiflunisalDiflunisal may increase the hypoglycemic activities of Quinine.Approved
DigitoxinThe serum concentration of Digitoxin can be increased when it is combined with Quinine.Approved
DigoxinThe serum concentration of Digoxin can be increased when it is combined with Quinine.Approved
DihydrocodeineThe metabolism of Dihydrocodeine can be decreased when combined with Quinine.Approved, Illicit
DihydroergotamineThe metabolism of Quinine can be decreased when combined with Dihydroergotamine.Approved
DihydrotestosteroneThe serum concentration of Dihydrotestosterone can be increased when it is combined with Quinine.Illicit
DiltiazemQuinine may increase the hypotensive activities of Diltiazem.Approved
DiphenhydramineDiphenhydramine may increase the QTc-prolonging activities of Quinine.Approved
DipyridamoleThe serum concentration of Quinine can be increased when it is combined with Dipyridamole.Approved
DisopyramideDisopyramide may increase the QTc-prolonging activities of Quinine.Approved
DisulfiramThe metabolism of Quinine can be decreased when combined with Disulfiram.Approved
DocetaxelThe serum concentration of Docetaxel can be increased when it is combined with Quinine.Approved, Investigational
DofetilideDofetilide may increase the QTc-prolonging activities of Quinine.Approved
DolasetronDolasetron may increase the QTc-prolonging activities of Quinine.Approved
Domoic AcidQuinine may increase the neuromuscular blocking activities of Domoic Acid.Experimental
DomperidoneQuinine may increase the QTc-prolonging activities of Domperidone.Approved, Investigational, Vet Approved
DonepezilThe metabolism of Donepezil can be decreased when combined with Quinine.Approved
DopamineThe metabolism of Dopamine can be decreased when combined with Quinine.Approved
DorzolamideQuinine may increase the hypotensive activities of Dorzolamide.Approved
Doxacurium chlorideQuinine may increase the neuromuscular blocking activities of Doxacurium chloride.Approved
DoxazosinQuinine may increase the hypotensive activities of Doxazosin.Approved
DoxepinDoxepin may increase the QTc-prolonging activities of Quinine.Approved
DoxorubicinThe serum concentration of Doxorubicin can be increased when it is combined with Quinine.Approved, Investigational
DoxorubicinThe serum concentration of Quinine can be decreased when it is combined with Doxorubicin.Approved, Investigational
DoxycyclineThe metabolism of Quinine can be decreased when combined with Doxycycline.Approved, Investigational, Vet Approved
DronabinolThe serum concentration of Dronabinol can be increased when it is combined with Quinine.Approved, Illicit
DronedaroneQuinine may increase the QTc-prolonging activities of Dronedarone.Approved
DroperidolDroperidol may increase the QTc-prolonging activities of Quinine.Approved, Vet Approved
DulaglutideDulaglutide may increase the hypoglycemic activities of Quinine.Approved
DuloxetineThe metabolism of Duloxetine can be decreased when combined with Quinine.Approved
DyphyllineThe serum concentration of Dyphylline can be increased when it is combined with Quinine.Approved
EdoxabanThe serum concentration of Edoxaban can be increased when it is combined with Quinine.Approved
EfavirenzThe serum concentration of Quinine can be decreased when it is combined with Efavirenz.Approved, Investigational
EfonidipineQuinine may increase the hypotensive activities of Efonidipine.Approved
ElbasvirThe serum concentration of Quinine can be increased when it is combined with Elbasvir.Approved
EletriptanThe serum concentration of Eletriptan can be increased when it is combined with Quinine.Approved, Investigational
EliglustatThe serum concentration of Eliglustat can be increased when it is combined with Quinine.Approved
EltrombopagThe metabolism of Eltrombopag can be decreased when combined with Quinine.Approved
EmpagliflozinEmpagliflozin may increase the hypoglycemic activities of Quinine.Approved
EnalaprilQuinine may increase the hypotensive activities of Enalapril.Approved, Vet Approved
EnalaprilatQuinine may increase the hypotensive activities of Enalaprilat.Approved
EncainideThe metabolism of Encainide can be decreased when combined with Quinine.Approved, Withdrawn
EnclomipheneThe metabolism of Enclomiphene can be decreased when combined with Quinine.Investigational
EnoxacinEnoxacin may increase the hypoglycemic activities of Quinine.Approved
EnzalutamideThe serum concentration of Quinine can be decreased when it is combined with Enzalutamide.Approved
EpinastineThe serum concentration of Epinastine can be increased when it is combined with Quinine.Approved, Investigational
EpoprostenolQuinine may increase the hypotensive activities of Epoprostenol.Approved
EprosartanQuinine may increase the hypotensive activities of Eprosartan.Approved
ErgonovineThe serum concentration of Quinine can be increased when it is combined with Ergonovine.Approved
ErgotamineThe serum concentration of Quinine can be increased when it is combined with Ergotamine.Approved
EribulinEribulin may increase the QTc-prolonging activities of Quinine.Approved, Investigational
ErlotinibThe serum concentration of Erlotinib can be increased when it is combined with Quinine.Approved, Investigational
ErythromycinThe serum concentration of Quinine can be increased when it is combined with Erythromycin.Approved, Vet Approved
EscitalopramQuinine may increase the QTc-prolonging activities of Escitalopram.Approved, Investigational
Eslicarbazepine acetateThe serum concentration of Quinine can be decreased when it is combined with Eslicarbazepine acetate.Approved
EsmirtazapineThe metabolism of Esmirtazapine can be decreased when combined with Quinine.Investigational
EsomeprazoleThe metabolism of Quinine can be decreased when combined with Esomeprazole.Approved, Investigational
EstradiolThe serum concentration of Estradiol can be increased when it is combined with Quinine.Approved, Investigational, Vet Approved
EstramustineThe serum concentration of Quinine can be increased when it is combined with Estramustine.Approved
EstriolThe serum concentration of Quinine can be decreased when it is combined with Estriol.Approved, Vet Approved
EstroneThe serum concentration of Quinine can be decreased when it is combined with Estrone.Approved
EszopicloneThe metabolism of Eszopiclone can be decreased when combined with Quinine.Approved
Ethinyl EstradiolThe serum concentration of Ethinyl Estradiol can be increased when it is combined with Quinine.Approved
Ethyl biscoumacetateQuinine may increase the anticoagulant activities of Ethyl biscoumacetate.Withdrawn
EthylmorphineThe metabolism of Ethylmorphine can be decreased when combined with Quinine.Approved, Illicit
EtodolacThe metabolism of Etodolac can be decreased when combined with Quinine.Approved, Investigational, Vet Approved
EtoperidoneEtoperidone may increase the hypoglycemic activities of Quinine.Approved
EtoposideThe serum concentration of Quinine can be increased when it is combined with Etoposide.Approved
EtoricoxibThe metabolism of Etoricoxib can be decreased when combined with Quinine.Approved, Investigational
EtravirineThe serum concentration of Quinine can be decreased when it is combined with Etravirine.Approved
EverolimusThe serum concentration of Everolimus can be increased when it is combined with Quinine.Approved
ExenatideExenatide may increase the hypoglycemic activities of Quinine.Approved, Investigational
EzetimibeThe serum concentration of Ezetimibe can be increased when it is combined with Quinine.Approved
EzogabineEzogabine may increase the QTc-prolonging activities of Quinine.Approved
FamotidineFamotidine may increase the QTc-prolonging activities of Quinine.Approved
FelbamateFelbamate may increase the QTc-prolonging activities of Quinine.Approved
FelodipineQuinine may increase the hypotensive activities of Felodipine.Approved, Investigational
FenoldopamQuinine may increase the hypotensive activities of Fenoldopam.Approved
FentanylThe serum concentration of Quinine can be increased when it is combined with Fentanyl.Approved, Illicit, Investigational, Vet Approved
FesoterodineThe serum concentration of the active metabolites of Fesoterodine can be increased when Fesoterodine is used in combination with Quinine.Approved
FexofenadineThe serum concentration of Fexofenadine can be increased when it is combined with Quinine.Approved
FidaxomicinThe serum concentration of Fidaxomicin can be increased when it is combined with Quinine.Approved
FingolimodFingolimod may increase the QTc-prolonging activities of Quinine.Approved, Investigational
FlecainideFlecainide may increase the QTc-prolonging activities of Quinine.Approved, Withdrawn
FleroxacinFleroxacin may increase the hypoglycemic activities of Quinine.Approved
FloxuridineThe metabolism of Quinine can be decreased when combined with Floxuridine.Approved
FluconazoleFluconazole may increase the QTc-prolonging activities of Quinine.Approved
FlumequineFlumequine may increase the hypoglycemic activities of Quinine.Withdrawn
FlunarizineThe metabolism of Flunarizine can be decreased when combined with Quinine.Approved
FlunitrazepamThe metabolism of Flunitrazepam can be decreased when combined with Quinine.Approved, Illicit
FluorouracilThe metabolism of Quinine can be decreased when combined with Fluorouracil.Approved
FluoxetineQuinine may increase the QTc-prolonging activities of Fluoxetine.Approved, Vet Approved
FluoxymesteroneFluoxymesterone may increase the hypoglycemic activities of Quinine.Approved, Illicit
FlupentixolQuinine may increase the QTc-prolonging activities of Flupentixol.Approved, Withdrawn
FluphenazineThe serum concentration of Fluphenazine can be increased when it is combined with Quinine.Approved
FlurazepamThe serum concentration of Quinine can be increased when it is combined with Flurazepam.Approved, Illicit
FlurbiprofenThe metabolism of Flurbiprofen can be decreased when combined with Quinine.Approved, Investigational
Fluticasone furoateThe serum concentration of Fluticasone furoate can be increased when it is combined with Quinine.Approved
FluvastatinThe serum concentration of Fluvastatin can be increased when it is combined with Quinine.Approved
FluvoxamineThe metabolism of Quinine can be decreased when combined with Fluvoxamine.Approved, Investigational
FormoterolFormoterol may increase the QTc-prolonging activities of Quinine.Approved, Investigational
FosamprenavirThe metabolism of Quinine can be decreased when combined with Fosamprenavir.Approved
FosaprepitantThe serum concentration of Quinine can be increased when it is combined with Fosaprepitant.Approved
FoscarnetFoscarnet may increase the QTc-prolonging activities of Quinine.Approved
FosinoprilQuinine may increase the hypotensive activities of Fosinopril.Approved
FosphenytoinThe serum concentration of Quinine can be decreased when it is combined with Fosphenytoin.Approved
FurazolidoneFurazolidone may increase the hypoglycemic activities of Quinine.Approved, Vet Approved
Fusidic AcidThe serum concentration of Quinine can be increased when it is combined with Fusidic Acid.Approved
Gadobenic acidGadobenic acid may increase the QTc-prolonging activities of Quinine.Approved
GalantamineGalantamine may increase the QTc-prolonging activities of Quinine.Approved
Gallamine TriethiodideQuinine may increase the neuromuscular blocking activities of Gallamine Triethiodide.Approved
GatifloxacinGatifloxacin may increase the hypoglycemic activities of Quinine.Approved, Investigational
GavestinelThe metabolism of Gavestinel can be decreased when combined with Quinine.Investigational
GefitinibThe serum concentration of Gefitinib can be increased when it is combined with Quinine.Approved, Investigational
GemcitabineThe serum concentration of Gemcitabine can be increased when it is combined with Quinine.Approved
GemfibrozilThe metabolism of Quinine can be decreased when combined with Gemfibrozil.Approved
GemifloxacinGemifloxacin may increase the QTc-prolonging activities of Quinine.Approved, Investigational
GenisteinThe serum concentration of Quinine can be increased when it is combined with Genistein.Investigational
GlibornurideGlibornuride may increase the hypoglycemic activities of Quinine.Withdrawn
GliclazideQuinine may increase the hypoglycemic activities of Gliclazide.Approved
GlimepirideGlimepiride may increase the hypoglycemic activities of Quinine.Approved
GlipizideQuinine may increase the hypoglycemic activities of Glipizide.Approved
GliquidoneGliquidone may increase the hypoglycemic activities of Quinine.Approved
GlyburideQuinine may increase the hypoglycemic activities of Glyburide.Approved
GoserelinGoserelin may increase the QTc-prolonging activities of Quinine.Approved
Gramicidin DThe serum concentration of Quinine can be increased when it is combined with Gramicidin D.Approved
GranisetronGranisetron may increase the QTc-prolonging activities of Quinine.Approved, Investigational
GrazoprevirThe serum concentration of Grazoprevir can be increased when it is combined with Quinine.Approved
GrepafloxacinThe serum concentration of Grepafloxacin can be increased when it is combined with Quinine.Withdrawn
GuanabenzQuinine may increase the hypotensive activities of Guanabenz.Approved
GuanadrelQuinine may increase the hypotensive activities of Guanadrel.Approved
GuanethidineQuinine may increase the hypotensive activities of Guanethidine.Approved
GuanfacineQuinine may increase the hypotensive activities of Guanfacine.Approved, Investigational
HalofantrineThe risk or severity of adverse effects can be increased when Quinine is combined with Halofantrine.Approved
HaloperidolHaloperidol may increase the QTc-prolonging activities of Quinine.Approved
HalothaneThe metabolism of Halothane can be decreased when combined with Quinine.Approved, Vet Approved
HexamethoniumQuinine may increase the hypotensive activities of Hexamethonium.Experimental
HexobarbitalThe metabolism of Hexobarbital can be decreased when combined with Quinine.Approved
HistamineThe metabolism of Histamine Phosphate can be decreased when combined with Quinine.Approved, Investigational
HistrelinHistrelin may increase the QTc-prolonging activities of Quinine.Approved
HydracarbazineHydracarbazine may increase the hypoglycemic activities of Quinine.Approved
HydralazineQuinine may increase the hypotensive activities of Hydralazine.Approved
HydrochlorothiazideQuinine may increase the hypotensive activities of Hydrochlorothiazide.Approved, Vet Approved
HydrocodoneThe metabolism of Hydrocodone can be decreased when combined with Quinine.Approved, Illicit
HydrocortisoneThe serum concentration of Hydrocortisone can be increased when it is combined with Quinine.Approved, Vet Approved
HydroflumethiazideQuinine may increase the hypotensive activities of Hydroflumethiazide.Approved
HydromorphoneThe metabolism of Hydromorphone can be decreased when combined with Quinine.Approved, Illicit
HydroxyzineHydroxyzine may increase the QTc-prolonging activities of Quinine.Approved
IbandronateIbandronate may increase the QTc-prolonging activities of Quinine.Approved, Investigational
IbrutinibThe metabolism of Ibrutinib can be decreased when combined with Quinine.Approved
IbuprofenThe serum concentration of Ibuprofen can be increased when it is combined with Quinine.Approved
IbutilideIbutilide may increase the QTc-prolonging activities of Quinine.Approved
IdarubicinThe metabolism of Idarubicin can be decreased when combined with Quinine.Approved
IdelalisibThe serum concentration of Quinine can be increased when it is combined with Idelalisib.Approved
IfosfamideThe metabolism of Ifosfamide can be decreased when combined with Quinine.Approved
IloperidoneQuinine may increase the QTc-prolonging activities of Iloperidone.Approved
ImatinibThe metabolism of Quinine can be decreased when combined with Imatinib.Approved
ImipramineImipramine may increase the QTc-prolonging activities of Quinine.Approved
IndacaterolIndacaterol may increase the QTc-prolonging activities of Quinine.Approved
IndalpineIndalpine may increase the hypoglycemic activities of Quinine.Investigational, Withdrawn
IndapamideIndapamide may increase the QTc-prolonging activities of Quinine.Approved
IndenololQuinine may increase the hypotensive activities of Indenolol.Withdrawn
IndinavirThe metabolism of Quinine can be decreased when combined with Indinavir.Approved
IndomethacinThe serum concentration of Indomethacin can be increased when it is combined with Quinine.Approved, Investigational
IndoraminQuinine may increase the hypotensive activities of Indoramin.Withdrawn
Insulin AspartQuinine may increase the hypoglycemic activities of Insulin Aspart.Approved
Insulin DetemirQuinine may increase the hypoglycemic activities of Insulin Detemir.Approved
Insulin GlargineInsulin Glargine may increase the hypoglycemic activities of Quinine.Approved
Insulin GlulisineQuinine may increase the hypoglycemic activities of Insulin Glulisine.Approved
Insulin HumanInsulin Human may increase the hypoglycemic activities of Quinine.Approved, Investigational
Insulin LisproInsulin Lispro may increase the hypoglycemic activities of Quinine.Approved
Insulin PorkInsulin Pork may increase the hypoglycemic activities of Quinine.Approved
Ipratropium bromideThe metabolism of Ipratropium bromide can be decreased when combined with Quinine.Approved
IproclozideIproclozide may increase the hypoglycemic activities of Quinine.Withdrawn
IproniazidIproniazid may increase the hypoglycemic activities of Quinine.Withdrawn
IrbesartanQuinine may increase the hypotensive activities of Irbesartan.Approved, Investigational
IrinotecanThe serum concentration of Irinotecan can be increased when it is combined with Quinine.Approved, Investigational
IsavuconazoniumThe metabolism of Quinine can be decreased when combined with Isavuconazonium.Approved, Investigational
IsocarboxazidIsocarboxazid may increase the hypoglycemic activities of Quinine.Approved
IsofluraneIsoflurane may increase the QTc-prolonging activities of Quinine.Approved, Vet Approved
IsoniazidThe metabolism of Quinine can be decreased when combined with Isoniazid.Approved
IsradipineIsradipine may increase the QTc-prolonging activities of Quinine.Approved
ItraconazoleThe metabolism of Quinine can be decreased when combined with Itraconazole.Approved, Investigational
IvabradineIvabradine may increase the QTc-prolonging activities of Quinine.Approved
IvacaftorThe serum concentration of Quinine can be increased when it is combined with Ivacaftor.Approved
IvermectinThe serum concentration of Ivermectin can be increased when it is combined with Quinine.Approved, Vet Approved
IxazomibThe metabolism of Ixazomib can be decreased when combined with Quinine.Approved
JosamycinThe serum concentration of Quinine can be increased when it is combined with Josamycin.Approved
KetamineThe serum concentration of Quinine can be increased when it is combined with Ketamine.Approved, Vet Approved
KetazolamThe serum concentration of Ketazolam can be increased when it is combined with Quinine.Approved
KetobemidoneThe metabolism of Ketobemidone can be decreased when combined with Quinine.Approved
KetoconazoleThe metabolism of Quinine can be decreased when combined with Ketoconazole.Approved, Investigational
KetoprofenThe metabolism of Ketoprofen can be decreased when combined with Quinine.Approved, Vet Approved
KitasamycinThe serum concentration of Quinine can be increased when it is combined with Kitasamycin.Experimental
LabetalolQuinine may increase the hypotensive activities of Labetalol.Approved
LacidipineQuinine may increase the hypotensive activities of Lacidipine.Approved
LamivudineThe serum concentration of Lamivudine can be increased when it is combined with Quinine.Approved, Investigational
LamotrigineThe serum concentration of Lamotrigine can be increased when it is combined with Quinine.Approved, Investigational
LanreotideQuinine may increase the hypoglycemic activities of Lanreotide.Approved
LansoprazoleThe serum concentration of Lansoprazole can be increased when it is combined with Quinine.Approved, Investigational
LapatinibLapatinib may increase the QTc-prolonging activities of Quinine.Approved, Investigational
LatanoprostQuinine may increase the hypotensive activities of Latanoprost.Approved, Investigational
LedipasvirThe serum concentration of Ledipasvir can be increased when it is combined with Quinine.Approved
LeflunomideThe metabolism of Leflunomide can be decreased when combined with Quinine.Approved, Investigational
LenalidomideThe serum concentration of Lenalidomide can be increased when it is combined with Quinine.Approved
LenvatinibLenvatinib may increase the QTc-prolonging activities of Quinine.Approved
LercanidipineQuinine may increase the hypotensive activities of Lercanidipine.Approved, Investigational
LesinuradThe metabolism of Lesinurad can be decreased when combined with Quinine.Approved
LeuprolideLeuprolide may increase the QTc-prolonging activities of Quinine.Approved, Investigational
LevetiracetamThe serum concentration of Levetiracetam can be increased when it is combined with Quinine.Approved, Investigational
LevodopaThe metabolism of Levodopa can be decreased when combined with Quinine.Approved
LevofloxacinLevofloxacin may increase the QTc-prolonging activities of Quinine.Approved, Investigational
LevomilnacipranThe serum concentration of Levomilnacipran can be increased when it is combined with Quinine.Approved
LevothyroxineThe serum concentration of Quinine can be decreased when it is combined with Levothyroxine.Approved
LicofeloneThe metabolism of Licofelone can be decreased when combined with Quinine.Investigational
LidocaineThe serum concentration of Quinine can be increased when it is combined with Lidocaine.Approved, Vet Approved
LinagliptinThe serum concentration of Linagliptin can be increased when it is combined with Quinine.Approved
LiothyronineThe serum concentration of Quinine can be decreased when it is combined with Liothyronine.Approved, Vet Approved
LiotrixThe serum concentration of Quinine can be decreased when it is combined with Liotrix.Approved
LiraglutideLiraglutide may increase the hypoglycemic activities of Quinine.Approved
LisinoprilQuinine may increase the hypotensive activities of Lisinopril.Approved, Investigational
LisurideThe metabolism of Lisuride can be decreased when combined with Quinine.Approved
LithiumLithium may increase the QTc-prolonging activities of Quinine.Approved
LofexidineQuinine may increase the hypotensive activities of Lofexidine.Approved, Investigational
LomefloxacinLomefloxacin may increase the hypoglycemic activities of Quinine.Approved
LomitapideThe serum concentration of Quinine can be increased when it is combined with Lomitapide.Approved
LomustineThe metabolism of Lomustine can be decreased when combined with Quinine.Approved
LoperamideThe serum concentration of Loperamide can be increased when it is combined with Quinine.Approved
LopinavirThe serum concentration of Quinine can be decreased when it is combined with Lopinavir.Approved
LoratadineThe serum concentration of Quinine can be increased when it is combined with Loratadine.Approved
LorcaserinThe metabolism of Lorcaserin can be decreased when combined with Quinine.Approved
LornoxicamThe metabolism of Lornoxicam can be decreased when combined with Quinine.Approved
LosartanQuinine may increase the hypotensive activities of Losartan.Approved
LovastatinThe serum concentration of Lovastatin can be increased when it is combined with Quinine.Approved, Investigational
LuliconazoleThe serum concentration of Quinine can be increased when it is combined with Luliconazole.Approved
LumacaftorThe serum concentration of Quinine can be increased when it is combined with Lumacaftor.Approved
LumefantrineThe risk or severity of adverse effects can be increased when Quinine is combined with Lumefantrine.Approved
LumiracoxibThe metabolism of Lumiracoxib can be decreased when combined with Quinine.Approved, Investigational
MacitentanQuinine may increase the hypotensive activities of Macitentan.Approved
MagaldrateThe serum concentration of Quinine can be decreased when it is combined with Magaldrate.Withdrawn
Magnesium carbonateThe serum concentration of Quinine can be decreased when it is combined with Magnesium carbonate.Approved
Magnesium HydroxideThe serum concentration of Quinine can be decreased when it is combined with Magnesium hydroxide.Approved
Magnesium oxideThe serum concentration of Quinine can be decreased when it is combined with Magnesium oxide.Approved
Magnesium TrisilicateThe serum concentration of Quinine can be decreased when it is combined with Magnesium Trisilicate.Approved
ManidipineQuinine may increase the hypotensive activities of Manidipine.Approved
MannitolThe serum concentration of Mannitol can be increased when it is combined with Quinine.Approved, Investigational
MaprotilineMaprotiline may increase the QTc-prolonging activities of Quinine.Approved
MebanazineMebanazine may increase the hypoglycemic activities of Quinine.Withdrawn
MebendazoleThe serum concentration of Quinine can be increased when it is combined with Mebendazole.Approved, Vet Approved
MecamylamineQuinine may increase the hypotensive activities of Mecamylamine.Approved
MecaserminQuinine may increase the hypoglycemic activities of Mecasermin.Approved, Investigational
Mefenamic acidThe metabolism of Mefenamic acid can be decreased when combined with Quinine.Approved
MefloquineThe risk or severity of adverse effects can be increased when Quinine is combined with Mefloquine.Approved
Megestrol acetateThe serum concentration of Quinine can be increased when it is combined with Megestrol acetate.Approved, Vet Approved
MelatoninThe metabolism of Melatonin can be decreased when combined with Quinine.Approved, Nutraceutical, Vet Approved
MeloxicamThe metabolism of Meloxicam can be decreased when combined with Quinine.Approved, Vet Approved
MephenytoinThe metabolism of Mephenytoin can be decreased when combined with Quinine.Investigational, Withdrawn
MeprobamateThe serum concentration of Quinine can be increased when it is combined with Meprobamate.Approved, Illicit
MequitazineThe metabolism of Mequitazine can be decreased when combined with Quinine.Approved
MesalazineMesalazine may increase the hypoglycemic activities of Quinine.Approved
MesoridazineThe serum concentration of Mesoridazine can be increased when it is combined with Quinine.Approved
MestranolThe metabolism of Mestranol can be decreased when combined with Quinine.Approved
MetforminMetformin may increase the hypoglycemic activities of Quinine.Approved
MethadoneMethadone may increase the QTc-prolonging activities of Quinine.Approved
MethamphetamineThe metabolism of Methamphetamine can be decreased when combined with Quinine.Approved, Illicit
MethotrexateThe serum concentration of Methotrexate can be increased when it is combined with Quinine.Approved
MethotrimeprazineMethotrimeprazine may increase the QTc-prolonging activities of Quinine.Approved
MethoxyfluraneThe metabolism of Methoxyflurane can be decreased when combined with Quinine.Approved, Vet Approved
MethyldopaQuinine may increase the hypotensive activities of Methyldopa.Approved
Methylene blueThe serum concentration of Methylene blue can be increased when it is combined with Quinine.Investigational
MethylphenidateThe metabolism of Methylphenidate can be decreased when combined with Quinine.Approved, Investigational
MethylprednisoloneThe serum concentration of Methylprednisolone can be increased when it is combined with Quinine.Approved, Vet Approved
MethyltestosteroneMethyltestosterone may increase the hypoglycemic activities of Quinine.Approved
MethyprylonThe metabolism of Methyprylon can be decreased when combined with Quinine.Approved, Illicit, Withdrawn
MetipranololQuinine may increase the hypotensive activities of Metipranolol.Approved
MetoclopramideMetoclopramide may increase the QTc-prolonging activities of Quinine.Approved, Investigational
MetocurineQuinine may increase the neuromuscular blocking activities of Metocurine.Approved
Metocurine IodideQuinine may increase the neuromuscular blocking activities of Metocurine Iodide.Withdrawn
MetolazoneQuinine may increase the hypotensive activities of Metolazone.Approved
MetoprololThe serum concentration of Metoprolol can be increased when it is combined with Quinine.Approved, Investigational
MetronidazoleMetronidazole may increase the QTc-prolonging activities of Quinine.Approved
MetyrosineQuinine may increase the hypotensive activities of Metyrosine.Approved
MevastatinThe serum concentration of Mevastatin can be increased when it is combined with Quinine.Experimental
MexiletineThe metabolism of Quinine can be decreased when combined with Mexiletine.Approved
MianserinThe metabolism of Mianserin can be decreased when combined with Quinine.Approved
MibefradilQuinine may increase the hypotensive activities of Mibefradil.Withdrawn
MiconazoleThe serum concentration of Quinine can be increased when it is combined with Miconazole.Approved, Investigational, Vet Approved
MidazolamThe serum concentration of Quinine can be decreased when it is combined with Midazolam.Approved, Illicit
MifepristoneMifepristone may increase the QTc-prolonging activities of Quinine.Approved, Investigational
MiglitolMiglitol may increase the hypoglycemic activities of Quinine.Approved
MiglustatMiglustat may increase the hypoglycemic activities of Quinine.Approved
MilnacipranMilnacipran may increase the hypoglycemic activities of Quinine.Approved
MinaprineMinaprine may increase the hypoglycemic activities of Quinine.Approved
MinoxidilQuinine may increase the hypotensive activities of Minoxidil.Approved
MirabegronMirabegron may increase the QTc-prolonging activities of Quinine.Approved
MirtazapineMirtazapine may increase the QTc-prolonging activities of Quinine.Approved
MitiglinideMitiglinide may increase the hypoglycemic activities of Quinine.Approved, Investigational
MitomycinThe serum concentration of Quinine can be increased when it is combined with Mitomycin.Approved
MitotaneThe serum concentration of Quinine can be decreased when it is combined with Mitotane.Approved
MitoxantroneThe serum concentration of Quinine can be decreased when it is combined with Mitoxantrone.Approved, Investigational
MivacuriumQuinine may increase the neuromuscular blocking activities of Mivacurium.Approved
MoclobemideMoclobemide may increase the hypoglycemic activities of Quinine.Approved
ModafinilThe serum concentration of Quinine can be decreased when it is combined with Modafinil.Approved, Investigational
MoexiprilMoexipril may increase the QTc-prolonging activities of Quinine.Approved
MontelukastThe metabolism of Montelukast can be decreased when combined with Quinine.Approved
MoricizineThe serum concentration of Moricizine can be increased when it is combined with Quinine.Approved, Withdrawn
MorphineThe serum concentration of Morphine can be increased when it is combined with Quinine.Approved, Investigational
MoxifloxacinMoxifloxacin may increase the QTc-prolonging activities of Quinine.Approved, Investigational
MoxonidineQuinine may increase the hypotensive activities of Moxonidine.Approved
Mycophenolate mofetilThe serum concentration of Mycophenolate mofetil can be increased when it is combined with Quinine.Approved, Investigational
NadololQuinine may increase the hypotensive activities of Nadolol.Approved
NafcillinThe serum concentration of Quinine can be decreased when it is combined with Nafcillin.Approved
Nalidixic AcidNalidixic Acid may increase the hypoglycemic activities of Quinine.Approved
NaloxegolThe serum concentration of Naloxegol can be increased when it is combined with Quinine.Approved
NaloxoneThe serum concentration of Naloxone can be increased when it is combined with Quinine.Approved, Vet Approved
NaltrexoneThe serum concentration of Quinine can be increased when it is combined with Naltrexone.Approved, Investigational, Vet Approved
NaproxenThe metabolism of Naproxen can be decreased when combined with Quinine.Approved, Vet Approved
NaringeninThe serum concentration of Quinine can be increased when it is combined with Naringenin.Experimental
NateglinideQuinine may increase the hypoglycemic activities of Nateglinide.Approved, Investigational
NCX 4016NCX 4016 may increase the hypoglycemic activities of Quinine.Investigational
NebivololThe serum concentration of Nebivolol can be increased when it is combined with Quinine.Approved, Investigational
NefazodoneThe metabolism of Quinine can be decreased when combined with Nefazodone.Approved, Withdrawn
NelfinavirThe metabolism of Quinine can be decreased when combined with Nelfinavir.Approved
NeostigmineThe serum concentration of Quinine can be increased when it is combined with Neostigmine.Approved, Vet Approved
NetupitantThe serum concentration of Quinine can be increased when it is combined with Netupitant.Approved
NevirapineThe metabolism of Quinine can be increased when combined with Nevirapine.Approved
NialamideNialamide may increase the hypoglycemic activities of Quinine.Withdrawn
NicardipineNicardipine may increase the QTc-prolonging activities of Quinine.Approved
NicergolineThe metabolism of Nicergoline can be decreased when combined with Quinine.Approved
NiclosamideThe metabolism of Niclosamide can be decreased when combined with Quinine.Approved, Vet Approved
NicorandilQuinine may increase the hypotensive activities of Nicorandil.Approved
NicotineThe metabolism of Nicotine can be decreased when combined with Quinine.Approved
NifedipineThe serum concentration of Quinine can be decreased when it is combined with Nifedipine.Approved
NiguldipineQuinine may increase the hypotensive activities of Niguldipine.Experimental
NilotinibQuinine may increase the QTc-prolonging activities of Nilotinib.Approved, Investigational
NilvadipineQuinine may increase the hypotensive activities of Nilvadipine.Approved
NimodipineQuinine may increase the hypotensive activities of Nimodipine.Approved
NintedanibThe serum concentration of Nintedanib can be increased when it is combined with Quinine.Approved
NisoldipineQuinine may increase the hypotensive activities of Nisoldipine.Approved
NitrazepamThe serum concentration of Quinine can be increased when it is combined with Nitrazepam.Approved
NitrendipineQuinine may increase the hypotensive activities of Nitrendipine.Approved
Nitric OxideThe risk or severity of adverse effects can be increased when Nitric Oxide is combined with Quinine.Approved
NitrofuralThe metabolism of Nitrofural can be decreased when combined with Quinine.Approved, Vet Approved
NitroprussideQuinine may increase the hypotensive activities of Nitroprusside.Approved
NizatidineThe serum concentration of Nizatidine can be increased when it is combined with Quinine.Approved
NorethisteroneThe serum concentration of Quinine can be decreased when it is combined with Norethisterone.Approved
NorfloxacinNorfloxacin may increase the QTc-prolonging activities of Quinine.Approved
NortriptylineNortriptyline may increase the QTc-prolonging activities of Quinine.Approved
OctamoxinOctamoxin may increase the hypoglycemic activities of Quinine.Withdrawn
OctreotideOctreotide may increase the QTc-prolonging activities of Quinine.Approved, Investigational
OfloxacinOfloxacin may increase the QTc-prolonging activities of Quinine.Approved
OlanzapineOlanzapine may increase the QTc-prolonging activities of Quinine.Approved, Investigational
OlaparibThe metabolism of Quinine can be decreased when combined with Olaparib.Approved
OlmesartanQuinine may increase the hypotensive activities of Olmesartan.Approved, Investigational
OlodaterolOlodaterol may increase the QTc-prolonging activities of Quinine.Approved
OlsalazineOlsalazine may increase the hypoglycemic activities of Quinine.Approved
OmapatrilatQuinine may increase the hypotensive activities of Omapatrilat.Investigational
OmbitasvirThe serum concentration of Ombitasvir can be increased when it is combined with Quinine.Approved
OmeprazoleThe serum concentration of Quinine can be increased when it is combined with Omeprazole.Approved, Investigational, Vet Approved
OndansetronOndansetron may increase the QTc-prolonging activities of Quinine.Approved
OsimertinibThe serum concentration of Quinine can be increased when it is combined with Osimertinib.Approved
OspemifeneThe metabolism of Ospemifene can be decreased when combined with Quinine.Approved
OxandroloneOxandrolone may increase the hypoglycemic activities of Quinine.Approved, Investigational
OxaprozinThe metabolism of Oxaprozin can be decreased when combined with Quinine.Approved
OxprenololQuinine may increase the hypotensive activities of Oxprenolol.Approved
OxycodoneThe metabolism of Oxycodone can be decreased when combined with Quinine.Approved, Illicit, Investigational
OxymetholoneOxymetholone may increase the hypoglycemic activities of Quinine.Approved, Illicit
OxymorphoneThe metabolism of Oxymorphone can be decreased when combined with Quinine.Approved, Investigational, Vet Approved
OxytocinOxytocin may increase the QTc-prolonging activities of Quinine.Approved, Vet Approved
P-NitrophenolThe serum concentration of Quinine can be increased when it is combined with P-Nitrophenol.Experimental
PaclitaxelThe serum concentration of Quinine can be increased when it is combined with Paclitaxel.Approved, Vet Approved
PalbociclibThe serum concentration of Quinine can be increased when it is combined with Palbociclib.Approved
PaliperidoneQuinine may increase the QTc-prolonging activities of Paliperidone.Approved
Palmitic AcidThe serum concentration of Quinine can be increased when it is combined with Palmitic Acid.Experimental
PalonosetronThe metabolism of Palonosetron can be decreased when combined with Quinine.Approved, Investigational
PancuroniumQuinine may increase the neuromuscular blocking activities of Pancuronium.Approved
PanobinostatThe serum concentration of Quinine can be increased when it is combined with Panobinostat.Approved, Investigational
PantoprazoleThe serum concentration of Quinine can be increased when it is combined with Pantoprazole.Approved
ParamethadioneThe metabolism of Paramethadione can be decreased when combined with Quinine.Approved
ParecoxibThe metabolism of Parecoxib can be decreased when combined with Quinine.Approved
PargylineQuinine may increase the hypotensive activities of Pargyline.Approved
ParoxetineParoxetine may increase the QTc-prolonging activities of Quinine.Approved, Investigational
PasireotidePasireotide may increase the QTc-prolonging activities of Quinine.Approved
PazopanibThe serum concentration of Pazopanib can be increased when it is combined with Quinine.Approved
PefloxacinPefloxacin may increase the hypoglycemic activities of Quinine.Approved
Peginterferon alfa-2bThe serum concentration of Quinine can be decreased when it is combined with Peginterferon alfa-2b.Approved
PegvisomantPegvisomant may increase the hypoglycemic activities of Quinine.Approved
PenbutololQuinine may increase the hypotensive activities of Penbutolol.Approved, Investigational
PentamidinePentamidine may increase the QTc-prolonging activities of Quinine.Approved
PentobarbitalThe metabolism of Quinine can be increased when combined with Pentobarbital.Approved, Vet Approved
PentoliniumQuinine may increase the hypotensive activities of Pentolinium.Approved
PerflutrenPerflutren may increase the QTc-prolonging activities of Quinine.Approved
PerhexilineThe metabolism of Perhexiline can be decreased when combined with Quinine.Approved
PerindoprilQuinine may increase the hypotensive activities of Perindopril.Approved
PerphenazineThe serum concentration of Perphenazine can be increased when it is combined with Quinine.Approved
PethidineThe metabolism of Pethidine can be decreased when combined with Quinine.Approved
PhenacetinThe metabolism of Phenacetin can be decreased when combined with Quinine.Withdrawn
PhenelzinePhenelzine may increase the hypoglycemic activities of Quinine.Approved
PhenforminThe metabolism of Phenformin can be decreased when combined with Quinine.Approved, Withdrawn
PhenindioneQuinine may increase the anticoagulant activities of Phenindione.Approved
PheniprazinePheniprazine may increase the hypoglycemic activities of Quinine.Withdrawn
PhenobarbitalThe serum concentration of Phenobarbital can be increased when it is combined with Quinine.Approved
PhenoxybenzamineQuinine may increase the hypotensive activities of Phenoxybenzamine.Approved
PhenoxypropazinePhenoxypropazine may increase the hypoglycemic activities of Quinine.Withdrawn
PhenprocoumonQuinine may increase the anticoagulant activities of Phenprocoumon.Approved
PhentolamineQuinine may increase the hypotensive activities of Phentolamine.Approved
PhenylbutazoneThe metabolism of Phenylbutazone can be decreased when combined with Quinine.Approved, Vet Approved
PhenytoinThe serum concentration of Quinine can be decreased when it is combined with Phenytoin.Approved, Vet Approved
PimozideQuinine may increase the QTc-prolonging activities of Pimozide.Approved
PindololQuinine may increase the hypotensive activities of Pindolol.Approved
PioglitazoneThe metabolism of Pioglitazone can be decreased when combined with Quinine.Approved, Investigational
PipecuroniumQuinine may increase the neuromuscular blocking activities of Pipecuronium.Approved
PiperazineThe metabolism of Piperazine can be decreased when combined with Quinine.Approved, Vet Approved
PipotiazineThe metabolism of Pipotiazine can be decreased when combined with Quinine.Approved
PirlindolePirlindole may increase the hypoglycemic activities of Quinine.Approved
PiroxicamThe metabolism of Piroxicam can be decreased when combined with Quinine.Approved, Investigational
PitavastatinThe serum concentration of Pitavastatin can be increased when it is combined with Quinine.Approved
PivhydrazinePivhydrazine may increase the hypoglycemic activities of Quinine.Withdrawn
Platelet Activating FactorThe serum concentration of Quinine can be decreased when it is combined with Platelet Activating Factor.Experimental
PolythiazideQuinine may increase the hypotensive activities of Polythiazide.Approved
PomalidomideThe serum concentration of Pomalidomide can be increased when it is combined with Quinine.Approved
PonatinibThe serum concentration of Ponatinib can be increased when it is combined with Quinine.Approved
PosaconazoleThe metabolism of Quinine can be decreased when combined with Posaconazole.Approved, Investigational, Vet Approved
PramlintidePramlintide may increase the hypoglycemic activities of Quinine.Approved, Investigational
PrasugrelThe metabolism of Prasugrel can be decreased when combined with Quinine.Approved
PravastatinThe serum concentration of Pravastatin can be increased when it is combined with Quinine.Approved
PrazosinQuinine may increase the hypotensive activities of Prazosin.Approved
PrednisoloneThe serum concentration of Prednisolone can be increased when it is combined with Quinine.Approved, Vet Approved
PrednisoneThe serum concentration of Prednisone can be increased when it is combined with Quinine.Approved, Vet Approved
PrilocaineThe risk or severity of adverse effects can be increased when Quinine is combined with Prilocaine.Approved
PrimaquinePrimaquine may increase the QTc-prolonging activities of Quinine.Approved
PrimidoneThe metabolism of Quinine can be increased when combined with Primidone.Approved, Vet Approved
ProbenecidThe serum concentration of Quinine can be increased when it is combined with Probenecid.Approved
ProcainamideQuinine may increase the QTc-prolonging activities of Procainamide.Approved
ProchlorperazineThe serum concentration of Prochlorperazine can be increased when it is combined with Quinine.Approved, Vet Approved
ProgesteroneThe serum concentration of Quinine can be decreased when it is combined with Progesterone.Approved, Vet Approved
ProguanilThe metabolism of Proguanil can be decreased when combined with Quinine.Approved
PromazinePromazine may increase the QTc-prolonging activities of Quinine.Approved, Vet Approved
PromethazinePromethazine may increase the QTc-prolonging activities of Quinine.Approved
PropafenoneThe serum concentration of Quinine can be increased when it is combined with Propafenone.Approved
PropofolPropofol may increase the QTc-prolonging activities of Quinine.Approved, Investigational, Vet Approved
PropranololQuinine may increase the hypotensive activities of Propranolol.Approved, Investigational
ProtriptylineProtriptyline may increase the QTc-prolonging activities of Quinine.Approved
PrucaloprideThe serum concentration of Prucalopride can be increased when it is combined with Quinine.Approved
PseudoephedrineThe metabolism of Pseudoephedrine can be decreased when combined with Quinine.Approved
PyrimethamineThe metabolism of Quinine can be decreased when combined with Pyrimethamine.Approved, Vet Approved
QuazepamThe metabolism of Quazepam can be decreased when combined with Quinine.Approved, Illicit
QuercetinThe serum concentration of Quinine can be increased when it is combined with Quercetin.Experimental
QuetiapineQuinine may increase the QTc-prolonging activities of Quetiapine.Approved
QuinacrineThe serum concentration of Quinine can be increased when it is combined with Quinacrine.Approved
QuinaprilQuinine may increase the hypotensive activities of Quinapril.Approved, Investigational
QuinidineQuinine may increase the QTc-prolonging activities of Quinidine.Approved
RabeprazoleThe metabolism of Quinine can be decreased when combined with Rabeprazole.Approved, Investigational
RamiprilQuinine may increase the hypotensive activities of Ramipril.Approved
RanitidineThe serum concentration of Quinine can be increased when it is combined with Ranitidine.Approved
RanolazineThe serum concentration of Ranolazine can be increased when it is combined with Quinine.Approved, Investigational
RapacuroniumQuinine may increase the neuromuscular blocking activities of Rapacuronium.Withdrawn
RasagilineRasagiline may increase the hypoglycemic activities of Quinine.Approved
ReboxetineThe serum concentration of Quinine can be increased when it is combined with Reboxetine.Approved, Investigational
RegorafenibThe serum concentration of Quinine can be increased when it is combined with Regorafenib.Approved
RemikirenQuinine may increase the hypotensive activities of Remikiren.Approved
RemoxiprideThe metabolism of Remoxipride can be decreased when combined with Quinine.Approved, Withdrawn
RepaglinideQuinine may increase the hypoglycemic activities of Repaglinide.Approved, Investigational
RescinnamineQuinine may increase the hypotensive activities of Rescinnamine.Approved
ReserpineQuinine may increase the hypotensive activities of Reserpine.Approved
RifabutinThe metabolism of Quinine can be increased when combined with Rifabutin.Approved
RifampicinThe serum concentration of Quinine can be decreased when it is combined with Rifampicin.Approved
RifapentineThe metabolism of Quinine can be increased when combined with Rifapentine.Approved
RifaximinThe serum concentration of Rifaximin can be increased when it is combined with Quinine.Approved, Investigational
RilpivirineRilpivirine may increase the QTc-prolonging activities of Quinine.Approved
RiociguatQuinine may increase the hypotensive activities of Riociguat.Approved
RisperidoneRisperidone may increase the QTc-prolonging activities of Quinine.Approved, Investigational
RitonavirThe serum concentration of Quinine can be decreased when it is combined with Ritonavir.Approved, Investigational
RivaroxabanThe serum concentration of Rivaroxaban can be increased when it is combined with Quinine.Approved
RocuroniumQuinine may increase the neuromuscular blocking activities of Rocuronium.Approved
RofecoxibThe metabolism of Rofecoxib can be decreased when combined with Quinine.Investigational, Withdrawn
RolapitantThe serum concentration of Quinine can be increased when it is combined with Rolapitant.Approved
RomidepsinThe serum concentration of Romidepsin can be increased when it is combined with Quinine.Approved, Investigational
RopiniroleThe metabolism of Quinine can be decreased when combined with Ropinirole.Approved, Investigational
RopivacaineThe metabolism of Ropivacaine can be decreased when combined with Quinine.Approved
RosiglitazoneThe metabolism of Rosiglitazone can be decreased when combined with Quinine.Approved, Investigational
RosoxacinRosoxacin may increase the hypoglycemic activities of Quinine.Approved
RosuvastatinThe serum concentration of Rosuvastatin can be increased when it is combined with Quinine.Approved
RotigotineThe metabolism of Rotigotine can be decreased when combined with Quinine.Approved
SafrazineSafrazine may increase the hypoglycemic activities of Quinine.Withdrawn
SalbutamolSalbutamol may increase the QTc-prolonging activities of Quinine.Approved, Vet Approved
Salicylic acidThe serum concentration of Salicylic acid can be increased when it is combined with Quinine.Approved, Vet Approved
SalmeterolSalmeterol may increase the QTc-prolonging activities of Quinine.Approved
SaprisartanQuinine may increase the hypotensive activities of Saprisartan.Experimental
SaquinavirSaquinavir may increase the QTc-prolonging activities of Quinine.Approved, Investigational
SaxagliptinThe serum concentration of Saxagliptin can be decreased when it is combined with Quinine.Approved
ScopolamineThe serum concentration of Quinine can be increased when it is combined with Scopolamine.Approved
SecobarbitalThe metabolism of Quinine can be increased when combined with Secobarbital.Approved, Vet Approved
SelegilineSelegiline may increase the hypoglycemic activities of Quinine.Approved, Investigational, Vet Approved
SelexipagQuinine may increase the hypotensive activities of Selexipag.Approved
SertindoleThe metabolism of Sertindole can be decreased when combined with Quinine.Approved, Withdrawn
SertralineSertraline may increase the QTc-prolonging activities of Quinine.Approved
SevofluraneSevoflurane may increase the QTc-prolonging activities of Quinine.Approved, Vet Approved
SildenafilThe metabolism of Quinine can be decreased when combined with Sildenafil.Approved, Investigational
SilodosinThe serum concentration of Silodosin can be increased when it is combined with Quinine.Approved
SiltuximabThe serum concentration of Quinine can be decreased when it is combined with Siltuximab.Approved
SimeprevirThe serum concentration of Quinine can be increased when it is combined with Simeprevir.Approved
SimvastatinThe serum concentration of Simvastatin can be increased when it is combined with Quinine.Approved
SirolimusThe serum concentration of Quinine can be decreased when it is combined with Sirolimus.Approved, Investigational
SitagliptinThe serum concentration of Sitagliptin can be increased when it is combined with Quinine.Approved, Investigational
SitaxentanQuinine may increase the hypotensive activities of Sitaxentan.Approved, Investigational, Withdrawn
Sodium NitriteThe risk or severity of adverse effects can be increased when Quinine is combined with Sodium Nitrite.Approved
SofosbuvirThe serum concentration of Sofosbuvir can be increased when it is combined with Quinine.Approved
SolifenacinSolifenacin may increase the QTc-prolonging activities of Quinine.Approved
SolithromycinThe serum concentration of Quinine can be increased when it is combined with Solithromycin.Investigational
SorafenibSorafenib may increase the QTc-prolonging activities of Quinine.Approved, Investigational
SotalolQuinine may increase the QTc-prolonging activities of Sotalol.Approved
SparfloxacinThe serum concentration of Sparfloxacin can be increased when it is combined with Quinine.Approved
SparteineThe metabolism of Sparteine can be decreased when combined with Quinine.Experimental
SphingosineThe serum concentration of Sphingosine can be increased when it is combined with Quinine.Experimental
SpiramycinThe serum concentration of Quinine can be increased when it is combined with Spiramycin.Approved
SpiraprilQuinine may increase the hypotensive activities of Spirapril.Approved
SpironolactoneThe serum concentration of Quinine can be increased when it is combined with Spironolactone.Approved
St. John's WortThe serum concentration of Quinine can be decreased when it is combined with St. John's Wort.Nutraceutical
StanozololStanozolol may increase the hypoglycemic activities of Quinine.Approved, Vet Approved
StaurosporineThe serum concentration of Quinine can be increased when it is combined with Staurosporine.Experimental
StiripentolThe serum concentration of Quinine can be increased when it is combined with Stiripentol.Approved
StreptozocinThe serum concentration of Quinine can be decreased when it is combined with Streptozocin.Approved
SuccinylcholineQuinine may increase the neuromuscular blocking activities of Succinylcholine.Approved
SulfadiazineThe metabolism of Quinine can be decreased when combined with Sulfadiazine.Approved, Vet Approved
SulfamethoxazoleSulfamethoxazole may increase the QTc-prolonging activities of Quinine.Approved
SulfamoxoleThe metabolism of Sulfamoxole can be decreased when combined with Quinine.Approved
SulfinpyrazoneThe serum concentration of Quinine can be increased when it is combined with Sulfinpyrazone.Approved
SulfisoxazoleSulfisoxazole may increase the QTc-prolonging activities of Quinine.Approved, Vet Approved
SulodexideSulodexide may increase the hypoglycemic activities of Quinine.Approved, Investigational
SumatriptanThe serum concentration of Quinine can be increased when it is combined with Sumatriptan.Approved, Investigational
SunitinibSunitinib may increase the QTc-prolonging activities of Quinine.Approved, Investigational
SuprofenThe metabolism of Suprofen can be decreased when combined with Quinine.Approved, Withdrawn
TacrineThe serum concentration of Quinine can be increased when it is combined with Tacrine.Withdrawn
TacrolimusThe serum concentration of Quinine can be decreased when it is combined with Tacrolimus.Approved, Investigational
TamoxifenThe serum concentration of the active metabolites of Tamoxifen can be reduced when Tamoxifen is used in combination with Quinine resulting in a loss in efficacy.Approved
TamsulosinThe metabolism of Tamsulosin can be decreased when combined with Quinine.Approved, Investigational
TapentadolThe metabolism of Tapentadol can be decreased when combined with Quinine.Approved
Taurocholic AcidThe serum concentration of Taurocholic Acid can be increased when it is combined with Quinine.Experimental
TazaroteneThe metabolism of Tazarotene can be decreased when combined with Quinine.Approved, Investigational
Technetium Tc-99m sestamibiThe serum concentration of Technetium Tc-99m sestamibi can be increased when it is combined with Quinine.Approved
TegaserodThe metabolism of Tegaserod can be decreased when combined with Quinine.Investigational, Withdrawn
TelaprevirThe metabolism of Quinine can be decreased when combined with Telaprevir.Withdrawn
TelavancinTelavancin may increase the QTc-prolonging activities of Quinine.Approved
TelithromycinThe serum concentration of Quinine can be increased when it is combined with Telithromycin.Approved
TelmisartanQuinine may increase the hypotensive activities of Telmisartan.Approved, Investigational
TemafloxacinTemafloxacin may increase the hypoglycemic activities of Quinine.Withdrawn
TemazepamThe metabolism of Temazepam can be decreased when combined with Quinine.Approved
TemocaprilQuinine may increase the hypotensive activities of Temocapril.Experimental, Investigational
TemsirolimusThe serum concentration of Temsirolimus can be increased when it is combined with Quinine.Approved
TenofovirThe metabolism of Quinine can be decreased when combined with Tenofovir.Approved, Investigational
TenoxicamThe metabolism of Tenoxicam can be decreased when combined with Quinine.Approved
TerazosinThe serum concentration of Quinine can be increased when it is combined with Terazosin.Approved
TerbinafineThe metabolism of Quinine can be decreased when combined with Terbinafine.Approved, Investigational, Vet Approved
TerbutalineTerbutaline may increase the QTc-prolonging activities of Quinine.Approved
TerfenadineThe serum concentration of Quinine can be increased when it is combined with Terfenadine.Withdrawn
TeriflunomideThe serum concentration of Quinine can be decreased when it is combined with Teriflunomide.Approved
TerlipressinQuinine may increase the hypotensive activities of Terlipressin.Approved, Investigational
TesmilifeneThe serum concentration of Quinine can be decreased when it is combined with Tesmilifene.Investigational
TestosteroneThe serum concentration of Quinine can be increased when it is combined with Testosterone.Approved, Investigational
TetrabenazineQuinine may increase the QTc-prolonging activities of Tetrabenazine.Approved
TetracyclineThe serum concentration of Quinine can be increased when it is combined with Tetracycline.Approved, Vet Approved
ThalidomideThe metabolism of Thalidomide can be decreased when combined with Quinine.Approved, Investigational, Withdrawn
TheophyllineThe serum concentration of Theophylline can be increased when it is combined with Quinine.Approved
ThiamylalThe metabolism of Thiamylal can be decreased when combined with Quinine.Approved, Vet Approved
ThiethylperazineThe serum concentration of Thiethylperazine can be increased when it is combined with Quinine.Withdrawn
ThioridazineThe serum concentration of Thioridazine can be increased when it is combined with Quinine.Withdrawn
ThiothixeneThiothixene may increase the QTc-prolonging activities of Quinine.Approved
TiboloneQuinine may increase the hypotensive activities of Tibolone.Approved
TicagrelorThe serum concentration of Ticagrelor can be increased when it is combined with Quinine.Approved
TiclopidineThe metabolism of Quinine can be decreased when combined with Ticlopidine.Approved
TicrynafenQuinine may increase the hypotensive activities of Ticrynafen.Withdrawn
TimololQuinine may increase the hypotensive activities of Timolol.Approved
TiotropiumThe metabolism of Tiotropium can be decreased when combined with Quinine.Approved
TipranavirThe metabolism of Quinine can be decreased when combined with Tipranavir.Approved, Investigational
TizanidineTizanidine may increase the QTc-prolonging activities of Quinine.Approved
TocilizumabThe serum concentration of Quinine can be decreased when it is combined with Tocilizumab.Approved
TolazamideQuinine may increase the hypoglycemic activities of Tolazamide.Approved
TolazolineQuinine may increase the hypotensive activities of Tolazoline.Approved, Vet Approved
TolbutamideThe metabolism of Quinine can be decreased when combined with Tolbutamide.Approved
ToloxatoneToloxatone may increase the hypoglycemic activities of Quinine.Approved
TolterodineTolterodine may increase the QTc-prolonging activities of Quinine.Approved, Investigational
TolvaptanThe serum concentration of Tolvaptan can be increased when it is combined with Quinine.Approved
TopiramateThe metabolism of Quinine can be decreased when combined with Topiramate.Approved
TopotecanThe serum concentration of Topotecan can be increased when it is combined with Quinine.Approved, Investigational
TorasemideQuinine may increase the hypotensive activities of Torasemide.Approved
ToremifeneQuinine may increase the QTc-prolonging activities of Toremifene.Approved, Investigational
TrabectedinThe metabolism of Trabectedin can be decreased when combined with Quinine.Approved, Investigational
TramadolThe therapeutic efficacy of Tramadol can be decreased when used in combination with Quinine.Approved, Investigational
TrandolaprilQuinine may increase the hypotensive activities of Trandolapril.Approved
Trans-2-PhenylcyclopropylamineTrans-2-Phenylcyclopropylamine may increase the hypoglycemic activities of Quinine.Experimental
TranylcypromineTranylcypromine may increase the hypoglycemic activities of Quinine.Approved
Trastuzumab emtansineThe serum concentration of Trastuzumab emtansine can be increased when it is combined with Quinine.Approved
TravoprostQuinine may increase the hypotensive activities of Travoprost.Approved
TrazodoneTrazodone may increase the QTc-prolonging activities of Quinine.Approved, Investigational
TreprostinilTreprostinil may increase the QTc-prolonging activities of Quinine.Approved, Investigational
TretinoinThe metabolism of Tretinoin can be decreased when combined with Quinine.Approved, Investigational, Nutraceutical
TrichlormethiazideQuinine may increase the hypotensive activities of Trichlormethiazide.Approved, Vet Approved
TrifluoperazineThe serum concentration of Trifluoperazine can be increased when it is combined with Quinine.Approved
TriflupromazineThe serum concentration of Triflupromazine can be increased when it is combined with Quinine.Approved, Vet Approved
TrimazosinQuinine may increase the hypotensive activities of Trimazosin.Experimental
TrimethadioneThe metabolism of Trimethadione can be decreased when combined with Quinine.Approved
TrimethaphanQuinine may increase the hypotensive activities of Trimethaphan.Approved
TrimethoprimTrimethoprim may increase the QTc-prolonging activities of Quinine.Approved, Vet Approved
TrimipramineTrimipramine may increase the QTc-prolonging activities of Quinine.Approved
TriptorelinTriptorelin may increase the QTc-prolonging activities of Quinine.Approved, Vet Approved
TroglitazoneThe metabolism of Troglitazone can be decreased when combined with Quinine.Withdrawn
TrovafloxacinTrovafloxacin may increase the hypoglycemic activities of Quinine.Approved, Withdrawn
TubocurarineQuinine may increase the neuromuscular blocking activities of Tubocurarine.Approved
UbidecarenoneThe serum concentration of Coenzyme Q10 can be increased when it is combined with Quinine.Experimental
UlipristalThe serum concentration of Ulipristal can be increased when it is combined with Quinine.Approved
UmeclidiniumThe serum concentration of Umeclidinium can be increased when it is combined with Quinine.Approved
UnoprostoneQuinine may increase the hypotensive activities of Unoprostone.Approved
ValdecoxibThe metabolism of Valdecoxib can be decreased when combined with Quinine.Investigational, Withdrawn
Valproic AcidThe metabolism of Quinine can be decreased when combined with Valproic Acid.Approved, Investigational
ValsartanQuinine may increase the hypotensive activities of Valsartan.Approved, Investigational
VandetanibQuinine may increase the QTc-prolonging activities of Vandetanib.Approved
VardenafilVardenafil may increase the QTc-prolonging activities of Quinine.Approved
VecuroniumQuinine may increase the neuromuscular blocking activities of Vecuronium.Approved
VemurafenibThe serum concentration of Quinine can be increased when it is combined with Vemurafenib.Approved
VenetoclaxThe serum concentration of Venetoclax can be increased when it is combined with Quinine.Approved
VenlafaxineVenlafaxine may increase the QTc-prolonging activities of Quinine.Approved
VerapamilThe metabolism of Quinine can be decreased when combined with Verapamil.Approved
VilanterolVilanterol may increase the QTc-prolonging activities of Quinine.Approved
VilazodoneThe metabolism of Vilazodone can be decreased when combined with Quinine.Approved
VildagliptinVildagliptin may increase the hypoglycemic activities of Quinine.Approved, Investigational
VinblastineThe serum concentration of Quinine can be decreased when it is combined with Vinblastine.Approved
VincristineThe serum concentration of Vincristine can be increased when it is combined with Quinine.Approved, Investigational
VincristineThe serum concentration of Quinine can be decreased when it is combined with Vincristine.Approved, Investigational
VinorelbineThe serum concentration of Quinine can be increased when it is combined with Vinorelbine.Approved, Investigational
VismodegibThe serum concentration of Vismodegib can be increased when it is combined with Quinine.Approved
VogliboseVoglibose may increase the hypoglycemic activities of Quinine.Approved, Investigational
VoriconazoleThe metabolism of Quinine can be decreased when combined with Voriconazole.Approved, Investigational
VorinostatVorinostat may increase the QTc-prolonging activities of Quinine.Approved, Investigational
VortioxetineThe metabolism of Vortioxetine can be decreased when combined with Quinine.Approved
WarfarinQuinine may increase the anticoagulant activities of Warfarin.Approved
XimelagatranThe metabolism of Ximelagatran can be decreased when combined with Quinine.Approved, Investigational, Withdrawn
XylometazolineQuinine may increase the hypotensive activities of Xylometazoline.Approved
YohimbineThe metabolism of Yohimbine can be decreased when combined with Quinine.Approved, Vet Approved
ZafirlukastThe metabolism of Zafirlukast can be decreased when combined with Quinine.Approved, Investigational
ZalcitabineThe metabolism of Zalcitabine can be decreased when combined with Quinine.Approved
ZaltoprofenThe metabolism of Zaltoprofen can be decreased when combined with Quinine.Approved
ZidovudineThe serum concentration of Zidovudine can be increased when it is combined with Quinine.Approved
ZileutonThe metabolism of Zileuton can be decreased when combined with Quinine.Approved, Investigational, Withdrawn
ZimelidineThe serum concentration of Quinine can be increased when it is combined with Zimelidine.Withdrawn
ZiprasidoneZiprasidone may increase the QTc-prolonging activities of Quinine.Approved
ZolpidemThe metabolism of Zolpidem can be decreased when combined with Quinine.Approved
ZopicloneThe metabolism of Zopiclone can be decreased when combined with Quinine.Approved
ZuclopenthixolQuinine may increase the QTc-prolonging activities of Zuclopenthixol.Approved, Investigational
Food Interactions
  • Take with food to reduce irritation.
Synthesis Reference

Tong Sun, Shawn Watson, Wei Lai, Stephan D. Parent, "QUININE SULFATE/BISULFATE SOLID COMPLEX; METHODS OF MAKING; AND METHODS OF USE THEREOF." U.S. Patent US20090326005, issued December 31, 2009.

General References
  1. Paintaud G, Alvan G, Berninger E, Gustafsson LL, Idrizbegovic E, Karlsson KK, Wakelkamp M: The concentration-effect relationship of quinine-induced hearing impairment. Clin Pharmacol Ther. 1994 Mar;55(3):317-23. [PubMed:8143397 ]
External Links
ATC CodesM09AA72P01BC01
AHFS Codes
  • 08:30.08
  • 92:02.00*
PDB EntriesNot Available
FDA labelDownload (718 KB)
MSDSDownload (72.1 KB)
Clinical Trials
Clinical Trials
1CompletedBasic ScienceHealthy Volunteers5
1CompletedBasic SciencePharmacokinetics1
1CompletedDiagnosticCocaine Use / Pharmacokinetics1
1TerminatedBasic ScienceHealthy Volunteers / Impaired Renal Function1
1, 2RecruitingTreatmentRhinitis / Sinusitis1
2CompletedBasic SciencePlasmodium Infections1
2CompletedTreatmentMalaria caused by Plasmodium falciparum1
2CompletedTreatmentPlasmodium Falciparum Malaria1
2WithdrawnOtherCompliance / Pain, Chronic1
3CompletedTreatmentDrug Resistant Malaria Due to Plasmodium Falciparum1
3CompletedTreatmentPlasmodium Falciparum Malaria1
3CompletedTreatmentPlasmodium Infections2
4CompletedNot AvailablePlasmodium Infections1
4CompletedTreatmentPlasmodium Infections1
4Unknown StatusTreatmentPlasmodium Infections1
4Unknown StatusTreatmentUncomplicated Malaria1
Not AvailableActive Not RecruitingBasic ScienceBMI >30 kg/m2 / Healthy Volunteers1
Not AvailableCompletedTreatmentHuman Immunodeficiency Virus (HIV) Infections1
  • Ar holding co inc
Dosage forms
CapsuleOral200 mg
TabletOral300 mg
CapsuleOral324 mg/1
CapsuleOral300 mg
Unit descriptionCostUnit
Quinine sulfate powd ultrex25.86USD g
Apo-Quinine 300 mg Capsule0.39USD capsule
Novo-Quinine 300 mg Capsule0.39USD capsule
Apo-Quinine 200 mg Capsule0.25USD capsule
Novo-Quinine 200 mg Capsule0.25USD capsule
DrugBank does not sell nor buy drugs. Pricing information is supplied for informational purposes only.
PatentsNot Available
Experimental Properties
melting point (°C)57 °CPhysProp
water solubility500 mg/L (at 15 °C)YALKOWSKY,SH & DANNENFELSER,RM (1992)
logP3.44HANSCH,C ET AL. (1995)
logS-2.76ADME Research, USCD
Predicted Properties
Water Solubility0.334 mg/mLALOGPS
pKa (Strongest Acidic)13.89ChemAxon
pKa (Strongest Basic)9.05ChemAxon
Physiological Charge1ChemAxon
Hydrogen Acceptor Count4ChemAxon
Hydrogen Donor Count1ChemAxon
Polar Surface Area45.59 Å2ChemAxon
Rotatable Bond Count4ChemAxon
Refractivity94.69 m3·mol-1ChemAxon
Polarizability35.96 Å3ChemAxon
Number of Rings4ChemAxon
Rule of FiveYesChemAxon
Ghose FilterYesChemAxon
Veber's RuleYesChemAxon
MDDR-like RuleYesChemAxon
Predicted ADMET features
Human Intestinal Absorption+0.9836
Blood Brain Barrier+0.9382
Caco-2 permeable+0.8867
P-glycoprotein substrateSubstrate0.7863
P-glycoprotein inhibitor IInhibitor0.8208
P-glycoprotein inhibitor IIInhibitor0.8387
Renal organic cation transporterInhibitor0.762
CYP450 2C9 substrateNon-substrate0.7898
CYP450 2D6 substrateNon-substrate0.9116
CYP450 3A4 substrateSubstrate0.5754
CYP450 1A2 substrateNon-inhibitor0.9045
CYP450 2C9 inhibitorNon-inhibitor0.9071
CYP450 2D6 inhibitorInhibitor0.8931
CYP450 2C19 inhibitorNon-inhibitor0.9026
CYP450 3A4 inhibitorNon-inhibitor0.8309
CYP450 inhibitory promiscuityLow CYP Inhibitory Promiscuity0.7225
Ames testNon AMES toxic0.9133
BiodegradationNot ready biodegradable1.0
Rat acute toxicity3.0596 LD50, mol/kg Not applicable
hERG inhibition (predictor I)Strong inhibitor0.5884
hERG inhibition (predictor II)Inhibitor0.538
ADMET data is predicted using admetSAR, a free tool for evaluating chemical ADMET properties. (23092397 )
Mass Spec (NIST)Not Available
Spectrum TypeDescriptionSplash Key
Predicted LC-MS/MSPredicted LC-MS/MS Spectrum - 10V, PositiveNot Available
Predicted LC-MS/MSPredicted LC-MS/MS Spectrum - 20V, PositiveNot Available
Predicted LC-MS/MSPredicted LC-MS/MS Spectrum - 40V, PositiveNot Available
Predicted LC-MS/MSPredicted LC-MS/MS Spectrum - 10V, NegativeNot Available
Predicted LC-MS/MSPredicted LC-MS/MS Spectrum - 20V, NegativeNot Available
Predicted LC-MS/MSPredicted LC-MS/MS Spectrum - 40V, NegativeNot Available
DescriptionThis compound belongs to the class of chemical entities known as cinchona alkaloids. These are alkaloids structurally characterized by the presence of the cinchonan skeleton, which consists of a quinoline linked to an azabicyclo[2.2.2]octane moiety.
KingdomChemical entities
Super ClassOrganic compounds
ClassAlkaloids and derivatives
Sub ClassCinchona alkaloids
Direct ParentCinchona alkaloids
Alternative Parents4-quinolinemethanols / Quinuclidines / Anisoles / Aralkylamines / Alkyl aryl ethers / Pyridines and derivatives / Piperidines / Heteroaromatic compounds / Trialkylamines / Secondary alcohols
SubstituentsCinchonan-skeleton / 4-quinolinemethanol / Quinoline / Anisole / Quinuclidine / Alkyl aryl ether / Aralkylamine / Piperidine / Pyridine / Benzenoid
Molecular FrameworkAromatic heteropolycyclic compounds
External Descriptorscinchona alkaloid (CHEBI:15854 )


1. Fe(II)-protoporphyrin IX
Small molecule
Plasmodium falciparum
Pharmacological action
  1. Alumasa JN, Gorka AP, Casabianca LB, Comstock E, de Dios AC, Roepe PD: The hydroxyl functionality and a rigid proximal N are required for forming a novel non-covalent quinine-heme complex. J Inorg Biochem. 2011 Mar;105(3):467-75. doi: 10.1016/j.jinorgbio.2010.08.011. Epub 2010 Sep 22. [PubMed:20864177 ]
  2. Fitch CD: Ferriprotoporphyrin IX, phospholipids, and the antimalarial actions of quinoline drugs. Life Sci. 2004 Mar 5;74(16):1957-72. [PubMed:14967191 ]
Pharmacological action
General Function:
Not Available
Specific Function:
The GPIb-V-IX complex functions as the vWF receptor and mediates vWF-dependent platelet adhesion to blood vessels. The adhesion of platelets to injured vascular surfaces in the arterial circulation is a critical initiating event in hemostasis. GP-IX may provide for membrane insertion and orientation of GP-Ib.
Gene Name:
Uniprot ID:
Molecular Weight:
19045.87 Da
  1. Asvadi P, Ahmadi Z, Chong BH: Drug-induced thrombocytopenia: localization of the binding site of GPIX-specific quinine-dependent antibodies. Blood. 2003 Sep 1;102(5):1670-7. Epub 2003 May 8. [PubMed:12738668 ]
Pharmacological action
General Function:
Protein phosphatase binding
Specific Function:
Forms a voltage-independent potassium channel that is activated by intracellular calcium (PubMed:26148990). Activation is followed by membrane hyperpolarization which promotes calcium influx. Required for maximal calcium influx and proliferation during the reactivation of naive T-cells. The channel is blocked by clotrimazole and charybdotoxin but is insensitive to apamin (PubMed:17157250, PubMe...
Gene Name:
Uniprot ID:
Molecular Weight:
47695.12 Da
  1. Chen X, Ji ZL, Chen YZ: TTD: Therapeutic Target Database. Nucleic Acids Res. 2002 Jan 1;30(1):412-5. [PubMed:11752352 ]


Pharmacological action
General Function:
Vitamin d3 25-hydroxylase activity
Specific Function:
Cytochromes P450 are a group of heme-thiolate monooxygenases. In liver microsomes, this enzyme is involved in an NADPH-dependent electron transport pathway. It performs a variety of oxidation reactions (e.g. caffeine 8-oxidation, omeprazole sulphoxidation, midazolam 1'-hydroxylation and midazolam 4-hydroxylation) of structurally unrelated compounds, including steroids, fatty acids, and xenobiot...
Gene Name:
Uniprot ID:
Molecular Weight:
57342.67 Da
  1. Zhao XJ, Yokoyama H, Chiba K, Wanwimolruk S, Ishizaki T: Identification of human cytochrome P450 isoforms involved in the 3-hydroxylation of quinine by human live microsomes and nine recombinant human cytochromes P450. J Pharmacol Exp Ther. 1996 Dec;279(3):1327-34. [PubMed:8968357 ]
  2. Preissner S, Kroll K, Dunkel M, Senger C, Goldsobel G, Kuzman D, Guenther S, Winnenburg R, Schroeder M, Preissner R: SuperCYP: a comprehensive database on Cytochrome P450 enzymes including a tool for analysis of CYP-drug interactions. Nucleic Acids Res. 2010 Jan;38(Database issue):D237-43. doi: 10.1093/nar/gkp970. Epub 2009 Nov 24. [PubMed:19934256 ]
  3. Ekins S, Bravi G, Wikel JH, Wrighton SA: Three-dimensional-quantitative structure activity relationship analysis of cytochrome P-450 3A4 substrates. J Pharmacol Exp Ther. 1999 Oct;291(1):424-33. [PubMed:10490933 ]
  4. Drug Interactions: Cytochrome P450 Drug Interaction Table [Link]
Pharmacological action
General Function:
Oxygen binding
Specific Function:
Cytochromes P450 are a group of heme-thiolate monooxygenases. In liver microsomes, this enzyme is involved in an NADPH-dependent electron transport pathway. It oxidizes a variety of structurally unrelated compounds, including steroids, fatty acids, and xenobiotics.
Gene Name:
Uniprot ID:
Molecular Weight:
57108.065 Da
  1. Drug Interactions: Cytochrome P450 Drug Interaction Table [Link]
Pharmacological action
General Function:
Vitamin d 24-hydroxylase activity
Specific Function:
Cytochromes P450 are a group of heme-thiolate monooxygenases. In liver microsomes, this enzyme is involved in an NADPH-dependent electron transport pathway. It oxidizes a variety of structurally unrelated compounds, including steroids, fatty acids, and xenobiotics.
Gene Name:
Uniprot ID:
Molecular Weight:
58164.815 Da
  1. Preissner S, Kroll K, Dunkel M, Senger C, Goldsobel G, Kuzman D, Guenther S, Winnenburg R, Schroeder M, Preissner R: SuperCYP: a comprehensive database on Cytochrome P450 enzymes including a tool for analysis of CYP-drug interactions. Nucleic Acids Res. 2010 Jan;38(Database issue):D237-43. doi: 10.1093/nar/gkp970. Epub 2009 Nov 24. [PubMed:19934256 ]
Pharmacological action
General Function:
Steroid hydroxylase activity
Specific Function:
Responsible for the metabolism of many drugs and environmental chemicals that it oxidizes. It is involved in the metabolism of drugs such as antiarrhythmics, adrenoceptor antagonists, and tricyclic antidepressants.
Gene Name:
Uniprot ID:
Molecular Weight:
55768.94 Da
  1. Preissner S, Kroll K, Dunkel M, Senger C, Goldsobel G, Kuzman D, Guenther S, Winnenburg R, Schroeder M, Preissner R: SuperCYP: a comprehensive database on Cytochrome P450 enzymes including a tool for analysis of CYP-drug interactions. Nucleic Acids Res. 2010 Jan;38(Database issue):D237-43. doi: 10.1093/nar/gkp970. Epub 2009 Nov 24. [PubMed:19934256 ]
Pharmacological action
General Function:
Oxidoreductase activity, acting on paired donors, with incorporation or reduction of molecular oxygen, reduced flavin or flavoprotein as one donor, and incorporation of one atom of oxygen
Specific Function:
Cytochromes P450 are a group of heme-thiolate monooxygenases. In liver microsomes, this enzyme is involved in an NADPH-dependent electron transport pathway. It oxidizes a variety of structurally unrelated compounds, including steroids, fatty acids, and xenobiotics. Most active in catalyzing 2-hydroxylation. Caffeine is metabolized primarily by cytochrome CYP1A2 in the liver through an initial N...
Gene Name:
Uniprot ID:
Molecular Weight:
58293.76 Da
  1. Preissner S, Kroll K, Dunkel M, Senger C, Goldsobel G, Kuzman D, Guenther S, Winnenburg R, Schroeder M, Preissner R: SuperCYP: a comprehensive database on Cytochrome P450 enzymes including a tool for analysis of CYP-drug interactions. Nucleic Acids Res. 2010 Jan;38(Database issue):D237-43. doi: 10.1093/nar/gkp970. Epub 2009 Nov 24. [PubMed:19934256 ]
Pharmacological action
General Function:
Steroid hydroxylase activity
Specific Function:
Cytochromes P450 are a group of heme-thiolate monooxygenases. In liver microsomes, this enzyme is involved in an NADPH-dependent electron transport pathway. It oxidizes a variety of structurally unrelated compounds, including steroids, fatty acids, and xenobiotics. In the epoxidation of arachidonic acid it generates only 14,15- and 11,12-cis-epoxyeicosatrienoic acids. It is the principal enzyme...
Gene Name:
Uniprot ID:
Molecular Weight:
55824.275 Da
  1. Preissner S, Kroll K, Dunkel M, Senger C, Goldsobel G, Kuzman D, Guenther S, Winnenburg R, Schroeder M, Preissner R: SuperCYP: a comprehensive database on Cytochrome P450 enzymes including a tool for analysis of CYP-drug interactions. Nucleic Acids Res. 2010 Jan;38(Database issue):D237-43. doi: 10.1093/nar/gkp970. Epub 2009 Nov 24. [PubMed:19934256 ]
Pharmacological action
General Function:
Steroid hydroxylase activity
Specific Function:
Cytochromes P450 are a group of heme-thiolate monooxygenases. In liver microsomes, this enzyme is involved in an NADPH-dependent electron transport pathway. It oxidizes a variety of structurally unrelated compounds, including steroids, fatty acids, and xenobiotics. This enzyme contributes to the wide pharmacokinetics variability of the metabolism of drugs such as S-warfarin, diclofenac, phenyto...
Gene Name:
Uniprot ID:
Molecular Weight:
55627.365 Da
  1. Zhao XJ, Yokoyama H, Chiba K, Wanwimolruk S, Ishizaki T: Identification of human cytochrome P450 isoforms involved in the 3-hydroxylation of quinine by human live microsomes and nine recombinant human cytochromes P450. J Pharmacol Exp Ther. 1996 Dec;279(3):1327-34. [PubMed:8968357 ]
  2. Preissner S, Kroll K, Dunkel M, Senger C, Goldsobel G, Kuzman D, Guenther S, Winnenburg R, Schroeder M, Preissner R: SuperCYP: a comprehensive database on Cytochrome P450 enzymes including a tool for analysis of CYP-drug interactions. Nucleic Acids Res. 2010 Jan;38(Database issue):D237-43. doi: 10.1093/nar/gkp970. Epub 2009 Nov 24. [PubMed:19934256 ]
Pharmacological action
General Function:
Steroid hydroxylase activity
Specific Function:
Responsible for the metabolism of a number of therapeutic agents such as the anticonvulsant drug S-mephenytoin, omeprazole, proguanil, certain barbiturates, diazepam, propranolol, citalopram and imipramine.
Gene Name:
Uniprot ID:
Molecular Weight:
55930.545 Da
  1. Preissner S, Kroll K, Dunkel M, Senger C, Goldsobel G, Kuzman D, Guenther S, Winnenburg R, Schroeder M, Preissner R: SuperCYP: a comprehensive database on Cytochrome P450 enzymes including a tool for analysis of CYP-drug interactions. Nucleic Acids Res. 2010 Jan;38(Database issue):D237-43. doi: 10.1093/nar/gkp970. Epub 2009 Nov 24. [PubMed:19934256 ]
  2. Kullak-Ublick GA, Ismair MG, Stieger B, Landmann L, Huber R, Pizzagalli F, Fattinger K, Meier PJ, Hagenbuch B: Organic anion-transporting polypeptide B (OATP-B) and its functional comparison with three other OATPs of human liver. Gastroenterology. 2001 Feb;120(2):525-33. [PubMed:11159893 ]
Pharmacological action
General Function:
Steroid hydroxylase activity
Specific Function:
Metabolizes several precarcinogens, drugs, and solvents to reactive metabolites. Inactivates a number of drugs and xenobiotics and also bioactivates many xenobiotic substrates to their hepatotoxic or carcinogenic forms.
Gene Name:
Uniprot ID:
Molecular Weight:
56848.42 Da
Pharmacological action
General Function:
Oxygen binding
Specific Function:
Cytochromes P450 are a group of heme-thiolate monooxygenases. In liver microsomes, this enzyme is involved in an NADPH-dependent electron transport pathway. It oxidizes a variety of structurally unrelated compounds, including steroids, fatty acids, and xenobiotics.
Gene Name:
Uniprot ID:
Molecular Weight:
57525.03 Da
  1. Drug Interactions: Cytochrome P450 Drug Interaction Table [Link]


Pharmacological action
General Function:
Quaternary ammonium group transmembrane transporter activity
Specific Function:
Mediates tubular uptake of organic compounds from circulation. Mediates the influx of agmatine, dopamine, noradrenaline (norepinephrine), serotonin, choline, famotidine, ranitidine, histamin, creatinine, amantadine, memantine, acriflavine, 4-[4-(dimethylamino)-styryl]-N-methylpyridinium ASP, amiloride, metformin, N-1-methylnicotinamide (NMN), tetraethylammonium (TEA), 1-methyl-4-phenylpyridiniu...
Gene Name:
Uniprot ID:
Molecular Weight:
62579.99 Da
  1. Sweet DH, Miller DS, Pritchard JB: Ventricular choline transport: a role for organic cation transporter 2 expressed in choroid plexus. J Biol Chem. 2001 Nov 9;276(45):41611-9. Epub 2001 Sep 11. [PubMed:11553644 ]
  2. Gorboulev V, Ulzheimer JC, Akhoundova A, Ulzheimer-Teuber I, Karbach U, Quester S, Baumann C, Lang F, Busch AE, Koepsell H: Cloning and characterization of two human polyspecific organic cation transporters. DNA Cell Biol. 1997 Jul;16(7):871-81. [PubMed:9260930 ]
  3. Kakehi M, Koyabu N, Nakamura T, Uchiumi T, Kuwano M, Ohtani H, Sawada Y: Functional characterization of mouse cation transporter mOCT2 compared with mOCT1. Biochem Biophys Res Commun. 2002 Aug 23;296(3):644-50. [PubMed:12176030 ]
  4. Arndt P, Volk C, Gorboulev V, Budiman T, Popp C, Ulzheimer-Teuber I, Akhoundova A, Koppatz S, Bamberg E, Nagel G, Koepsell H: Interaction of cations, anions, and weak base quinine with rat renal cation transporter rOCT2 compared with rOCT1. Am J Physiol Renal Physiol. 2001 Sep;281(3):F454-68. [PubMed:11502595 ]
  5. Goralski KB, Lou G, Prowse MT, Gorboulev V, Volk C, Koepsell H, Sitar DS: The cation transporters rOCT1 and rOCT2 interact with bicarbonate but play only a minor role for amantadine uptake into rat renal proximal tubules. J Pharmacol Exp Ther. 2002 Dec;303(3):959-68. [PubMed:12438515 ]
  6. Sweet DH, Pritchard JB: rOCT2 is a basolateral potential-driven carrier, not an organic cation/proton exchanger. Am J Physiol. 1999 Dec;277(6 Pt 2):F890-8. [PubMed:10600936 ]
Pharmacological action
General Function:
Secondary active organic cation transmembrane transporter activity
Specific Function:
Translocates a broad array of organic cations with various structures and molecular weights including the model compounds 1-methyl-4-phenylpyridinium (MPP), tetraethylammonium (TEA), N-1-methylnicotinamide (NMN), 4-(4-(dimethylamino)styryl)-N-methylpyridinium (ASP), the endogenous compounds choline, guanidine, histamine, epinephrine, adrenaline, noradrenaline and dopamine, and the drugs quinine...
Gene Name:
Uniprot ID:
Molecular Weight:
61153.345 Da
  1. Zhang L, Dresser MJ, Gray AT, Yost SC, Terashita S, Giacomini KM: Cloning and functional expression of a human liver organic cation transporter. Mol Pharmacol. 1997 Jun;51(6):913-21. [PubMed:9187257 ]
  2. Zhang L, Schaner ME, Giacomini KM: Functional characterization of an organic cation transporter (hOCT1) in a transiently transfected human cell line (HeLa). J Pharmacol Exp Ther. 1998 Jul;286(1):354-61. [PubMed:9655880 ]
  3. Kakehi M, Koyabu N, Nakamura T, Uchiumi T, Kuwano M, Ohtani H, Sawada Y: Functional characterization of mouse cation transporter mOCT2 compared with mOCT1. Biochem Biophys Res Commun. 2002 Aug 23;296(3):644-50. [PubMed:12176030 ]
  4. Arndt P, Volk C, Gorboulev V, Budiman T, Popp C, Ulzheimer-Teuber I, Akhoundova A, Koppatz S, Bamberg E, Nagel G, Koepsell H: Interaction of cations, anions, and weak base quinine with rat renal cation transporter rOCT2 compared with rOCT1. Am J Physiol Renal Physiol. 2001 Sep;281(3):F454-68. [PubMed:11502595 ]
  5. Sweet DH, Miller DS, Pritchard JB: Ventricular choline transport: a role for organic cation transporter 2 expressed in choroid plexus. J Biol Chem. 2001 Nov 9;276(45):41611-9. Epub 2001 Sep 11. [PubMed:11553644 ]
  6. Goralski KB, Lou G, Prowse MT, Gorboulev V, Volk C, Koepsell H, Sitar DS: The cation transporters rOCT1 and rOCT2 interact with bicarbonate but play only a minor role for amantadine uptake into rat renal proximal tubules. J Pharmacol Exp Ther. 2002 Dec;303(3):959-68. [PubMed:12438515 ]
  7. Grundemann D, Gorboulev V, Gambaryan S, Veyhl M, Koepsell H: Drug excretion mediated by a new prototype of polyspecific transporter. Nature. 1994 Dec 8;372(6506):549-52. [PubMed:7990927 ]
  8. Martel F, Vetter T, Russ H, Grundemann D, Azevedo I, Koepsell H, Schomig E: Transport of small organic cations in the rat liver. The role of the organic cation transporter OCT1. Naunyn Schmiedebergs Arch Pharmacol. 1996 Aug-Sep;354(3):320-6. [PubMed:8878062 ]
  9. Busch AE, Quester S, Ulzheimer JC, Gorboulev V, Akhoundova A, Waldegger S, Lang F, Koepsell H: Monoamine neurotransmitter transport mediated by the polyspecific cation transporter rOCT1. FEBS Lett. 1996 Oct 21;395(2-3):153-6. [PubMed:8898084 ]
  10. Busch AE, Quester S, Ulzheimer JC, Waldegger S, Gorboulev V, Arndt P, Lang F, Koepsell H: Electrogenic properties and substrate specificity of the polyspecific rat cation transporter rOCT1. J Biol Chem. 1996 Dec 20;271(51):32599-604. [PubMed:8955087 ]
Pharmacological action
General Function:
Symporter activity
Specific Function:
Sodium-ion dependent, high affinity carnitine transporter. Involved in the active cellular uptake of carnitine. Transports one sodium ion with one molecule of carnitine. Also transports organic cations such as tetraethylammonium (TEA) without the involvement of sodium. Also relative uptake activity ratio of carnitine to TEA is 11.3.
Gene Name:
Uniprot ID:
Molecular Weight:
62751.08 Da
  1. Ohashi R, Tamai I, Yabuuchi H, Nezu JI, Oku A, Sai Y, Shimane M, Tsuji A: Na(+)-dependent carnitine transport by organic cation transporter (OCTN2): its pharmacological and toxicological relevance. J Pharmacol Exp Ther. 1999 Nov;291(2):778-84. [PubMed:10525100 ]
Pharmacological action
General Function:
Xenobiotic-transporting atpase activity
Specific Function:
Energy-dependent efflux pump responsible for decreased drug accumulation in multidrug-resistant cells.
Gene Name:
Uniprot ID:
Molecular Weight:
141477.255 Da
  1. Wang EJ, Casciano CN, Clement RP, Johnson WW: Active transport of fluorescent P-glycoprotein substrates: evaluation as markers and interaction with inhibitors. Biochem Biophys Res Commun. 2001 Nov 30;289(2):580-5. [PubMed:11716514 ]
  2. van der Sandt IC, Blom-Roosemalen MC, de Boer AG, Breimer DD: Specificity of doxorubicin versus rhodamine-123 in assessing P-glycoprotein functionality in the LLC-PK1, LLC-PK1:MDR1 and Caco-2 cell lines. Eur J Pharm Sci. 2000 Sep;11(3):207-14. [PubMed:11042226 ]
  3. Nagy H, Goda K, Fenyvesi F, Bacso Z, Szilasi M, Kappelmayer J, Lustyik G, Cianfriglia M, Szabo G Jr: Distinct groups of multidrug resistance modulating agents are distinguished by competition of P-glycoprotein-specific antibodies. Biochem Biophys Res Commun. 2004 Mar 19;315(4):942-9. [PubMed:14985103 ]
  4. Borgnia MJ, Eytan GD, Assaraf YG: Competition of hydrophobic peptides, cytotoxic drugs, and chemosensitizers on a common P-glycoprotein pharmacophore as revealed by its ATPase activity. J Biol Chem. 1996 Feb 9;271(6):3163-71. [PubMed:8621716 ]
Pharmacological action
General Function:
Sodium-independent organic anion transmembrane transporter activity
Specific Function:
Mediates the Na(+)-independent transport of organic anions such as sulfobromophthalein (BSP) and conjugated (taurocholate) and unconjugated (cholate) bile acids (By similarity). Selectively inhibited by the grapefruit juice component naringin.
Gene Name:
Uniprot ID:
Molecular Weight:
74144.105 Da
  1. Shitara Y, Sugiyama D, Kusuhara H, Kato Y, Abe T, Meier PJ, Itoh T, Sugiyama Y: Comparative inhibitory effects of different compounds on rat oatpl (slc21a1)- and Oatp2 (Slc21a5)-mediated transport. Pharm Res. 2002 Feb;19(2):147-53. [PubMed:11883641 ]
  2. Kullak-Ublick GA, Ismair MG, Stieger B, Landmann L, Huber R, Pizzagalli F, Fattinger K, Meier PJ, Hagenbuch B: Organic anion-transporting polypeptide B (OATP-B) and its functional comparison with three other OATPs of human liver. Gastroenterology. 2001 Feb;120(2):525-33. [PubMed:11159893 ]
Pharmacological action
General Function:
Symporter activity
Specific Function:
Sodium-ion dependent, low affinity carnitine transporter. Probably transports one sodium ion with one molecule of carnitine. Also transports organic cations such as tetraethylammonium (TEA) without the involvement of sodium. Relative uptake activity ratio of carnitine to TEA is 1.78. A key substrate of this transporter seems to be ergothioneine (ET).
Gene Name:
Uniprot ID:
Molecular Weight:
62154.48 Da
  1. Yabuuchi H, Tamai I, Nezu J, Sakamoto K, Oku A, Shimane M, Sai Y, Tsuji A: Novel membrane transporter OCTN1 mediates multispecific, bidirectional, and pH-dependent transport of organic cations. J Pharmacol Exp Ther. 1999 May;289(2):768-73. [PubMed:10215651 ]
Drug created on June 13, 2005 07:24 / Updated on June 11, 2017 15:38